CN108034671B

CN108034671B - Plasmid vector and method for establishing plant population by using same

Info

Publication number: CN108034671B
Application number: CN201711294415.4A
Authority: CN
Inventors: 周焕斌; 旷永洁; 严芳
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2017-12-08
Filing date: 2017-12-08
Publication date: 2021-09-28
Anticipated expiration: 2037-12-08
Also published as: CN108034671A

Abstract

The application relates to a plasmid vector and a method for establishing plant mutant population on a large scale by using the plasmid vector. The plasmid vector comprises a gene expression cassette for expressing a Cas9 protein, a first promoter, a nucleotide sequence comprising a suicide gene sequence, a gRNA scaffold element and a termination signal at the origin of replication, and at least one first enzyme cleavage site located 5 'of the nucleotide sequence comprising the suicide gene sequence and at least one second enzyme cleavage site located 3' of the nucleotide sequence comprising the suicide gene sequence; and the first and second enzyme cleavage sites are absent from other positions of the plasmid vector; wherein the first promoter is located upstream of the termination signal, the nucleotide sequence comprising a suicide gene sequence and the gRNA scaffold element and are both located between the first promoter and the termination signal.

Description

Plasmid vector and method for establishing plant population by using same

Technical Field

The present application relates to a plasmid vector and a method for establishing a plant population using the same.

Background

The CRISPR/Cas9 genome site-directed editing technology has become an important means for the current plant gene function and application research. The gene targeting technology can artificially modify genetic materials at specific sites of a genome in an organism, and genetic information change caused by the gene targeting technology can be stably transmitted and functionally presented in generations. The principle of genome site-specific editing is that an artificial nuclease is used for cutting at a target site of a biological genome to generate a DNA Double Strand Break (DSB), so that a DSB repair mechanism of a cell is activated to achieve the aim. This technique generally allows for simultaneous screening of mutations at as few as one site or at as few as a few sites.

Although large scale mutant population creation work has been done on plants using CRISPR/Cas9 technology. However, the lack of negative selection markers (such as suicide gene ccdB) in some plasmid vectors leads to a low positive rate during the construction of the vector library; and the plasmid vector containing the negative selection marker ccdB is constructed by only T4DNA ligase, and the process has high cost and efficiency but very complicated operation. In addition, the existing plasmid vector for CRISPR/Cas9 library construction does not contain a reporter gene for tracking, so that false positive materials cannot be directly removed in the preparation process of the mutant library, and the late stage is confronted with a complex and large-scale seed production process. Therefore, it cannot be effectively used for large-scale mutant population construction and screening.

In addition, rice (Oryza sativa L.) among plants is taken as an example: as the first crop to complete genome sequencing, rice research has entered the age of functional genomics. The key of the current rice research is to excavate relevant functional genes of important economic traits, explain the action mechanism of the genes and utilize the genes in production. Rice mutants are artificially created and screened by separating natural rice-induced mutants, or by physical mutagenesis means such as gamma ray and fast neutron radiation, chemical mutagenesis means such as MNU and EMS treatment, and biotechnology means such as T-DNA insertion, TALEN and CRISPR fixed-point editing technology, and the like, at present, researchers combine technologies such as map-based cloning and the like to separate and identify a plurality of key genes for controlling rice growth, development, stress resistance and nutrition absorption related processes such as MOC1, IPA1, DSM2, DLT and LTN1, and the molecular mechanism in the key genes is analyzed. However, compared with tens of thousands of functional genes carried by the whole genome of rice, the previous results are still cup of salary. How to comprehensively analyze and annotate the functions of all genes in the rice so as to finally improve the rice according to local conditions and better serve the agricultural production in China is the key point of the research on functional genomes of the rice. Among them, establishing the population resources of rice mutants is the most important. At present, a plurality of scientific research institutions in the countries such as the United states, China, Japan and the like establish huge rice EMS induced mutant populations, radiation induced mutant populations, T-DNA or transposon (Ac/Ds system, Tos17 system) insertion mutant populations. However, mutant groups constructed by physicochemical mutagenesis and insertion mutation have the problems of complex operation, low mutation rate, long time consumption for screening and separation, high cost and the like. For example, for the physicochemical mutation of rice mutant groups, the later stage relates to the fussy processes of hybridization, gene map-location cloning and the like; for the insertion mutant population, the target gene is easy to clone, but the coverage rate of the coding gene of the whole genome is not high. In particular, they all involve a large-scale seed production process in the later period, and consume a large amount of manpower and material resources.

Therefore, if a technology for constructing a plasmid library and creating a rice mutant population with high efficiency and high throughput by a one-step cloning method can be developed, false-positive transformation materials can be directly removed by methods such as fluorescence observation and the like so as to avoid the tedious work in the seed production process of the subsequent mutant population materials, save labor and cost, and greatly accelerate the steps of gene function research, new germplasm resource creation and variety improvement in the post-genomics era of rice.

Disclosure of Invention

To overcome the drawbacks of the prior art, one of the present applications provides a plasmid vector comprising a gene expression cassette comprising a Cas9 protein, a first promoter, a nucleotide sequence comprising a suicide gene sequence, a gRNA scaffold element and a termination signal, and at least one first enzyme cleavage site located 5 'of the nucleotide sequence comprising the suicide gene sequence and at least one second enzyme cleavage site located 3' of the nucleotide sequence comprising the suicide gene sequence; and the first and second enzyme cleavage sites are absent from other positions of the plasmid vector; wherein the first promoter is located upstream of the termination signal, and the nucleotide sequence comprising the suicide gene sequence and the gRNA scaffold element are both located between the first promoter and the termination signal.

In a specific embodiment, the first enzyme cleavage site and the second enzyme cleavage site may be the same or different. The first and second cleavage sites are set so that when the plasmid vector is used, the nucleotide sequence comprising the suicide gene sequence is excised, while the plasmid vector is linearized. For a plasmid vector which fails to successfully excise a nucleotide sequence containing a suicide gene sequence, the suicide gene exerts its characteristics to suicide the plasmid vector during transformation, thereby achieving the purpose of improving the positive rate.

In one embodiment, the plasmid vector further comprises a marker gene expression cassette.

In a specific embodiment, when a plurality of marker genes are contained, the marker genes may be used independently as individual expression cassettes or may be used in common as one expression cassette, which may be appropriately selected according to the ordinary skill in the art.

In one embodiment, the marker gene expression cassette comprises a selection gene expression cassette and a reporter gene expression cassette.

In a specific embodiment, the selection gene expression cassette comprises a selection gene expression cassette for use in plants.

In one embodiment, the selection gene expression cassette is a hygromycin resistance gene expression cassette or a G418 resistance gene expression cassette.

In one embodiment, the amino acid sequence encoded by the resistance gene or the nucleotide sequence of the resistance gene described above can be easily obtained by those skilled in the art, for example, the nucleotide sequence genebank accession number of the hygromycin resistance gene is KY420085.1, and the amino acid sequence genebank accession number of the hygromycin resistance gene is ASK 07515.1.

In a specific embodiment, the reporter gene is selected from at least one of a β galactosidase gene, a luciferase gene, a fluorescent protein gene, and a seed coat color gene.

In a specific embodiment, the reporter gene is selected from at least one of fluorescent protein genes. In one embodiment, the fluorescent protein gene is selected from at least one of a green fluorescent protein gene, a red fluorescent protein gene, a cyan fluorescent protein gene, a blue fluorescent protein gene, and a yellow fluorescent protein gene.

In one embodiment, the green fluorescent protein includes proteins that exhibit green fluorescence or enhanced green fluorescence after various mutations, such as enhanced green fluorescent protein. The red fluorescent protein includes various proteins which still show red fluorescence or red fluorescence enhancement after mutation, such as enhanced red fluorescent protein. Cyan fluorescent proteins include various proteins that exhibit cyan fluorescence or cyan fluorescence enhancement after mutation, such as enhanced cyan fluorescent protein. Blue fluorescent proteins include proteins that exhibit blue fluorescence or blue fluorescence enhancement after various mutations, such as enhanced blue fluorescent proteins. Yellow fluorescent proteins include proteins that exhibit yellow fluorescence or enhanced yellow fluorescence after various mutations, such as enhanced yellow fluorescent protein.

In a specific embodiment, the reporter gene expression cassette is selected from the group consisting of green fluorescent protein expression cassettes.

In one embodiment, the amino acid sequence encoded by the reporter gene or the sequence of the reporter gene (e.g., the amino acid sequence of a fluorescent protein or the nucleotide sequence of a fluorescent protein gene) can be readily obtained by one skilled in the art, for example, from genebank. For example, the nucleotide sequence genebank accession number of the green fluorescent protein is KY464890.1, and the encoded amino acid sequence genebank accession number is AQT 31663.1.

In a specific embodiment, the nucleotide sequence of the first promoter is selected from the group consisting of nucleotide sequences specific to the plant species to be mutated.

In a specific embodiment, the nucleotide sequence of the first promoter is selected from nucleotide sequences specific for gramineae plants.

In a specific embodiment, the gramineae is selected from at least one of rice, wheat, corn and sorghum.

In a specific embodiment, the first promoter is an RNA polymerase type III promoter.

In a specific embodiment, the nucleotide sequence of the first promoter is the nucleotide sequence shown as SEQ ID No. 1.

In a specific embodiment, the nucleotide sequence of the termination signal is the nucleotide sequence shown as SEQ ID No. 2.

In a specific embodiment, the nucleotide sequence of the gRNA scaffold element is set forth in SEQ ID No. 3.

In a specific embodiment, the gene expression cassette comprising a Cas9 protein expression cassette includes, from 5 'end to 3' end, a second promoter, a gene encoding a Cas9 protein, and a first terminator.

In a specific embodiment, the Cas9 protein may be a Cas9 protein conventional in the art, e.g., its amino acid sequence may be the amino acid sequence shown as SEQ ID No. 4.

In a specific embodiment, the nucleotide sequence of the gene encoding Cas9 protein is the nucleotide sequence shown as SEQ ID No. 5.

In a specific embodiment, the second promoter is an RNA polymerase II type promoter.

In a specific embodiment, the nucleotide sequence of the second promoter is as shown in SEQ ID No. 6.

In a specific embodiment, the nucleotide sequence of the first terminator is the 8 th to 260 th nucleotide sequences in genebank accession number FJ 362600.1.

In one embodiment, the selection gene expression cassette comprises a third promoter from 5 'to 3', a selection gene, and a second terminator.

In a specific embodiment, the third promoter is an RNA polymerase type II promoter.

In a specific embodiment, the nucleotide sequence of the third promoter is the 10382 th to 11162 th nucleotide sequences in genebank accession number FJ 362600.1.

In a specific embodiment, the nucleotide sequence of the second terminator is the 8 th to 260 th nucleotide sequences in genebank accession number FJ 362600.1.

In a specific embodiment, the reporter expression cassette comprises a fourth promoter from 5 'to 3', a reporter gene, and a third terminator.

In a specific embodiment, the fourth promoter is an RNA polymerase II type promoter.

In a specific embodiment, the nucleotide sequence of the fourth promoter is the 10382 th to 11162 th nucleotide sequences in genebank accession number FJ 362600.1.

In a specific embodiment, the nucleotide sequence of the third terminator is the 8 th to 260 th nucleotide sequences in genebank accession number FJ 362600.1.

In a specific embodiment, the suicide gene is the ccdB gene; preferably, the nucleotide sequence comprising the suicide gene sequence is shown in SEQ ID No. 7.

In a specific embodiment, the selection gene expression cassette further comprises a second selection gene expression cassette for use in bacteria.

In a specific embodiment, the second selection gene expression cassette is selected from at least one of a kanamycin resistance gene expression cassette, a penicillin resistance gene expression cassette, a tetracycline resistance gene expression cassette, a streptomycin resistance gene expression cassette.

In one embodiment, the amino acid sequence encoded by the resistance gene or the nucleotide sequence of the resistance gene can be easily obtained by those skilled in the art, for example, the kanamycin resistance gene sequence is the nucleotide sequence from 9156 to 9950 in genebank accession No. KX400856.1, and the encoded amino acid sequence is the amino acid sequence of genebank accession No. ASN 63838.1.

In a specific embodiment, the second selection gene expression cassette comprises, from 5 'to 3', a fifth promoter, a second selection gene and a fourth terminator.

In one embodiment, it is preferred that the fifth promoter is a promoter that can be used in bacteria.

In a specific embodiment, the nucleotide sequence of the fourth terminator is preferably the 8 th to 260 th nucleotide sequences in genebank accession number FJ 362600.1.

In one embodiment, the plasmid vector further comprises an origin of replication, which may be used in bacteria.

In a specific embodiment, the nucleotide sequence of the origin of replication has the sequence 4066 to 5066 nucleotides in KY 420084.1.

The second application provides a method for establishing a plant mutant population, which is obtained by targeting at least one plant endogenous gene, comprising the following steps:

the method comprises the following steps: obtaining at least one I element which comprises an I-1 nucleotide sequence, an I-2 nucleotide sequence and an I-3 nucleotide sequence from 5 'end to 3' end in sequence;

wherein the I-1 nucleotide sequence is identical to a sequence which is 20bp or more upstream of the 5' end from the first enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site; the I-2 nucleotide sequence is a target nucleotide sequence which is consistent with a part of nucleotide sequences on the plant endogenous gene; the I-3 nucleotide sequence is consistent with a sequence which is 20bp above the downstream of the 3' end from the second enzyme cutting site of the plasmid vector after being linearized by the first enzyme cutting site and the second enzyme cutting site;

step two: exchanging said I element by homologous recombination respectively onto said plasmid vector as defined in any of the present applications, resulting in a targeting vector in which said I element is located between said first promoter and a termination signal and said I-2 nucleotide sequence and said gRNA scaffold are transcriptionally fused;

step three: introducing the targeting vector into plant callus or plant protoplast, and culturing to obtain plant;

step four: screening the plant plants to obtain transgenic plants containing targeted plant endogenous genes; further, the transgenic plant containing the targeted plant endogenous gene is capable of producing transgenic plant seed containing the targeted plant endogenous gene.

In a specific embodiment, said I-1 nucleotide sequence is identical to a sequence 50-80bp upstream from the 5' end from said first cleavage site of said plasmid vector linearized with said first cleavage site and said second cleavage site.

In a specific embodiment, said nucleotide sequence I-3 is identical to a sequence 50-80bp downstream from the 3' end from said second cleavage site of said plasmid vector after being linearized by said first cleavage site and said second cleavage site.

In the present application, the principle of determining the target nucleotide sequence is the same as that of the conventional art. For example:

in a specific embodiment, the target nucleotide sequence is determined by:

1) determining at least one plant endogenous gene on a plant genome that is to be targeted;

2) searching the coding sequence of the plant endogenous gene or the reverse complementary sequence thereof for a PAM (Polyacrylamide) module sequence capable of being recognized by the Cas9 protein, and determining the nucleotide sequences 17 to 21 upstream of the 5 'end of the PAM module sequence as the target nucleotide sequence under the condition of ensuring that the nucleotide sequences 17 to 21 upstream of the 5' end of the PAM module sequence are specific sequences in the genome (namely, the sequences have high specificity in the genome and cannot be sequences with high sequence consistency in the genome).

In a specific embodiment, when the Cas9 protein is the amino acid sequence shown in SEQ ID No.4, the recognition PAM module is one of 5 ' -NGG-3 ', 5 ' -NGA-3 ', 5 ' -gann-3 ', 5 ' -AAGN-3 ', the target nucleotide sequence is 17 to 21 nucleotide sequences upstream of the 5 ' end of the PAM module, and nucleotide sequences containing five consecutive ts are eliminated; wherein N is one of A, G, C and T.

In one embodiment, at least one of the I-th elements is obtained by:

I) obtaining at least one oligonucleotide sequence comprising a nucleotide sequence II-1, a nucleotide sequence II-2, and a nucleotide sequence II-3 in that order from a 5 'end to a 3' end; wherein the II-1 nucleotide sequence is identical to a sequence which is 20bp or more upstream of the 5' end from the first enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site; the II-2 nucleotide sequence comprises a target nucleotide sequence identical to a partial nucleotide sequence on the endogenous gene of the plant; the II-3 nucleotide sequence is consistent with a sequence which is 20bp above the downstream of the 3' end from the second enzyme cutting site of the plasmid vector after being linearized by the first enzyme cutting site and the second enzyme cutting site;

II) obtaining an upstream primer and a downstream primer; wherein the upstream primer is consistent with a sequence which is more than 20bp from the first enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site to the upstream of the 5' end; the downstream primer is reversely complementary with a sequence which is more than 20bp from the second enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site to the downstream of the 3' end;

III) carrying out PCR amplification by taking the oligonucleotide sequence in the step I) as a template and the upstream primer and the downstream primer in the step II) as a primer pair, thereby obtaining the I element.

In a specific embodiment, said II-1 nucleotide sequence is identical to a sequence 20-35bp upstream from the 5' end of said plasmid vector from said first cleavage site after being linearized by said first cleavage site and said second cleavage site.

In a specific embodiment, said II-3 nucleotide sequence is identical to a sequence 20-35bp downstream from the 3' end from said second cleavage site of said plasmid vector after being linearized by said first cleavage site and said second cleavage site.

In a specific embodiment, the upstream primer is identical to a sequence 50-80bp upstream from the 5' end of the plasmid vector from the first cleavage site linearized by the first cleavage site and the second cleavage site.

In a specific embodiment, the downstream primer is reverse complementary to a sequence 50-80bp downstream from the 3' end from the second cleavage site of the plasmid vector after being linearized by the first cleavage site and the second cleavage site.

In one embodiment, when the plurality of oligonucleotide sequences of step I) is multiple, PCR amplification is performed in step III) using a mixture of the plurality of oligonucleotide sequences as a template, thereby obtaining a mixed plurality of the I element.

In one embodiment, when the I element is a plurality, the I-2 nucleotide sequences in the plurality are different in pairs.

In one embodiment, when the I element is a plurality of I elements, the I-1 nucleotide sequences in the plurality of I elements may be the same or different, but for the sake of simplicity of operation, it is preferred that the I-1 nucleotide sequences are the same.

In one embodiment, when the I element is a plurality of I elements, the I-3 nucleotide sequences in the plurality of I elements may be the same or different, but for the sake of simplicity of operation, it is preferred that the I-3 nucleotide sequences are the same.

In one embodiment, the I element is exchanged with the plasmid vector into a Cas9 vector by conventional molecular biology procedures, preferably Gibson assembly (Gibson assembly).

In one embodiment, the target nucleotide sequence may be a plurality of target nucleotide sequences, or, as it were, the I-th element may be a plurality of I-th elements. Thus, a plurality of I elements obtained by, for example, PCR, are mixed with the plasmid vector of any one of the present applications, and the plurality of I elements are ligated together with the plasmid vector by Gibbson assembly to obtain a targeting vector library. When the targeting vector is subjected to small-scale or large-scale plant transformation through conventional genetic manipulation, a mutant population of plants can be created.

In the present application, the nucleotide sequence is upstream of the portion near the 5 ' end and downstream of the portion near the 3 ' end, wherein the upstream and downstream are relative positions in the nucleotide sequence, and the nucleotide sequence located upstream is closer to the 5 ' end of the sequence. The beneficial effect of this application lies in:

the plasmid vector provided by the application greatly improves the positive rate of the obtained mutant population to 100% at most, and reduces the probability of false positive plants in the plant mutant population; meanwhile, the plasmid vector carries a green fluorescent protein gene expression cassette, and by means of the visualization of fluorescent protein, the single plant in the CRISPR mutant population can be tracked for the later generation, the T-DNA separation condition in the later generation plant and the like very conveniently, so that the field workload is greatly reduced.

Drawings

FIG. 1 shows a schematic flow chart of the construction of the vector pHZLib2 in example 1.

FIG. 2 shows typical mutation types of OsMPK1 and OsMPK3 mutant plants in OsMPK mutant population constructed using pHZLib 2.

FIG. 3 is a graph showing the results of the expression of GFP in rice resistance-cured rice after transformation of rice with plasmid pHZLIb2-OsMPKs, which was observed by confocal laser microscopy.

FIG. 4 is a graph showing the result of GFP expression in the roots of transgenic plants of the T0 generation after transformation of rice with plasmid pHZLIb2-OsMPKs in a stereoscopic fluorescence microscope.

Detailed Description

The present invention will be described in detail below with reference to examples and the accompanying drawings. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1: construction of recombinant plasmid

The technical route for constructing the vector is as follows:

1. construction of pUbi-ccdB-Cas9 recombinant plasmid

Hind III digestion was carried out on the self-contained binary vector of this laboratory, pH3, and the 8.8kb vector backbone was recovered and self-ligated using T4DNA Ligase (Takara), and then named pH 4. The elements included in pH4 are: CaMV35S promoter, hygromycin gene, NOS terminator, pVS1RepA, pVS1 origin of replication.A large 5.5kb fragment was recovered by double digestion at pH4 with BsaI and Hind III, which included the major elements: CaMV35S promoter, hygromycin gene and NOS terminator. Meanwhile, the pH4 is taken as a template, H3-F (SEQ ID No.8, a restriction enzyme BsaI restriction site is introduced) and H3-R (SEQ ID No.9) are taken as primers, and high fidelity enzyme I-5 is utilized^TMA small 3.7kb fragment (comprising the elements pVS1RepA and pVS1 origin of replication) was amplified from the pH4 plasmid at 2 × High-Fidelity Master Mix (available from Biotechnology Ltd., Beijing) and ligated to the above 5.5kb large fragment and named pH5. HindIII cleavage at pH5 was performed to recover the linearized vector backbone, comprising the elements: CaMV35S promoter, hygromycin gene, NOS terminator, pVS1RepA, pVS1 origin of replication.

BsmBI enzyme digestion is carried out on an own vector pGEMT of the laboratory, attR1R2, a 1kb fragment (comprising attR1, ccdB gene sequence and attR2) is recovered by gel casting and is connected with the linearized pH5 vector framework, sequencing is carried out to identify that the attR1R2 is inserted in the positive direction (namely the expression direction of GFP is consistent), the name is pH5-ccdB, and the expression direction of the ccdB gene is consistent with the expression direction of a promoter on the vector. The laboratory vector pGEMT, Ubip and pH5-ccdB were digested simultaneously with Hind III and SacI, respectively, and after ligation, the plasmid was named pH 5-ccdB-Ubip. The plasmid of pH5-ccdB-Ubip and the plasmid pUC57: Cas9 with artificially synthesized Cas9 fragment (SEQ ID No.5, the amino acid sequence of which is shown in SEQ ID No. 4) are subjected to BamHI and SpeI double enzyme digestion respectively, a 12kb vector framework and a 4.2kb Cas9 gene fragment are recovered and are connected, and the plasmid is named as pUbi-ccdB-Cas 9. The plasmid pUbi-ccdB-Cas9 was constructed as follows: CaMV35S promoter, hygromycin gene, NOS terminator, pVS1RepA, pVS1 origin of replication, attR1, ccdB gene sequence, attR2, Ubip promoter, Cas9 gene, NOS terminator.

2. pENTR4-gRNA recombinant plasmid construction

A792 bp GFP gene fragment (Biotechnology engineering, Shanghai, Inc.) was artificially synthesized and cloned into pUC57, and named pUC57: GFP. Plasmid pUC57, GFP and vector pUC19-3Flag were digested with BamHI and SpeI, and 792bp GFP gene fragment and 3.9kb pUC19-3Flag vector backbone (including the major elements: CaMV35S promoter) were recovered separately3Flag gene, NOS terminator, etc.), the GFP gene fragment was ligated to pUC19-3Flag vector using T4DNA ligase (Takara), named pUC19, GFP, and was used for future use after colony PCR and enzyme digestion verification. 35S-F3(SEQ ID No.10, restriction enzyme XhoI cleavage site is introduced) and NOS-R (SEQ ID No.11, restriction enzyme XhoI cleavage site is introduced) are used as primers, and I-5 is used^TM2 XHigh-Fidelity Master Mix was subjected to PCR amplification using vector PUC19: GFP as a template to obtain a target fragment of 1.8kb in size (i.e., GFP expression cassette: 35s-GFP-Nos, abbreviated as GFP-cassette, wherein 35s represents 35s promoter, GFP represents GFP gene, and Nos represents Nos terminator), digested with XhoI, and recovered. Meanwhile, XhoI digestion is carried out on pENTR4-gRNA which is a laboratory self-contained vector, a linearized fragment of 2.75kb (the element is U6 promoter, gRNA scaffold) is recovered, then dephosphorylation treatment is carried out on the linearized pENTR4-gRNA by using FastAP Thermosensive Alkaline Phosphatase (Thermo Scientific) to prevent self-ligation, and then the GFP fragment of 1.8kb is connected to the linearized pENTR4-gRNA fragment which is subjected to the dephosphorylation treatment by using T4DNA Ligase (Takara) to be named as pENTR4-gRNA, and sequencing is carried out for standby after colony PCR and enzyme digestion verification. The plasmid pENTR4-gRNA-GFP comprises the following components: u6 promoter, gRNA scaffold, CaMV35S promoter, GFP gene, NOS terminator.

3. Construction of pHZLib2 vector

The method comprises the steps of digesting pENTR4-gRNA-GFP with NheI, recovering a fragment of about 4kb (the elements are U6 promoter, gRNA scaffold, CaMV35S promoter, GFP gene and NOS terminator), exchanging a gRNA expression cassette (including a first promoter U6 promoter (SEQ ID No.1) + a termination signal (SEQ ID No.2) in pENTR4-gRNA3-GFP by gateway technology, wherein the gRNA expression cassette does not contain gRNA) and a GFP expression cassette into pUbi-ccdB-Cas9, and naming as pUbi-gRNA-GFP-Cas9 (the elements include CaMV35S promoter, hygromycin gene, NOS terminator, pVS1RepA, pVS1 replication origin, 685B 2, U6 promoter, gRNA scaffno, termination signal (SEQ ID No.2), CaMV35 promoter, NOS terminator, pVS1RepA, pVS1 replication origin, 685B 2, U6 promoter, and the DNA expression cassette is digested with correct sequence of the promoter, and the sequence is verified by digestion of the pUATTsRNA promoter, the CATV 35 promoter, the CATV terminator, the cDNA terminator, the CATV 9, the SEQ ID promoter, and the SEQ ID NO is verified by digestion of the DNA. ccdB-F1(SEQ ID No.12) and ccdB-R1(SEQ ID No.13) are used as referencesSubstance, utilizing I-5^TM2 xHigh-Fidelity Master Mix takes a vector pGEMT-attR1R2 as a template to carry out PCR amplification, and a target fragment (containing ccdB gene) with the size of about 800bp is obtained; digesting the plasmid pUbi-gRNA-GFP-Cas9 by BsaI enzyme, recovering a linearization band of about 10kb, and then utilizing Treidef^TMThe SoSoSoSoo Cloning Kit (TsingKe) inserts the ccdB gene into pUbi-gRNA3-GFP-rCas9 to obtain a final vector pHZLib2, and the final vector is subjected to colony PCR and enzyme digestion verification for later use. The plasmid pHZLib2 is composed of the following components: CaMV35S promoter (genebank accession number FJ362600.1, nucleotide sequence 10382 to 11162), hygromycin gene (genebank accession number KY420085.1), NOS terminator (genebank accession number FJ362600.1, nucleotide sequence 8 to 260), pVS1RepA (genebank accession number KY420084.1, nucleotide sequence 5755 to 6435), pVS1 origin of replication (genebank accession number KY420084.1, nucleotide sequence 4066 to 5066), attB1(SEQ ID 6314), U6 promoter (SEQ ID No.1), nucleic acid containing ccdB gene (SEQ ID No.7), gRNA scaffold (SEQ ID No.3), termination signal (SEQ ID No.2), CaMV35 promoter (genebank accession number FJ362600.1, nucleotide sequence 10382 to 11162), gene (SEQ ID No. 464890.1), nucleotide sequence FVbank accession number GFP 98), nucleotide sequence Uebk accession number GFP promoter (SEQ ID No.15) and nucleotide sequence 464890.1, NOS terminator (genebank accession number FJ362600.1, nucleotide sequences 8 to 260), Kan resistance gene expression cassette (genebank accession number KX400856.1, wherein the kana resistance gene is located at nucleotide sequences 9156 to 9950).

Example 2: plasmid library for constructing rice endogenous MPK gene family by using pHZLib2 system and rice transformation

1. Construction of plasmid library of pHZLib2-OsMPKs

Synthetic oligonucleotide sequence OsMPK1-oligo-1(SEQ ID No. 16: CCCGCGCGCTGTCGCTTGTGTG)TC ATCCAGTACAACATCTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG, the target nucleotide sequence of OsMPK1 is underlined), OsMPK2-oligo-1(SEQ ID No. 17: CCCGCGCGCTGTCGCTTGTGTGATGGCCATCACGGTGGCATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG, the target nucleotide sequence of OsMPK2 is underlined),OsMPK3-oligo-1(SEQ ID No.18：CCCGCGCGCTGTCGCTTGTGTGAAGTATTACTACTCGATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG, the target nucleotide sequence of OsMPK3 is underlined), OsMPK4-oligo-1(SEQ ID No. 19: CCCGCGCGCTGTCGCTTGTGTGCTAATGGCATGGGAAACCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG, the target nucleotide sequence of OsMPK4 is underlined), OsMPK5-oligo-1(SEQ ID No. 20: CCCGCGCGCTGTCGCTTGTGTGTCAGGCC GACGATGACGCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG, the target nucleotide sequence of OsMPK5 is underlined), OsMPK6-oligo-1(SEQ ID No. 21: CCCGCGCGCTGTCGCTT GTGTGTGTACGGGAACTTCTTCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG, the target nucleotide sequence of OsMPK6 is underlined) and OsMPK12-oligo-1(SEQ ID No. 22: CCCGCGCGCTGTCGCTTGTGTGCCAACCAGTCGTCC AACGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG underlined as the target nucleotide sequence of OsMPK 12), mixed at equal volume and equal concentration with the above seven oligonucleotides as templates, Array-F1(SEQ ID No. 23: CACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCTTGTGT) and Array-R1(SEQ ID No. 24: ACTCGGTG CCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) as primers, using I-5^TMThe above 7 oligonucleotides were mixed and amplified at 2 Xhigh-Fidelity Master Mix, and the PCR product was recovered at approximately 140 bp. At the same time, the vector pHZLib2 was digested with BsaI, and the vector backbone of about 10kb (releasing the ccdB gene fragment) was recovered. Reuse of Trelief^TMThe gRNA of the ccdB gene was replaced with the gRNA of the MPK gene by SoSoSoo Cloning Kit (TsingKe), and the replacement was named pHZLib 2-OsMPKs. Randomly picked 10 colonies were sequenced with up to 100% accuracy and contained all 7 grnas.

2. pHZLib2-OsMPKs plasmid library transformed japonica rice Kitaake

1) Rice callus induction:

treating the dehulled mature rice seeds with 50% commercial sterilizing solution for 25 minutes; cleaning with sterile water for 3-5 times, transferring the seeds to a sterile culture dish, and sucking out excessive water; placing the seeds on MSD plate (4.43g/L MS powder; 30g/L sucrose; 2 ml/L2, 4-D; 8g/L plant gel; pH5.7), culturing in light culture room for 10 days, inducing callus formation; embryos and shoots of the seeds were removed and the calli were transferred to a new MSD petri dish and cultured for 5 days until they could be used for agrobacterium transformation.

2) And (3) agrobacterium transformation:

the pHZLib2-OsMPKs plasmid library is transferred into an agrobacterium strain EHA105 by an electric shock method to construct the EHA105 strain containing the pHZLib2-OsMPKs plasmid library. Activating the EHA105 strain, and culturing in TY medium overnight at room temperature for 12 hours; the Agrobacterium was collected by centrifugation and resuspended in MSD solution to OD₆₀₀Stand up to 0.2 for use.

3) Agrobacterium infection of rice callus:

placing the callus in the agrobacterium suspension for 30 minutes; removing the agrobacterium suspension, transferring the callus onto sterile absorbent paper to remove redundant agrobacterium liquid, transferring the callus onto a new MSD culture medium containing 100 mu M acetosyringone, and culturing at room temperature in a dark place for 2-3 days.

4) Rice resistance callus screening:

transferring the dark cultured callus onto MSD culture medium (100mg/L timentin; 50mg/L hygromycin B) for 2 weeks to 2 months until the surface of the callus shows resistant callus; the medium was changed every 2 weeks.

5) Resistant callus differentiation and rooting

Transferring the resistant callus to a regeneration culture medium (4.43g/L MS powder, 30g/L sucrose, 25g/L sorbitol, 0.5mg/L NAA, 3mg/L BA, 100mg/L timentin, 50mg/L hygromycin B, 12g/L agar powder, pH5.7) until the resistant callus grows into a plant seedling, and transferring the resistant callus once every 7-10 days; the seedlings were transferred to 1/2MS medium (2.21g/L MS powder; 15g/L sucrose; 8g/L plant gel; pH5.7) for rooting.

Example 3: detection of OsMPKs rice mutant population

1) Extraction of genomic DNA

Cutting about 0.1g of T0 plant leaves, quickly freezing by liquid nitrogen, and grinding by using a grinder; adding 600 μ l 2 × CTAB DNA extract (containing 1/1000 β -mercaptoethanol), shaking, mixing, and splitting at 65 deg.C for 45 min. Add 500. mu.l chloroform and shake vigorously to form an emulsion, centrifuge at 14000rpm for 10 min. After centrifugation, the supernatant was transferred to a 1.5ml centrifuge tubeAdding isopropanol with the same volume, reversing, mixing uniformly, centrifuging at 14000rpm for 10min, removing supernatant, adding 700 μ l 70% ethanol to wash white precipitate, centrifuging at 14000rpm for 5min, removing supernatant, and air drying in a fume hood for 10 min. Add 30. mu.l ddH₂O dissolves the DNA. The DNA solution was stored at-20 ℃ for further use.

2) PCR amplification and sequencing detection of mutation sites

The detection sequencing of the gRNA of 109 randomly selected T0 plant seedlings was carried out by using a universal primer pair U6P-F3(SEQ ID No.25) and G4-R1(SEQ ID No.26), and the results showed that 16 transgenic plants each including OsMPK1, OsMPK4 and OsMPK5, 17 transgenic plants including OsMPK2, 15 transgenic plants including OsMPK3 and OsMPK12 and 14 transgenic plants including OsMPK 6. Designing a specific PCR primer according to the target site of the OsMPKs gene: OsMPK1-F1(SEQ ID No.27) and OsMPK1-R1(SEQ ID No. 28); OsMPK2-F1(SEQ ID No.29) and OsMPK2-R1(SEQ ID No. 30); OsMPK3-F1(SEQ ID No.31) and OsMPK3-R1(SEQ ID No. 32); OsMPK4-F1(SEQ ID No.33) and OsMPK4-R1(SEQ ID No. 34); OsMPK5-F1(SEQ ID No.35) and OsMPK5-R1(SEQ ID No. 36); OsMPK6-F1(SEQ ID No.37) and OsMPK6-R1(SEQ ID No. 38); OsMPK12-F1(SEQ ID No.39) and OsMPK12-R1(SEQ ID No. 40); by using I-5^TM2 × High-Fidelity Master Mix, using the above-mentioned primers as template, respectively PCR-amplifying to obtain OsMPK1, OsMPK2, OsMPK3, OsMPK4, OsMPK5, OsMPK6 and OsMPK12 gene fragments, whose sizes are 655bp, 438bp, 399bp, 358bp, 468bp, 530bp and 466bp in turn. The PCR products were directly Sanger sequenced. Sanger sequencing results showed: 13 strains of each of the OsMPK1, OsMPK3 and OsMPK5 mutants, 14 strains of each of the OsMPK2 and OsMPK4 mutants, 12 strains of the OsMPK6 mutant and 15 strains of the OsMPK12 mutant have mutation efficiency of 81.25-100 percent and can generate various types of mutations. For example, 13 mutant plants and a #1 plant heterozygote with the mutation type of +6/-6 are detected by the gene OsMPK1, which indicates that the OsMPK1 double alleles of diploid rice are mutated and the mutation types are different; the #2 plant contains a wild-type gene, and the single gene is mutated into-1 + 2. For example, 13 mutant plants are detected together with the OsMPK3 gene, and the mutation type of the No.1 plant is + A, so that a double allele mutant homozygous material is obtained; #2 plantThe mutation type was + T/+ C, and a heterozygote with biallelic mutation was also obtained (FIG. 2).

The mutation rate of T0 transgenic plants constructed by pHZLib2-OsMPKs plasmid library is up to more than 80%, and the system has high mutation efficiency.

TABLE 2 efficiency of construction of OsMPKs mutant populations Using the cosmid library pHZLib2-OsMPKs

Example 4: green fluorescent protein GFP visualization of transgenic resistant calli

Transgenic resistant callus and wild Kitaake callus are respectively picked and observed under a handheld UV lamp, and meanwhile, the callus is made into a temporary slide glass to be observed under a laser confocal microscope. The results show that the cells of rice callus showed green color under the condition of GFP excitation light (FIG. 3, left), while the cells showed no green fluorescent protein expression without GFP excitation light (FIG. 3), and the right side of FIG. 3 shows the additive effect of the above two, from which the obvious green fluorescence was observed in the case of transgenic resistance healing (FIG. 3, right). Meanwhile, the roots of the rice T0 generation plants are observed under the ultraviolet excitation of a body type fluorescence microscope, and obvious green fluorescence can be observed at the roots of the transgenic plants (figure 4). The GFP in the system can be expressed normally in rice cells, and green fluorescence is shown, so that the system can be used for tracking transgenic plants of progeny segregation populations.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> a plasmid vector and a method for establishing a plant population using the same

<130> LHA1760716

<160> 40

<170> SIPOSequenceListing 1.0

<210> 1

<211> 245

<212> DNA

<213> Artificial sequence (non)

<400> 1

ggatcatgaa ccaacggcct ggctgtattt ggtggttgtg tagggagatg gggagaagaa 60

aagcccgatt ctcttcgctg tgatgggctg gatgcatgcg ggggagcggg aggcccaagt 120

acgtgcacgg tgagcggccc acagggcgag tgtgagcgcg agaggcggga ggaacagttt 180

agtaccacat tgcccagcta actcgaacgc gaccaactta taaacccgcg cgctgtcgct 240

tgtgt 245

<210> 2

<211> 7

<212> DNA

<213> Artificial sequence (non)

<400> 2

ttttttt 7

<210> 3

<211> 76

<212> DNA

<213> Artificial sequence (non)

<400> 3

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgc 76

<210> 4

<211> 1417

<212> PRT

<213> Artificial sequence (non)

<400> 4

Met Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp

1 5 10 15

Tyr Lys Asp Asp Asp Asp Lys Met Ala Pro Lys Lys Lys Arg Lys Val

20 25 30

Gly Ile His Gly Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu

35 40 45

Asp Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr

50 55 60

Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His

65 70 75 80

Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu

85 90 95

Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr

100 105 110

Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu

115 120 125

Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe

130 135 140

Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn

145 150 155 160

Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His

165 170 175

Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu

180 185 190

Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu

195 200 205

Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe

210 215 220

Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile

225 230 235 240

Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser

245 250 255

Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys

260 265 270

Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr

275 280 285

Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln

290 295 300

Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln

305 310 315 320

Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser

325 330 335

Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr

340 345 350

Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His

355 360 365

Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu

370 375 380

Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly

385 390 395 400

Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys

405 410 415

Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu

420 425 430

Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser

435 440 445

Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg

450 455 460

Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu

465 470 475 480

Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg

485 490 495

Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile

500 505 510

Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln

515 520 525

Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu

530 535 540

Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr

545 550 555 560

Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro

565 570 575

Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe

580 585 590

Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe

595 600 605

Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp

610 615 620

Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile

625 630 635 640

Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu

645 650 655

Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu

660 665 670

Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys

675 680 685

Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys

690 695 700

Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp

705 710 715 720

Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile

725 730 735

His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val

740 745 750

Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly

755 760 765

Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp

770 775 780

Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile

785 790 795 800

Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser

805 810 815

Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser

820 825 830

Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu

835 840 845

Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp

850 855 860

Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile

865 870 875 880

Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu

885 890 895

Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu

900 905 910

Glu Val Val Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala

915 920 925

Lys Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg

930 935 940

Gly Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu

945 950 955 960

Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser

965 970 975

Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val

980 985 990

Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp

995 1000 1005

Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His

1010 1015 1020

Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr

1025 1030 1035 1040

Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp

1045 1050 1055

Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr

1060 1065 1070

Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu

1075 1080 1085

Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr

1090 1095 1100

Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala

1105 1110 1115 1120

Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys

1125 1130 1135

Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys

1140 1145 1150

Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys

1155 1160 1165

Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val

1170 1175 1180

Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys

1185 1190 1195 1200

Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn

1205 1210 1215

Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp

1220 1225 1230

Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly

1235 1240 1245

Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu

1250 1255 1260

Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His

1265 1270 1275 1280

Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu

1285 1290 1295

Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile

1300 1305 1310

Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys

1315 1320 1325

Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln

1330 1335 1340

Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro

1345 1350 1355 1360

Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr

1365 1370 1375

Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr

1380 1385 1390

Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Arg

1395 1400 1405

Pro Lys Lys Lys Arg Lys Val Gly Gly

1410 1415

<210> 5

<211> 4254

<212> DNA

<213> Artificial sequence (non)

<400> 5

atggactata aggatcacga tggcgactac aaggatcatg acattgacta taaggatgac 60

gacgataaga tggcacctaa gaagaaaagg aaagtcggca ttcatggcgt tccggcagcc 120

gacaaaaagt atagcatcgg cctcgatatt gggacaaact ctgtgggctg ggcggtaatt 180

accgacgagt acaaggtgcc tagtaagaaa tttaaagtgc tcggaaacac tgacaggcac 240

tctataaaga agaacctgat cggggcactg cttttcgact ccggagagac ggcggaggcg 300

acgcgtctca agcgtaccgc gcgccgcagg tacacaagaa ggaagaatag gatctgctac 360

ttgcaggaaa tcttcagtaa cgagatggcg aaggtcgacg atagtttctt tcatcggttg 420

gaagaatcgt tcctcgtaga ggaggacaaa aagcacgagc gtcacccaat attcgggaat 480

attgttgacg aggttgccta ccatgagaaa tatcctacaa tatatcacct ccgtaagaag 540

cttgtcgatt caactgataa ggctgatctc agactcatct atcttgccct cgcacatatg 600

attaagtttc gtggccactt cttgattgaa ggcgacctca acccggacaa ctcagatgtt 660

gacaagcttt ttatacagct cgtccagaca tataaccagc tgtttgaaga gaatcccatc 720

aatgcgagtg gggttgatgc taaggccatt ttgtccgcca ggttgtccaa atctcgcaga 780

ctggaaaacc tgatcgcaca gcttcccggt gaaaagaaaa acgggctctt cggcaatctc 840

atcgcactgt ccctcggcct caccccaaac ttcaagtcta acttcgacct ggccgaggat 900

gcgaagctcc agctgtcaaa agatacatac gacgacgatt tggacaatct gcttgcgcaa 960

ataggcgacc agtatgcgga cctgttcctg gctgccaaaa atctgtcaga tgcaatcctc 1020

ctgtccgata tattgcgtgt gaacaccgaa atcacgaagg caccgcttag cgcatccatg 1080

atcaagagat acgacgagca ccatcaggac ctcacactcc tcaaggcgct tgttcgtcag 1140

cagcttcccg agaaatataa ggaaattttt ttcgatcaaa gcaagaatgg atatgctggc 1200

tatattgacg gtggcgcttc gcaggaggag ttctataaat tcattaagcc gattctggag 1260

aagatggacg gaacggagga gctcctcgtc aagcttaacc gggaagacct gttgcggaag 1320

cagaggactt ttgataacgg ctctattccg caccaaatcc atctgggtga gttgcacgca 1380

atcttgagaa gacaagagga tttctacccg ttccttaagg ataacagaga gaagatagaa 1440

aaaatactga ccttcaggat accatactat gtgggcccac tggcgcgcgg aaatagtcgt 1500

ttcgcatgga tgactagaaa gtccgaagaa acgatcacgc catggaattt tgaggaagtg 1560

gtcgacaagg gcgcctctgc ccagagcttc atcgaaagga tgaccaattt tgacaaaaat 1620

ctgcctaacg aaaaggtgct tccgaagcac agcctgttgt atgaatactt cacagtttat 1680

aacgagctca ctaaggtcaa gtacgtcacg gagggcatgc gtaagcctgc tttcctgtct 1740

ggtgaacaaa aaaaggcgat tgtggacctc cttttcaaga cgaaccgtaa agttactgtg 1800

aagcaactga aagaggatta ctttaagaaa attgagtgct tcgacagtgt ggagatttcc 1860

ggtgtcgagg accggtttaa cgccagcctg ggtacgtatc atgacctgct taaaattatc 1920

aaggataaag atttcctgga taatgaagag aacgaagata tactggagga cattgtgttg 1980

actttgaccc tcttcgagga cagagagatg attgaggaaa gactgaagac ctacgcacac 2040

ctttttgatg acaaggtcat gaaacaactc aagcgccggc gctatactgg ctggggccgg 2100

ctttctcgca agctcatcaa tgggattcgg gataagcaat caggcaagac aattttggac 2160

ttcctcaaat ccgacggatt cgcaaatagg aattttatgc agctgataca tgacgactct 2220

ttgacattca aagaagacat acagaaggct caggtgtccg gccaaggaga ttctttgcac 2280

gagcatatcg ctaacttggc aggtagcccc gccataaaaa agggcattct tcaaacggta 2340

aaagttgttg acgaactcgt gaaggttatg ggccgtcata agccggaaaa cattgttatt 2400

gaaatggcta gggaaaatca gacgacccag aagggacaga aaaatagcag ggagcggatg 2460

aagagaattg aagagggaat taaggagctt ggatctcaga ttcttaagga gcaccctgtg 2520

gagaacaccc aacttcagaa tgaaaagctc tacctttact accttcaaaa cggccgggat 2580

atgtacgtcg atcaggaact tgacattaac cggttgagcg attatgacgt tgaccatatt 2640

gtgccccaat ctttccttaa agacgactct atcgacaata aagtgctgac gcgcagcgat 2700

aaaaatcgcg gtaagtcgga taatgtcccg tcggaagagg tggttaaaaa aatgaagaac 2760

tattggaggc aactcctgaa tgccaagctg atcactcaga ggaaattcga caatctcacc 2820

aaggcagaaa ggggtggact tagcgagctc gacaaggccg gttttatcaa aagacagctg 2880

gtggagacac gccaaatcac caaacacgtt gcccagatcc tggattcgag gatgaacacg 2940

aagtatgacg agaacgacaa gttgattagg gaagtcaagg tcatcacttt gaagtccaag 3000

ctggtgagcg actttcgcaa agacttccag ttttacaaag tcagggaaat taataactac 3060

caccacgccc acgacgccta ccttaacgcc gtggttggca cagcactcat caagaaatac 3120

cctaagctcg aatctgagtt cgtctatggc gactataagg tctacgacgt tagaaaaatg 3180

atcgcgaaat ctgagcagga aataggcaag gcaactgcca agtacttctt ctattccaat 3240

atcatgaact tttttaagac ggagattacc ctggcgaatg gtgagatccg caagcgccct 3300

ttgattgaga caaacggaga aacaggagag atcgtatggg acaaagggcg ggactttgct 3360

actgttagga aggtgctctc tatgccacaa gttaacattg tcaaaaaaac tgaagtgcag 3420

acaggtgggt ttagcaagga atctatcctg ccgaagagga actctgacaa gctgatcgcc 3480

cgcaagaaag attgggatcc gaaaaagtac ggaggattcg actcccccac agttgcgtac 3540

tccgtgcttg tcgtggccaa agtggagaag ggcaagtcta agaagctcaa gagcgtcaaa 3600

gagttgttgg ggatcacgat tatggagcgg tcgtctttcg aaaagaatcc gatagatttt 3660

ctcgaggcca agggttataa agaagtcaag aaggatctta tcatcaagct ccctaagtac 3720

tccctctttg agcttgaaaa cggacggaaa agaatgctgg cttcagcggg tgaacttcag 3780

aagggtaatg aactcgctct gccctcaaaa tatgtgaatt tcctttacct ggcatcacac 3840

tatgagaagc ttaaggggtc cccagaggac aacgagcaga agcaactgtt cgttgaacaa 3900

cacaagcact accttgacga gattatcgag caaatcagcg agtttagcaa gcgcgttata 3960

ctggcagacg caaatcttga taaggtcctt agcgcctaca acaagcatag agacaaaccc 4020

atccgggagc aggccgagaa cattattcat ctcttcacct tgacgaatct tggggccccg 4080

gccgcgttca agtacttcga tactaccata gacagaaagc gctatacatc gacaaaggaa 4140

gttcttgacg ccacgctgat ccaccaaagt ataacaggcc tctatgagac acgcatcgac 4200

ctttcgcagt tgggcggtga ccgccccaaa aagaagagga aagttggcgg gtga 4254

<210> 6

<211> 1706

<212> DNA

<213> Artificial sequence (non)

<400> 6

aaaaaattac cacatatttt ttttgtcaca cttgtttgaa gtgcagttta tctatcttta 60

tacatatatt taaactttac tctacgaata atataatcta tagtactaca ataatatcag 120

tgttttagag aatcatataa atgaacagtt agacatggtc taaaggacaa ttgagtattt 180

tgacaacagg actctacagt tttatctttt tagtgtgcat gtgttctcct ttttttttgc 240

aaatagcttc acctatataa tacttcatcc attttattag tacatccatt tagggtttag 300

ggttaatggt ttttatagac taattttttt agtacatcta ttttattcta ttttagcctc 360

taaattaaga aaactaaaac tctattttag tttttttatt taataattta gatataaaat 420

agaataaaat aaagtgacta aaaattaaac aaataccctt taagaaatta aaaaaactaa 480

ggaaacattt ttcttgtttc gagtagataa tgccagcctg ttaaacgccg tcgacgagtc 540

taacggacac caaccagcga accagcagcg tcgcgtcggg ccaagcgaag cagacggcac 600

ggcatctctg tcgctgcctc tggacccctc tcgagagttc cgctccaccg ttggacttgc 660

tccgctgtcg gcatccagaa attgcgtggc ggagcggcag acgtgagccg gcacggcagg 720

cggcctcctc ctcctctcac ggcacggcag ctacggggga ttcctttccc accgctcctt 780

cgctttccct tcctcgcccg ccgtaataaa tagacacccc ctccacaccc tctttcccca 840

acctcgtgtt gttcggagcg cacacacaca caaccagatc tcccccaaat ccacccgtcg 900

gcacctccgc ttcaaggtac gccgctcgtc ctcccccccc ccccctctct accttctcta 960

gatcggcgtt ccggtccatg gttagggccc ggtagttcta cttctgttca tgtttgtgtt 1020

agatccgtgt ttgtgttaga tccgtgctgc tagcgttcgt acacggatgc gacctgtacg 1080

tcagacacgt tctgattgct aacttgccag tgtttctctt tggggaatcc tgggatggct 1140

ctagccgttc cgcagacggg atcgatttca tgattttttt tgtttcgttg catagggttt 1200

ggtttgccct tttcctttat ttcaatatat gccgtgcact tgtttgtcgg gtcatctttt 1260

catgcttttt ttttgtcttg gttgtgatga tgtggtgtgg ttgggcggtc gttcattcgt 1320

tctagatcgg agtagaatac tgtttcaaac tacctggtgt atttattaat tttggaactg 1380

tatgtgtgtg tcatacatct tcatagttac gagtttaaga tggatggaaa tatcgatcta 1440

ggataggtat acatgttgat gtgggtttta ctgatgcata tacatgatgg catatgcagc 1500

atctattcat atgctctaac cttgagtacc tatctattat aataaacaag tatgttttat 1560

aattattttg atcttgatat acttggatga tggcatatgc agcagctata tgtggatttt 1620

tttagccctg ccttcatacg ctatttattt gcttggtact gtttcttttg tcgatgctca 1680

ccctgttgtt tggtgttact tctgca 1706

<210> 7

<211> 569

<212> DNA

<213> Artificial sequence (non)

<400> 7

tcaaaaagag gtatgctatg aagcagcgta ttacagtgac agttgacagc gacagctatc 60

agttgctcaa ggcatatatg atgtcaatat ctccggtctg gtaagcacaa ccatgcagaa 120

tgaagcccgt cgtctgcgtg ccgaacgctg gaaagcggaa aatcaggaag ggatggctga 180

ggtcgcccgg tttattgaaa tgaacggctc ttttgctgac gagaacaggg gctggtgaaa 240

tgcagtttaa ggtttacacc tataaaagag agagccgtta tcgtctgttt gtggatgtac 300

agagtgatat tattgacacg cccgggcgac ggatggtgat ccccctggcc agtgcacgtc 360

tgctgtcaga taaagtctcc cgtgaacttt acccggtggt gcatatcggg gatgaaagct 420

ggcgcatgat gaccaccgat atggccagtg tgccggtctc cgttatcggg gaagaagtgg 480

ctgatctcag ccaccgcgaa aatgacatca aaaacgccat taacctgatg ttctggggaa 540

tataaatgtc aggctccctt atacacagc 569

<210> 8

<211> 31

<212> DNA

<213> Artificial sequence (non)

<400> 8

gctggtctca ggaaacagac cttttcgacc t 31

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence (non)

<400> 9

tctagaagct tggcactgg 19

<210> 10

<211> 28

<212> DNA

<213> Artificial sequence (non)

<400> 10

aggctcgagc aagacgatct acccgagc 28

<210> 11

<211> 33

<212> DNA

<213> Artificial sequence (non)

<400> 11

gaactcgagc cgatctagta acatagatga cac 33

<210> 12

<211> 47

<212> DNA

<213> Artificial sequence (non)

<400> 12

acccgcgcgc tgtcgcttgt gtagagacca ttggcggccg cattagg 47

<210> 13

<211> 48

<212> DNA

<213> Artificial sequence (non)

<400> 13

cttgctattt ctagctctaa aactgagacc gtcgacctgc agactggc 48

<210> 14

<211> 25

<212> DNA

<213> Artificial sequence (non)

<400> 14

acaagtttgt acaaaaaagc aggct 25

<210> 15

<211> 25

<212> DNA

<213> Artificial sequence (non)

<400> 15

acccagcttt cttgtacaaa gtggt 25

<210> 16

<211> 74

<212> DNA

<213> Artificial sequence (non)

<400> 16

cccgcgcgct gtcgcttgtg tgtcatccag tacaacatct tgttttagag ctagaaatag 60

caagttaaaa taag 74

<210> 17

<211> 74

<212> DNA

<213> Artificial sequence (non)

<400> 17

cccgcgcgct gtcgcttgtg tgatggccat cacggtggca tgttttagag ctagaaatag 60

caagttaaaa taag 74

<210> 18

<211> 73

<212> DNA

<213> Artificial sequence (non)

<400> 18

cccgcgcgct gtcgcttgtg tgaagtatta ctactcgatg gttttagagc tagaaatagc 60

aagttaaaat aag 73

<210> 19

<211> 74

<212> DNA

<213> Artificial sequence (non)

<400> 19

cccgcgcgct gtcgcttgtg tgctaatggc atgggaaacc agttttagag ctagaaatag 60

caagttaaaa taag 74

<210> 20

<211> 74

<212> DNA

<213> Artificial sequence (non)

<400> 20

cccgcgcgct gtcgcttgtg tgtcaggccg acgatgacgc agttttagag ctagaaatag 60

caagttaaaa taag 74

<210> 21

<211> 73

<212> DNA

<213> Artificial sequence (non)

<400> 21

cccgcgcgct gtcgcttgtg tgtgtacggg aacttcttcg gttttagagc tagaaatagc 60

aagttaaaat aag 73

<210> 22

<211> 74

<212> DNA

<213> Artificial sequence (non)

<400> 22

cccgcgcgct gtcgcttgtg tgccaaccag tcgtccaacg cgttttagag ctagaaatag 60

caagttaaaa taag 74

<210> 23

<211> 60

<212> DNA

<213> Artificial sequence (non)

<400> 23

cacattgccc agctaactcg aacgcgacca acttataaac ccgcgcgctg tcgcttgtgt 60

<210> 24

<211> 70

<212> DNA

<213> Artificial sequence (non)

<400> 24

actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt gctatttcta 60

gctctaaaac 70

<210> 25

<211> 17

<212> DNA

<213> Artificial sequence (non)

<400> 25

ctgtgatggg ctggatg 17

<210> 26

<211> 18

<212> DNA

<213> Artificial sequence (non)

<400> 26

ctgcagaatt gcccttcg 18

<210> 27

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 27

gccgaaagcg accaaatctc 20

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 28

cgagctgtca tccaaaccca 20

<210> 29

<211> 19

<212> DNA

<213> Artificial sequence (non)

<400> 29

ctcctcccaa cgccattga 19

<210> 30

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 30

tcacgatcac acgaggttga 20

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 31

cttgaagact gggactgcgt 20

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 32

gctcccgcaa agtccttagt 20

<210> 33

<211> 22

<212> DNA

<213> Artificial sequence (non)

<400> 33

atgccatgag atcttgtctt gc 22

<210> 34

<211> 21

<212> DNA

<213> Artificial sequence (non)

<400> 34

ttttcgttgg ttgcacggtt t 21

<210> 35

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 35

gagagagcca ctagcagcag 20

<210> 36

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 36

ccactcatcg acgcgtatca 20

<210> 37

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 37

ccgagtcaaa aagaggggga 20

<210> 38

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 38

ataacatttt tgggccgccg 20

<210> 39

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 39

gtccgagctt ggaaggagaa 20

<210> 40

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 40

caggtgccac gaagatctga 20

Claims

1. A plasmid vector for rice comprising a gene expression cassette comprising a Cas9 protein, a first promoter, a nucleotide sequence comprising a suicide gene sequence, a gRNA scaffold element and a termination signal, and at least one first enzyme cleavage site located 5 'of the nucleotide sequence comprising the suicide gene sequence and at least one second enzyme cleavage site located 3' of the nucleotide sequence comprising the suicide gene sequence; and the first and second enzyme cleavage sites are absent from other positions of the plasmid vector;

wherein the first promoter is located upstream of the termination signal, the nucleotide sequence comprising a suicide gene sequence and the gRNA scaffold element and are both located between the first promoter and the termination signal;

obtaining at least one I element which comprises an I-1 nucleotide sequence, an I-2 nucleotide sequence and an I-3 nucleotide sequence from 5 'end to 3' end in sequence;

wherein the I-1 nucleotide sequence is identical to a sequence which is 20bp or more upstream of the 5' end from the first enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site;

the I-2 nucleotide sequence is a target nucleotide sequence which is consistent with a part of nucleotide sequences on plant endogenous genes;

the I-3 nucleotide sequence is consistent with a sequence which is 20bp above the downstream of the 3' end from the second enzyme cutting site of the plasmid vector after being linearized by the first enzyme cutting site and the second enzyme cutting site;

exchanging said I element by homologous recombination respectively onto said plasmid vector to obtain a targeting vector in which said I element is located between said first promoter and a termination signal and said I-2 nucleotide sequence and said gRNA scaffold are transcriptionally fused;

the amino acid sequence of the Cas9 protein is shown as SEQ ID No. 4; the nucleotide sequence of the gene for encoding the Cas9 protein is shown as SEQ ID No. 5;

the nucleotide sequence containing the suicide gene sequence is shown as SEQ ID No. 7;

the nucleotide sequence of the gRNA scafffold element is shown as SEQ ID No. 3;

the plasmid vector further comprises a marker gene expression cassette;

the marker gene expression cassette comprises a selection gene expression cassette and a reporter gene expression cassette;

the selection gene expression cassette comprises a selection gene expression cassette for use in a plant;

the reporter gene is selected from at least one of beta galactosidase gene, luciferase gene, fluorescent protein gene and seed coat color gene.

2. The plasmid vector of claim 1 wherein the selection gene expression cassette is a hygromycin resistance gene expression cassette or a G418 resistance gene expression cassette.

3. The plasmid vector of claim 1 wherein the reporter gene is selected from at least one of the fluorescent protein genes.

4. The plasmid vector according to claim 3, wherein the fluorescent protein gene is at least one selected from the group consisting of a green fluorescent protein gene, a red fluorescent protein gene, a cyan fluorescent protein gene, a blue fluorescent protein gene, and a yellow protein gene.

5. The plasmid vector of claim 1, wherein the nucleotide sequence of the first promoter is selected from the group consisting of nucleotide sequences specific to rice.

6. A plasmid vector according to claim 5, characterized in that the first promoter is an RNA polymerase type III promoter.

7. The plasmid vector of claim 6, wherein the nucleotide sequence of the first promoter is the nucleotide sequence shown as SEQ ID No. 1.

8. The plasmid vector of claim 1, wherein the nucleotide sequence of the termination signal is the nucleotide sequence shown as SEQ ID No. 2.

9. A plasmid vector according to any of claims 1-8, characterized in that the gene expression cassette comprising the expressed Cas9 protein comprises a second promoter from 5 'end to 3' end, a gene encoding the Cas9 protein and a first terminator.

10. The plasmid vector of claim 1 wherein the second promoter is an RNA polymerase II type promoter.

11. The plasmid vector of claim 10, wherein the nucleotide sequence of the second promoter is set forth in SEQ ID No. 6.

12. The plasmid vector according to claim 10, wherein the nucleotide sequence of the first terminator is the 8 th to 260 th nucleotide sequence of genebank accession number FJ 362600.1.

13. The plasmid vector of claim 1 wherein the selection gene expression cassette comprises a third promoter from 5 'to 3', a selection gene, and a second terminator.

14. A plasmid vector according to claim 13, wherein the third promoter is an RNA polymerase type II promoter.

15. The plasmid vector of claim 13, wherein the nucleotide sequence of the third promoter is the 10382 th to 11162 th nucleotide sequence of genebank accession number FJ 362600.1.

16. The plasmid vector of claim 13 wherein the nucleotide sequence of the second terminator is the 8 th to 260 th nucleotide sequence of genebank accession number FJ 362600.1.

17. The plasmid vector of claim 1 wherein the reporter expression cassette comprises a fourth promoter from 5 'to 3', a reporter gene, and a third terminator.

18. The plasmid vector of claim 17, wherein the fourth promoter is an RNA polymerase II type promoter; the nucleotide sequence of the fourth promoter is the 10382 to 11162 nucleotide sequences in genebank accession number FJ 362600.1.

19. The plasmid vector of claim 17, wherein the nucleotide sequence of the third terminator is the 8 th to 260 th nucleotide sequence of genebank accession number FJ 362600.1.

20. A method of establishing a mutant population of plants obtained by targeting at least one gene endogenous to a plant, comprising the steps of:

the I-2 nucleotide sequence is a target nucleotide sequence which is consistent with a part of nucleotide sequences on the plant endogenous gene;

step two: exchanging said I element by homologous recombination respectively onto said plasmid vector of any one of claims 1-19 to obtain a targeting vector in which said I element is located between said first promoter and a termination signal and said I-2 nucleotide sequence and said gRNA scaffold are transcriptionally fused;

21. The method of claim 20, wherein the I-1 nucleotide sequence is identical to a sequence 50-80bp upstream from the 5' end of the first cleavage site of the plasmid vector linearized by the first cleavage site and the second cleavage site;

the I-3 nucleotide sequence is consistent with a sequence which is 50-80bp from the second enzyme cutting site of the plasmid vector after being linearized by the first enzyme cutting site and the second enzyme cutting site to the downstream of the 3' end.

22. The method of claim 20, wherein the target nucleotide sequence is determined by:

2) searching the coding sequence of the plant endogenous gene or the reverse complementary sequence thereof for a PAM (Polyacrylamide) module sequence capable of being recognized by the Cas9 protein, and determining 17-21 nucleotide sequences upstream of the 5 'end of the PAM module sequence as the target nucleotide sequence under the condition of ensuring that 17-21 nucleotide sequences upstream of the 5' end of the PAM module sequence are specific sequences in the genome.

23. The method of claim 20, wherein when the Cas9 protein is the amino acid sequence shown in SEQ ID No.4, the PAM recognition module is one of 5 ' -NGG-3 ', 5 ' -NGA-3 ', 5 ' -GAGN-3 ', 5 ' -AAGN-3 ', the target nucleotide sequence is 17 to 21 nucleotide sequences upstream of the 5 ' end of the PAM module, eliminating nucleotide sequences containing five consecutive ts;

wherein N is one of A, G, C and T.

24. Method according to any of claims 20-23, characterized in that at least one of said I-th elements is obtained by:

I) obtaining at least one oligonucleotide sequence comprising a nucleotide sequence II-1, a nucleotide sequence II-2, and a nucleotide sequence II-3 in that order from a 5 'end to a 3' end; wherein the II-1 nucleotide sequence is identical to a sequence which is 20bp or more upstream of the 5' end from the first enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site;

the II-2 nucleotide sequence comprises a target nucleotide sequence identical to a partial nucleotide sequence on the endogenous gene of the plant;

the II-3 nucleotide sequence is consistent with a sequence which is 20bp above the downstream of the 3' end from the second enzyme cutting site of the plasmid vector after being linearized by the first enzyme cutting site and the second enzyme cutting site;

II) obtaining an upstream primer and a downstream primer; wherein the content of the first and second substances,

the upstream primer is consistent with a sequence which is more than 20bp from the first enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site to the upstream of the 5' end;

the downstream primer is reversely complementary with a sequence which is more than 20bp from the second enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site to the downstream of the 3' end;

25. The method of claim 24, wherein the II-1 nucleotide sequence is identical to a sequence 20-35bp upstream from the 5' end of the first cleavage site of the plasmid vector linearized by the first cleavage site and the second cleavage site;

the II-3 nucleotide sequence is consistent with a sequence which is 20-35bp from the second enzyme cutting site of the plasmid vector after being linearized by the first enzyme cutting site and the second enzyme cutting site to the downstream of the 3' end;

the upstream primer is consistent with a sequence which is 50-80bp from the first enzyme cutting site of the plasmid vector linearized by the first enzyme cutting site and the second enzyme cutting site to the upstream of the 5' end;

and the downstream primer is reversely complementary with a sequence which is 50-80bp from the second enzyme cutting site of the plasmid vector after being linearized by the first enzyme cutting site and the second enzyme cutting site to the downstream of the 3' end.