CN110129359B

CN110129359B - Method for detecting gene editing event and determining gene editing efficiency and application thereof

Info

Publication number: CN110129359B
Application number: CN201910422241.8A
Authority: CN
Inventors: 许建平; 李江
Original assignee: Syngenta Crop Protection AG Switzerland; Syngenta Biotechnology China Co Ltd
Current assignee: Syngenta Crop Protection AG Switzerland; Syngenta Biotechnology China Co Ltd
Priority date: 2019-05-21
Filing date: 2019-05-21
Publication date: 2021-08-10
Anticipated expiration: 2039-05-21
Also published as: CN110129359A

Abstract

The invention provides a method for detecting gene editing events generated by a gene editing tool such as CRISPR/Cas9 in plant cells and determining gene editing efficiency by using exogenous nucleotide fragments for the first time, and combines an example of application of fragments with different nucleotide structures in rice protoplasts.

Description

Method for detecting gene editing event and determining gene editing efficiency and application thereof

Technical Field

The present invention relates to the fields of molecular biology, plant genetics and plant bioengineering. In particular, the present invention relates to a method for detecting a gene editing product in a plant cell, and more particularly, to a method capable of detecting an editing event generated by a gene editing tool in a plant cell and determining the editing efficiency thereof by editing a target gene of a rice protoplast. The method can be applied to the activity comparison and optimization of a gene editing tool in plant cells.

Background

Gene editing is a hotspot of current life science research, and an important tool CRISPR/Cas9(Clustered regulated plasmid sequences/CRISPR-associated 9) in the current widely used gene editing technology is a defense system of bacteria and archaea against exogenous DNA invasion, and can excise exogenous nucleic acid sequences such as invaded phage genome DNA and the like. In addition, Sequence-specific nucleases (SSNs) have been designed to cleave genomic DNA at specific positions, such as early Zinc Finger Nucleases (ZFNs), Transcription Activator-Like Effector nucleases (TALENs), and homing endonucleases (MNs). These gene editing tools all produce DNA Double Strand Breaks (DSBs) at specific locations in the genome, and DSBs can accomplish nucleotide sequence changes (deletions, insertions, and substitutions) by in vivo repair mechanisms of organisms. Since the CRISPR/Cas9 is reported to realize gene editing in organisms for the first time, the system is widely applied to animals and plants due to simple operation and high efficiency, becomes an important gene editing tool in the fields of drug development, disease treatment, crop quality improvement and the like, and has wide application prospect.

Eukaryotic cells have two repair systems to achieve DSB repair of DNA in vivo. Homologous Recombination (HR) and non-Homologous end joining (NHEJ). HR requires repair with homologous DNA fragments as templates and allows precise nucleotide changes, but HR is very inefficient in plants. NHEJ does not require additional provision of homologous fragments and, depending on the nuclease activity in vivo, produces few nucleotide changes, including insertions or deletions, at the DSB. NHEJ is a major repair pathway in plants. At present, the detection aiming at the activity of HR and NHEJ depends on a fluorescent reporter system, DSB is generated by cutting a fluorescent reporter gene, then the activity of the fluorescent reporter gene is recovered after the HR or NHEJ is repaired, and the number of luminescent cells is counted by a flow cytometer so as to calculate the activity of the HR or NHEJ. In addition, microdroplet digital PCR (ddPR) can also be used to detect the number of DSBs repaired in template DNA, and high-throughput deep sequencing can also sensitively detect the number of DNA repair products.

Methods for detecting gene editing events in plant genome editing studies many methods have been developed in addition to the methods described above. As the most commonly used PCR/RE method, this method is a detection method using a combination of specific primer PCR and restriction enzyme digestion, and distinguishes whether a target site is edited or not mainly by subjecting the PCR-amplified DNA fragment to restriction enzyme digestion. This method is simple and low cost, but requires restriction sites in the genome editing nuclease cleavage sites. In addition, there is a mismatch cleavage method, which is a method for detecting by recognizing and cleaving a heteroduplex nucleic acid molecule with a mismatch cleaving enzyme. Commonly used mismatch cleaving enzymes are T7EI, Surveyor (Cel I), and Cruiser. The advantage of mismatch cleavage enzymes is that they are not restricted to restriction sites, but they are influenced by specific nucleic acid structures such as Holiday or Cruciform and have some false positives.

In recent years, gene editing techniques have been rapidly developed, and a large number of efficient editing systems have been developed. Particularly, the editing technology taking CRISPR/Cas9 as the core is widely applied to animal and plant research and development. With the increasing application of plant genome editing, a sensitive and simple method for detecting gene editing events is urgently needed. Although high-throughput sequencing techniques are widely used for the detection of gene editing events in mammalian cells due to their advantages of accuracy, sensitivity, and low cost, plants are less amenable to high-throughput sequencing techniques due to the complex genome and the difficulty in obtaining plant cell lines. The application of the detection method for plant genome editing in recent years is very different, which indicates that the existing methods have limitations and need to be further optimized or improved according to the plant species and the target gene.

Compared with the existing detection method of gene editing events, when the gene frequency is very low, mutation types are difficult to obtain by directly utilizing PCR amplification and Sanger DNA sequencing, even the mutation types cannot be obtained by utilizing a high-throughput sequencing method (NGS) to carry out whole genome analysis, and the application of the high-throughput sequencing method in different species is limited due to the polyploidy of plants. The method of performing enzyme digestion (PCR/RE) on the PCR product (a restriction enzyme digestion site is required at a genome editing nuclease cleavage site), or counting the frequency of gene editing events by recovering the luminescent function of a fluorescent reporter gene has limitations on the selection of target genes and target sites.

Disclosure of Invention

In one aspect, the invention relates to a method of detecting the occurrence of a gene editing event in a plant cell comprising generating a DNA double strand break by a selected gene editing tool and inserting a provided exogenous nucleotide fragment into the break via the NHEJ pathway from an in vivo repair system such that the gene editing event can be detected by PCR amplification alone, wherein the exogenous nucleotide fragment does not contain a sequence homologous to the genome of the plant that is greater than 6 contiguous nucleotides.

In another aspect, the present invention relates to a method for determining gene editing efficiency in a plant cell, comprising co-transforming a plant cell with a reporter gene together with a selected gene editing tool and an exogenous nucleotide fragment, wherein the exogenous nucleotide fragment contains a degenerate base, generating a DNA double strand break by the gene editing tool, inserting the exogenous nucleotide fragment into the break by an in vivo repair system via the NHEJ pathway, performing PCR amplification and sequencing the amplified fragment, and calculating the gene editing efficiency based on the sequencing result and the transformation efficiency obtained with the help of the reporter gene. In a preferred embodiment, the degenerate base is selected from the group consisting of: (1) degenerate base N, representing A, T, C or G; (2) degenerate base D, representing A, T or G; (3) degenerate base H, representing A, T or C; (4) degenerate base V, representing A, C or G; (5) degenerate base B, representing T, C or G; (6) a degenerate base R representing A or G; (7) a degenerate base W representing A or T; (8) a degenerate base M, which represents A or C; (9) a degenerate base Y representing T or C; (10) a degenerate base K, representing T or G; and (11) a degenerate base S, which represents C or G. In a further preferred embodiment, the reporter gene is a gene for green fluorescent protein, red fluorescent protein or yellow fluorescent protein.

In a preferred embodiment according to both aspects above, the exogenous nucleotide fragments are artificially aggregated and synthesized and are in the form of single-stranded DNA or double-stranded DNA. In another preferred embodiment according to both aspects above, the 5' end of the exogenous nucleotide fragment contains a phosphorylation modification. In another preferred embodiment according to both aspects above, the exogenous nucleotide fragment contains a phosphorothioate modification at both ends. In another preferred embodiment according to both aspects above, the 5' end of the exogenous nucleotide fragment contains a phosphorylation modification and both ends contain a phosphorothioate modification. In another preferred embodiment according to both aspects above, the sequence of the exogenous nucleotide fragment is as shown in SEQ ID NO 5, SEQ ID NO 6 or SEQ ID NO 7. In another preferred embodiment according to both aspects above, the gene editing tool is CRISPR/Cas9, TALEN, MN or ZFN. In a further preferred embodiment, the nucleotide sequence of Cas9 is shown as SEQ ID No. 1, or the amino acid sequence of Cas9 is shown as SEQ ID No. 2. In a further preferred embodiment, the gene editing tool is CRISPR/Cas9 and the guide RNA used to perform the editing is a single-component RNA or a double-component RNA. In a further preferred embodiment, the backbone nucleotide sequence of the guide RNA is shown in SEQ ID NO 3. In another preferred embodiment according to both aspects above, a forward primer designed on the basis of the chromosomal sequence at the double strand break and a reverse primer designed on the basis of the inserted foreign nucleotide fragment sequence are used in the PCR amplification. In a further preferred embodiment, the forward primer is shown as SEQ ID NO. 8 and the reverse primer is shown as SEQ ID NO. 9. In a further preferred embodiment, a secondary PCR amplification using the forward primer shown as SEQ ID NO. 10 and the reverse primer shown as SEQ ID NO. 11 is performed. In another preferred embodiment according to both aspects above, the plant is a monocotyledonous plant, such as rice or wheat; or dicotyledonous plants, such as soybean.

Description of the invention

The inventors of the present invention developed a detection technique of a gene editing event using an exogenous nucleotide fragment in a rice protoplast for the first time, and tested the detection effect on 3 types of nucleotide fragments, thereby completing the present invention.

The nucleotide fragment is artificially designed and synthesized; through the comparison with rice genome, the sequence has no homology with rice gene and consists of single-stranded or double-stranded DNA of 60-85 nt. Nucleotide segment 1 is a single-stranded DNA molecule (ssDNA), nucleotide segment 2 is a double-stranded DNA molecule (dsDNA), and nucleotide segment 3 is a single-stranded DNA molecule (ssDNA) containing an degenerate base. The above nucleotide sequences can be synthesized in vitro by chemical methods. Meanwhile, a reverse complementary nucleotide sequence is synthesized and then is combined with the forward nucleotide sequence through annealing to form a double-stranded nucleotide sequence.

The nucleotide fragment and a CRISPR/Cas9 editing vector are together introduced into the nucleus of a rice cell, an in-vivo NHEJ repair system integrates the introduced exogenous nucleotide fragment into a DSB generated by cutting Cas9, and the combination of the exogenous nucleotide fragment and a chromosome is completed through a chromosome replication process. A forward primer is designed based on a chromosome sequence at a double-strand break, and forms a PCR amplification primer pair with a reverse primer designed based on an inserted exogenous nucleotide fragment sequence, so that a rice cell editing event generated by CRISPR/Cas9 can be detected. Further, degenerate bases are introduced into the exogenous nucleotide fragment to detect cells with different editing events, and when the cells are cotransformed with a plasmid expressing GFP (green fluorescent protein), the transformation efficiency can be calculated, thereby obtaining the efficiency of the used editing tool to generate gene editing events in rice cells. The concrete model is shown in figure 1.

The application reports a method for detecting a gene editing event by using an exogenous nucleotide fragment in rice for the first time, successfully tests the gene editing event by using 3 different nucleotide sequences, and determines the editing efficiency of a used gene editing tool. The method can obviously shorten the time for optimizing the gene expression tool and the research and development cost, and has great significance for gene editing of plant systems.

Advantageous effects of the invention

In the research, the inventor successfully detects the gene editing events of different cells by editing the endogenous OsDep1 gene of rice by using the exogenous nucleotide fragment and adopting the CRISPR/Cas9 technology for the first time, and the method has pioneering significance. Cas9 gene in the used gene editing tool is shown as SEQ ID NO. 1 and SEQ ID NO. 2, the nucleotide sequence of the guide RNA framework is shown as SEQ ID NO. 3, and the target site sequence is from the exon of the OsDep1 gene of wild rice and is shown as SEQ ID NO. 4. The exogenous nucleotide sequences are respectively shown as SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7. The exogenous nucleotide sequence can be used as a DNA fragment for detecting a gene editing event in rice cells and can also be used for detecting the gene editing event in different plant cells.

The technical solution according to the present invention is further described in detail by the accompanying drawings and embodiments.

Drawings

Fig. 1 is a schematic diagram of the principle of the present invention.

FIG. 2 is a map of a gene editing vector.

FIG. 3 shows rice protoplasts.

FIG. 4 shows PCR detection of gene editing events in rice protoplasts for ssDNA and dsDNA.

FIG. 5 is a DNA sequencing result comparing the editing events of ssDNA and dsDNA in rice protoplasts.

FIG. 6 is a photograph showing the transformation of rice protoplasts with GFP.

FIG. 7 shows rice protoplast counts.

FIG. 8 shows PCR detection of gene editing events of ssdDNA in rice protoplasts.

FIG. 9 is a DNA sequencing result alignment of ssdDNA editing events in rice protoplasts.

Sequence Listing information

SEQ ID No. 1 is a nucleic acid sequence of Cas9 that is improved and optimized.

SEQ ID No. 2 is an improved and optimized amino acid sequence of Cas9.

SEQ ID NO 3 is a guide RNA framework nucleotide sequence of CRISPR/Cas9.

SEQ ID NO. 4 is the target site nucleotide sequence in the rice OsDep1 gene.

SEQ ID NO 5 is a single-stranded nucleotide sequence: the 5' -end contains a phospho-modification (phosphonate) and the two ends each contain 2 Phosphorothioate modifications (phosphothionate), where "a" represents a Phosphorothioate linkage.

SEQ ID NO 6 is the reverse complement of single-stranded nucleotides: the 5 ' end contains a phosphorylation modification, and the two ends are respectively provided with 2 phosphorothioate modifications, wherein the ' x ' represents a phosphorothioate bond.

SEQ ID NO 7 is a single-stranded nucleotide sequence containing degenerate bases: the 5' end contains a phosphorylated modification and 2 phosphorothioate modifications at each end, where N represents base A, T, C or G and "+" represents a phosphorothioate linkage.

SEQ ID NO. 8 shows the sequence of primer F1.

SEQ ID NO. 9 is the sequence of primer R1.

SEQ ID NO. 10 shows the sequence of primer F2.

SEQ ID NO. 11 is the sequence of primer R2.

SEQ ID NO. 12 is the sequence of primer M13F.

SEQ ID NO. 13 is the sequence of primer M13R.

SEQ ID NO. 14 is the sequence of primer R1'.

SEQ ID NO. 15 is the sequence of primer R2'.

16 is a green fluorescent protein expression cassette sequence, wherein the italic part is the maize ubiquitin promoter, the underlined part is the green fluorescent protein CDS sequence, and the rest is the Nos terminator sequence.

SEQ ID NO 17 is the 35S promoter sequence.

SEQ ID NO. 18 is a rice U6 promoter sequence.

SEQ ID NO 19 is the NOS terminator sequence.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1 materials and methods

Material

Plant material: indica inbred line IR 58025B.

Exogenous nucleotide fragment(s): the nucleotide fragment used in the present invention was designed by the inventors, combined with GC content, nucleotide composition, secondary structure and homologous sequence not containing more than 6 consecutive nucleotides compared with the rice genome, the forward and reverse complementary strands were synthesized by Invitrogen, the degenerate sequence containing randomly selected nucleotide A, T, C or G was synthesized by degenerate synthesis, and was used diluted to 10 μ M with water or TE buffer. The sequence information is shown in the sequence table (SEQ ID NO: 5-7).

Primer: the clone sequencing amplification primers used in the present invention were designed using Primer Express 3.0 software of Applied biosystems, usa, and synthesized by Invitrogen. The sequence information is shown in the sequence table (SEQ ID NO: 8-15).

Method

Plant growth conditions: the rice plant related in the invention is cultured in a tissue culture room under the conditions of 16 hours of illumination (30 ℃) and 8 hours of darkness (30 ℃) and the humidity of a greenhouse is controlled at 60%.

The double-stranded nucleotide fragment was prepared by the following method:

single-stranded DNA to be annealed was prepared to 100. mu.M with sterilized water, and the reaction system was prepared as follows

Wherein the composition of the annealing buffer (5 ×):

50mM Tris,pH 7.5-8.0

250mM NaCl

5mM EDTA

placing the reaction solution in a PCR instrument, and setting the following program to operate:

95 ℃ for 2 minutes.

25 deg.C (2% ramp rate or 8 seconds/deg.C, approximately 45 minutes).

Storing at 4 deg.C until use.

Example 2 construction of CRISPR/Cas9 editing vector

A modified version of Cas9 fused a nuclear localization signal (cBCas9Nu-02) at the carboxy terminus and was codon optimized for expression in maize, this optimized form was tested as well for rice and used the cauliflower mosaic virus 35S promoter (SEQ ID NO:17) to drive Cas9 expression. The nucleic acid sequence and amino acid sequence of the improved and optimized Cas9 are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively. OsDep1 gene sequence in indica rice inbred line IR58025B is obtained from internal genome sequencing data and verified by cloning and sequencing again. The editing site of the OsDep1 gene was designed to generate a double-strand break at a position near the initial end of the gene (exon region No. 1) to generate a frameshift mutation to prematurely terminate the function of OsDep 1. The guide RNA selects 20 nucleotides adjacent to the upstream of the NGG, and BLAST analysis is carried out on 12 core nucleotide sequences (12 nucleotides adjacent to the NGG) and 15 nucleotides of the NGG in total in an internal database, so that a plurality of rice genomes (including indica rice and japonica rice) with existing genome information are considered, and only unique accurate matching is ensured in the rice genomes. The rice U6 promoter (SEQ ID NO:18) was used to drive the expression of the targeting and backbone RNAs. The final selected guide RNA was synthesized in full sequence as provided by GenScript (www.genscript.com). General methods for constructing vectors and identifying are well known to those skilled in the art. The map of gene editing vector 24333 is shown in FIG. 2.

The final selected target site sequence targeted by the guide RNA is as follows:

AACTGCAGTGCGTGCTGCGC(SEQ ID NO:4)。

example 3 isolation and transformation of Rice IR58025B protoplasts

Transforming the constructed editing vector into escherichia coli DH5a, and extracting plasmid DNA; methods are well known to those skilled in the art. Sterile seedlings were obtained by planting seeds of indica rice variety IR58025B on MS medium, treating the minced plant tissue with the enzymatic hydrolysate, separating and purifying, and co-transforming the mixture containing 0.1. mu.M of the exogenous nucleotide fragment of example 1 and 10. mu.g of the editing vector plasmid DNA of example 2 into 0.5X 10 by 40% PEG-4000 transformation⁵Rice protoplasts were cultured and subjected to molecular detection, as shown in FIG. 3. Methods are well known to those skilled in the art. A more detailed method and various solution or medium components for rice transformation can be found in Liang et al, 2016.

Example 4 Single-stranded nucleotide fragments for event detection of Rice protoplast OsDep1 Gene editing

A48-hour culture of rice protoplasts transformed with the single-stranded nucleotide fragment (SEQ ID NO: 5) according to example 3 was subjected to extraction of genomic DNA as follows: 2ml of the culture was collected in a centrifuge tube, centrifuged at 250g at room temperature for 5 minutes, the precipitate was retained, 0.3ml of Plant DNAzol (Thermofisher) was added, mixed at room temperature for 5 minutes, centrifuged at 12,000g at room temperature for 10 minutes, the supernatant was aspirated and then added with 0.225ml of 100% ethanol, mixed by inversion and then left at room temperature for 5 minutes, 5,000g at room temperature for 5 minutes, the precipitate was added with 0.3ml of Plant DNAzol-ethanol (DNAzol: 100% ethanol, 1:3), mixed by inversion and then left at room temperature for 5 minutes, centrifuged at 5,000g at room temperature for 5 minutes, the precipitate was added with 0.3ml of 75% ethanol, mixed by inversion and then left at room temperature for 5 minutes, centrifuged at 5,000g at room temperature for 5 minutes, the precipitate was dried and then 50. mu.l of TE was added, and left at 4 ℃ for 1 hour. The specific extraction procedure is described in the instructions of the Plant DNAzol kit.

Designing a detection primer: the upstream primer is positioned in the upstream region of double-strand break of the rice OSDEP1 gene and is named as F1; the downstream primer is located within the nucleotide fragment, near the 3' end, and is designated R1. Diluting with sterile water or TE to 10 μ M for use.

F1：5’-GCAAACTAGTCCAGGGATGTAATCATC-3’(SEQ ID NO:8)

R1:5’-TCCAAGTTGAGCCCTCTACCATGC-3’(SEQ ID NO:9)。

The following PCR reaction system was prepared:

the reaction solution was placed on a PCR instrument and the following program was set up to run:

in addition, in order to improve the detection sensitivity, another forward primer, named F2(SEQ ID NO:10), was designed in the upstream region of the double-strand break of the OsDep1 gene of rice downstream of the F1 primer binding; and another reverse primer, designated R2(SEQ ID NO:11), was designed downstream of the nucleotide fragment reverse primer for secondary PCR amplification. The first round PCR product was diluted 10-100 fold with sterile water or TE and the second round amplification was performed with F2/R2. The invention can detect the target fragment only by the first round of amplification. General methods for PCR amplification are well known to those skilled in the art.

The PCR products were electrophoresed on a 1% agarose Gel (see FIG. 4), and a band of interest of about 300bp (QIAquick Gel Extraction Kit, Qiagen) was recovered, and the specific Extraction procedures were described in the instructions of the Kit. The recovered target fragment DNA was cloned into pEASY vector (pEASY-Blunt Zero Cloning Kit, Transgen) by ligation and transformation, and the specific extraction procedures are described in the specification of the Kit. Plasmid DNA was extracted from 10 random single colonies for Sanger DNA sequencing (Life Technologies) with sequencing primers M13F (SEQ ID NO:12) and M13R (SEQ ID NO: 13). And (3) comparing the sequencing result with a reference sequence in Vector NTI, and analyzing the double-strand break generated by the insertion of the nucleotide fragment into the gene editing to obtain a gene editing event generated by the gene editing Vector in the rice protoplast. The sequencing alignment results are shown in FIG. 5.

Example 5 detection of transformation events for Rice protoplast OsDep1 Gene editing by double-stranded nucleotide fragments

Using the double-stranded nucleotide fragment (sequence shown in SEQ ID NO: 6) obtained in example 1, rice protoplast cells were transformed according to the method of example 3, and molecular detection was performed according to the method of example 4. Obtaining the gene editing event generated by the gene editing carrier in the rice protoplast. The sequencing results are shown in FIG. 5.

Example 6 nucleotide fragments containing degenerate bases for the detection of transformation events for OsDep1 Gene editing in Rice protoplasts

For use in quantitative detection of transformation events, the present invention contemplates degenerate base-containing nucleotide fragments containing a desired single degenerate base or multiple degenerate bases, e.g., 1-3 degenerate bases. To reduce the difficulty of synthesis, the nucleotide sequence required for design consists of 60 bases. The sequence is shown as SEQ ID NO. 7.

The rice protoplast cells were transformed according to the method of example 3 and simultaneously 10. mu.g of an expression vector containing a green fluorescent protein gene expression cassette (SEQ ID NO:16) was transferred; in this example pUC57 carries the expression cassette described above. The proportion of the green fluorescent cells to the total number of cells cultured for 48 hours was counted by a fluorescence microscope or a flow cytometer. General methods of detection are well known to those skilled in the art. The transformation efficiency was determined to be 60% (e.g., 6 out of 10 cells had green fluorescence) as shown in FIGS. 6-7. And molecular detection was carried out according to the method of example 4, except that the downstream primer corresponded to the nucleotide fragment used, designated R1' (see SEQ ID NO:14 for sequence); and for the second round of PCR amplification using R2' (see SEQ ID NO:15), the PCR products were electrophoresed on a 1% agarose gel (see FIG. 8) and subjected to clone sequencing, the sequencing results of which are shown in FIG. 9. Statistical analysis showed that 5 editing events, accounting for 50% of 10 clones, were obtained. Finally, the efficiency of the gene editing vector in generating the gene editing event in the rice protoplast was calculated to be 30% according to the following formula.

Formula for calculating editing efficiency:

editing efficiency ═ (number of recombinant sequence species ÷ number of sequenced clones) × (number of green fluorescent cells ÷ total number of cells) × 100%

The results show that the invention provides a method for detecting the editing event generated by the CRISPR/Cas9 gene editing tool in the rice protoplast by using the exogenous nucleotide fragment for the first time, creates exogenous nucleotide fragments with different forms, and can quantitatively detect the editing efficiency of the used editing vector to the target gene. The invention provides a new detection method for the optimization and the test of a CRISPR/Cas9 gene editing tool in rice.

Finally, it should be noted that although the specific embodiments of the present invention have been described in detail, the above examples are only for illustrating the technical solutions of the present invention and are not limited. It will be understood by those skilled in the art that various modifications or equivalent arrangements to those details could be made in light of the overall teachings of the disclosure; such variations are within the scope of the invention.

Sequence listing

SEQ ID NO:1

Improved and optimized Cas9 nucleic acid sequence:

ATGGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACAGCGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCGAGCAAGAAGTTCAAGGTGCTGGGCAACACCGACAGGCACAGCATCAAGAAGAACCTGATCGGCGCCCTGCTGTTCGACAGCGGCGAGACCGCCGAGGCCACCAGGCTGAAGAGGACCGCCAGGAGGAGGTACACCAGGAGGAAGAACAGGATCTGCTACCTGCAGGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGGCTGGAGGAGAGCTTCCTGGTGGAGGAGGACAAGAAGCACGAGAGGCACCCGATCTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCGACCATCTACCACCTGAGGAAGAAGCTGGTGGACAGCACCGACAAGGCCGACCTGAGGCTGATCTACCTGGCCCTGGCCCACATGATCAAGTTCAGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCGGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAGAACCCGATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGAGCGCCAGGCTGAGCAAGAGCAGGAGGCTGGAGAACCTGATCGCCCAGCTGCCGGGCGAGAAGAAGAACGGCCTGTTCGGCAACCTGATCGCCCTGAGCCTGGGCCTGACCCCGAACTTCAAGAGCAACTTCGACCTGGCCGAGGACGCCAAGCTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTCCTGGCCGCCAAGAACCTGAGCGACGCCATCCTGCTGAGCGACATCCTGAGGGTGAACACCGAGATCACCAAGGCCCCGCTGAGCGCCAGCATGATCAAGAGGTACGACGAGCACCACCAGGACCTGACCCTGCTGAAGGCCCTGGTGAGGCAGCAGCTGCCGGAGAAGTACAAGGAGATCTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATCGACGGCGGCGCCAGCCAGGAGGAGTTCTACAAGTTCATCAAGCCGATCCTGGAGAAGATGGACGGCACCGAGGAGCTGCTGGTGAAGCTGAACAGGGAGGACCTGCTGAGGAAGCAGAGGACCTTCGACAACGGCAGCATCCCGCACCAGATCCACCTGGGCGAGCTGCACGCCATCCTGAGGAGGCAGGAGGACTTCTACCCGTTCCTGAAGGACAACAGGGAGAAGATCGAGAAGATCCTGACCTTCCGCATCCCGTACTACGTGGGCCCGCTGGCCAGGGGCAACAGCAGGTTCGCCTGGATGACCAGGAAGAGCGAGGAGACCATCACCCCGTGGAACTTCGAGGAGGTGGTGGACAAGGGCGCCAGCGCCCAGAGCTTCATCGAGAGGATGACCAACTTCGACAAGAACCTGCCGAACGAGAAGGTGCTGCCGAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTACAACGAGCTGACCAAGGTGAAGTACGTGACCGAGGGCATGAGGAAGCCGGCCTTCCTGAGCGGCGAGCAGAAGAAGGCCATCGTGGACCTGCTGTTCAAGACCAACAGGAAGGTGACCGTGAAGCAGCTGAAGGAGGACTACTTCAAGAAGATCGAGTGCTTCGACAGCGTGGAGATCAGCGGCGTGGAGGACAGGTTCAACGCCAGCCTGGGCACCTACCACGACCTGCTGAAGATCATCAAGGACAAGGACTTCCTGGACAACGAGGAGAACGAGGACATCCTGGAGGACATCGTGCTGACCCTGACCCTGTTCGAGGACAGGGAGATGATCGAGGAGAGGCTGAAGACCTACGCCCACCTGTTCGACGACAAGGTGATGAAGCAGCTGAAGAGGAGGAGGTACACCGGCTGGGGCAGGCTGAGCAGGAAGCTGATCAACGGCATCAGGGACAAGCAGAGCGGCAAGACCATCCTGGACTTCCTGAAGAGCGACGGCTTCGCCAACAGGAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTCAAGGAGGACATCCAGAAGGCCCAGGTGAGCGGCCAGGGCGACAGCCTGCACGAGCACATCGCCAACCTGGCCGGCAGCCCGGCCATCAAGAAGGGCATCCTGCAGACCGTGAAGGTGGTGGACGAGCTGGTGAAGGTGATGGGCAGGCACAAGCCGGAGAACATCGTGATCGAGATGGCCAGGGAGAACCAGACCACCCAGAAGGGCCAGAAGAACAGCAGGGAGAGGATGAAGAGGATCGAGGAGGGCATCAAGGAGCTGGGCAGCCAGATCCTGAAGGAGCACCCGGTGGAGAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAACGGCAGGGACATGTACGTGGACCAGGAGCTGGACATCAACAGGCTGAGCGACTACGACGTGGACCACATCGTGCCGCAGAGCTTCCTGAAGGACGACAGCATCGACAACAAGGTGCTGACCAGGAGCGACAAGAACAGGGGCAAGAGCGACAACGTGCCGAGCGAGGAGGTGGTGAAGAAGATGAAAAACTACTGGAGGCAGCTGCTGAACGCCAAGCTGATCACCCAGAGGAAGTTCGACAACCTGACCAAGGCCGAGAGGGGCGGCCTGAGCGAGCTGGACAAGGCCGGCTTCATTAAAAGGCAGCTGGTGGAGACCAGGCAGATCACCAAGCACGTGGCCCAGATCCTGGACAGCAGGATGAACACCAAGTACGACGAGAACGACAAGCTGATCAGGGAGGTGAAGGTGATCACCCTGAAGAGCAAGCTGGTGAGCGACTTCAGGAAGGACTTCCAGTTCTACAAGGTGAGGGAGATCAATAATTACCACCACGCCCACGACGCCTACCTGAACGCCGTGGTGGGCACCGCCCTGATTAAAAAGTACCCGAAGCTGGAGAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGAGGAAGATGATCGCCAAGAGCGAGCAGGAGATCGGCAAGGCCACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTCTTCAAGACCGAGATCACCCTGGCCAACGGCGAGATCAGGAAGAGGCCGCTGATCGAGACCAACGGCGAGACCGGCGAGATCGTGTGGGACAAGGGCAGGGACTTCGCCACCGTGAGGAAGGTGCTGTCCATGCCGCAGGTGAACATCGTGAAGAAGACCGAGGTGCAGACCGGCGGCTTCAGCAAGGAGAGCATCCTGCCGAAGAGGAACAGCGACAAGCTGATCGCCAGGAAGAAGGACTGGGATCCGAAGAAGTACGGCGGCTTCGACAGCCCGACCGTGGCCTACAGCGTGCTGGTGGTGGCCAAGGTGGAGAAGGGCAAGAGCAAGAAGCTGAAGAGCGTGAAGGAGCTGGTGGGCATCACCATCATGGAGAGGAGCAGCTTCGAGAAGAACCCAGTGGACTTCCTGGAGGCCAAGGGCTACAAGGAGGTGAAGAAGGACCTGATCATTAAACTGCCGAAGTACAGCCTGTTCGAGCTGGAGAACGGCAGGAAGAGGATGCTGGCCAGCGCCGGCGAGCTGCAGAAGGGCAACGAGCTGGCCCTGCCGAGCAAGTACGTGAACTTCCTGTACCTGGCCAGCCACTACGAGAAGCTGAAGGGCAGCCCGGAGGACAACGAGCAGAAGCAGCTGTTCGTGGAGCAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCAGCAAGAGGGTGATCCTGGCCGACGCCAACCTGGACAAGGTGCTGAGCGCCTACAACAAGCACAGGGACAAGCCGATCAGGGAGCAGGCCGAGAACATCATCCACCTGTTCACCCTGACCAACCTGGGCGCCCCGGCCGCCTTCAAGTACTTCGACACCACCATCGACAGGAAGAGGTACACCAGCACCAAGGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACCAGGATCGACCTGAGCCAGCTGGGCGGCGACAGCAGCCCGCCGAAGAAGAAGAGGAAGGTGAGCTGGAAGGACGCCAGCGGCTGGAGCAGGATGTGA

SEQ ID NO:2

improved and optimized amino acid sequence of Cas 9:

MDKKYSIGLDIGTNSVGWAVITDEYKVPSKKFKVLGNTDRHSIKKNLIGALLFDSGETAEATRLKRTARRRYTRRKNRICYLQEIFSNEMAKVDDSFFHRLEESFLVEEDKKHERHPIFGNIVDEVAYHEKYPTIYHLRKKLVDSTDKADLRLIYLALAHMIKFRGHFLIEGDLNPDNSDVDKLFIQLVQTYNQLFEENPINASGVDAKAILSARLSKSRRLENLIAQLPGEKKNGLFGNLIALSLGLTPNFKSNFDLAEDAKLQLSKDTYDDDLDNLLAQIGDQYADLFLAAKNLSDAILLSDILRVNTEITKAPLSASMIKRYDEHHQDLTLLKALVRQQLPEKYKEIFFDQSKNGYAGYIDGGASQEEFYKFIKPILEKMDGTEELLVKLNREDLLRKQRTFDNGSIPHQIHLGELHAILRRQEDFYPFLKDNREKIEKILTFRIPYYVGPLARGNSRFAWMTRKSEETITPWNFEEVVDKGASAQSFIERMTNFDKNLPNEKVLPKHSLLYEYFTVYNELTKVKYVTEGMRKPAFLSGEQKKAIVDLLFKTNRKVTVKQLKEDYFKKIECFDSVEISGVEDRFNASLGTYHDLLKIIKDKDFLDNEENEDILEDIVLTLTLFEDREMIEERLKTYAHLFDDKVMKQLKRRRYTGWGRLSRKLINGIRDKQSGKTILDFLKSDGFANRNFMQLIHDDSLTFKEDIQKAQVSGQGDSLHEHIANLAGSPAIKKGILQTVKVVDELVKVMGRHKPENIVIEMARENQTTQKGQKNSRERMKRIEEGIKELGSQILKEHPVENTQLQNEKLYLYYLQNGRDMYVDQELDINRLSDYDVDHIVPQSFLKDDSIDNKVLTRSDKNRGKSDNVPSEEVVKKMKNYWRQLLNAKLITQRKFDNLTKAERGGLSELDKAGFIKRQLVETRQITKHVAQILDSRMNTKYDENDKLIREVKVITLKSKLVSDFRKDFQFYKVREINNYHHAHDAYLNAVVGTALIKKYPKLESEFVYGDYKVYDVRKMIAKSEQEIGKATAKYFFYSNIMNFFKTEITLANGEIRKRPLIETNGETGEIVWDKGRDFATVRKVLSMPQVNIVKKTEVQTGGFSKESILPKRNSDKLIARKKDWDPKKYGGFDSPTVAYSVLVVAKVEKGKSKKLKSVKELVGITIMERSSFEKNPVDFLEAKGYKEVKKDLIIKLPKYSLFELENGRKRMLASAGELQKGNELALPSKYVNFLYLASHYEKLKGSPEDNEQKQLFVEQHKHYLDEIIEQISEFSKRVILADANLDKVLSAYNKHRDKPIREQAENIIHLFTLTNLGAPAAFKYFDTTIDRKRYTSTKEVLDATLIHQSITGLYETRIDLSQLGGDSSPPKKKRKVSWKDASGWSRM

SEQ ID NO:3

guide RNA backbone nucleotide sequence of CRISPR/Cas 9:

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTT

SEQ ID NO:4

nucleotide sequence of target site in rice OsDep1 gene:

AACTGCAGTGCGTGCTGCGC

SEQ ID NO:5

single-stranded nucleotide sequence: the 5 ' end contains a phosphorylation modification, and the two ends are respectively provided with 2 phosphorothioate modifications, wherein the ' x ' represents a phosphorothioate bond.

5’-PHO-G*G*AACCTGTGAGTCGCATGGTAGAGGGCTCAACTTGGACATCGTCGATCTAGAGAACTCATCGATCGCACTCCCGTAGCCGAC*G*T-3’

SEQ ID NO:6

Reverse complement of single-stranded nucleotides: the 5 ' end contains a phosphorylation modification, and the two ends are respectively provided with 2 phosphorothioate modifications, wherein the ' x ' represents a phosphorothioate bond.

5’-PHO-A*C*GTCGGCTACGGGAGTGCGATCGATGAGTTCTCTAGATCGACGATGTCCAAGTTGA*G*C-3’

SEQ ID NO:7

Single-stranded nucleotide sequence containing degenerate bases: the 5' end contains a phosphorylated modification and 2 phosphorothioate modifications at each end, where N represents base A, T, C or G and "+" represents a phosphorothioate linkage.

5’-PHO-C*C*TACGNTCGNCACGACCCTGANCTACGGCGTCCAGTGCTTCTCCCGCAACCCTGACC*A*C-3’

Cloning, sequencing and amplifying primer sequences:

SEQ ID NO:8

F1：5’-GCAAACTAGTCCAGGGATGTAATCATC-3’

SEQ ID NO:9

R1：5’-TCCAAGTTGAGCCCTCTACCATGC-3’

SEQ ID NO:10

F2:5’-GGCATAATAATCTGTACTACTGCC-3’

SEQ ID NO:11

R2:5’-GAGCCCTCTACCATGCGACTC-3’

SEQ ID NO:12

M13F：CAGGAAACAGCTATGACC

SEQ ID NO:13

M13R：TGTAAAACGACGGCCAGT

SEQ ID NO:14

R1’：5’-GTGGTCAGGGTTGCGGGAGA-3’

SEQ ID NO:15

R2’:5’-GGGAGAAGCACTGGACGCCG-3’

SEQ ID NO:16

the sequence of the green fluorescent protein expression cassette, wherein the italic part is a maize ubiquitin promoter, the underlined part is a green fluorescent protein CDS sequence, and the rest is a Nos terminator sequence.

SEQ ID NO:17

35S promoter sequence

AGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACTTGGTGGAGCACGACACGCTAGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTAATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGTAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG

SEQ ID NO:18

Rice U6 promoter sequence

TTTGTGAAAGTTGAATTACGGCATAGCCGAAGGAATAACAGAATCGTTTCACACTTTCGTAACAAAGGTCTTCTTATCATGTTTCAGACGATGGAGGCAAGGCTGATCAAAGTGATCAAGCACATAAACGCATTTTTTTACCATGTTTCACTCCATAAGCGTCTGAGATTATCACAAGTCACGTCTAGTAGTTTGATGGTACACTAGTGACAATCAGTTCGTGCAGACAGAGCTCATACTTGACTACTTGAGCGATTACAGGCGAAAGTGTGAAACGCATGTGATGTGGGCTGGGAGGAGGAGAATATATACTAATGGGCCGTATCCTGATTTGGGCTGCGTCGGAAGGTGCAGCCCACGCGCGCCGTACCGCGCGGGTGGCGCTGCTACCCACTTTAGTCCGTTGGATGGGGATCCGATGGTTTGCGCGGTGGCGTTGCGGGGGATGTTTAGTACCACATCGGAAACCGAAAGACGATGGAACCAGCTTATAAACCCGCGCGCTGTAGTCAGCTT

SEQ ID NO:19

NOS terminator sequences

GATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATC

Reference to the literature

Wiedenheft B, Sternberg SH and Doudna JA RNA-guided genetic screening systems in bacteria and archaea Nature,2012,482: 331-.

Zhou HB, Liu B, Weeks DP et al, Large chromosomal deletions and reliable small genetic changes induced by CRISPR/Cas9 in rice nucleic Acids Research,2014,42: 10903-.

Liang Z, Zong Y and Gao C.an effective targeted mutagenesis system using CRISPR/cas in monoclonal antibodies Current.Protoc.plant biol.2016,1: 329-.

Liu CX, Geng LZ and Xu JP detection methods of genome editing in plants Hereditas,2018,40: 1075-.

Wang Y, Geng L, Yuan M et al, Deletion of a target gene in Industrial device via CRISPR/Cas9.plant Cell Rep,2017,36: 1333-.

Sequence listing

<110> Xianzhenda Crop Protection shares company (Syngenta Crop Protection AG)

Syngenta Biotechnology China Co., Ltd. (Syngenta Biotechnology China Co., Ltd.)

<120> method for detecting gene editing event and measuring gene editing efficiency and use thereof

<130> 81845-WO-REG-ORG-P-1

<141> 2019-05-21

<160> 19

<170> PatentIn version 3.5

<210> 1

<211> 4170

<212> DNA

<213> Artificial sequence

<220>

<223> nucleic acid sequence of improved and optimized Cas9

<400> 1

atggacaaga agtacagcat cggcctggac atcggcacca acagcgtggg ctgggccgtg 60

atcaccgacg agtacaaggt gccgagcaag aagttcaagg tgctgggcaa caccgacagg 120

cacagcatca agaagaacct gatcggcgcc ctgctgttcg acagcggcga gaccgccgag 180

gccaccaggc tgaagaggac cgccaggagg aggtacacca ggaggaagaa caggatctgc 240

tacctgcagg agatcttcag caacgagatg gccaaggtgg acgacagctt cttccacagg 300

ctggaggaga gcttcctggt ggaggaggac aagaagcacg agaggcaccc gatcttcggc 360

aacatcgtgg acgaggtggc ctaccacgag aagtacccga ccatctacca cctgaggaag 420

aagctggtgg acagcaccga caaggccgac ctgaggctga tctacctggc cctggcccac 480

atgatcaagt tcaggggcca cttcctgatc gagggcgacc tgaacccgga caacagcgac 540

gtggacaagc tgttcatcca gctggtgcag acctacaacc agctgttcga ggagaacccg 600

atcaacgcca gcggcgtgga cgccaaggcc atcctgagcg ccaggctgag caagagcagg 660

aggctggaga acctgatcgc ccagctgccg ggcgagaaga agaacggcct gttcggcaac 720

ctgatcgccc tgagcctggg cctgaccccg aacttcaaga gcaacttcga cctggccgag 780

gacgccaagc tgcagctgag caaggacacc tacgacgacg acctggacaa cctgctggcc 840

cagatcggcg accagtacgc cgacctgttc ctggccgcca agaacctgag cgacgccatc 900

ctgctgagcg acatcctgag ggtgaacacc gagatcacca aggccccgct gagcgccagc 960

atgatcaaga ggtacgacga gcaccaccag gacctgaccc tgctgaaggc cctggtgagg 1020

cagcagctgc cggagaagta caaggagatc ttcttcgacc agagcaagaa cggctacgcc 1080

ggctacatcg acggcggcgc cagccaggag gagttctaca agttcatcaa gccgatcctg 1140

gagaagatgg acggcaccga ggagctgctg gtgaagctga acagggagga cctgctgagg 1200

aagcagagga ccttcgacaa cggcagcatc ccgcaccaga tccacctggg cgagctgcac 1260

gccatcctga ggaggcagga ggacttctac ccgttcctga aggacaacag ggagaagatc 1320

gagaagatcc tgaccttccg catcccgtac tacgtgggcc cgctggccag gggcaacagc 1380

aggttcgcct ggatgaccag gaagagcgag gagaccatca ccccgtggaa cttcgaggag 1440

gtggtggaca agggcgccag cgcccagagc ttcatcgaga ggatgaccaa cttcgacaag 1500

aacctgccga acgagaaggt gctgccgaag cacagcctgc tgtacgagta cttcaccgtg 1560

tacaacgagc tgaccaaggt gaagtacgtg accgagggca tgaggaagcc ggccttcctg 1620

agcggcgagc agaagaaggc catcgtggac ctgctgttca agaccaacag gaaggtgacc 1680

gtgaagcagc tgaaggagga ctacttcaag aagatcgagt gcttcgacag cgtggagatc 1740

agcggcgtgg aggacaggtt caacgccagc ctgggcacct accacgacct gctgaagatc 1800

atcaaggaca aggacttcct ggacaacgag gagaacgagg acatcctgga ggacatcgtg 1860

ctgaccctga ccctgttcga ggacagggag atgatcgagg agaggctgaa gacctacgcc 1920

cacctgttcg acgacaaggt gatgaagcag ctgaagagga ggaggtacac cggctggggc 1980

aggctgagca ggaagctgat caacggcatc agggacaagc agagcggcaa gaccatcctg 2040

gacttcctga agagcgacgg cttcgccaac aggaacttca tgcagctgat ccacgacgac 2100

agcctgacct tcaaggagga catccagaag gcccaggtga gcggccaggg cgacagcctg 2160

cacgagcaca tcgccaacct ggccggcagc ccggccatca agaagggcat cctgcagacc 2220

gtgaaggtgg tggacgagct ggtgaaggtg atgggcaggc acaagccgga gaacatcgtg 2280

atcgagatgg ccagggagaa ccagaccacc cagaagggcc agaagaacag cagggagagg 2340

atgaagagga tcgaggaggg catcaaggag ctgggcagcc agatcctgaa ggagcacccg 2400

gtggagaaca cccagctgca gaacgagaag ctgtacctgt actacctgca gaacggcagg 2460

gacatgtacg tggaccagga gctggacatc aacaggctga gcgactacga cgtggaccac 2520

atcgtgccgc agagcttcct gaaggacgac agcatcgaca acaaggtgct gaccaggagc 2580

gacaagaaca ggggcaagag cgacaacgtg ccgagcgagg aggtggtgaa gaagatgaaa 2640

aactactgga ggcagctgct gaacgccaag ctgatcaccc agaggaagtt cgacaacctg 2700

accaaggccg agaggggcgg cctgagcgag ctggacaagg ccggcttcat taaaaggcag 2760

ctggtggaga ccaggcagat caccaagcac gtggcccaga tcctggacag caggatgaac 2820

accaagtacg acgagaacga caagctgatc agggaggtga aggtgatcac cctgaagagc 2880

aagctggtga gcgacttcag gaaggacttc cagttctaca aggtgaggga gatcaataat 2940

taccaccacg cccacgacgc ctacctgaac gccgtggtgg gcaccgccct gattaaaaag 3000

tacccgaagc tggagagcga gttcgtgtac ggcgactaca aggtgtacga cgtgaggaag 3060

atgatcgcca agagcgagca ggagatcggc aaggccaccg ccaagtactt cttctacagc 3120

aacatcatga acttcttcaa gaccgagatc accctggcca acggcgagat caggaagagg 3180

ccgctgatcg agaccaacgg cgagaccggc gagatcgtgt gggacaaggg cagggacttc 3240

gccaccgtga ggaaggtgct gtccatgccg caggtgaaca tcgtgaagaa gaccgaggtg 3300

cagaccggcg gcttcagcaa ggagagcatc ctgccgaaga ggaacagcga caagctgatc 3360

gccaggaaga aggactggga tccgaagaag tacggcggct tcgacagccc gaccgtggcc 3420

tacagcgtgc tggtggtggc caaggtggag aagggcaaga gcaagaagct gaagagcgtg 3480

aaggagctgg tgggcatcac catcatggag aggagcagct tcgagaagaa cccagtggac 3540

ttcctggagg ccaagggcta caaggaggtg aagaaggacc tgatcattaa actgccgaag 3600

tacagcctgt tcgagctgga gaacggcagg aagaggatgc tggccagcgc cggcgagctg 3660

cagaagggca acgagctggc cctgccgagc aagtacgtga acttcctgta cctggccagc 3720

cactacgaga agctgaaggg cagcccggag gacaacgagc agaagcagct gttcgtggag 3780

cagcacaagc actacctgga cgagatcatc gagcagatca gcgagttcag caagagggtg 3840

atcctggccg acgccaacct ggacaaggtg ctgagcgcct acaacaagca cagggacaag 3900

ccgatcaggg agcaggccga gaacatcatc cacctgttca ccctgaccaa cctgggcgcc 3960

ccggccgcct tcaagtactt cgacaccacc atcgacagga agaggtacac cagcaccaag 4020

gaggtgctgg acgccaccct gatccaccag agcatcaccg gcctgtacga gaccaggatc 4080

gacctgagcc agctgggcgg cgacagcagc ccgccgaaga agaagaggaa ggtgagctgg 4140

aaggacgcca gcggctggag caggatgtga 4170

<210> 2

<211> 1389

<212> PRT

<213> Artificial sequence

<220>

<223> improved and optimized amino acid sequence of Cas9

<400> 2

Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val

1 5 10 15

Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe

20 25 30

Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile

35 40 45

Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu

50 55 60

Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys

65 70 75 80

Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser

85 90 95

Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys

100 105 110

His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr

115 120 125

His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp

130 135 140

Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His

145 150 155 160

Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro

165 170 175

Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr

180 185 190

Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala

195 200 205

Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn

210 215 220

Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn

225 230 235 240

Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe

245 250 255

Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp

260 265 270

Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp

275 280 285

Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp

290 295 300

Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser

305 310 315 320

Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys

325 330 335

Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe

340 345 350

Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser

355 360 365

Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp

370 375 380

Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg

385 390 395 400

Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu

405 410 415

Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe

420 425 430

Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile

435 440 445

Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp

450 455 460

Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu

465 470 475 480

Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr

485 490 495

Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser

500 505 510

Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys

515 520 525

Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln

530 535 540

Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr

545 550 555 560

Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp

565 570 575

Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly

580 585 590

Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp

595 600 605

Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr

610 615 620

Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala

625 630 635 640

His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr

645 650 655

Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp

660 665 670

Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe

675 680 685

Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe

690 695 700

Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu

705 710 715 720

His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly

725 730 735

Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly

740 745 750

Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln

755 760 765

Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile

770 775 780

Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro

785 790 795 800

Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu

805 810 815

Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg

820 825 830

Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys

835 840 845

Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg

850 855 860

Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys

865 870 875 880

Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys

885 890 895

Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp

900 905 910

Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr

915 920 925

Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp

930 935 940

Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser

945 950 955 960

Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg

965 970 975

Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val

980 985 990

Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe

995 1000 1005

Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala

1010 1015 1020

Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe

1025 1030 1035

Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala

1040 1045 1050

Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu

1055 1060 1065

Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val

1070 1075 1080

Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr

1085 1090 1095

Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys

1100 1105 1110

Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro

1115 1120 1125

Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val

1130 1135 1140

Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys

1145 1150 1155

Ser Val Lys Glu Leu Val Gly Ile Thr Ile Met Glu Arg Ser Ser

1160 1165 1170

Phe Glu Lys Asn Pro Val Asp Phe Leu Glu Ala Lys Gly Tyr Lys

1175 1180 1185

Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu

1190 1195 1200

Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly

1205 1210 1215

Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val

1220 1225 1230

Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser

1235 1240 1245

Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys

1250 1255 1260

His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys

1265 1270 1275

Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala

1280 1285 1290

Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn

1295 1300 1305

Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala

1310 1315 1320

Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser

1325 1330 1335

Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr

1340 1345 1350

Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp

1355 1360 1365

Ser Ser Pro Pro Lys Lys Lys Arg Lys Val Ser Trp Lys Asp Ala

1370 1375 1380

Ser Gly Trp Ser Arg Met

1385

<210> 3

<211> 85

<212> DNA

<213> Artificial sequence

<220>

<223> CRISPR/Cas9 guide RNA backbone nucleotide sequence

<400> 3

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt ttttt 85

<210> 4

<211> 20

<212> DNA

<213> Rice (Oryza sativa)

<220>

<223> target site nucleotide sequence in rice OsDep1 Gene

<400> 4

aactgcagtg cgtgctgcgc 20

<210> 5

<211> 85

<212> DNA

<213> Artificial sequence

<220>

<223> Single-stranded nucleotide sequence

<220>

<221> misc_feature

<222> (1)..(1)

<223> 5' -terminal phosphorylation modification

<220>

<221> misc_feature

<222> (1)..(2)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (2)..(3)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (83)..(84)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (84)..(85)

<223> the two nucleotides are linked by a phosphorothioate linkage

<400> 5

ggaacctgtg agtcgcatgg tagagggctc aacttggaca tcgtcgatct agagaactca 60

tcgatcgcac tcccgtagcc gacgt 85

<210> 6

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> reverse complement sequence of Single-stranded nucleotide

<220>

<221> misc_feature

<222> (1)..(1)

<223> 5' -terminal phosphorylation modification

<220>

<221> misc_feature

<222> (1)..(2)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (2)..(3)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (57)..(58)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (58)..(59)

<223> the two nucleotides are linked by a phosphorothioate linkage

<400> 6

acgtcggcta cgggagtgcg atcgatgagt tctctagatc gacgatgtcc aagttgagc 59

<210> 7

<211> 60

<212> DNA

<213> Artificial sequence

<220>

<223> Single-stranded nucleotide sequence containing degenerate bases

<220>

<221> misc_feature

<222> (1)..(1)

<223> 5' -terminal phosphorylation modification

<220>

<221> misc_feature

<222> (1)..(2)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (2)..(3)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (7)..(7)

<223> n is a, c, g or t

<220>

<221> misc_feature

<222> (11)..(11)

<223> n is a, c, g or t

<220>

<221> misc_feature

<222> (23)..(23)

<223> n is a, c, g or t

<220>

<221> misc_feature

<222> (58)..(59)

<223> the two nucleotides are linked by a phosphorothioate linkage

<220>

<221> misc_feature

<222> (59)..(60)

<223> the two nucleotides are linked by a phosphorothioate linkage

<400> 7

cctacgntcg ncacgaccct ganctacggc gtccagtgct tctcccgcaa ccctgaccac 60

<210> 8

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> primer F1

<400> 8

gcaaactagt ccagggatgt aatcatc 27

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> primer R1

<400> 9

tccaagttga gccctctacc atgc 24

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> primer F2

<400> 10

ggcataataa tctgtactac tgcc 24

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> primer R2

<400> 11

gagccctcta ccatgcgact c 21

<210> 12

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> primer M13F

<400> 12

caggaaacag ctatgacc 18

<210> 13

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> primer M13R

<400> 13

tgtaaaacga cggccagt 18

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer R1'

<400> 14

gtggtcaggg ttgcgggaga 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer R2'

<400> 15

gggagaagca ctggacgccg 20

<210> 16

<211> 2972

<212> DNA

<213> Artificial sequence

<220>

<223> Green fluorescent protein expression cassette sequence

<400> 16

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca ccggcagcta cgggggattc ctttcccacc 840

gctccttcgc tttcccttcc tcgcccgccg taataaatag acaccccctc cacaccctct 900

ttccccaacc tcgtgttgtt cggagcgcac acacacacaa ccagatctcc cccaaatcca 960

cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc cccccccccc cctctctacc 1020

ttctctagat cggcgttccg gtccatggtt agggcccggt agttctactt ctgttcatgt 1080

ttgtgttaga tccgtgtttg tgttagatcc gtgctgctag cgttcgtaca cggatgcgac 1140

ctgtacgtca gacacgttct gattgctaac ttgccagtgt ttctctttgg ggaatcctgg 1200

gatggctcta gccgttccgc agacgggatc gatttcatga ttttttttgt ttcgttgcat 1260

agggtttggt ttgccctttt cctttatttc aatatatgcc gtgcacttgt ttgtcgggtc 1320

atcttttcat gctttttttt gtcttggttg tgatgatgtg gtctggttgg gcggtcgttc 1380

tagatcggag tagaattctg tttcaaacta cctggtggat ttattaattt tggatctgta 1440

tgtgtgtgcc atacatattc atagttacga attgaagatg atggatggaa atatcgatct 1500

aggataggta tacatgttga tgcgggtttt actgatgcat atacagagat gctttttgtt 1560

cgcttggttg tgatgatgtg gtgtggttgg gcggtcgttc attcgttcta gatcggagta 1620

gaatactgtt tcaaactacc tggtgtattt attaattttg gaactgtatg tgtgtgtcat 1680

acatcttcat agttacgagt ttaagatgga tggaaatatc gatctaggat aggtatacat 1740

gttgatgtgg gttttactga tgcatataca tgatggcata tgcagcatct attcatatgc 1800

tctaaccttg agtacctatc tattataata aacaagtatg ttttataatt attttgatct 1860

tgatatactt ggatgatggc atatgcagca gctatatgtg gattttttta gccctgcctt 1920

catacgctat ttatttgctt ggtactgttt cttttgtcga tgctcaccct gttgtttggt 1980

gttacttctg cagactagta tggtctccaa gggagaggag ctcttcaccg gagtggtccc 2040

aatcctcgtg gagctggacg gcgatgtcaa tggccacaag ttctccgtga gcggagaggg 2100

agagggcgac gccacatacg gcaagctcac gctgaagttc atctgcacca caggcaagct 2160

gccggtgcca tggcctacgc tcgtcacgac cctgacctac ggcgtccagt gcttctcccg 2220

gtaccctgac cacatgaagc agcatgattt cttcaagagc gcaatgccag agggctacgt 2280

gcaggagcgc accatcttct tcaaggacga tggcaactac aagacaaggg cggaggtgaa 2340

gttcgagggc gacacgctcg tcaaccggat cgagctgaag ggcatcgact tcaaggagga 2400

tggcaatatc ctcggccaca agctggagta caactacaat tctcataacg tgtacatcat 2460

ggccgataag cagaagaacg gcatcaaggt caatttcaag atccgccaca atatcgagga 2520

cggctccgtg cagctcgcgg atcattacca gcagaacacc ccaatcggcg acggaccagt 2580

cctcctgcca gataatcact acctctctac acagtcagcg ctgtcgaagg accctaacga 2640

gaagagggat catatggtgc tcctggagtt cgtcaccgca gcaggcatca cactcggcat 2700

ggatgagctg tacaagtgag atcgttcaaa catttggcaa taaagtttct taagattgaa 2760

tcctgttgcc ggtcttgcga tgattatcat ataatttctg ttgaattacg ttaagcatgt 2820

aataattaac atgtaatgca tgacgttatt tatgagatgg gtttttatga ttagagtccc 2880

gcaattatac atttaatacg cgatagaaaa caaaatatag cgcgcaaact aggataaatt 2940

atcgcgcgcg gtgtcatcta tgttactaga tc 2972

<210> 17

<211> 521

<212> DNA

<213> Artificial sequence

<220>

<223> 35S promoter sequence

<400> 17

agtcaaagat tcaaatagag gacctaacag aactcgccgt aaagactggc gaacagttca 60

tacagagtct cttacgactc aatgacaaga agaaaatctt cgtcaacttg gtggagcacg 120

acacgctagt ctactccaaa aatatcaaag atacagtctc agaagaccaa agggcaattg 180

agacttttca acaaagggta atatccggaa acctcctcgg attccattgc ccagctatct 240

gtcacttaat tgtgaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 300

ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 360

cacccacgag gagcatcgtg gtaaaagaag acgttccaac cacgtcttca aagcaagtgg 420

attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 480

acccttcctc tatataagga agttcatttc atttggagag g 521

<210> 18

<211> 516

<212> DNA

<213> Artificial sequence

<220>

<223> Rice U6 promoter sequence

<400> 18

tttgtgaaag ttgaattacg gcatagccga aggaataaca gaatcgtttc acactttcgt 60

aacaaaggtc ttcttatcat gtttcagacg atggaggcaa ggctgatcaa agtgatcaag 120

cacataaacg cattttttta ccatgtttca ctccataagc gtctgagatt atcacaagtc 180

acgtctagta gtttgatggt acactagtga caatcagttc gtgcagacag agctcatact 240

tgactacttg agcgattaca ggcgaaagtg tgaaacgcat gtgatgtggg ctgggaggag 300

gagaatatat actaatgggc cgtatcctga tttgggctgc gtcggaaggt gcagcccacg 360

cgcgccgtac cgcgcgggtg gcgctgctac ccactttagt ccgttggatg gggatccgat 420

ggtttgcgcg gtggcgttgc gggggatgtt tagtaccaca tcggaaaccg aaagacgatg 480

gaaccagctt ataaacccgc gcgctgtagt cagctt 516

<210> 19

<211> 253

<212> DNA

<213> Artificial sequence

<220>

<223> NOS terminator sequence

<400> 19

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 180

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

Claims

1. A method for determining gene editing efficiency in rice cells, comprising co-transforming rice cells with a reporter gene with a selected gene editing tool and an exogenous nucleotide fragment, generating a DNA double strand break by the gene editing tool, inserting the exogenous nucleotide fragment into the break by an in vivo repair system via the NHEJ pathway, performing PCR amplification and sequencing the amplified fragment, and calculating the gene editing efficiency based on the sequencing result and the transformation efficiency obtained with the help of the reporter gene, wherein the exogenous nucleotide fragment is artificially designed and synthesized in the form of a single-stranded DNA or a double-stranded DNA, and wherein the sequence of the exogenous nucleotide fragment is as shown in SEQ ID NO. 5, SEQ ID NO. 6 or SEQ ID NO. 7.

2. The method of claim 1, the exogenous coreThe ratio of the concentration of the nucleotide fragment to the rice cell was 1. mu.M: 5X 10⁵And (4) cells.

3. The method of claim 1 or 2, wherein the reporter gene is a gene for green fluorescent protein, red fluorescent protein, or yellow fluorescent protein.

4. The method of claim 1 or 2, wherein the 5' terminus of the exogenous nucleotide fragment contains a phosphorylation modification.

5. The method of claim 1 or 2, wherein both ends of the exogenous nucleotide fragment contain a phosphorothioate modification.

6. The method of claim 1 or 2, wherein the 5' terminus of the exogenous nucleotide fragment contains a phosphorylation modification and both termini contain a phosphorothioate modification.

7. The method of claim 1 or 2, wherein the gene editing tool is CRISPR/Cas9, TALEN, MN, or ZFN.

8. The method of claim 7, wherein the gene editing tool is CRISPR/Cas9 and the guide RNA used to perform editing is a single-component RNA or a bi-component RNA.

9. The method of claim 8, wherein the nucleotide sequence of Cas9 is shown as SEQ ID No. 1, or the amino acid sequence of Cas9 is shown as SEQ ID No. 2.

10. The method of claim 8, wherein the backbone nucleotide sequence of the guide RNA is set forth in SEQ ID NO 3.

11. The method according to claim 1 or 2, wherein a forward primer designed based on a chromosomal sequence at a double-strand break and a reverse primer designed based on an inserted exogenous nucleotide fragment sequence are used in the PCR amplification.

12. The method of claim 11, wherein the forward primer is set forth in SEQ ID No. 8 and the reverse primer is set forth in SEQ ID No. 9.

13. The method according to claim 12, wherein secondary PCR amplification using a forward primer as shown in SEQ ID NO. 10 and a reverse primer as shown in SEQ ID NO. 11 is performed.