CN104846009B - A kind of construction method of Rice Engineering maintainer and its application - Google Patents
A kind of construction method of Rice Engineering maintainer and its application Download PDFInfo
- Publication number
- CN104846009B CN104846009B CN201510253259.1A CN201510253259A CN104846009B CN 104846009 B CN104846009 B CN 104846009B CN 201510253259 A CN201510253259 A CN 201510253259A CN 104846009 B CN104846009 B CN 104846009B
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- external source
- reporter gene
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of construction method of Rice Engineering maintainer, including：Step 1: the transgenic line containing external source reporter gene will be obtained on the chromosome of external source reporter gene site-directed integration to wild rice, wherein, the external source reporter gene being capable of close linkage heredity with wild type sterility changing gene；And, enter step 2 afterwards, Step 2: by the transgenic line obtained in step 1 and the common male nuclear sterile strain cross of homozygous recessive rice, it is required Rice Engineering maintainer to screen the strain containing external source reporter gene, wherein, the common male nuclear sterile strain of the homozygous recessive rice is sterility changing gene mutation body strain.The invention also discloses application of the Rice Engineering maintainer in rice breeding.The present invention solves the restricted problem of transformation receptor material by the chromosome of external source reporter gene site-directed integration to wild rice.The Rice Engineering maintainer of the present invention can be used in the common Recessive male sterility system breeding of rice.
Description
Technical field
The present invention relates to a kind of construction method of Rice Engineering maintainer and its application.
Background technology
Rice heterosis utilization is to improve the maximally effective approach of rice yield." three line method " hybrid rice is to germ plasm resource
Utilization rate is low and the hybrid seeding security constraint of " two line method " hybrid rice is to influence hybrid rice plantation popularizing area to enter one
An important factor for step expands.New breeding technique is invented, develops the rice of hybrid seeding safety high to germ plasm resource utilization rate
Heterosis utilization method is the direction of hybrid rice development.Common recessive cytoblast sterile material sterility is stable, hybrid seeding peace
Entirely, it is easy to prepare high yield, high-quality, how anti-combination；The shortcomings that common is the batch breeding that can not realize male-sterile seed.
For the breeding problem of recessive nucleus male sterility material, breeding man also successively proposes a variety of solutions, main bag
Include：(1) according to male sterility mechanism, by the metabolic intermediate matter (such as amino acid, flavones, the aliphatic acid thing that apply missing
Matter), mutation sterile plant is recovered fertility and is bred；(2) in male sterile plant, (such as inductivity) is controlled to open using condition
Mover driving restoring gene expression, when giving suitable promoter expression condition, restoring gene expression, fertility restorer
And bred；During condition without giving the expression of suitable promoter, restoring gene is not expressed, as sterile line.In addition,
The inhibitory factor expression of condition control promoter driving crop endogenous fertile gene can also be utilized and reach above-mentioned same mesh
's.The above scheme has obtained different degrees of application in the actual production of Different Crop, but due to the fertility of sterile line
Conversion can not be accurately controlled completely, or in sterile line containing transgene component and thus cause in cenospecies containing turning base
Because the problems such as, be not all widely used.
With the progress of Molecular design breeding thought and technology, develop can accurately control without transgene component not
The reproduction technique for being is educated, the problem of turning into MOLECULE DESIGN crossbreeding technology field urgent need to resolve.It is on June 11st, 1993, external
Biotech company PLANT GENETIC SYSTEM propose a PCT Patent Application, and the patent proposes following technological thought：
Lethal (abortion) gene of restoring gene, pollen and the selection markers that chained list reaches are imported in recessive male sterile plants
Three sets of elements of gene (such as fluorescence protein gene), the maintainer of the male sterile plants can be obtained, maintainer is by being selfed just
The breeding of sterile line and maintainer can be realized.2002, Perez-Prat et al. propose, can by homozygosis male not
Educate and two sets of elements of restoring gene and riddled basins that chained list reaches are imported in plant, be derived from male sterility plant
The maintainer of strain, maintainer can breeding male sterile lines and maintainers with sterile plant hybridization.Two methods are proposed using accurate
Molecular biotechnology means, solve the application problem of recessive nucleus male sterility gene and sterile material, it is miscellaneous to carry out MOLECULE DESIGN
Breeding is handed over to provide technological frame.Comparatively speaking, three element systems consider that pollen escape and transgenosis ecological risk are asked
Topic, it is more careful compared with two-element system thinking.2006, Dupont Pioneer Electronic Corp. was on three element systems technology thinkings basis
On, the seed production technique based on Genetic Sterility mutant material is realized in corn first, and be named as Seed Production
Technology (SPT) technology.In September, 2010, under the support of Chinese science and technology portion " national high-tech research development plan ", three
Element system technological thought confirmed and applied in rice, and be referred to as " the sterility cross-bred breeding technique of intelligence " or
" third generation hybrid rice technology ".By project implementation, the sterile MOLECULE DESIGN technology of intelligence will be effectively promoted in crop breeding
In research application, make China continue to keep advantage leading in the world in paddy rice cross breeding breeding field, for promote Biology Breeding industry
Development technology and product support are provided.
For from thinking, SPT technologies are almost ideal, can both realize the breeding of common line with genic sterile, can eliminate again
People for transgenosis risk worry because there is no the transgenic element of external source in filial generation plant, in the absence of transgenosis
Bio-safety problem.But following problem can be run into actual mechanical process：(1) transformation receptor materials are restricted,
Because complementing vector will be transformed into sterile plant, therefore only selects the young fringe evoked callus of male sterile rice plant；
Materials are very limited, and the time of effectively drawing materials is very short；(2) phenotype of the importing of restoring gene to mutation sterile plant
Recover not very good, influenceed for follow-up hybrid seed yield very big.Reason may be with carrier sequence in acceptor gene group
Insertion point it is relevant, the feature of flanking sequence might have influence to the expression of restoring gene.
The content of the invention
One object of the present invention overcome the deficiencies in the prior art, and the advantages of at least will be described later is provided.
Another object of the present invention is to provide a kind of construction method of Rice Engineering maintainer, and the present invention passes through CRISPR/
External source reporter gene is incorporated on the chromosome of wild rice by Cas9 systems, solves that transformation receptor material is restricted to ask
Topic.
A further object of the invention improves application of the Rice Engineering maintainer in rice breeding, rice work of the invention
Journey maintainer can be used in the common Recessive male sterility system breeding of rice, and the Rice Engineering maintainer product after cultivation can machinery
Change, scale application are used in the crossbreeding of the common line with genic sterile of rice, and process is simple and convenient to operate.
Therefore, technical scheme provided by the invention is：
A kind of construction method of Rice Engineering maintainer, including：
Step 1: it will obtain reporting base containing external source on the chromosome of external source reporter gene site-directed integration to wild rice
The transgenic line of cause, wherein, the external source reporter gene being capable of close linkage heredity with wild type sterility changing gene；And
Enter step 2 afterwards,
It is Step 2: the transgenic line obtained in step 1 and the common male nuclear sterile strain of homozygous recessive rice is miscellaneous
To hand over, strain of the screening containing the external source reporter gene is required Rice Engineering maintainer, wherein, the homozygous recessive water
The common male nuclear sterile strain of rice is the sterility changing gene mutation body strain.
Preferably, the construction method of described Rice Engineering maintainer, also includes before the step 1：Pass through figure
Position clone determines the position of saltant type sterility changing gene on chromosome in the common male nuclear sterile strain of homozygous recessive rice
Put.
Preferably, in the construction method of described Rice Engineering maintainer, in the step 1, by external source reporter gene
The specific method of site-directed integration to transgenic line of the acquisition containing external source reporter gene on the chromosome of wild rice includes：
(1.1) the upstream and downstream sequence area of sterility changing gene on wild rice chromosome is analyzed, takes NGG in the region
20bp above designs the primer sequence with the target site regions pair as target site region, before primer upstream sequence
Add GCAA, AAAC is added before primer downstream sequence, obtains primer
Upstream sequence：5’–GCAA NNNNNNNNNNNNNNNNNNNN–3’(SEQ ID NO:1)
Downstream sequence：5’–AAACNNNNNNNNNNNNNNNNNNNN–3’(SEQ ID NO:2)；
(1.2) according to CRISPR/Cas9 systems, the primer sequence in step (1.1) is building up on pP1C.1 carriers and obtained
To gene integration carrier；
(1.3) external source reporter gene is building up on expression vector and obtains recombinant expression carrier；
(1.4) by the recombinant expression carrier and the gene integration carrier cotransformation wild rice, transgenosis is obtained
Plant；
(1.5) primer is designed in target site both wings, is expanded with transfer-gen plant genome, if amplified production fragment is big
Small roughly equal with external source reporter gene clip size, then it is the Transgenic Rice strain containing external source reporter gene to judge the plant
System, and pinpoint insertion in target site and integrate.
Preferably, in the construction method of described Rice Engineering maintainer, in the step (1.3), the expression carries
Body uses over-express vector.
Preferably, in the construction method of described Rice Engineering maintainer, in the recombinant expression carrier, the external source
Rice endosperm specific promoter Gt1 is built with before the nucleotide sequence of reporter gene.
Even more preferably, in the construction method of described Rice Engineering maintainer, the sterility changing gene is rice
EAT1 genes.
Even more preferably, in the construction method of described Rice Engineering maintainer, the primer sequence in the step (1.1)
For：
Upstream sequence：5’–GCAAGAGCGAGAGGGGAAGCATTT–3’(SEQ ID NO:3)
Downstream sequence：5’–AAACAAATGCTTCCCCTCTCGCTC–3’(SEQ ID NO:4).
Even more preferably, in the construction method of described Rice Engineering maintainer, the external source reporter gene is red glimmering
It is any one in signal gene, red fluorescent protein marker gene, green fluorescence protein gene or blue-fluorescence marker gene
Kind.
Application of the Rice Engineering maintainer in rice breeding, the Rice Engineering maintainer are obtained by any described method
.
The present invention comprises at least following beneficial effect：
External source reporter gene is incorporated on the chromosome of wild rice by the present invention by CRISPR/Cas9 systems, is solved
Determine the restricted problem of transformation receptor material.The site-directed integration of exogenous sequences has considered sterility changing gene and screening is reported
Accuse the expression of gene, the uncertainty of destination gene expression caused by avoiding the random integration site of former transgenosis.
The Rice Engineering maintainer of the present invention can be used in the common Recessive male sterility system breeding of rice, the water after cultivation
Rice engineering maintainer product can mechanization, scale application be used in the crossbreeding of the common line with genic sterile of rice, and process it is simple,
It is easy to operate.
Definition
For the ease of understanding the present invention, a large amount of terms and phrase are defined
" reverse complemental " in the present invention, refer to the nucleotide sequence associated by basepairing rule.For example, sequence " 5 '-
A-T-G-3 ' " and sequence " 5 '-C-A-T-3 ' " reverse complemental.
Term " gene " refers to a kind of DNA molecular, and gene is the main matter of hereditary variation, is the base for controlling biological character
This hereditary unit, the base sequence of coding RNA or protein turns into structural gene in gene, and alleged gene is knot in the present invention
Structure gene.
" wild type gene " refers to a kind of gene separated from source, " wild type gene " of the invention be first with
Rice sterile mutant obtains the position of mutator by map based cloning method, and the position is then obtained from rice wild type
The sequence of the corresponding gene at place, it is " wild type gene ".And " gene of mutation " refers to a kind of gene, with " wild type base
Cause " is compared, and it has the modification of sequence and/or functional character (feature changed).
" allele " refers generally to control a pair of bases of relativity in the same position of pair of homologous chromosome
Cause.Its possibly be present in two or more genes in chromosome particular seat one.Homozygous recessive in the present invention
Sterility changing gene in the common male nuclear sterile strain of rice and the sterility changing gene in wild rice are allele.
" carrier " is the nucleic acid molecules for referring to transport another connected nucleic acid, and a type of carrier is " matter
Grain ", plasmid is that other DNA fragmentations can connected circular double stranded DNA ring.Another type of carrier is viral vector, its
Other DNA fragmentations can be connected to viral genome.Some vector integrations are able to and host into host cell gene group
Genome replicates together.Also, some carriers can instruct the expression for the gene being operatively connected with it, what is typically used is such
Expression vector is plasmid form.In the present invention, " plasmid " and " carrier " can be used interchangeably.
" recombinant vector " refers to the expression vector for being connected to gene.In the present invention, can be used interchangeably " recombinant plasmid "
" recombinant vector ".
Primer, also known as introduction.It is a bit of single stranded DNA or RNA, as the starting point of DNA replication dna, in nucleic acid synthetic reaction
When, the polynucleotide chain that is worked as the starting point that each polynucleotide chain is extended, on 3 '-OH of primer, core
Thuja acid is synthesized in the form of diester chain, therefore 3 '-OH of primer, it is necessary to is free.Why need primer be because
Archaeal dna polymerase can only be added to new nucleotides on existing DNA in DNA synthesis.Primer is artificial synthesized two sections
Oligonucleotide sequence, a primer and a DNA profiling chain of area-of-interest one end are complementary, another primer and region of interest
Another DNA profiling chain of the domain other end is complementary.The chain of the nucleotide sequence of encoding proteins matter amino acid information is carried on DNA
Referred to as positive-sense strand, also known as coding strand.Another chain nucleotide sequence is complementary with positive-sense strand, referred to as antisense strand.Typically will be with justice
A complementary primer of chain turns into sense primer, and a complementary primer is referred to as anti-sense primer with antisense strand.
Further advantage, target and the feature of the present invention embodies part by following explanation, and part will also be by this
The research and practice of invention and be understood by the person skilled in the art.
Brief description of the drawings
Fig. 1 is the principle flow chart of the keeping method of Rice Engineering holding material and sterile material traditionally；
Fig. 2 is the principle flow chart that the Rice Engineering of the present invention keeps the keeping method of material and sterile material；
Fig. 3 is the plasmid map of the pP1C.2 carriers in CRISPR/Cas9 systems；
Fig. 4 is the plasmid map of the pP1C.1 carriers in CRISPR/Cas9 systems；
Fig. 5 is the plasmid map of pJIT163-hGFP carriers；
Fig. 6 is the plasmid map of pSB130M carriers；
Fig. 7 is that transgenic paddy rice PCR primer detects gel electrophoresis figure, and wherein T is the amplification of transgenic line, and CK is
Positive control；
(a) is the spike of rice photo of transgenic line in Fig. 8, and (b) is the photo of transgenic paddy rice seed.
Embodiment
The present invention is described in further detail below in conjunction with the accompanying drawings, to make those skilled in the art with reference to specification text
Word can be implemented according to this.
As shown in figure 1, the experimental considerations of former holding Rice Engineering system is restoring gene and red fluorescence egg
White gene is gone in mutant together, allow mutant to recover fertility, and the chain red fluorescent protein base of restoring gene
Cause, a very big limitation of this thinking is exactly materials limitation, and sterile plant conversion must use young fringe callus induction, usually young fringe
Or so the 4th phase of development, and this growth period is very short.And the thinking of the present invention is, as shown in Fig. 2 utilizing genome editor's skill
Foreign gene fixed point is inserted in Plant Genome by art.The present invention provides a kind of structure side of Rice Engineering maintainer
Method, including：
Step 1: it will obtain reporting base containing external source on the chromosome of external source reporter gene site-directed integration to wild rice
The transgenic line of cause, wherein, the external source reporter gene being capable of close linkage heredity with wild type sterility changing gene；And
Enter step 2 afterwards,
It is Step 2: the transgenic line obtained in step 1 and the common male nuclear sterile strain of homozygous recessive rice is miscellaneous
To hand over, strain of the screening containing the external source reporter gene is required Rice Engineering maintainer, wherein, the homozygous recessive water
The common male nuclear sterile strain of rice is the sterility changing gene mutation body strain.
The present invention solves the materials limitation of conversion sterile mutant, external source using common wild rice as transformation receptor
The site-directed integration of fragment considered sterility changing gene and screen reporter gene expression, avoid former transgenosis with
The uncertainty of destination gene expression caused by machine integration site.
In above-mentioned scheme, also include before the step 1：Homozygous recessive rice is determined by map based cloning
The position of saltant type sterility changing gene on chromosome in common male nuclear sterile strain.This is the think of in forward genetics
Road.Certainly, in the research of reverse genetics, if specify that the position of sterility changing gene on chromosome, it is not required to
Want this step.
Preferably, in the step 1, will be obtained on the chromosome of external source reporter gene site-directed integration to wild rice
It must include containing the specific method of the transgenic line of external source reporter gene：
(1.1) the upstream and downstream sequence area of sterility changing gene on wild rice chromosome is analyzed, takes NGG in the region
20bp above designs the primer sequence with the target site regions pair as target site region, before primer upstream sequence
Add GCAA, AAAC is added before primer downstream sequence, obtains primer
Upstream sequence：5’–GCAANNNNNNNNNNNNNNNNNNNN–3’(SEQ ID NO:1)
Downstream sequence：5’–AAACNNNNNNNNNNNNNNNNNNNN–3’(SEQ ID NO:2)；
(1.2) according to CRISPR/Cas9 systems, the primer sequence in step (1.1) is building up on pP1C.1 carriers and obtained
To gene integration carrier；
(1.3) external source reporter gene is building up on expression vector and obtains recombinant expression carrier；
(1.4) by the recombinant expression carrier and the gene integration carrier corotation into rice wild rice plant,
Obtain transfer-gen plant；
(1.5) primer is designed in target site both wings, is expanded with transfer-gen plant genome, if amplified production fragment is big
It is small roughly equal with external source reporter gene clip size, then judge that the plant turns for the wild rice containing external source reporter gene
Gene strain.
Preferably, the expression vector uses over-express vector.
Preferably, in order that external source reporter gene is expressed in rice paddy seed, the nucleotides of the external source reporter gene
Rice endosperm specific promoter Gt1 is built with before sequence.
Preferably, in one embodiment of the invention, the sterility changing gene is rice EAT1 genes.
In above-mentioned scheme, the primer sequence that rice EAT1 genes match in step (1.1) is：
Upstream sequence：5’–GCAAGAGCGAGAGGGGAAGCATTT–3’(SEQ ID NO:3)
Downstream sequence：5’–AAACAAATGCTTCCCCTCTCGCTC–3’(SEQ ID NO:4)
Preferably, the external source reporter gene is red fluorescence marker gene, red fluorescent protein marker gene, green
Any one in fluorescence protein gene or blue-fluorescence marker gene.
Application of the Rice Engineering maintainer in rice breeding, the Rice Engineering maintainer are obtained by any described method
.
The present invention is not to be directed to some specific gene, as long as common male nuclear sterile gene can use this hair
Bright method carries out germplasm creation.The present invention is realized using following thinking：
1) applicant of the present invention obtains the common male nuclear sterile mutant (gene of homozygous recessive rice using radioinduction
Type is aa), positioned using the method for map based cloning and clone the sterility changing Gene A of the rice sterile line.
2) particular location according to the gene of clone on rice genome, the fertility in analyzing rice wild type gene group
The sequence of controlling gene A upstream and downstream, the integration site of selection design external source reporter gene.Realized by CRISPR/Cas9 systems
Fixed point insertion, by reporter gene site-directed integration to sterility changing gene flanking sequence, integration site will ensure external source reporter gene
After insertion with sterility changing gene can close linkage, isolate.
3) fluorescent screening marker gene R Expression elements are connected to another plant expression vector pSB130M (containing double T-
DNA on), carrier pSB130M-R is obtained.Screening reporter gene expression element includes rice endosperm specific promoter, fluorescent base
Because of total length reading frame and terminator sequence.
Using agriculture bacillus mediated transgenic method by targeting vector recombinant vector pP1C.1 and donor vehicle pSB130M-
Gt1-DsRed-CaMVTerm cotransformations are into rice wild type (genotype AA).It is successfully fixed to be screened by PCR method
Point integrates screening reporter gene R transfer-gen plant (genotype AAR), using transfer-gen plant as male parent and mutant (aa)
Hybridize, in F1 generation, by Fluirescence observation, the seed of the reporter gene R containing screening is exactly maintainer seed (genotype ARA), protect
It is that seed kind goes down can serve as male parent and mutant (aa) hybridization to hold, and carries out sterile line (aa) and maintainer (ARA) seed
Breeding.Male-sterile seed is free of fluorescent screening gene R, maintainer seed fluorogene R containing screening, can pass through fluorescence color sorting
Machine is sorted.
Embodiment 1
Various rice tissue culture medium prescriptions
Inducing culture NB：The a large amount of salinities of N6, the micro salinities of B5, N6 molysite, B5 vitamins, proline 0.5g/L, hydrolysis
Casein 0.3g/L, BA 0.1mg/L, sucrose 33.5g/L, agar powder 8.5g/L, adjust pH 6.0
Subculture medium J3：The a large amount of salinities of MS, 10 times of micro salinities of B5, J3 molysite FeSO4·7H2O41.8mg/L,
Na2EDTA55.9mg/L, DL vitamin (glycine 2.0mg/L, thiamine hydrochloride 1.0mg/L, puridoxine hydrochloride 1.0mg/L, cigarette
Sour 1.0mg/L, inositol 100mg/L), glutamine 0.3g/L, proline 0.5g/L, 2,4-D 2.5mg/L, maltose 30g/L,
Agar powder 8.5g/L, adjust pH 6.0
Co-culture base NBM：The a large amount of salinities of N6, the micro salinities of B5, N6 molysite, B5 vitamins, caseinhydrolysate 0.8g/L, 2,
4-D 2.5mg/L, maltose 30g/L, agar powder 8.5g/L, acetosyringone 0.1mM, adjust pH 5.6
Screening and culturing medium J3S：Subculture medium J3, head cytomycin 500mg/L, carboxylic become penicillin 400mg/L, hygromycin
50mg/L
Pre- differential medium Y：N6 is a large amount of, CuSO43mg/L, N6 molysite, B5 vitamins, glutamine 0.5g/L, proline
0.5g/L, caseinhydrolysate 0.3g/L, BA 3mg/L, NAA 1mg/L, sucrose 30g/L, sorbierite 20g/L, agar powder 8.5g/
L, pH 6.0, head cytomycin 500mg/L, carboxylic become penicillin 400mg/L
Differential medium D：The a large amount of salinities of N6,10 times of micro salinities of B5, D molysite (FeSO4·7H2O55.9mg/L,
Na2EDTA 74.5mg/L), DL vitamins, glutamine 0.5g/L, proline 0.5g/L, caseinhydrolysate 0.8g/L, BA
2mg/L, IAA 0.2mg/L, NAA 0.2mg/L, KT 2mg/L, maltose 30g/L, agar powder 8.5g/L, adjust pH 6.0, head
Cytomycin 500mg/L, carboxylic become penicillin 400mg/L
Root media R：MS salinities and vitamin, sucrose 15g/L, IAA 0.5mg/L, NAA 0.5mg/L, agar powder
8g/L, pH 6.0
In the present embodiment, the sterility changing gene is EAT1 (LOC_Os04g51070) gene, and homozygous recessive rice is general
The sequence led in male nuclear sterile mutant is compared with wild type, and there occurs base insertion.It is real by CRISPR/Cas9 systems
Now fixed point insertion, reporter gene fixed point is inserted into sterility changing gene flanking sequence, it is theoretically absolutely chain.In water
In rice, if chain rate is 99%, the physical distance of reporter gene and restoring gene is 250 × 103(about 250Kb),
Integration site selection is in the range of the 1000bp of fertile gene downstream in the present embodiment, i.e., within 1kb, between two genes without between
Every Genetic Performance isolates.
The design and synthesis of integration site specifically include：
1st, sterility changing gene EAT1 downstream sequences are analyzed, design primers F and R
Analyze in the range of fertile gene downstream sequence 1000bp, NGG (N A, T, C or G) is found in the region sequence, most
It is well AGG, takes the 20bp before NGG as target sequences.
The normal chain of Target sequences adds GCAA in 5', and minus strand adds AAAC in 5'.
The GCAA of its middle and upper reaches, the CAAA in downstream are the cohesive end that BbsI digestions are formed.
I.e.：
The synthetic primer of one of integration site is；
Upstream F：5’–GCAAGAGCGAGAGGGGAAGCATTT–3’(SEQ ID NO:3)
Downstream R：5’–AAACAAATGCTTCCCCTCTCGCTC–3’(SEQ ID NO:4)
Sequence after design is sent to trustworthy company's synthesis, purifying rank is PAGE.
2nd, pP1C.2 carriers are linearized, the collection of illustrative plates of pP1C.2 carriers is as shown in Figure 3
Using BbsI digestions pP1C.2 (ammonia benzyl resistance) carrier, 3.2kb fragment is reclaimed；
3rd, the structure of pP1C.2 carriers is recombinated
By primer upstream and downstream (SEQ ID NO:3 and 4) after positive minus strand oligos (100 μM) equal proportion mixing, it is heated to 95
DEG C, 3min, less than 40 DEG C are naturally cooled to, double-stranded DNA is prepared；By double-stranded DNA and the pP1C.2 carriers of digestion after purification
Fragment connection, conversion Escherichia coli, structure obtain recombinating pP1C.2 carriers.Recombinant vector is sequenced, confirms insetion sequence
Correctness.
Then EcoRI, NheI double digestion recombinant vector pP1C.2, about 520bp DNA fragmentation is reclaimed；
4th, the structure of pP1C.1 carriers is recombinated
The collection of illustrative plates of pP1C.1 carriers using EcoRI, XbaI double digestion pP1C.1 (kalamycin resistance) as shown in figure 4, carried
Body, reclaim carrier segments；The 520bp DNA fragmentations obtained in step 3 are carried out into T4DNA enzymes with the pP1C.1 after digestion to be connected,
Escherichia coli are converted, obtain recombinant vector pP1C.1, recombinant vector pP1C.1 is the CRISPR/Cas9 system plants built
Gene integration carrier.It is follow-up to carry out recombinant vector pP1C.1 conversion Agrobacteriums, then with pCAMBIA1300-Gt1-DsRED-
CaMVTerm carrier cotransformation Rice Callus, screening positive clone, sequence verification, integration site analysis etc..
Embodiment 2
The clone of rice Gt1 promoters and connection
Using oryza sativa genomic dna as template, primer GT1-F is utilized：5-aaAAGCTTCACCCTCAATATTTGG-3 (contains
HindIII restriction enzyme sites) (SEQ ID NO:5), GT1-R：5-aaGGATCCGTTGTTGTAGGACTAATG-3 (the enzymes containing BamH I
Enzyme site) (SEQ ID NO:6) gene order of Gt1 promoters, the base sequence of Gt1 promoters, are obtained by PCR clonal expansions
Row such as SEQ ID NO:Shown in 7, wherein,
PCR amplification system and program are as follows：
Pcr amplification reaction program：94 DEG C of pre-degeneration 5min；Then with 94 DEG C of denaturation, 40s；52 DEG C of annealing, 40s；72 DEG C are prolonged
Stretch, 2min, carry out 35 reaction cycles, last 72 DEG C of extensions 10min altogether.
Electrophoresis detection PCR results, reclaim purpose fragment, and with pMD18-T cloning vectors (TaKaRa) 16 DEG C be connected.Connection
Product picking monoclonal bacterium colony, is incubated overnight, extraction plasmid enzyme restriction identification through heat shock method transformed competence colibacillus cell Ecoli.DH5 α
Positive colony.Choosing positive colony (containing plasmid pMD18-T-Gt1) send company to be sequenced, and obtains that correct pMD18-T-Gt1 is sequenced
Carrier.
Connection
Correct carrier pMD18-T-Gt1 Hind III and the double digestions of BamH I will be sequenced, reclaim Gt1 fragments, such as Fig. 5
Shown pJIT163-hGFP HindIII and the double digestions of BamH I, reclaim carrier segments, obtained carrier segments and Gt1 fragments
Connection, obtain intermediate carrier pJIT163-Gt1-GFP.
The connection of DsRed fragments
The base sequence of red fluorescent protein gene such as SEQ ID NO:Shown in 8, cloned with Bam H I and the double digestions of Sma I
Carrier pMD-18T-DsRed (clone has red fluorescent protein gene, and this laboratory preserves) and intermediate carrier pJIT163-Gt1-
GFP, DsRed genetic fragments and carrier segments are reclaimed, two fragments spend night connection with T4 ligases 16, and connection product is through heat shock
Method transformed competence colibacillus cell Ecoli.DH5 α, picking monoclonal bacterium colony are incubated overnight, extraction plasmid enzyme restriction identification positive colony.I.e.
For pJIT163-Gt1-DsRed carriers.
DsRed Expression elements are connected to plant expression vector pSB130M
PSB130M plasmid maps as shown in fig. 6, with the HindIII and double digestion pSB130M of Sal I and with Hind III and
The double digestion pJIT163-Gt1-DsRed of Xho I (Sal I be isocaudarner with Xho I), are separately recovered carrier segments and Gt1-DsRed-
CaMV Term fragments, two fragments spend night connection with T4 ligases 16, and connection product is through heat shock method transformed competence colibacillus cell
Ecoli.DH5 α, picking monoclonal bacterium colony are incubated overnight, extraction plasmid enzyme restriction identification positive colony.It is follow-up to carry out recombinant vector
PSB130M-Gt1-DsRed-CaMVTerm converts Agrobacterium.
Embodiment 3
Using agriculture bacillus mediated transgenic method by targeting vector recombinant vector pP1C.1 and donor vehicle pSB130M-
Gt1-DsRed-CaMVTerm cotransformations are into rice wild type (genotype AA).
Agrobacterium mediation converted
The induction of Rice Callus and squamous subculture
Healthy seed is selected respectively and peels off glume, is placed in 37 DEG C of incubators and is stayed overnight.Seed is put into the triangle of sterilizing after taking out
In bottle, first with the ethanol surface sterilizing 5min that volume fraction is 75%, with aseptic water washing 1 time, 0.1%HgCl sterilization 12min,
With aseptic water washing 5 times, sodium hypochlorite stoste sterilization 40min is placed into, aseptic water washing 5 times, is dried on the filter paper of sterilizing,
(NB) is then seeded on inducing culture, allows the half of embryo to contact culture medium.Per 20, ware, it is placed at 25~26 DEG C and secretly trains
Support, with evoked callus.After 20 days, the callus of surface dry, compact structure is selected, removes the bud in grain and callus
Head is gone on subculture medium J3, and at this time nutrition is softened by absorption in grain, squamous subculture 1~2 time, and every time 20
My god.
Drawing LB plates, (by taking Agrobacterium EHA105 as an example, culture medium is LB+Kan 50mg/L+CHL 34mg/L+RIF 50mg/
L Agrobacterium EHA105) is activated, (EHA105 is LB+Kan 50mg/L+CHL 34mg/L+ to picking single bacterium colony stroke LB plates two days later
RIF 50mg/L) full ware, 28 DEG C of cultures 48 hours are standby, and Agrobacterium is washed to the co-cultivation base (NBM+As of 50ml liquid
In 0.1mM), OD600=0.5 is adjusted；Surface dry, compact structure are never selected in the callus of subculture or subculture 1~2 time
Callus, turn white in being air-dried on sterile filter paper to surface；Callus is transferred in bacterium solution and soaks 30min, every
5min rocks once.Bacterium water rinse 5 times it is not muddy to liquid, with sterilizing filter paper suck dry moisture, in air-dried on the filter paper of sterilizing to
Turn white on callus surface.Callus is transferred to and co-cultured on base (NBM+As 0.1mM), thereon the co-cultivation base of useful liquid
The filter paper soaked, pay attention to that too many callus can not be put in a culture dish, ensure that callus fully connects with aseptic filter paper
Touch, light culture 3 days at 25~26 DEG C；After 3 days, callus is transferred in sterilized triangular flask, with aseptic water washing 5 times extremely
Liquid is not muddy, then soaks 30min with added with the sterilized water of 500mg/L heads cytomycin and 400mg/L carbenicillins, every
5min rocks once.With aseptic filter paper suck dry moisture, turn white in being air-dried on the filter paper of sterilizing to callus surface, be transferred to sieve
Select culture medium J3S；Terminate to grow the callus global transfer of kanamycin-resistant callus tissue twice in screening and culturing medium after screening to pre- point
Change on culture medium (Y+500mg/L head born of the same parents+400mg/L carbenicillins), be placed in illumination box, condition of culture is：25~
26 DEG C, 14h illumination cultivations, 1000~1500lx of light intensity, there is callus greening successively within 3~7 days；It will become in pre- differential medium
Green callus is transferred on differential medium (DL+500mg/L head born of the same parents+400mg/L carbenicillins), is placed in 25~26
DEG C, 14h illumination cultivations, light intensity 1000~1500lx illumination cultivations, change a subculture within every 20 days；When the green height of seedling differentiated
During about 5~8cm, it is transferred on root media (R), promotes the growth of root, is placed in 25~26 DEG C, 14h illumination cultivations, light intensity
1000~1500lx illumination cultivations.After 3~4 weeks, open bottle cap and add distilled water, indoor hardening 3-5 days, will be attached to running water
Culture medium on seedling is rinsed well, is transplanted in the side plate equipped with soil, is treated that seedling survives and is moved into bucket or experimental field again
In, cultivate to maturation.
PCR identifications transfer-gen plant (amplimer for using red fluorescent protein gene)
Regrowth rice leaf DNA is extracted, positive plant is identified using round pcr.Applicant of the present invention is according to expression
Red fluorescent protein gene order designs specific primer on carrier：
DsRed-F:5’-ATGGCCTCCTCCGAGAACGT-3’(SEQ ID NO:9)
DsRed-R:5’-CTACAGGAACAGGTGGTGGC-3’(SEQ ID NO:10)
Enter performing PCR checking to transfer-gen plant.PCR amplification system and program are as follows：
Response procedures：94 DEG C of pre-degeneration 5min；PCR is expanded：Then with 94 DEG C of denaturation, 40s；53 DEG C of annealing, 40s；72℃
Extension, 1min；35 reaction cycles, last 72 DEG C of extensions 10min are carried out altogether.Electrophoresis detection PCR results.As shown in fig. 7, from figure
As can be seen that red fluorescent protein gene can be amplified in successful transfer-gen plant is converted in 7.
In addition, to further confirm that out that fixed point is inserted into target site region to red fluorescent protein gene really, adjusts with fertility
Gene linkage is controlled, applicant of the present invention utilizes SEQ ID NO:3 and SEQ ID NO:Primer sequence shown in 4, with from turning base
Because plant DNA is template, red fluorescent protein gene is expanded.
If exogenous array site-directed integration, amplified production 1950bp, product owns comprising red fluorescent protein gene
Expression element, if without site-directed integration, amplified production 129bp.
Following table is maintainer and the data on genetics and molecules data of the seed after mutant hybridization
The present invention has carried out Thinking Creation to SPT technologies, utilizes newest genome editing technique CRISPR/Cas9 systems
The flank sequence that reporter gene (red fluorescent protein gene, DsRed) Expression element fixed point is inserted into sterility changing gene will be screened
Row, realize the chain of fertile gene and color sorting reporter gene.Hybridization by transgenosis T0 for plant and sterile mutant, obtain
Maintainer, maintainer continue to hybridize with sterile mutant, realize the breeding of sterile line and maintainer seed, and sort using fluorescence
Technology quick separating sterile line and the two kinds of seed of maintainer.The present invention is using common wild rice as transformation receptor, solution
Determine and converted the materials limitation of sterile mutant, the site-directed integration of exogenous sequences has considered sterility changing gene and screening is reported
Accuse the expression of gene, the uncertainty of destination gene expression caused by avoiding the random integration site of former transgenosis.
Although embodiment of the present invention is disclosed as above, it is not restricted in specification and embodiment listed
With it can be applied to various suitable the field of the invention completely, can be easily for those skilled in the art
Other modification is realized, therefore under the universal limited without departing substantially from claim and equivalency range, it is of the invention and unlimited
In specific details and shown here as the legend with description.
Claims (7)
- A kind of 1. construction method of Rice Engineering maintainer, it is characterised in that including：Step 1: it will be obtained on the chromosome of external source reporter gene site-directed integration to wild rice containing external source reporter gene Transgenic line, wherein, the external source reporter gene being capable of close linkage heredity with wild type sterility changing gene；And afterwards Into step 2,Step 2: by the transgenic line obtained in step 1 and the common male nuclear sterile strain cross of homozygous recessive rice, sieve Strain of the choosing containing the external source reporter gene is required Rice Engineering maintainer, wherein, the homozygous recessive rice is general Logical male nuclear sterile strain is the sterility changing gene mutation body strain；In the step 1, obtaining the specific method of the transgenic line containing external source reporter gene includes：(1.1) the upstream and downstream sequence area of sterility changing gene on wild rice chromosome is analyzed, is taken in the region before NGG 20bp as target site region, and design the primer sequence with the target site regions pair, before primer upstream sequence plus GCAA, AAAC is added before primer downstream sequence, obtains primer:Upstream sequence：5’–GCAANNNNNNNNNNNNNNNNNNNN–3’Downstream sequence：5 '-AAACNNNNNNNNNNNNNNNNNNNN -3 ', wherein " N " refers to base A, T, C or G；(1.2) according to CRISPR/Cas9 systems, the primer sequence in step (1.1) is building up on pP1C.1 carriers and obtains base Because of integration vector；(1.3) external source reporter gene is building up on plant expression vector and obtains recombinant expression carrier；(1.4) by the recombinant expression carrier and the gene integration carrier cotransformation wild rice, transfer-gen plant is obtained；(1.5) target site both wings design primer, expanded with transfer-gen plant genome, if amplified production clip size with External source reporter gene clip size is roughly equal, then it is the Transgenic Rice strain containing external source reporter gene to judge the plant, And pinpoint insertion in target site to integrate.
- 2. the construction method of Rice Engineering maintainer as claimed in claim 1, it is characterised in that before the step 1 also Including：Determine that saltant type sterility changing gene is contaminating in the common male nuclear sterile strain of homozygous recessive rice by map based cloning Position on colour solid.
- 3. the construction method of Rice Engineering maintainer as claimed in claim 1, it is characterised in that the recombinant expression carrier In, it is built with rice endosperm specific promoter Gt1 before the nucleotide sequence of the external source reporter gene.
- 4. the construction method of Rice Engineering maintainer as claimed in claim 1, it is characterised in that the sterility changing gene is Rice EAT1 genes.
- 5. the construction method of Rice Engineering maintainer as claimed in claim 4, it is characterised in that in the step (1.1) Primer sequence is：Upstream sequence：5’–GCAAGAGCGAGAGGGGAAGCATTT–3’Downstream sequence：5’–AAACAAATGCTTCCCCTCTCGCTC–3’.
- 6. the construction method of Rice Engineering maintainer as claimed in claim 1, it is characterised in that the external source reporter gene is In red fluorescence marker gene, red fluorescent protein marker gene, green fluorescence protein gene or blue-fluorescence marker gene Any one.
- 7. application of the Rice Engineering maintainer in rice breeding, it is characterised in that the Rice Engineering maintainer is by such as right It is required that 1 to 6 any described method obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510253259.1A CN104846009B (en) | 2015-05-18 | 2015-05-18 | A kind of construction method of Rice Engineering maintainer and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510253259.1A CN104846009B (en) | 2015-05-18 | 2015-05-18 | A kind of construction method of Rice Engineering maintainer and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104846009A CN104846009A (en) | 2015-08-19 |
| CN104846009B true CN104846009B (en) | 2018-02-13 |
Family
ID=53845997
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510253259.1A Expired - Fee Related CN104846009B (en) | 2015-05-18 | 2015-05-18 | A kind of construction method of Rice Engineering maintainer and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104846009B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701818B (en) * | 2017-01-09 | 2020-04-24 | 湖南杂交水稻研究中心 | Method for cultivating common genic male sterile line of rice |
| CN107815463A (en) * | 2017-08-15 | 2018-03-20 | 西南大学 | CRISPR/Cas9 technologies mediate the method for building up of miR167 precursor sequence editor's systems |
| CN108841859A (en) * | 2018-07-04 | 2018-11-20 | 青岛袁策集团有限公司 | A kind of breeding method of the transgenic paddy rice sterile line based on MSP1 gene |
| CN109006454A (en) * | 2018-07-05 | 2018-12-18 | 青岛袁策集团有限公司 | A method of the third generation is obtained by hybridization technique and keeps system |
| CN113817768A (en) * | 2021-09-13 | 2021-12-21 | 湖南杂交水稻研究中心 | Method for improving rice temperature-sensitive sterile line, application and recombinant vector |
| CN115094085B (en) * | 2022-06-08 | 2024-04-12 | 湖南杂交水稻研究中心 | Rapid creation method of rice engineering propagation line and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732556A (en) * | 2012-06-29 | 2012-10-17 | 上海交通大学 | Creation method and purpose of paddy rice male sterile line |
| CN102870670A (en) * | 2012-10-31 | 2013-01-16 | 湖南杂交水稻研究中心 | Universal type breeding method for rice engineering maintainer line, and application thereof in propagation of ordinary nucleic male sterility lines of rice |
-
2015
- 2015-05-18 CN CN201510253259.1A patent/CN104846009B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732556A (en) * | 2012-06-29 | 2012-10-17 | 上海交通大学 | Creation method and purpose of paddy rice male sterile line |
| CN102870670A (en) * | 2012-10-31 | 2013-01-16 | 湖南杂交水稻研究中心 | Universal type breeding method for rice engineering maintainer line, and application thereof in propagation of ordinary nucleic male sterility lines of rice |
Non-Patent Citations (1)
| Title |
|---|
| A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants.Mol Plant;Xingliang Ma等;《Molecular Plant》;20150423;第8卷(第8期);第1281页右栏第2段至第1282页左栏第5段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104846009A (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105063083B (en) | Prevent method for creating and its application of the Rice Engineering maintainer of genetic drift | |
| CN104846009B (en) | A kind of construction method of Rice Engineering maintainer and its application | |
| CN104846010B (en) | A kind of method for deleting transgenic paddy rice riddled basins | |
| CN107988229A (en) | A kind of method for obtaining the rice that tiller changes using CRISPR-Cas modification OsTAC1 genes | |
| CN108103092A (en) | System and its application for downgrading rice are obtained using CRISPR-Cas systems modification OsHPH genes | |
| CN102634522B (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| CN106399323A (en) | Paddy rice leaf color regulation and control gene YL1 and use thereof | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| CN107338265B (en) | Gene editing system and method for editing plant genome by applying same | |
| WO2014154115A1 (en) | Spt transformation event of rice and detection method thereof | |
| CN107805632B (en) | OsMKK6 albumen and encoding gene are in the regulation developmental application of vegetable seeds | |
| CN105695461B (en) | A kind of specifically expressed promoter of wheat flag leaf and its application | |
| CN108396035A (en) | A kind of agriculture bacillus mediated rice transformation method | |
| CN107805633B (en) | OsMPK4 albumen and encoding gene are in the regulation developmental application of vegetable seeds | |
| CN104087605B (en) | Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases | |
| CN110268973A (en) | The production method of hybrid rice seed | |
| CN108795976A (en) | A method of conversion wild rice cDNA library improves rice varieties | |
| CN106978499A (en) | The external source Insert Fragment flanking sequences of transgenic soybean event GC1 1 and its application | |
| CN104341514B (en) | The application of rice transcription factor Os03g05590.1 gene C DS sequences | |
| CN110106200A (en) | Corn BBM1 gene is improving the application in Genetic Transformation in Higher Plants efficiency | |
| CN103320463B (en) | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene | |
| CN106244595B (en) | China fir phytosulfokine-α CLPSK1 gene and its application | |
| CN108277233A (en) | The method for inducing and cultivating of Mature Embryos of Rice callus | |
| CN109504703A (en) | Corn M8-P type rice system and its breeding production of hybrid seeds application method are formulated using p5126-ZmMs1D construct | |
| CN109022479A (en) | A kind of screening technique of callus phase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180213 Termination date: 20210518 |