CN103320463B - Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene - Google Patents
Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene Download PDFInfo
- Publication number
- CN103320463B CN103320463B CN201310241968.9A CN201310241968A CN103320463B CN 103320463 B CN103320463 B CN 103320463B CN 201310241968 A CN201310241968 A CN 201310241968A CN 103320463 B CN103320463 B CN 103320463B
- Authority
- CN
- China
- Prior art keywords
- rice
- seq
- asabcg15
- gene
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention discloses a method for obtaining a rice sterile line by utilizing an RNAi (Ribose Nucleic Acid interfere) technology to control an expression of a rice fertile gene. The method comprises the following steps of: amplifying a DNA (Deoxyribose Nucleic Acid) fragment used for generating an antisense RNA (Ribose Nucleic Acid); then constructing an expression vector; converting the DNA fragment into normal fertile rice, thereby obtaining a novel rice kernel sterile material. The provided method for generating the kernel sterile line is simple, convenient and rapid. The obtained nuclear sterile material can be used for replacing artificial emasculation during a rice hybridization process, so that the human source is saved; or the obtained nuclear sterile material can be applied to recurrent selection breeding, so that the an important function for amplifying the rice germplasm basis is achieved.
Description
The application is that (application number is: divisional application 201210057952.8) in the application for a patent for invention " gene and proteins encoded and the application of control rice fertility " proposing on March 7th, 2012.
Technical field
The invention belongs to plant fertility gene field.Be specifically related to obtain with RNAi technology control rice fertility gene the method for rice sterile line
Background technology
Paddy rice is self pollination crop, the improvement of rice varieties for a long time mainly relies on cross breeding method, but due to the restriction of artificial emasculation and hybridization technique, conventionally can only utilize minority parent to hybridize, parental source narrow range, cause kind hereditary basis day by day narrow, be difficult to be bred as breakthrough kind.The Other Main Agronomic Characters of paddy rice mostly is the quantitative character of minor-polygene control, recurrent selection breeding method can be broken the chain of unfavorable gene, increase the accumulation of excellent genes, because of but expand hereditary basis, be bred as the important means of breakthrough kind, but because artificial emasculation difficulty waits restriction, the application of recurrent selection breeding method on self pollination crop is restricted.And the self pollination crop application recurrent selection breeding method that is found to be of genic male sterile gene provides possibility.Gilmore proposes core sterile material to be applied to the recurrent selection (Gilmore, E.C, Jr. Crop Sci, 1964.4:323-325) of self pollination crop.Fujimaki propose by core sterile material for the recurrent selection of paddy rice (Fujimaki. H, S etc. Japan. J. Breed. 1977. 27:70-77).Lkehashi describe in detail by sterile core for paddy rice in the method (Lkehashi H.Japan.J.Breed, 1980,31:205-209) of recurrent selection.
The subject matter of utilizing existing rice recessive male nuclear sterile to carry out the existence of paddy rice recurrent selection breeding is: the overall proterties of (1) colony is subject to the impact of Recessive Male sterility donor material genetic background large, easily cause hereditary form and the Characters of colony single, be difficult to be bred as excellent strain; (2) be to carry out according to offspring's natural separation with selection or the rejecting of Recessive Male sterility strain, time-consuming and workload is large, efficiency is low.Therefore, need to find and new carry out the recurrent selection of paddy rice for the recessive cytoblast sterile type of paddy rice recurrent selection, and binding molecule biology techniques identifies in early days to Recessive Male sterility, reduce workload.
The growth of angiosperm flower pesticide comprises the division of flower pesticide and the growth of pollen granule.Ripe flower pesticide comprises epidermis, endodermis, middle level and tapetum four confluent monolayer cells.The normal development of flower pesticide and pollen wall is extremely important to plant fertility.In paddy rice, the gene of report and flower pesticide and pollen wall related to development has WDA1, PTC1, OSC6, TDR, UDT1, GAMYB, CYP704B2, DPW, OsRaftin1 etc. at present.The mutant of these genes shows as flower pesticide epicutile wax layer on cytology and pollen wall all lacks, or shows as pollen wall disappearance, and these mutant finally all show as male sterile.
ABC (ATP binding cassette) transfer protein is the gene family very large, diversity is abundant being extensively present in animals and plants.Its major function is to participate in the transmembrane movement of a large amount of molecules directly.In plant, ABC transfer protein is especially abundant, and such as there being respectively 130 and 132 of coding ABC transfer proteins in Arabidopis thaliana and paddy rice, these transfer proteins belong to respectively different subfamilies.Wherein ABCG subfamily is ABC transfer protein subfamily maximum in paddy rice and Arabidopis thaliana, this family member is coding half molecular weight transfer protein, and it must could form one with half other molecular weight transfer protein interaction function ABC transfer protein.In plant, the substrate of ABC transfer protein has very much higher sample, comprises (the Rea PA.Annual Review of Plant Biology.2007. 58 (1): 347-375 such as iron, lipid acid, hormone..Biochim Biophys Acta.2003.1465 (1-2): the 79-103 such as Jasinski M).Existing 6 family members correlation function that has been in the news in ABCG subfamily.ABC11/COF1 in Arabidopis thaliana, ABCG12/CER5, ABCG13 and ABCG26 participates in lipid acid and shifts.Two other STAR1 is relevant to the resistance to aluminium of paddy rice with STAR2, may be participate in aluminum ions transfer (Huang CF etc. The Plant Cell.2009.21 (2): 655-667).But the function relevant to fertility there is not yet report.
Sichuan Agricultural University has found that in 1988 (this core sterile material is called as H2S or H to the single recessive cytoblast sterile material of a paddy rice in the present invention
2s, refers to same core sterile material), microscopic examination finds at microspore stage, this sterile material tapetum does not show obvious degraded, and sporule shows obvious degraded, finally causes mature period mutant WUHUAFEN; Electron microscopic observation is found the accumulation of this sterile material flower pesticide epidermic cell anoderm of mature period and wax layer, and disappearance extine and Ubisch body structure (Wang Yuping, Ph D dissertation in 2007, the genetic research of Sichuan recessive cytoblast sterile paddy rice and breeding utilization; Li Yuanyuan, Master's thesis in 2008, the cytology research of rice male sterility mutant and genetic analysis).Through studying this gene Primary Location between the 6th chromosomal W11 and two Indel marks of W19; (application number is: 200910250526.4), disclose this application of list recessive cytoblast sterile material in paddy rice recurrent selection breeding, and be bred as some outstanding good kinds in patent application " utilizing recessive cytoblast sterile material to carry out the method for long-grained nonglutinous rice recurrent selection breeding ".
ABCG15 belongs to ABC transfer protein G subfamily member (Paul J. Verrier etc.Trends in Plant Science 2008.13 (14): 151-159), through retrieval, do not find about ABCG15 is at the report of purposes aspect male sterility of rice.
Summary of the invention
The object of the invention is to provide the method for utilizing RNAi technology control rice fertility gene to obtain rice sterile line.
For achieving the above object, technical scheme of the present invention is as follows:
Control a gene for rice fertility, called after ABCG15, is made up of following (1) or (2):
(1) formed by the nucleotide sequence shown in SEQ ID NO:1;
(2) by nucleotide sequence shown in SEQ ID NO:1 through inserting, disappearance or substitute one or more bases, the homology and the coding that have more than 90% with the nucleotide sequence shown in SEQ ID NO:1 form with the nucleotide sequence of (1) identical function protein.
The encode protein of gene of above-mentioned control rice fertility is the protein of following (1) or (2):
(1) formed by the aminoacid sequence shown in SEQ ID NO:2;
(2) aminoacid sequence shown in SEQ ID NO:2 is formed through one or several amino acid whose replacement, disappearance or interpolation and the aminoacid sequence relevant to rice fertility.
The expression vector, host cell or the plant that contain the above-mentioned control rice fertility of external source gene.
Described carrier refers to pCambia1300, pCambia1301 or pOsact2 etc.
Described host cell refers to Agrobacterium or intestinal bacteria etc.
Described plant refers to paddy rice, corn, wheat, soybean, Arabidopis thaliana or rape etc.
A single recessive male sterility gene of paddy rice, is made up of following (1) or (2):
(1) formed by the nucleotide sequence shown in SEQ ID NO:3;
(2) insert, lack or substitute one or more bases by the nucleotide sequence process shown in SEQ ID NO:3, the nucleotide sequence with the nucleotide sequence shown in SEQ ID NO:3 with more than 90% homology and the male sterile function identical with (1) of encoding forms.
The expression vector, host cell or the plant that contain the single Recessive Male sterility of above-mentioned paddy rice.
Described carrier refers to pCambia1300, the carriers such as pCambia1301 or pOsact2.
Described host cell refers to Agrobacterium or intestinal bacteria etc.
Described plant refers to paddy rice, corn, wheat, rape, soybean, false bromegrass or Arabidopis thaliana etc.
Utilize the expression of the above-mentioned rice fertility gene of RNAi technology control to obtain the method for rice sterile line, comprise the steps:
(1) pcr amplification, obtain for generation of the DNA fragmentation (ASABCG15) of sense-rna: taking the cDNA of the rice varieties that normally can educate as template, carry out pcr amplification taking ASABCG15-F and ASABCG15-R as primer, obtain 493bp(SEQ ID No:16) pcr amplification product, called after ASABCG15; Described primer is:
ASABCG15-F: CGGGGTACCACGGCCATCCTCTACTTCATGG（SEQ ID No:4），
ASABCG15-R: CCGGAATTCCTACAAGGGCATGAGGCTGATC（SEQ ID No:5）；
Described PCR reaction system is: cDNA 3 μ L(200ng), dNTP(2mM) 5 μ L, 10XPCR damping fluid 5 μ L, 25mM Mg
2+2 μ L, primer 10 μ M 1.5 μ L; KOD-plus-NEO enzyme (1U/ μ L) 1.5 μ L; DMSO 1.5 μ L; H
2o 30.5 μ L; The reaction conditions of described PCR: 94 DEG C of 2min; 98 DEG C of 10s, 68 DEG C of 30s, 35 circulations; 72 DEG C of 10min, 10 DEG C of 1min;
(2) build RNAi interference vector: reclaim pcr amplification product, and pcr amplification product is connected with carrier PMD20, obtain connection product; Connection product is converted into host cell, 37 DEG C of incubated overnight; Then picking list bacterium is to LB liquid nutrient medium incubated overnight; Extract plasmid, then detect positive plasmid, and the insertion sequence in plasmid is checked order, confirm that insertion sequence is ASABCG15 sequence, obtain PMD20-ASABCG15 carrier; PMD20-ASABCG15 carrier and pOsAct2-nos carrier are carried out to double digestion by Kpn I and EcoR I simultaneously, enzyme is cut to product and reclaim, connect, transform, be built into pOsAct2-ASABCG15 carrier; POsAct2-ASABCG15 carrier is arrived to EHA105 bacterial strain by Agrobacterium-mediated Transformation, obtained strains called after EHA105-pOsAct2-ASABCG15 after transforming;
(2) cultivate Rice Callus, EHA105-pOsAct2-ASABCG15 is transformed in Rice Callus by the method for agrobacterium mediation converted, then utilize hygromycin gene to carry out positive detection to transgenic seedling, and the rna expression amount to ABCG15 detects, select performance holandry sterile and can't detect the plant of ABCG15 expression amount, be the rice male core sterile material obtaining by RNAi technology.
Described rice varieties can be that Japan is fine.
Compared with prior art, the advantage that the present invention has and beneficial effect: the present invention utilizes RNAi technology to carry out genetic engineering modified its fertility forfeiture that makes to this gene, cultivates simple, rapid, an effective means are provided for paddy rice line with genic sterile; Utilize genic male sterile gene of the present invention can carry out the line with genic sterile that transgenic culturing is new; Core sterile material of the present invention replaces artificial emasculation while being used in paddy rice cross breeding, save labour, especially can be used for carrying out the recurrent selection breeding of a large amount of hybridization, and the Germplasm Bases that expands paddy rice is played an important role.
Brief description of the drawings
Fig. 1 .ABCG15 gene Fine Mapping schematic diagram.
Fig. 2 .RT-PCR detects electrophoretogram in ABCG15 gene mutation body cDNA, wherein 1 wild-type band, and 2 is heterozygote band, 3 is mutant band.
Fig. 3. complementary fragment electrophoretogram.
Fig. 4. complementary expression vector structural representation.
Fig. 5. grain husk flower contrast photo, wherein 1 is mutant, and 2 is complementary plant, and 3 is wild-type.
Fig. 6. the flower pesticide dyeing Photomicrograph of complementary plant.
Fig. 7 .RNAi expression vector structural representation (solid black surround represents the antisense sequences of ABCG15 3 ' end sub-sequence)
Fig. 8 .RNAi transfer-gen plant contrast photo; Wherein 1 is the solid plant of part in transfer-gen plant, and 2 is complete acarpous plant in transfer-gen plant.
The flower pesticide photo of Fig. 9 .RNAi transfer-gen plant.
The flower pesticide photo of Figure 10 .RNAi transfer-gen plant.
The pollen granule Photomicrograph of Figure 11 .RNAi transfer-gen plant.
The pollen granule Photomicrograph of Figure 12 .RNAi transfer-gen plant.
ABCG15 quantitative RT-PCR column diagram in the fine plant of Figure 13 .RNAi transfer-gen plant and wild-type Japan; Wherein number 1-10 and be respectively positive transgenosis individual plant, WT is that Japan is fine.
Figure 14. the setting percentage column diagram of the RNAi plant corresponding with Figure 13; Wherein number 1-10 and be respectively positive transgenosis individual plant, WT is that Japan is fine.
Embodiment
With specific embodiment, the invention will be further described below, but be not to be construed as limiting the scope of the invention.
The Fine Mapping of embodiment 1 list Recessive Male sterility of the present invention
(1) adopt large two order-checking parents 9311 of hereditary difference and Japan fine respectively with H
2s hybridization, builds target group.
(2) utilize H
2s and 9311 and Japan there is SSR primer and the Indel(insertion-deletion of polymorphism between fine) mark, at H
2s × 9311 combination F
21200 sterile individual plants of recessiveness in, and H
2s × Japanese fine F
2in analyzed the linkage relationship between mark Indel40520 and RM20366 and the sterile gene between parent with polymorphism in 1320 sterile individual plants of recessiveness.
(3) will control the 45K of this male sterile assignment of genes gene mapping between Indel40520 and RM20366 apart from (see figure 1).The primer sequence of Indel40520 mark is:
Indel40520F：TTGGTCCCACAAATAAGTCATG （SEQ ID No:6），
Indel40520R：TTGGAGCAACTGAAGCAAGGAA （SEQ ID No:7）；
This gene is positioned in the interval of the 6th karyomit(e) 50kb, and this interval has 7 candidate genes.These 7 genes only have Loc_OS06g40550(http: //rice.sinica.edu.tw/rice/) at meiosis telophase high expression level, therefore this gene is optimal candidate gene.
The cloning and identification of the single Recessive Male sterility of embodiment 2 paddy rice of the present invention
According to the assignment of genes gene mapping result of embodiment 1, carry out sequencing analysis using Loc_OS06g40550 gene as candidate gene.With H
2s genomic dna is template, carries out pcr amplification taking CDS40550-F and CDS40550-R as primer, and described sequencing primer is:
CDS40550-F: CACCATGATGGAGATCAGCAGCAAT （SEQ ID No:8）,
CDS40550-R: CTACAAGGGCATGAGGCTGAT （SEQ ID No:9）；
Described PCR reaction system is: H
2s genomic dna 3 μ L(200ng), dNTP(2mM) 5 μ L, 10XPCR damping fluid 5 μ L, 25mM Mg
2+2 μ L, primer 10 μ M 1.5 μ L; KOD-plus-NEO enzyme (1U/ μ L) 1.5 μ L; DMSO 1.5 μ L (TOYOBO company provides); H
2o 30.5 μ L.The reaction conditions of described PCR is: 94 DEG C of 2min; 98 DEG C of 10s, 68 DEG C of 1:30min, 35 circulations; 68 DEG C of 10min, 10 DEG C of 1min.Reclaim PCR product (method reclaims test kit specification sheets with reference to Omega), the PCR product reclaiming is connected to 1 hour with D-topo carrier, and (Topo linked system is: object fragment 2ng, Salt Solution 0.5ul, D-Topo carrier 0.5ul, H
2o supplies 3 ul), connection product is converted into intestinal bacteria (method reference: Pehanorm Brooker " molecular cloning experiment guide " third edition, Science Press, 2002), 37 DEG C of incubated overnight.Then picking list bacterium is to LB liquid nutrient medium incubated overnight, then extracts plasmid for positive detection (plasmid extraction is with reference to sky root plasmid extraction kit specification sheets).Detect positive plasmid and (plasmid is carried out at 37 DEG C to endonuclease reaction 4h; Endonuclease reaction system is 20 μ L, 10 × K buffer, 2 μ L, BamH I (precious biological product) 1 μ L, Xba I (precious biological product) 1 μ L, plasmid 5 μ L, water 11 μ L).Determine the positive colony that contains object fragment through electrophoresis detection, then positive plasmid is sent to the order-checking of handsome biotech company.Sequencing result is found H
2at the 4943bp of Loc_Os06g40550 genome sequence, to the nucleotide sequence that has lacked GCCACCCTCCTC 12bp between 4957bp, (wild-type Loc_Os06g40550 gene order is shown in SEQ ID No:1 to S; H
2in S, mutator gene sequence is shown in SEQ ID No:3).
RT-PCR detects: designed across this 12bp deletion sequence primer Q11F and the Q12R that product length is 147bp, with wild-type (H
2sW), heterozygote (H
2and H SH)
2s mutants cDNA is template, carries out RT-PCR amplification taking Q11F and Q12R as primer, detects the disappearance that whether also has 12bp in RNA; Described primer is:
Q11F：CGACGCGGTGCCGCACGTCGTGT （SEQ ID No:10），
Q12R：AGCTCGCCGGTGCCCTGGCTGGTG （SEQ ID No:11）；
RT-PCR result (see figure 2) mutant band is less than wild-type band, there is the band of wild-type and mutant in heterozygote simultaneously, this disappearance that shows 12bp is also present in RNA, sequencing result shows that the cDNA in H2S also lacks identical 12bp, illustrates that the deletion mutantion of 12bp in very possible Loc_Os06g40550 gene has caused H2S male sterile simultaneously.Because the albumen of Loc_Os06g40550 coding belongs to the 15th of G subfamily of ATP Binding Cassette (ABC) translocator family, therefore this unnamed gene is ABCG15, therefore can infer that ABCG15 is the gene of controlling rice fertility.
The complementary transgenosis proof test of embodiment 3
Carry out as follows:
The structure of 1 complementary expression vector:
In order to verify H
2whether S male sterile material by the disappearance of 12bp in ABCG15 is caused, carries out complementary transgenosis confirmatory experiment.The construction process of complementary expression vector is as follows:
1.1 wild-type (H normally can educate
2sW) genomic dna that plant leaf extracts is template, carries out pcr amplification taking Q51 and Q52 as primer; Described primer is:
Q51:CCGGAATTCTGAATCGTCGTCACCTGCTAAGCCCAAAT（SEQ ID No: 12），
Q52:CGGGGTACCGTGTCCCTCCCTACCCAACCTAACCCAAC（SEQ ID No: 13）；
Wherein the reaction system of PCR is: genomic dna 3 μ L(200ng), dNTP(2mM) 5 μ L, 10xPCR buffer 5 μ L, 25mM Mg
2+2 μ L, primer 10 μ M 1.5 μ L; KOD-plus-NEO (1U/ μ L) 1.5 μ L; DMSO 1.5 μ L (TOYOBO company provides); H
2o 30.5 μ L.Wherein the reaction conditions of PCR is: 94 DEG C of 2min; 98 DEG C of 10s, 74 DEG C of 4min, 5 circulations; 98 DEG C of 10s, 72 DEG C of 4min(30s/kb), 5 circulations; 98 DEG C of 10s, 70 DEG C of 4min(30s/kb), 5 circulations; 98 DEG C of 10s, 68 DEG C of 4min(30s/kb), 25 circulations; 68 DEG C of 10min.Electrophoresis result (see figure 3) shows that acquisition contains 1500bp promoter sequence, and ABCG15 gene order and TGA downstream 400bp are in interior 8Kbp fragment.
1.2 reclaim PCR product (reclaiming test kit specification sheets with reference to Omega), carry out double digestion 16 hours by Kpn1 and EcoR I with pColumbia1300 carrier (endonuclease reaction system is: 20 μ L simultaneously, 10 × K buffer, 2 μ L, the precious biological product of Kpn1() 1 μ L, EcoR I (precious biological product) 1 μ L, pCambia1300 plasmid or PCR product 5 μ L, water 11 μ L); Reclaim enzyme and cut product (reclaiming test kit specification sheets with reference to Omega carries out), the carrier that the enzyme of recovery is cut after PCR product is cut with enzyme is connected: (ligation system: the PCR product 8ul after enzyme is cut, carrier 2ul after enzyme is cut, efficient ligase enzyme (TOYOBO company) 10ul, amount to 20ul, ligation condition: after mixing in 16 DEG C of connections of spending the night.Connection product is converted into intestinal bacteria (method for transformation reference: Pehanorm Brooker " molecular cloning experiment guide " third edition, Science Press, 2002), 37 DEG C of incubated overnight; Then picking list bacterium, to LB liquid nutrient medium incubated overnight, is then extracted plasmid for positive detection (plasmid extraction is with reference to sky root plasmid extraction kit specification sheets).
1.3 detect positive plasmid: gained plasmid in step (2) is carried out to endonuclease reaction 4h(endonuclease reaction system by Kpn and EcoR I at 37 DEG C is: 20 μ L, 10 × K buffer, 2 μ L, the precious biological product of Kpn() 1 μ L, EcoR I (precious biological product) 1 μ L, plasmid 5 μ L, H
2o 11 μ L), the insertion sequence in plasmid delivered to handsome biotech company check order, confirm that insertion sequence is ABCG15 gene order, successfully build complementary expression vector p13000-ABCG15 (seeing Fig. 4).
1.4 complementary p1300-ABCG15 expression vector is transformed into Agrobacterium EHA105 bacterial strain, bacterial strain called after EHA105-p1300-ABCG15 (Agrobacterium competence and method for transformation reference: Pehanorm Brooker " molecular cloning experiment guide " third edition after conversion, Science Press, 2002).
2 genetic transformation tests
The induction of 2.1 callus: get H2S and ear to the young fringe (1-2cm the best) of 3-4 phase, with 75% alcohol-pickled sterilization 40s, then use aseptic water washing 1 time, soak 8min with 0.1% mercuric chloride again, then use sterile water wash 5 times, be positioned in the culture dish with filter paper and be filtered dry, with tweezers, young fringe is inoculated in to NMB substratum (its moiety and ratio are in table 1) upper, under 28 DEG C of illumination conditions, cultivate 10-15 days; Once, after subculture 2～3 times, the well-grown callus of picking, is connected to MS substratum (its moiety and ratio are in table 1) them upper to 10 days subcultures, 28 DEG C of dark 4d that cultivate.
The activation of 2.2 agrobacterium strains: (its moiety and weight ratio thereof are: yeast extract 1g to get the YEP liquid nutrient medium that the Agrobacterium EHA105-p1300-ABCG15 30 μ L of gained in step 1.4 contain Rifampin and kantlex in 3 mL, peptone 1g, sodium-chlor 0.5g, water 100ml), shaking culture 14h at 200rpm, 28 DEG C; Get again wherein 1mL in the YEP of the 50mL that contains Rifampin and kantlex liquid nutrient medium, 28 DEG C of shaking culture 4h; The Agrobacterium EHA105-p1300-ABCG15 bacterium liquid that must activate.
2.3 cultivate and transform altogether: by Agrobacterium EHA105-p1300-ABCG15 bacterium liquid centrifugal collection thalline under 5000 rpm of activation in step 2.2, be total to the resuspended thalline of substratum (moiety and ratio thereof are in table 2) 30mL with the liquid that is added with 100 μ M/L Syringylethanones and become uniform bacterium liquid, then the callus of choosing is in advance immersed in to 20min in bacterium liquid, suck unnecessary bacterium liquid, substratum (moiety and ratio thereof are in table 2) is upper to be altogether laid in solid, 28 DEG C of dark 2d that cultivate.
The de-bacterium of 2.4 callus and callus resistance screening: by the callus use aseptic water washing of common cultivation 3-5 time to clarification of water, then with the extremely clarification of sterilized water vibration 30min containing cephamycin (500mg/L), again callus is thoroughly blotted with aseptic filter paper or thieving paper, be then inoculated in the upper cultivation of screening culture medium (moiety and ratio thereof are in table 2) about 3 weeks.
2.5 differentiation are inoculated into the above-mentioned resistant calli newly growing on division culture medium (moiety and ratio thereof are in table 2), to carry out cultivating 1-2 month under illumination condition with taking root, then the high seedling in 3cm left and right growing is forwarded to the upper cultivation of root media (moiety and ratio thereof are in table 2), in the time that seedling grows to approximately 10 cm, after hardening, transplant in land for growing field crops, with Totomycin primer (HPTF:TACACAGGCC ATCGGTCCAGA; HPTR:TAGGAGGGCGTGGATATGTC) detect positive plant; PCR reaction system is: genomic dna 2 ul of transfer-gen plant, 10 × buffer, 2 ul, dNTP (2.5mM) 2 ul, Totomycin hpt primer 2 ul, H
2o 11.8 ul, Taq enzyme (5U/ul) 0.2 ul.PCR reaction conditions: 94 DEG C of 5min; 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 35 circulations; 72 DEG C of 10min; 20 DEG C of 2min.Result detects 15 strain positive plants, the form of transgenic positive plant, grain husk flower and flower pesticide (seeing Fig. 5 (2)) and pollen granule coloration result (see figure 6) all with wild-type H
2sW is close, and transfer-gen plant all shows as and can educate.This result has further proved that the disappearance of ABCG15 gene 12bp has caused the phenotype of this male-sterile mutation body, also shows that ABCG15 is the important gene that participates in adjusting and controlling rice flower pesticide and pollen wall growth simultaneously.
Embodiment 5 creates the test of paddy rice core sterile material by suppressing the expression of ABCG15 gene
1. build RNAi interference vector
According to paddy rice ABCG15 cDNA sequence, ABCG15 3 ' end is designed to a pair of antisense strand primer:
ASABCG15-F: CGGGGTACCACGGCCATCCTCTACTTCATGG，（SEQ ID No:4）
ASABCG15-R: CCGGAATTCCTACAAGGGCATGAGGCTGATC；（SEQ ID No:5）
The cDNA fine taking rice varieties Japan carries out pcr amplification as template, the sequence (SEQ ID No:16) that to obtain length be 493bp, called after ASABCG15; Wherein the reaction system of PCR is: cDNA 3 μ L(200ng), dNTP(2mM) 5 μ L, 10XPCR damping fluid 5 μ L, 25mM Mg
2+2 μ L, primer 10 μ M 1.5 μ L; KOD-plus-NEO enzyme (1U/ μ L) 1.5 μ L; DMSO 1.5 μ L (TOYOBO company); H
2o 30.5 μ L.The reaction conditions of PCR is: 94 DEG C of 2min; 98 DEG C of 10s, 68 DEG C of 30s, 35 circulations; 72 DEG C of 10min, 10 DEG C of 1min; Reclaim PCR product (reclaiming test kit specification sheets with reference to Omega), the PCR product of recovery is connected to PMD20T carrier (precious biotech firm provides) (reaction system: PCR product 4 ul of recovery, PMD 20T carrier 1 ul, reaction conditions: 16 DEG C, the connection of spending the night).Connection product is converted into intestinal bacteria (method reference: Pehanorm Brooker " molecular cloning experiment guide " third edition, Science Press, 2002), 37 DEG C of incubated overnight.Then picking list bacterium to LB liquid nutrient medium, (moiety and weight ratio thereof are: yeast extract 0.5g, peptone 1g, sodium-chlor 1g, H
2o 100ml, pH7) extract plasmid for positive detection (plasmid extraction is with reference to sky root plasmid extraction kit specification sheets) after incubated overnight.Then detect positive plasmid (plasmid being carried out at 37 DEG C to endonuclease reaction 4h(endonuclease reaction system is 20 μ L, 10 × K buffer, 2 μ L, the precious biological product of Kpn() 1 μ L, EcoR I (precious biological product) 1 μ L, plasmid 5 μ L, H
2o 11 μ L)), the insertion sequence in plasmid delivered to handsome biotech company check order, confirm that insertion sequence is ASABCG15 sequence, obtain PMD20-ASABCG15 carrier, then by PMD20-ASABCG15 carrier and pOsAct2-nos carrier (He Chengkun etc. Plant Biotechnology Journal.2009.7, 227-239) carry out double digestion by Kpn I and EcoR I (the enzyme system of cutting is: 20 μ L simultaneously, 10 × K buffer, 2 μ L, Kpn I (precious biological product) 1 μ L, EcoR I (precious biological product) 1 μ L, plasmid 5 μ L, water 11 μ L), enzyme is cut to product to be reclaimed, connect, transform, plasmid extraction and plasmid positive detection are finally built into pOsAct2-ASABCG15 carrier (see figure 7) and (reclaim, connect, transform, plasmid extraction is with reference to above-mentioned steps).Then the pOsAct2-ASABCG15 carrier building is arrived to EHA105 bacterial strain by Agrobacterium-mediated Transformation, the positive strain called after EHA105-pOsAct2-ASABCG15 after conversion.
2 genetic transformation tests
The cultivation of 2.1 Rice Callus:
Get Japanese fine seed, after shelling, with 75% alcohol disinfecting 2min, then use aseptic water washing 1 time, then soak 18min with 0.1% mercuric chloride, then with sterile water wash several times, be positioned in the culture dish with filter paper and be filtered dry, be inoculated in NMB substratum (moiety and ratio thereof are in table 1) upper, cultivate 10-15 days in 30 DEG C of light, will see that less callus occurs.After subculture 1-2 time, the well-grown callus of picking, is connected to them on NMB pre-culture medium, 28 DEG C of dark 4d that cultivate.
2.2 genetic transformations: EHA105-pOsAct2-ASABCG15 is converted in the fine callus of Japan of step 2.1 gained (agriculture bacillus mediated method for transformation is with 2.2-2.5 part in embodiment 4), obtains transgenic seedling.
3 test-results:
3.1 transfer-gen plants detect and Fertility observation
Utilize hygromycin gene to carry out PCR positive detection to transgenic seedling, (PCR reaction system: genomic dna 2 ul of transfer-gen plant, 10 × buffer, 2 ul, dNTP (2.5mM) 2 ul, Totomycin hpt primer 2 ul(primer is with the Totomycin primer in embodiment 4), H
2o 11.8 ul, Taq enzyme (5U/ul) 0.2 ul; Reaction conditions: 94 DEG C of 5min; 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 35 circulations; 72 DEG C of 10min; 20 DEG C of 2min), obtain the positive transgenic seedling of 50 strains.Wherein show as totally 33 strains that fertility is less than 30%, account for 66% of sum; Show as holandry sterile have 6 strains.In Fig. 8, be numbered 1,2 plant represents respectively the plant of part solid (1) and completely shaky (2) in transfer-gen plant, and Fig. 9 and Figure 10 are respectively the grain husk flower (full be yellow) of the solid plant of part in transfer-gen plant and the grain husk colored (slight of stature is white in color) of complete shaky plant.Figure 11 and Figure 12 represent respectively the coloration result (pollen is normal) of the solid plant flower pesticide of part in transfer-gen plant and the coloration result (WUHUAFEN grain) of complete shaky plant flower pesticide.
In 3.2 transfer-gen plants, the expression amount of ABCG15 detects test
Whether be to cause owing to suppressing ABCG15 expression amount in order to detect low fertility plant, selected part transgenic positive individual plant utilizes RT-qPCR to detect the expression amount of its ABCG15.
(1). experiment material: the grain husk flower of wild-type microspore stage grain husk flower and 10 transgenosis individual plant microspore stages
(2). test method: paddy rice RNA extracts (with reference to QIGEN plant RNA extraction test kit specification sheets (Code.74904) in a small amount). synthetic ReverTra Ace – α-(TOYOB, the Code.FSK-100) test kit (program reference reagent box specification sheets) that uses of cDNA the first chain.System is 12ul: random primer (25pmol/ul) 1ul, and (10pmol/ul) 1ul of Oligo (dT), total RNA 600ng, containing the H of RNA enzyme
2o polishing 12ul.Rare 6 times of the cDNA mother liquor that reverse transcription is gone out, then carries out quantitative fluorescent PCR, and the test kit using is: SsoFast EvaGreen supermix (Bio-Rad).Quantitative PCR system is 10ul:SsoFast EvaGreen supermix 5ul, primer (4uM) 1ul(F:TTGGTCCCACAAATAAGTCATG (SEQ ID No:15); R:TTGGAGCAACTGAAGCAAGGAA (SEQ ID No:16)), cDNA 1ul, containing the H of RNA enzyme
2o 3ul.Quantitative fluorescent PCR program: 95 DEG C of 30sec, 95 DEG C of 5sec; 58 DEG C of 5sec (39 circulation).Quantitative real time PCR Instrument is Bio-Rad C1000, utilizes CFX Manager Software verse 1.6 data analysis software to analyze expression amount.
ABCG15 expression amount in the most of transfer-gen plant of result (seeing Figure 13) reduces.Corresponding setting percentage observed result (Figure 14) shows that its setting percentage of plant that ABCG15 expression amount reduces also reduces, otherwise setting percentage does not have considerable change (Figure 14-2 strains), and the expression amount of ABCG15 does not have considerable change yet.This test shows that these positive transgenosis single-strain fructification yields reductions are because the expression amount of ABCG15 reduces caused.As can be seen here, can, by suppressing the expression of paddy rice wild-type ABCG15 gene, reach and reduce rice fertility or create male sterile individual plant completely, this test simultaneously has also further proved that ABCG15 is the gene of controlling rice fertility.
Attached: the formula of substratum:
The minimum medium that the induction of callus in this experiment, subculture, common cultivation and screening adopt is NBM substratum; Differentiation and its minimum medium of substratum used of taking root are MS substratum.
Minimum medium MS substratum and NMB substratum used in table 1 embodiment of the present invention
| MS substratum (1L) | NMB substratum (1L) | ||
| MS a large amount of (20x) | 50ml | N6（20x） | 50ml |
| MSⅠ（100x） | 10ml | MSⅠ（100x） | 10ml |
| MSⅡ（1000x） | 1ml | MSⅡ（1000x） | 1ml |
| Molysite (200x) | 5ml | Molysite (200x) | 5ml |
| Nicotinic acid (1000x) | 0.5ml | Nicotinic acid (1000x) | 1ml |
| VB6（1mg/ml） | 0.5ml | VB6（1mg/ml） | 1ml |
| VB1（10mg/ml） | 40μl | VB1（10mg/ml） | 1ml |
| Glycine (2mg/ml) | 1ml | 2,4-D（2mg/ml） | 1ml |
| 2,4-D（2mg/ml） | 1ml | Inositol | 0.1g |
| KT(0.5mg/l) | 500μl | Glutamine | 0.25g |
| Inositol | 0.1g | Proline(Pro) | 0.5g |
| Glutamine | 0.25g | Acid hydrolyzed casein | 0.3g |
| Proline(Pro) | 0.5g | Sucrose | 30g |
| Acid hydrolyzed casein | 0.3g | Agar powder | 7.2g |
| Sucrose | 30g | pH | 5.8 |
| Plant gel | 3.0g | ||
| pH | 5.8 |
Other substratum and the moiety thereof in table 2 transformation experiment, used
Claims (3)
1. utilize the expression of RNAi technology control rice fertility gene of sequence as shown in SEQ ID NO:1 to obtain the method for rice sterile line, comprise the steps:
(1), taking the cDNA of the rice varieties that normally can educate as template, taking ASABCG15-F and ASABCG15-R as primer carries out pcr amplification, obtain the pcr amplification product of 493bp, called after ASABCG15; Described primer is by the nucleotide sequence shown in SEQ ID No:4 and SEQ ID No:5; Described PCR reaction system is: cDNA3 μ L, dNTP5 μ L, 10XPCR damping fluid 5 μ L, 25mM Mg
2+2 μ L, primer 10 μ M1.5 μ L; KOD-plus-NEO enzyme 1.5 μ L; DMSO1.5 μ L; H
2o30.5 μ L; The reaction conditions of described PCR: 94 DEG C of 2min; 98 DEG C of 10s, 68 DEG C of 30s, 35 circulations; 72 DEG C of 10min, 10 DEG C of 1min; Described ASABCG15 is made up of the nucleotide sequence shown in SEQ ID No:16;
(2) reclaim pcr amplification product, and pcr amplification product is connected with carrier PMD20, obtain connection product; Connection product is converted into host cell, 37 DEG C of incubated overnight; Then picking list bacterium is to LB liquid nutrient medium incubated overnight; Extract plasmid, then detect positive plasmid, and the insertion sequence in plasmid is checked order, confirm that insertion sequence is ASABCG15 sequence, obtain PMD20-ASABCG15 carrier; PMD20-ASABCG15 carrier and pOsAct2-nos carrier are carried out to double digestion by Kpn I and EcoR I simultaneously, enzyme is cut to product and reclaim, connect, transform, be built into pOsAct2-ASABCG15 carrier; POsAct2-ASABCG15 carrier is arrived to EHA105 bacterial strain by Agrobacterium-mediated Transformation, obtained strains called after EHA105-pOsAct2-ASABCG15 after transforming;
(3) cultivate Rice Callus, EHA105-pOsAct2-ASABCG15 is transformed in Rice Callus by the method for agrobacterium mediation converted, then utilize hygromycin gene to carry out positive detection to transgenic seedling, and the rna expression amount to ABCG15 detects, select performance holandry sterile and can't detect the plant of ABCG15 expression amount, be the rice male core sterile material obtaining by RNAi technology; Wherein said ABCG15 is a kind of gene of controlling rice fertility, and this gene is made up of the nucleotide sequence shown in SEQ ID NO:1.
2. produce the PCR primer that utilizes RNA technology control DNA fragmentation of the sense-rna of the rice fertility gene of sequence as shown in SEQ ID No:1 as shown in SEQ ID No:16 for increasing, it is characterized in that described primer is made up of the nucleotide sequence shown in SEQ ID No:4 and SEQ ID No:5.
3. for generation of the DNA fragmentation that utilizes RNAi technology control sense-rna of the rice fertility gene of sequence as shown in SEQ ID No:1, it is characterized in that described DNA fragmentation is made up of the nucleotide sequence shown in SEQ ID No:16.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310241968.9A CN103320463B (en) | 2012-03-07 | 2012-03-07 | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310241968.9A CN103320463B (en) | 2012-03-07 | 2012-03-07 | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100579528A Division CN102634522B (en) | 2012-03-07 | 2012-03-07 | Gene for controlling rice fertility, encoded protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103320463A CN103320463A (en) | 2013-09-25 |
| CN103320463B true CN103320463B (en) | 2014-07-23 |
Family
ID=49189505
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310241968.9A Expired - Fee Related CN103320463B (en) | 2012-03-07 | 2012-03-07 | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103320463B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058351B (en) * | 2017-03-31 | 2020-06-09 | 西南大学 | Mutant gene of rice nuclease gene OsGEN-L and application thereof |
| CN109439667A (en) * | 2017-09-30 | 2019-03-08 | 海南波莲水稻基因科技有限公司 | Application of the corn gene ZmABCG20 in regulation crop male fertile |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101037695A (en) * | 2006-03-16 | 2007-09-19 | 华中农业大学 | Control gene of paddy pollen fertility and application |
| CN101333533A (en) * | 2008-07-25 | 2008-12-31 | 华南农业大学 | Temperature sensing male fertile gene and use thereof |
| CN101492682A (en) * | 2008-01-23 | 2009-07-29 | 华南农业大学 | Rice hybrid pollen fertility gene and uses thereof |
-
2012
- 2012-03-07 CN CN201310241968.9A patent/CN103320463B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101037695A (en) * | 2006-03-16 | 2007-09-19 | 华中农业大学 | Control gene of paddy pollen fertility and application |
| CN101492682A (en) * | 2008-01-23 | 2009-07-29 | 华南农业大学 | Rice hybrid pollen fertility gene and uses thereof |
| CN101333533A (en) * | 2008-07-25 | 2008-12-31 | 华南农业大学 | Temperature sensing male fertile gene and use thereof |
Non-Patent Citations (2)
| Title |
|---|
| ncbi.os06g0607700[oryzasativa japonica group].《Genbank》.2010, |
| os06g0607700[oryzasativa japonica group];ncbi;《Genbank》;20100608;序列 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103320463A (en) | 2013-09-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102634522B (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| JP6393478B2 (en) | Soybean plant and seed corresponding to transgenic event MON87712 and method for detecting it | |
| CN107988229A (en) | A kind of method for obtaining the rice that tiller changes using CRISPR-Cas modification OsTAC1 genes | |
| CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
| CN107129993B (en) | Modified glyphosate-resistant gene and cultivation method of glyphosate-resistant rice | |
| CN104878091B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9978 | |
| WO2019154373A1 (en) | Insect-resistant herbicide-tolerant corn transformation event | |
| CN105755021A (en) | Rice cadmium-tolerant gene OsGSTU37 and application thereof | |
| CN112626080B (en) | R gene for controlling soybean-rhizobium matching property, protein and application thereof | |
| AU2019460919B2 (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method therefor | |
| CN104878092B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9953 | |
| CN107338230B (en) | The application of OsMPK11 albumen and its encoding gene in regulation plant drought resistance | |
| CN105585619B (en) | With rice grain grain length and grain weight GAP-associated protein GAP and its encoding gene GL3-3 and application | |
| CN110881367A (en) | Corn event Ttrans-4 and methods of use thereof | |
| CN103320463B (en) | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene | |
| CN109456969B (en) | Rice brown planthopper-harming inducible promoter and application thereof | |
| CN106047887A (en) | Dahurian larch LkANT gene, protein and applications | |
| CN106146638B (en) | It is a kind of control Senescence of Rice gene and its coding protein | |
| CN105039316A (en) | Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene | |
| CN104846084B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9927 | |
| CN104878097B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9981 | |
| CN109504703B (en) | Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs1D construct and breeding application method thereof | |
| CN106701820A (en) | Method for improving and utilizing key genes of wild rice | |
| CN112080481B (en) | Spike-type related gene OsFRS5 and application and phenotype recovery method thereof | |
| CN115851821B (en) | Application of BBX16 gene in improving plant salt tolerance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140723 Termination date: 20180307 |