CN104878092B

CN104878092B - Nucleic acid sequence and its detection method for detecting corn plant DBN9953

Info

Publication number: CN104878092B
Application number: CN201510218649.5A
Authority: CN
Inventors: 丁德荣; 康越景; 张云珠; 刘海利; 庞洁; 王利君; 贾志伟; 黄金存; 郭函子; 王磊; 傅学乾; 周毅; 李风; 鲍晓明; 吕玉平; 张世平
Original assignee: Beijing Dabeinong Technology Group Co Ltd; Beijing Dabeinong Biotechnology Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2015-04-30
Filing date: 2015-04-30
Publication date: 2018-10-26
Anticipated expiration: 2035-04-30
Also published as: CN104878092A

Abstract

The present invention relates to a kind of nucleic acid sequences and its detection method for detecting corn plant DBN9953, and the nucleic acid sequence of the corn plant includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series.Corn plant DBN9953 of the present invention is to lepidopterous insects with preferable resistance and to glyphosate herbicidal with preferable tolerance, on yield without influence, and detection method can quickly and accurately identify the DNA molecular for whether including transgenic corn events DBN9953 in biological sample.

Description

Nucleic acid sequence and its detection method for detecting corn plant DBN9953

Technical field

The present invention relates to a kind of nucleic acid sequences and its detection method for detecting corn plant DBN9953, especially relate to And it is a kind of resistant to insect and be resistant to glyphosate herbicidal application transgenic corn events DBN9953 and for detecting life Whether the nucleic acid sequence and its detection method of specific transgenic corn events DBN9953 are included in object sample.

Background technology

Many areas are all main cereal crops to corn (Zea mays L.) in the world.Biotechnology has been applied In corn to improve its economical character and quality.Insect-resistant is an important economical character in maize production, especially To resistance of lepidopterous insects, such as corn borer, bollworm, armyworm etc..Corn can be by turning to the resistance of lepidopterous insects The method of gene makes the resistant gene of lepidopterous insects express and obtain in corn plant.Another important economical character is Herbicide tolerant is especially resistant to glyphosate herbicidal.Corn can pass through transgenosis to the tolerance of glyphosate herbicidal Method so that glyphosate herbicide tolerant type gene (such as EPSPS) is expressed and is obtained in corn plant.

Expression of the known foreign gene in plant is influenced by their chromosome location, it may be possible to due to dyeing Matter structure (such as heterochromatin) or transcription regulatory element (such as enhancer) are close to integration site.Thus, it usually needs screening is a large amount of Event be possible to identify can be with commercialized event (target gene imported obtains the event of optimal expression).Example Such as, have been observed that the expression quantity of quiding gene there may be very big difference between event in plant and other organisms；In table On the space reached or temporal mode may there is also differences, such as between different plant tissues transgenosis relative expression exist it is poor Different, this species diversity shows that actual expression pattern may be pre- with the transcription regulatory element institute in the gene construct according to importing The expression pattern of phase is inconsistent.It is thus typically necessary to generate hundreds and thousands of different events and filter out from these events Single incident with transgene expression amount and expression pattern desired for the purpose of commercialization.With expected transgenosis table Event up to amount and expression pattern can be used for that transgenosis is penetrated into other by sexual cutcross using conventional breeding methods In genetic background.The offspring generated by this Crossing system maintains the transgenic expression characteristics of original transformant.Using this Kind strategy pattern may insure there is reliable gene expression in many kinds, and these kinds can well adapt to locality Growth conditions.

The presence of particular event can be detected to determine whether the offspring of sexual hybridization will be beneficial comprising target gene. In addition, the method for detection particular event also will be helpful to abide by relevant laws and regulations, such as thrown from the food of recombination crops It needs to obtain official approval and be marked before entering market.Transgenosis is detected by any well known polynucleotides detection method Presence be all it is possible, such as PCR (PCR) or using polynucleotide probes DNA hybridization.These detections Method is usually focused on common genetic elements, such as promoter, terminator, marker gene etc..Therefore, unless with insertion turn The sequence of the adjacent chromosomal DNA of gene DNA (" flanking DNA ") is known, and above-mentioned this method cannot be used to distinguish Different events, especially those events generated with identical DNA construct.Insertion is spanned so often utilizing at present The pair of primers of the junction of transgenosis and flanking DNA identifies transgenosis particular event by PCR, specifically includes The first primer in flanking sequence and the second primer comprising insetion sequence.

Invention content

The object of the present invention is to provide a kind of for detecting the nucleic acid sequence and its detection method of corn plant DBN9953, Transgenic corn events DBN9953 to insect with preferable resistance and to glyphosate herbicidal with preferable tolerance, and Detection method can quickly and accurately identify whether the DNA comprising specific transgenic corn events DBN9953 divides in biological sample Son.

To achieve the above object, the present invention provides a kind of nucleic acid sequence, SEQ ID NO:3 or its complementary series at least 11 continuous nucleotide, and/or SEQ ID NO:4 or its complementary series at least 11 continuous nucleotide.

Preferably, the nucleic acid sequence includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its mutually Complementary series.

Further, the nucleic acid sequence includes SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its Complementary series.

Further, the nucleic acid sequence includes SEQ ID NO:5 or its complementary series.

The SEQ ID NO:1 or its complementary series be transgenic corn events DBN9953 in insetion sequence 5 ' end End is located at the sequence that a length being inserted near junction is 22 nucleotide, the SEQ ID NO:1 or its complementary sequence Row span the DNA sequence dna of the flanking genomic DNA sequence of corn insertion point and 5 ' ends of insetion sequence, including described SEQ ID NO:1 or its complementary series can be accredited as the presence of transgenic corn events DBN9953.The SEQ ID NO:2 Or its complementary series is to be located to be inserted near junction in 3 ' ends of insetion sequence in transgenic corn events DBN9953 One length is the sequence of 22 nucleotide, the SEQ ID NO:2 or its complementary series span 3 ' ends of insetion sequence DNA sequence dna and corn insertion point flanking genomic DNA sequence, including the SEQ ID NO:2 or its complementary series be The presence of transgenic corn events DBN9953 can be accredited as.

In the present invention, the nucleic acid sequence can be the SEQ ID NO:3 or its complementary series transgenic be inserted into sequence Any portion of at least 11 or more continuous polynucleotides (the first nucleic acid sequence) of row, or be the SEQ ID NO: 3 or its complementary series in 5 ' flank corn gene group DNA regions any portion of at least 11 or more continuous multinuclear glycosides Sour (second nucleotide sequence).It includes the complete SEQ ID that the nucleic acid sequence, which may further be with being derived from or being complementary to, NO:The 1 SEQ ID NO:3 part.When the first nucleic acid sequence is when second nucleotide sequence is used together, these nucleic acid Sequence includes DNA primer group generating the DNA cloning method of amplified production.Using DNA primer in DNA cloning method The amplified production of generation be include SEQ ID NO:When 1 amplified production, can diagnose transgenic corn events DBN9953 or its The presence of offspring.Well known to those skilled in the art, the first and second nucleic acid sequences need not be only made of DNA, may also comprise The mixture or DNA, RNA of RNA, DNA and RNA or it is other not as the nucleotide of one or more polymerase templates or its The combination of analog.In addition, heretofore described probe or primer should be at least about 11,12,13,14,15,16,17, 18, the length of 19,20,21 or 22 continuous nucleotides can be selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4 and SEQ ID NO:Nucleotide described in 5.When selected from SEQ ID NO:3,SEQ ID NO:4 Hes SEQ ID NO:Shown in 5 when nucleotide, the probe and primer can be length be at least about 21 to about 50 or More continuous nucleotides.The SEQ ID NO:3 or its complementary series be transgenic corn events DBN9953 in be inserted into sequence 5 ' ends of row are located at the sequence that a length being inserted near junction is 1295 nucleotide, the SEQ ID NO:3 Or its complementary series is by corn flanking genomic DNA sequence (the SEQ ID NO of 1105 nucleotide:3 nucleotide 1-1105), DBN10124 constructs DNA sequence dna (the SEQ ID NO of 141 nucleotide:3 nucleotide 1106-1246) and 49 nucleotide T35S terminators 3 ' end DNA sequences (SEQ ID NO:3 nucleotide 1247-1295) composition, including the SEQ ID NO:3 or its complementary series can be accredited as the presence of transgenic corn events DBN9953.

The nucleic acid sequence can be the SEQ ID NO:Any portion of 4 or its complementary series transgenic insetion sequence At least 11 or more the continuous polynucleotides (third nucleic acid sequence) divided, or be the SEQ ID NO:4 or it is complementary Any portion of at least 11 or more continuous polynucleotides (the 4th cores in 3 ' flank corn gene group DNA regions in sequence Acid sequence).It includes the complete SEQ ID NO that the nucleic acid sequence, which may further be with being derived from or being complementary to,:2 it is described SEQ ID NO:4 part.When third nucleic acid sequence is when the 4th nucleic acid sequence is used together, these nucleic acid sequences are generating The DNA cloning method of amplified production includes DNA primer group.The amplification generated in DNA cloning method is produced using DNA primer Object be include SEQ ID NO:When 2 amplified production, transgenic corn events DBN9953 or the presence of its offspring can be diagnosed. The SEQ ID NO:4 or its complementary series be transgenic corn events DBN9953 in 3 ' ends of insetion sequence be located at insert Enter the sequence that a length near junction is 1178 nucleotide, the SEQ ID NO:4 or its complementary series by 87 TNos (rouge alkali synthetase) transcription terminator sequences (SEQ ID NO of a nucleotide:4 nucleotide 1-87), 77 nucleosides DBN10124 constructs DNA sequence dna (the SEQ ID NO of acid:4 nucleotide 88-164) and the corn of 1014 nucleotide integrate Site flanking genomic DNA sequence (SEQ ID NO:4 nucleotide 165-1014) composition, including the SEQ ID NO:4 or Its complementary series can be accredited as the presence of transgenic corn events DBN9953.

The SEQ ID NO:5 or its complementary series be that characterize the length of transgenic corn events DBN9953 be 9477 The sequence of nucleotide, the genome and genetic elements for including specifically are as shown in table 1.Including the SEQ ID NO:5 or its mutually Complementary series can be accredited as the presence of transgenic corn events DBN9953.

Table 1, SEQ ID NO:5 genomes for including and genetic elements

The nucleic acid sequence or its complementary series can be used in DNA cloning method to generate amplicon, the inspection of the amplicon Survey diagnosis biological sample transgenic corn event DBN9953 or the presence of its offspring；The nucleic acid sequence or its complementary series It can be used in nucleotide detection method, to detect the presence of biological sample transgenic corn event DBN9953 or its offspring.

To achieve the above object, the present invention also provides a kind of DNA of detection sample transgenic corn event DBN9953 Existing method, including：

Detected sample is set to be contacted in nucleic acid amplification reaction at least two primers；

Carry out nucleic acid amplification reaction；

Detect the presence of amplified production；

The amplified production includes SEQ ID NO:3 or its complementary series at least 11 continuous nucleotide or SEQ ID NO:4 or its complementary series at least 11 continuous nucleotide.

Further, the amplified production includes SEQ ID NO:1 or its complementary series in 1-11 or 12-22 Continuous nucleotide or SEQ ID NO:2 or its complementary series in 1-11 or 12-22 continuous nucleotides.

Further, the amplified production includes SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its mutually Complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

In the above-mentioned technical solutions, the primer includes at least one nucleic acid sequence.

Specifically, the primer includes the first primer and the second primer, and the first primer is selected from SEQ ID NO:8 Hes SEQ ID NO:10；Second primer is selected from SEQ ID NO:9 and SEQ ID NO:11.

To achieve the above object, the present invention also provides a kind of detection sample transgenic corn event DBN9953's Method existing for DNA, including：

Detected sample is set to be contacted with probe, the probe includes SEQ ID NO:3 or its complementary series at least 11 Continuous nucleotide or SEQ ID NO:4 or its complementary series at least 11 continuous nucleotide；

The detected sample and the probe is set to hybridize under stringent hybridization conditions；

Detect the hybridisation events of the detected sample and the probe.

The stringent condition can be in 6 × SSC (sodium citrate), 0.5%SDS (lauryl sodium sulfate) solution, Hybridize at 65 DEG C, then respectively washes film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.

Further, the probe includes SEQ ID NO:1 or its complementary series in 1-11 or 12-22 it is continuous Nucleotide or SEQ ID NO:2 or its complementary series in 1-11 or 12-22 continuous nucleotides.

Further, the probe includes SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary sequence Row, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

Selectively, at least one probe is marked at least one fluorophor.

Detected sample is set to be contacted with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:3 or At least 11 continuous nucleotide or SEQ ID NO in its complementary series:4 or its complementary series at least 11 it is continuous Nucleotide；

The detected sample and the marker nucleic acid molecules is set to hybridize under stringent hybridization conditions；

The hybridisation events of the detected sample and the marker nucleic acid molecules are detected, and then are educated by marker auxiliary Kind analysis is to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecules are chain on science of heredity.

Further, the marker nucleic acid molecules include SEQ ID NO:1 or its complementary series in 1-11 or 12-22 continuous nucleotides or SEQ ID NO:2 or its complementary series in 1-11 or 12-22 continuous nucleotides.

Further, the marker nucleic acid molecules include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 Or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

To achieve the above object, the present invention also provides a kind of DNA detection kits, including at least one DNA molecular, institutes It includes SEQ ID NO to state DNA molecular:At least 11 continuous nucleotide or SEQ in 3 homologous sequence or its complementary series ID NO:At least 11 continuous nucleotide in 4 homologous sequence or its complementary series can be used as transgenic corns Event DBN9953 or its offspring have the DNA primer or probe of specificity.

Further, the DNA molecular includes SEQ ID NO:1 or its complementary series in 1-11 or 12-22 Continuous nucleotide or SEQ ID NO:2 or its complementary series in 1-11 or 12-22 continuous nucleotides.

Further, the DNA molecular includes SEQ ID NO:1 homologous sequence or its complementary series, SEQ ID NO:2 homologous sequence or its complementary series, SEQ ID NO:6 homologous sequence or its complementary series or SEQ ID NO:7 Homologous sequence or its complementary series.To achieve the above object, the present invention also provides a kind of plant cells, including coding insect The nucleic acid sequence of resistance Cry1Ab albumen, the nucleic acid sequence for encoding glyphosate herbicide tolerance EPSPS albumen and specific region Nucleic acid sequence, the nucleic acid sequence of the specific region includes SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:6 or SEQ ID NO:Sequence shown in 7.

To achieve the above object, the present invention also provides a kind of protection corn plants from the method for insect infestations, including At least one transgenic corn plant cell is provided in the diet of target insect, the transgenic corn plant cell is in its gene All include to be selected from SEQ ID NO in group:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7, the target for the transgenic corn plant cell of ingesting Insect is suppressed the corn plant of further ingesting.

To achieve the above object, protect corn plant from damaging caused by herbicide the present invention also provides a kind of Method, including the big Tanaka for planting at least one rotaring gene corn plant will be applied to containing effective dose glyphosate herbicidal, The rotaring gene corn plant includes to be selected from SEQ ID NO in its genome:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQID NO:At least one of sequence nucleic acid sequence shown in 7, described turn Gene corn plant has the tolerance to glyphosate herbicidal.

To achieve the above object, the present invention also provides it is a kind of control maize planting plant big Tanaka weeds method, Plant the big Tanaka of at least one rotaring gene corn plant including that will be applied to containing effective dose glyphosate herbicidal, described turn Gene corn plant includes to be selected from SEQ ID NO in its genome:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7, it is described to turn base Because corn plant has the tolerance to glyphosate herbicidal.

To achieve the above object, the present invention also provides it is a kind of cultivate the corn plant resistant to insect method, Including：

An at least corn seed is planted, the genome of the corn seed includes coding insect-resistant Cry1Ab albumen Nucleic acid sequence and specific region nucleic acid sequence；

The corn seed is set to grow up to plant；

The plant described in target insect infestations harvests compared with the plant of other nucleic acid sequences for not having specific region The plant of plant injury with decrease；

The nucleic acid sequence of the specific region is selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7.

To achieve the above object, the present invention also provides the corns that a kind of culture has glyphosate herbicidal tolerance The method of plant, including：

An at least corn seed is planted, the genome of the corn seed includes coding glyphosate herbicide tolerance The nucleic acid sequence of EPSPS albumen and the nucleic acid sequence of specific region；

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of specific region with other The plant of sequence compares the plant with the plant injury weakened；

To achieve the above object, a kind of resistant to insect the present invention also provides culture and tolerance Gyphosate herbicice The method of the corn plant of agent, including：

An at least corn seed is planted, the genome of the corn seed includes coding insect-resistant Cry1Ab albumen Nucleic acid sequence, encode glyphosate herbicide tolerance EPSPS albumen nucleic acid sequence and specific region nucleic acid sequence；

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of specific region with other The plant of sequence compares the plant with the plant injury weakened, and the plant pair insect with the plant injury weakened is taken the photograph Food damage is also resistant；

To achieve the above object, the present invention also provides it is a kind of generate the plant resistant to insect method, Include nucleic acid sequence and the specific region that coding insect-resistant Cry1Ab albumen is introduced into the genome of the plant The nucleic acid sequence of nucleic acid sequence, the specific region is selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7.

Specifically, the method for generating the plant resistant to insect includes：

It will be to resistant the first parental maize plants of transgenic corn events DBN9953 of insect and lacking insect-resistant The second parental maize plant sexual hybridization, to generate a large amount of progeny plants；

The progeny plant described in target insect infestations；

It selects compared with the plant of other nucleic acid sequences for not having specific region to have described in the plant injury weakened Progeny plant；

The transgenic corn events DBN9953 includes to be selected from SEQ ID NO in its genome:1,SEQ ID NO:2, SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one in sequence shown in 7 Kind nucleic acid sequence.

To achieve the above object, the present invention also provides a kind of corns for generating and having tolerance to glyphosate herbicidal The method of plant includes the nucleic acid sequence that coding glyphosate tolerant EPSPS albumen is introduced into the genome of the plant The nucleic acid sequence of the nucleic acid sequence of row and specific region, the specific region is selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence core shown in 7 Acid sequence.

Specifically, described generate includes to the method for plant of the glyphosate herbicidal with tolerance：

By first parental maize plants of transgenic corn events DBN9953 to glyphosate herbicidal with tolerance and lack Second parental maize plant sexual hybridization of few glyphosate tolerant, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate herbicidal；

The progeny plant of selection tolerance glyphosate；

To achieve the above object, and tolerance glyphosate herbicidal resistant to insect is generated the present invention also provides a kind of The method of the plant of application, including：

By the first parental maize plants of transgenic corn events DBN9953 of glyphosate tolerance and insect-resistant and lack grass Second parental maize plant sexual hybridization of sweet phosphine tolerance and/or insect-resistant, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate；

The progeny plant of selection tolerance glyphosate, is resistant to feeding damage of the progeny plant to insect of glyphosate Also resistant；

To achieve the above object, include SEQ ID NO the present invention also provides one kind:1 or SEQ ID NO:2 multinuclear glycosides The composition of acid, the composition are corn flour, maize flour, corn oil, corn silk or cornstarch.

To achieve the above object, include SEQ ID NO the present invention also provides one kind:1 or SEQ ID NO:2 multinuclear glycosides The agricultural product or commodity of acid, the agricultural product or commodity are corn flour, maize flour, corn oil, cornstarch, corn gluten, jade Rice cake, cosmetics or filler.

In the present invention in detecting the nucleic acid sequence and its detection method of corn plant, defined below and method can be more The present invention is defined well and those skilled in the art is instructed to implement the present invention, it is unless otherwise mentioned, general according to this field Lead to the conventional usage of technical staff to understand term.

" corn " refers to maize (Zea mays), and includes all plant varieties that can be mated with corn, Including field corn kind.

The "comprising" refers to " including but not limited to ".

Term " plant " includes that whole plant, plant cell, plant organ, plant protoplast, plant can therefrom again It is complete in raw plant cell tissue cultures, plant callus, vegetation bed (plant clumps) and plant or plant part Whole plant cell, the plant part such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stalk, root, the tip of a root, flower Medicine etc..The part for the genetically modified plants being interpreted as in the scope of the invention includes but not limited to plant cell, protoplast, group It knits, callus, embryo and flower, stem, fruit, Ye Hegen, the above plant part are originated from the DNA molecular conversion with the present invention in advance And the genetically modified plants being therefore made of at least partly transgenic cell or its filial generation.

Term " gene " refers to expressing the nucleic acid fragment of specific protein, including regulatory sequence (5 ' the non-volumes before coded sequence Code sequence) and coded sequence after regulatory sequence (3 ' non-coding sequence)." natural gene " refers to natural find with its own The gene of regulatory sequence." mosaic gene " refers to any gene for not being natural gene, it includes non-natural find adjusting and Coded sequence." endogenous gene " refers to natural gene, and the natural gene is located at its natural place in organism genome. " foreign gene " is the existing alien gene for being to be not present in the genome of biology and originally, also refers to and is imported through Transgenic procedures The gene of recipient cell.Foreign gene can include the natural gene or mosaic gene for being inserted into non-native organism." transgenosis " It is the gene that genome is had been incorporated by Transformation Program.The site that recombinant DNA has been inserted into Plant Genome can claim For " insertion point " or " target site ".

" flanking DNA " can include the genome being naturally occurring in the organism of such as plant or be drawn by conversion process External source (heterologous) DNA entered, for example, with the relevant segment of transformation event.Therefore, flanking DNA may include natural and exogenous DNA Combination.In the present invention, " flanking region " or " flanking sequence " or " genome frontier district " or " genome border sequence " refer to The base-pair of at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 is longer Sequence, be located at initial external source be inserted into DNA molecular immediately upstream or downstream and with initial external source be inserted into DNA molecular phase It is adjacent.When the flanking region is located at downstream, it is referred to as " left margin flank " or " 3 ' flank " or " 3 ' genome frontier district " Or " 3 ' border sequence of genome " etc..When the flanking region is located at upstream, it is referred to as " right margin flank " or " 5 ' sides The wing " or " 5 ' genome frontier district " or " 5 ' border sequence of genome " etc..

Cause the Transformation Program of the random integration of exogenous DNA that can lead to the transformant containing different flanking regions, the difference Flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, flanking region is logical Chang Buhui changes.Transformant also can be containing between heterologous insertion DNA and the section of genomic DNA or between two sections of genomic DNAs Or the unique engagement between two sections of allogeneic dna sequence DNAs." engagement " is the point of two specific DNA fragmentation connections.For example, engagement exists In the position of insert DNA connection flanking DNAs.Junction is also present in the organism of conversion, and two of which DNA fragmentation is to repair Adorn linking together for the mode found from native organism." engagement DNA " refers to the DNA for including junction.

The present invention provides the referred to as transgenic corn events of DBN9953 and its offspring, the transgenic corn events DBN9953 is corn plant DBN9953 comprising the Plants and Seeds of transgenic corn events DBN9953 and its plant are thin Born of the same parents or its renewable part, the plant part of the transgenic corn events DBN9953, including but not limited to cell, pollen, embryo Pearl, flower, bud, root, stem, fringe silk, inflorescence, ear fringe, leaf and the product from corn plant DBN9953, such as corn flour, corn Face, corn oil, corn steep liquor, corn silk, cornstarch and the biomass for staying in corn crop field.

Transgenic corn events DBN9953 of the present invention contains a DNA construct, when it is expressed in plant cell When, the transgenic corn events DBN9953 obtains the resistance to insect and the tolerance to glyphosate herbicidal.The DNA Construct includes two concatenated expression cassettes, and first expression cassette includes suitable promoter for being expressed in plant and suitable The polyadenylation signal sequence of conjunction, the promoter are operably connected the nucleic acid sequence of Cry1Ab albumen, described The nucleic acid sequence of Cry1Ab albumen is mainly resistant to lepidopterous insects.Second expression cassette includes for being expressed in plant Suitable promoter and suitable polyadenylation signal sequence, the promoter be operably connected coding 5- enols- The nucleic acid sequence of the gene of pyruvoyl shikimic acid -3- phosphate synthases (EPSPS), the EPSPS albumen has glyphosate herbicidal There is tolerance.Further, the promoter can be the suitable promoter that is detached from plant, including composing type, induction type and/ Or tissue-specific promoter, the suitable promoter include but not limited to, cauliflower mosaic virus (CaMV) 35S promoter, Figwort mosaic virus (FMV) 35S promoter, ubiquitin protein (Ubiquitin) promoter, actin (Actin) promoter, soil Earth Agrobacterium (Agrobacteriumtumefaciens) rouge alkali synthetase (NOS) promoter, octopine synthase (OCS) open Mover, Cestrum (Cestrum) yellow leaf curl virus promoter, patatin (Patatin) promoter, core Ketose -1,5- diphosphonic acid carboxylases/oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 are opened Mover, GOS promoters, alcA/alcR promoters, Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promoters With Arabidopsis (Arabidopsis thaliana) Suc2 promoters.The polyadenylation signal sequence can be to plant The suitable polyadenylation signal sequence to work in object, the suitable polyadenylation signal sequence include but unlimited In from the polyadenosine of soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Polyadenylation signal sequence derives from cauliflower mosaic virus (CaMV) 35S terminators, derives from protease-inhibitor Ⅱ (PIN II) The polyadenylation signal sequence of gene and the polyadenylation signal for deriving from alpha-tubulin (α-tubulin) gene Sequence.

In addition, the expression cassette can also include other genetic elements, the genetic elements include but not limited to enhance Son and signal peptide/transit peptides.The enhancer can enhance the expression of gene, and the enhancer includes but not limited to cigarette Careless etch virus (TEV) translation activity factor, CaMV35S enhancers and FMV35S enhancers.Signal peptide/the transit peptides can be with Guide Cry1Ab albumen and/or EPSPS Protein transports to extracellular or intracellular specific organelle or compartment, for example, sharp Chloroplaset is targeted with encoding chloroplast transit peptide sequence, or utilizes ' KDEL ' to retain sequence and targets endoplasmic reticulum.

The Cry1Ab genes can be from thuringiensis (Bacillus thuringiensis, abbreviation Bt) Isolated, and can be by optimizing codon or changing the nucleotide sequence of Cry1Ab genes in other ways, to reach To the stability of transcript and the purpose of utilizability in increase transformed cells.

" Lepidoptera ", scientific name Lepidoptera, including moth, two class insect of butterfly are one of agriculture and forestry injurious insect at most Mesh, such as corn borer, bollworm, east armyworm, 2 committee noctuid insect, dichocrocis punctiferalis.

5- enol-pyrovyls shikimic acid -3- phosphate synthases (EPSPS) gene can be from soil Agrobacterium It is isolated in (Agrobacterium tumefaciens sp.) CP4 bacterial strains, and can by optimize codon or In other ways change coding EPSPS genes polynucleotides, with reach increase transformed cells in transcript stability and can The purpose of usability.5- enol-pyrovyls shikimic acid -3- phosphate synthases (EPSPS) gene can also be used as selective mark Remember gene.

" glyphosate " refers to the salt of N- phosphonomethylglycines and it, and it refers to using to be handled with " glyphosate herbicidal " The herbicide formulations that any type contains glyphosate are handled.In order to reach ebd and to certain glyphosate system Technical ability of the selection of agent utilization rate no more than common agronomic technique personnel.Contain the herbicide formulations of glyphosate using any type Processing contains the field of the vegetable material from transgenic corn events DBN9953, will control the weeds in the field Growth, and do not influence to derive from growth or the yield of the vegetable material of transgenic corn events DBN9953.

The DNA construct is introduced in using method for transformation in plant, and the method for transformation includes but not limited to agriculture bar Bacterium (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.

The Agrobacterium_mediated method is the common method of Plant Transformation.The exogenous DNA gram that will be introduced into plant Between the grand left and right boundary consensus sequence to carrier, i.e. areas T-DNA.The carrier is transformed into agrobatcerium cell, then, The agrobatcerium cell is organized for infection plant, including the areas T-DNA of the carrier of exogenous DNA are inserted into plant gene In group.

The Gene Knock-out Mice is with carrier bombardment plant cell (the biological bullet that particle mediates comprising exogenous DNA Hit conversion).

The pollen tube channel conversion method is that natural pollen tube channel (also known as pollen is formed by after pollinating using plant Pipe guides tissue), through megarchidium channel, exogenous DNA is carried into blastular.

After conversion, it is necessary to have from the plant tissue regenerating plants of conversion, and using suitable label selection The offspring of exogenous DNA.

DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassettes.DNA Construct preferably can the self-replacation in bacterial cell, and containing different restriction endonuclease sites plasmid, Contained restriction endonuclease sites provide functioning gene element, i.e. promoter, introne, targeting sequencing, volume for importing The DNA molecular of code sequence, 3 ' terminator regions and other sequences.Expression cassette contained in DNA construct includes providing courier Genetic elements necessary to the transcription of RNA, the expression cassette can be designed as expressing in prokaryotic cell or eukaryocyte.This hair Bright expression cassette is designed to most preferably express in plant cell.

Transgenosis " event " is as obtained from converting plant cell with heterologous DNA construct, that is, includes at least one Expression of nucleic acid box containing target gene is inserted into Plant Genome by transgene method to generate plant population, then The raw plant population, and selection have the specific plant for being inserted into specific gene group site feature.Term " event " refers to including different The original transformant of source DNA and the offspring of the transformant.Term " event " also refers to transformant and other kinds containing allogeneic dna sequence DNA Offspring obtained from sexual hybridization is carried out between individual, even if after with backcross parent be returned repeatedly, comes from transformant The insertion DNA and flanking genomic dna of parent exists in the same chromosome location in filial generation.Term " event " also refers to DNA sequence dna from original transformant, the DNA sequence dna include be inserted into DNA and be inserted into the close adjacent flanking genomes of DNA Sequence, which, which is expected, is transferred in filial generation, the filial generation by containing be inserted into DNA parental department (such as original transformant and It is selfed the filial generation generated) it is generated with sexual hybridization is carried out without containing the parental department for being inserted into DNA, and the filial generation receives and includes The insertion DNA of target gene.

" recombination " refers to the DNA that generally can not be found in nature and therefore be generated by manual intervention in the present invention And/or the form of albumen and/or organism.This manual intervention can generate recombinant DNA molecules and/or recombinant plant." the weight Group DNA molecular " is to be in other cases the sequence section of separation by two kinds of artificial combination by obtain, such as pass through chemistry Synthesis or the nucleic acid segment detached by genetic engineering technology operation.The technology for carrying out nucleic-acid manipulation is well-known.

Term " transgenosis " includes any cell, cell line, callus, tissue, plant part or plant, above base Because type due to heterologous nucleic acids there are due to change, " transgenosis " includes Transgenics initially changed in this way and by most The offspring individual that first Transgenics are generated by sexual hybridization or vegetative propagation.In the present invention, term " transgenosis " does not wrap (chromosome the or extrachromosomal) change by conventional plant breeding method or the natural genome that event occurs is included, it is described It is natural that for example random allogamy of event, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base or spontaneous prominent occurs Become.

" heterologous " refers to that the first molecule is not found usually and the second molecular combinations in nature in the present invention.For example, Molecule can be originated from the first species and be inserted into the genome of the second species.Therefore this molecule for host be it is heterologous and It is artificially introduced in the genome of host cell.

Culture is resistant to lepidopterous insects and has the transgenic corn events of tolerance to glyphosate herbicidal DBN9953 passes through following steps：Make the first parental corn plants and the second parental corn plants sexual hybridization first, to produce Given birth to various first generation progeny plant, first parental corn plants by cultivation transgenic corn event DBN9953 and The corn plant composition of its offspring, transgenic corn events DBN9953 and its offspring are by using the present invention to squama wing Mesh insect it is resistant and to glyphosate herbicidal have tolerance expression cassette convert obtained from, the second parental maize Plant lacks to the resistance of lepidopterous insects and/or has tolerance to glyphosate herbicidal；Then it selects to lepidopterous insects Invasion it is resistant and/or to glyphosate herbicidal have tolerance progeny plant, can cultivate to lepidopterous insects Corn plant resistant and that there is tolerance to glyphosate herbicidal.These steps, which may further include, makes Lepidoptera elder brother The progeny plant and the second parental corn plants or third parental corn plants of worm resistance and/or glyphosate tolerant are returned It hands over, then by being applied with lepidopteran insect infestation, glyphosate herbicidal or by (such as being wrapped with the relevant molecular marked compound of character The DNA molecular of bond site that the 5 ' ends and 3 ' ends of insetion sequence identify in DBN9953 containing transgenic corn events) identification Filial generation is selected, to generate corn plant to lepidopterous insects resistant and that there is tolerance to glyphosate herbicidal.

It will also be appreciated that two different genetically modified plants can also hybridize to generate containing there are two independent, separation The offspring of the foreign gene of formula addition.The selfing of appropriate offspring can obtain all being homozygous for the foreign gene of two additions The Progeny plants of son.It is also as previously described to be expected to the backcrossing of parental plant and with the cutcross of non-transgenic plant , vegetative propagation is also same.

Term " probe " is the nucleic acid molecules of one section of separation, is combined with conventional detectable label or report point above Son, for example, radioactive isotope, ligand, chemiluminescent agent or enzyme.One chain of this probe and target nucleic acid is complementary , in the present invention, probe and a DNA chain complementation from transgenic corn events DBN9953 genomes, no matter the gene Group DNA be from transgenic corn events DBN9953 or seed be also derived from transgenic corn events DBN9953 plant or Seed or extract.The present invention probe not only include DNA or ribonucleic acid, further include specifically with target DNA sequence dna combines and can be used for detecting the existing polyamide and other probe materials of the target dna sequence.

Term " primer " is the nucleic acid molecules of one section of separation, is hybridized by nucleic acid, annealed combination to complementary target dna On chain, heterozygote is formed between primer and target dna chain, then under the action of polymerase (such as archaeal dna polymerase), along mesh DNA chain is marked to extend.The primer pair of the present invention is related to its application in target nucleic acid sequence amplification, for example, passing through polymerase chain Formula reacts (PCR) or other conventional nucleic acid amplification methods.

The length of probe and primer is usually 11 polynucleotides or more, preferably 18 polynucleotides or more, More preferably 24 polynucleotides or more, most preferably 30 polynucleotides or more.This probe and primer are in height Specifically hybridize with target sequence under degree stringent hybridization condition.Although being protected different from target dna sequence and to target dna sequence Holding the probe of hybridization ability can design by conventional method, however, it is preferred to, probe and primer in the present invention There is complete DNA sequence dna homogeneity with the continuous nucleic acid of target sequence.

It can be determined by conventional method based on the primer and probe of flanking genomic dna and insetion sequence of the invention, For example, by detaching corresponding DNA molecular from the vegetable material from transgenic corn events DBN9953, and determining should The nucleic acid sequence of DNA molecular.The DNA molecular includes transgene insert sequence and Maize genome flank region, and the DNA divides The segment of son may be used as primer or probe.

The nucleic acid probe and primer of the present invention hybridizes with target dna sequence under strict conditions.Any conventional nucleic acid is miscellaneous Friendship or amplification method may be used to identify the presence of the DNA in sample from transgenic corn events DBN9953.Nucleic acid point Son or its segment can carry out specific hybrid with other nucleic acid molecules in any case.As the present invention uses, if two A nucleic acid molecules can form antiparallel double-strandednucleic acid structure, so that it may can be carried out specifically with saying the two nucleic acid molecules to each other Property hybridization.If two nucleic acid molecules show complete complementarity, it is another nucleic acid point to claim one of nucleic acid molecules " complement " of son.As the present invention uses, when each nucleotide and another nucleic acid molecules of a nucleic acid molecules The corresponding nucleotide mutual added time, then the two nucleic acid molecules is claimed to show " complete complementarity ".If two nucleic acid molecules can be with Enough stability phase mutual crosses then claim to make them anneal and be bonded to each other under the conditions of at least conventional " low stringent " The two nucleic acid molecules are " minimum level is complementary ".Similarly, if two nucleic acid molecules can be mutual with enough stability Hybridize that them is made to anneal and be bonded to each other under the conditions of conventional " height is stringent ", then the two nucleic acid molecules is claimed to have " complementarity ".Deviateing from complete complementarity can allow, as long as not exclusively to prevent two molecules from being formed double for this deviation Chain structure.In order to enable a nucleic acid molecules as primer or probe, it is only necessary to it is adequately complementary to ensure that it has in sequence Property, so that stable duplex structure can be formed under used specific solvent and salinity.

As the present invention uses, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules are in high stringency Specific hybrid can occur with the complementary strand of another section of nucleic acid molecules to match down.Promote the suitable stringent of DNA hybridization Then condition is used for example, about being handled with 6.0 × sodium chloride/sodium citrate (SSC) under the conditions of 45 DEG C under the conditions of 50 DEG C 2.0 × SSC is washed, these conditions are well known to those skilled in the art.For example, the salinity in washing step can be selected From about 2.0 × SSC of Low stringency conditions, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C.In addition, washing step In temperature condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of the room temperature of Low stringency conditions.Temperature strip Part and salinity can all change, can also one of them remain unchanged and another variable changes.Preferably, originally Invention a nucleic acid molecules can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with SEQ ID NO: 1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:In 7 Specific hybrid occurs for any segment of one or more nucleic acid molecules or its complementary series or above-mentioned sequence.It is highly preferred that The present invention a nucleic acid molecules under high stringency with SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:One or more nucleic acid molecules or its complementary series in 7, Or specific hybrid occurs for any segment of above-mentioned sequence.In the present invention, preferred marker nucleic acid molecules have SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned sequence any segment. Another preferred marker nucleic acid molecules of the present invention and SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:6 or SEQ ID NO:7 or any segment of its complementary series or above-mentioned sequence with 80% to 100% or 90% to 100% sequence it is same Property.SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:6 and SEQ ID NO:7 may be used as the mark in plant breeding method Remember object to identify the offspring of genetic cross.Probe can be art technology by any type with hybridizing for target dna molecule Method known to personnel is detected, these methods include but not limited to fluorescent marker, radioactive label, antibody class label And chemiluminescent labeling.

About the amplification (for example, passing through PCR) for using specific amplimer to carry out target nucleic acid sequence, " stringent item Part " refers to the condition for only allowing primer pair target nucleic acid sequence to hybridize in the hot amplified reactions of DNA, has and target core The primer of the corresponding wild-type sequence of acid sequence (or its complementary series), can be combined, and excellent with the target nucleic acid sequence Choosing generates unique amplified production, amplified production, that is, amplicon.

Term " specific binding (target sequence) " refer under stringent hybridization conditions probe or primer only with comprising target Target sequence in the sample of sequence hybridizes.

As the present invention uses, " by the DNA of amplification " or " amplicon " refer to the target as a nucleic acid-templated part The nucleic acid amplification product of nucleic acid sequence.For example, in order to determine corn plant whether by containing transgenic corn events of the present invention DBN9953 is generated by sexual hybridization mode, or whether acquisition includes transgenic corn events from the corn sample in field Whether DBN9953 or corn extract, such as coarse powder, powder or oil include transgenic corn events DBN9953, from corn plant Tissue sample or the DNA of extract extraction can be by using the nucleic acid amplification methods of primer pair to generate for transgenic corns The presence of the DNA of event DBN9953 is diagnostic amplicon.The primer pair include one in the Plant Genome with The first primer of the adjacent flanking sequence of exogenous DNA insertion point of insertion, and second draw from the exogenous DNA of insertion Object.Amplicon has certain length and sequence, and transgenic corn events DBN9953 described in the sequence pair is also diagnostic. The length range of amplicon can be that the combination length of primer pair adds a nucleotide base pair, preferably add about 50 cores Thuja acid base-pair more preferably adds about 250 nucleotide bases pair, most preferably adds about 450 nucleosides soda acids Base to or more.

Optionally, primer pair can derive from the flanking genomic sequence for being inserted into the both sides DNA, include entire be inserted into generate The amplicon of nucleotide sequence.One in the primer pair of plant genome sequences can be located at away from insertion DNA sequence dna At a certain distance from, which may range from a nucleotide base to arriving about 20,000 nucleotide bases pair.Term " amplification The use of son " has been particularly intended to exclude the primer dimer formed in the hot amplified reactions of DNA.

Nucleic acid amplification reaction can be realized by any type nucleic acid amplification reaction method known in the art, including polymerization Enzyme chain reaction (PCR).Various nucleic acid amplification methods have been well-known to those skilled in the art.PCR amplification method has been sent out Open up the genomic DNA of amplifiable 22kb and the phage DNA of 42kb.Other DNA cloning sides of these methods and this field Method can be used for the present invention.The exogenous DNA array of insertion and flanking DNA sequence from transgenic corn events DBN9953 can To be expanded to the genome of transgenic corn events DBN9953 by using the primer sequence provided, to PCR after amplification Amplicon or the DNA of clone carry out the DNA sequencing of standard.

DNA detection kits based on DNA cloning method contain DNA primer molecule, they are under reaction condition appropriate On specific hybrid to target dna and expand diagnostic amplicon.Kit can provide the detection method based on Ago-Gel Or many methods of checkout and diagnosis amplicon known in the art.Containing with SEQ ID NO:3 or SEQ ID NO:4 Any part in Maize genome area it is homologous or complementary and with SEQ ID NO:Any part of 5 transgenosis insert district The kit of homologous or complementary DNA primer is provided by the present invention.Particularly differentiate useful in DNA cloning method draw Object is to being SEQ ID NO:8 and SEQ ID NO:9,5 ' transgenosis/genome of amplification and transgenic corn events DBN9953 A part of homologous diagnostic amplicon in area, wherein amplicon include SEQ ID NO:1.Other DNA as DNA primer points Son can be selected from SEQ ID NO:5.

Amplicon caused by these methods can be detected by multiple technologies.One of method is Genetic Bit Analysis, this method devise one across the DNA widows for being inserted into DNA sequence dna and adjacent flanking genomic DNA sequence Nucleotide chain.The oligonucleotide chain is fixed in the micropore of a microwell plate, after carrying out PCR amplification to target area ( A primer is respectively used in insetion sequence and in adjacent flanking genomic sequence), single stranded PCR products can be with fixed few nucleosides Sour chain is hybridized, and as the template of single base extension, which has used archaeal dna polymerase and be next The ddNTPs of expected base specific markers.Result can be obtained by fluorescence or ELISA class methods.Signal represent insertion/ The presence of flanking sequence illustrates that amplification, hybridization and single base extension are successful.

Another method is Pyrosequencing (pyrosequencing) technology.This method devises one across insertion The oligonucleotide chain of DNA sequence dna and adjacent genomic DNA binding site.By the single-stranded of the oligonucleotide chain and target area PCR product (in insetion sequence and adjacent flanking genomic sequence in respectively use a primer) hybridized, then and Archaeal dna polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine -5 '-phosphorus sulfate and luciferin one It rises and is incubated.It is separately added into dNTPs, measures the optical signal of generation.Optical signal represents the presence of insertion/flanking sequence, Illustrate that amplification, hybridization and single base or polybase base extension are successful.

(the genome research (Genome Res.) 9 such as Chen:492-498,1999) Fluorescence polarization of description be also can For detecting a kind of method of amplicon of the present invention.It needs design one to cross in this way and is inserted into DNA sequence dna and phase The oligonucleotide chain of adjacent genomic DNA binding site.The single stranded PCR products of the oligonucleotide chain and target area (are being inserted Enter in sequence and respectively used in adjacent flanking genomic sequence a primer) hybridized, then with archaeal dna polymerase and one The ddNTP of kind fluorescent marker is incubated together.Single base extension can cause to be inserted into ddNTP.This insertion can utilize fluorescence Instrument measures the change of its polarization.The change of polarization represents the presence of insertion/flanking sequence, illustrates amplification, hybridization and single alkali Base extension is successful.

Taqman is described as a kind of detect and is carried in manufacturer with method, this method existing for quantitative analysis DNA sequence dna It is discussed in detail in the operation instruction of confession.It is now briefly illustrated below, designs one across insertion DNA sequence dna and adjacent base Because of the FRET oligonucleotide probes of group flank binding site.The FRET probes and PCR primer are (in insetion sequence and adjacent side A primer is respectively used in wing genome sequence) carry out circular response in the presence of heat-stabilised poly synthase and dNTPs.FRET probes Hybridization lead to the division of fluorescence part and quencher moieties and the release of fluorescence part on FRET probes.The generation of fluorescence signal The presence for representing insertion/flanking sequence illustrates that amplification and hybridization are successful.

Based on Hybridization principle, the suitable technology for detecting the vegetable material from transgenic corn events DBN9953 Can also include Southern blot hybridizations, Northern blot hybridizations and in situ hybridization.Particularly, the suitable technology includes Probe and sample are incubated, is washed to remove whether unbonded probe and detection probe have hybridized.The detection method takes The type certainly marked appended by probe, for example, by X-ray is exposed and developed can be or logical with the probe of detection of radioactive labels It crosses substrate conversion and realizes that color change can detect the probe of enzyme label.

(the Nature Biotechnol (Nat.Biotech.) 14 such as Tyangi:303-308,1996) molecular labeling is described in sequence Application in row detection.It is briefly described as follows, designs one across insertion DNA sequence dna and adjacent flanking genomic binding site FRET oligonucleotide probes.The unique texture of the FRET probes causes it to contain secondary structure, which can be close Apart from interior holding fluorescence part and quencher moieties.The FRET probes and PCR primer are (in insetion sequence and adjacent flanking gene A primer is respectively used in group sequence) carry out circular response in the presence of heat-stabilised poly synthase and dNTPs.By successful PCR Amplification, the hybridization of FRET probes and target sequence leads to the forfeiture of probe secondary structure, to make fluorescence part and quencher moieties It spatially detaches, generates fluorescence signal.The generation of fluorescence signal represents the presence of insertion/flanking sequence, explanation Amplification and hybridization are successful.

The method of other descriptions, such as method that microfluid (microfluidics) provides separation and DNA amplification sample And equipment.Photoinitiator dye is for detecting and measuring specific DNA molecular.Including electronic sensor or knot for detecting DNA molecules Close specific DNA molecular receive pearl and thus can be detected receive test tube (nanotube) equipment for the detection present invention DNA point Son is useful.

Method can be described using composition of the present invention and DNA detection fields or known is examined to develop DNA Test agent box.The kit is conducive to identify the DNA that whether there is transgenic corn events DBN9953 in sample, can be with Corn plant for cultivating the DNA containing transgenic corn events DBN9953.The kit can contain DNA primer or Probe, it is same to be derived from or be complementary to SEQ ID NO:1,2,3,4 or 5 at least part, or contain other DNA primers or spy Needle, with being derived from or being complementary to DNA contained in the genetically modified element of DNA, these DNA sequence dnas can be used for DNA cloning Reaction, or as the probe in DNA hybridization method.It is containing in the corn genome and what is illustrated in Fig. 1 and table 1 turns base Because the DNA structure of insetion sequence and Maize genome binding site includes：Corn positioned at 5 ' end of transgene insert sequence DBN9953 flanking genomes region, a part of insetion sequence in the right side boundary region (RB) from Agrobacterium, first expression Box is operably connected to arabidopsis EPSPS chloroplast transit peptides by 1 promoter of rice actin (prOsAct1) (spAtCTP2) on, it is operably connected to the 5- enol-pyrovyl thick grass of the glyphosate tolerant of Agrobacterium CP4 bacterial strains On acid -3- phosphate synthases (cEPSPS), and it is operably connected on cauliflower mosaic virus 35S terminators (t35S) and group At second expression cassette, can by the cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats containing enhancer region It is operatively coupled on maize Heat Shock 70kDa albumen introne (iZmHSP70), is operably connected to Su Yun gold gemma bars On the Cry1Ab albumen (cCry1Ab) of the insect-resistant of bacterium, and it is operably connected to the transcription terminator of nopaline synthase (tNos) it forms on, a part of insetion sequence of the left boundary area (LB) from Agrobacterium, and is inserted positioned at transgenosis Enter corn plant DBN9953 flanking genomes region (the SEQ ID NO of 3 ' end of sequence:5).In DNA cloning method, as The DNA molecular of primer can be derived from any part of transgenic corn events DBN9953 transgenic insetion sequences, also may be used To be derived from any part in the region of DNA domain of flank Maize genome in transgenic corn events DBN9953.

Transgenic corn events DBN9953 can be combined with other transgenic maize varieties, such as herbicide is (such as careless ammonium Phosphine, Mediben etc.) tolerance corn, or carry the transgenic maize varieties of other anti insect genes.All these differences turn base Because of the various combinations of event, the breeding together with the transgenic corn events DBN9953 of the present invention can provide anti-a variety of insect pests simultaneously Resist the improvement hybrid transgenic corn variety of a variety of herbicides.These kinds turn base compared to non-transgenic kind and unisexuality shape Because kind can show the superior features such as yield promotion.

The present invention provides a kind of nucleic acid sequence and its detection method for detecting corn plant, transgenic corn events DBN9953's is resistant to the feeding damage of lepidoptera pest, and is resistant to the plant of the agriculture herbicide containing glyphosate Toxic effect.The Cry1Ab albumen of the plant expression bacillus thuringiensis of the dual character, provides to Lepidoptera The resistance of pest (such as Ostrinia furnacalis) feeding damage, and express the 5- enols-of the glyphosate resistance of Agrobacterium strains CP4 Pyruvoyl shikimic acid -3- phosphate synthases (EPSPS) albumen assigns tolerance of the plant to glyphosate.Dual character corn tool It has the following advantages：1) from due to economic damage caused by lepidoptera pest (such as Ostrinia furnacalis, east armyworm and dichocrocis punctiferalis etc.) It loses, Ostrinia furnacalis, east armyworm and dichocrocis punctiferalis etc. are the primary pests of corn-growing regions；2) apply the agricultural containing glyphosate to remove Careless agent is used for the ability of broad-spectrum weeding control to corn crop；3) corn yield does not reduce.In addition, coding insect-resistant and grass The gene linkage of sweet phosphine tolerance trait is present in transgenic corn events DBN9953 genomes in same DNA section Term single gene seat on, this point provide the breeding efficiency of enhancing and make it possible to molecular labeling come track reproductive population and Transgenic insert in its filial generation.SEQ ID NO in detection method simultaneously:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series can conduct DNA primer or probe to generate the amplified production for being diagnosed as transgenic corn events DBN9953 or its offspring, and can quickly, Accurately, the presence for identifying the vegetable material from transgenic corn events DBN9953 stablized.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO:The insertion point and Maize genome of 5 ' transgenic fragments in 1 transgenic corn events DBN9953 11 nucleotide of every side of DNA；

SEQ ID NO:The insertion point and Maize genome of 3 ' transgenic fragments in 2 transgenic corn events DBN9953 11 nucleotide of every side of DNA；

SEQ ID NO:It is located in 5 ' ends of insetion sequence in 3 transgenic corn events DBN9953 and is inserted into junction A neighbouring length is the sequence of 1295 nucleotide；

SEQ ID NO:It is located in 3 ' ends of insetion sequence in 4 transgenic corn events DBN9953 and is inserted into junction A neighbouring length is the sequence of 1178 nucleotide；

SEQ ID NO:The flank maize genomic sequence of 5 entire T-DNA sequences, 5 ' and 3 '；

SEQ ID NO:6 are located at SEQ ID NO:Sequence inside 3, span DBN10124 constructs DNA sequence dna and T35S transcription terminators；

SEQ ID NO:7 are located at SEQ ID NO:Sequence inside 4, span tNos transcription terminators and DBN10124 construct DNA sequence dnas；

SEQ ID NO:8 amplification SEQ ID NO:3 the first primer；

SEQ ID NO:9 amplification SEQ ID NO:3 the second primer；

SEQ ID NO:10 amplification SEQ ID NO:4 the first primer；

SEQ ID NO:11 amplification SEQ ID NO:4 the second primer；

SEQ ID NO:12 5 ' primer on flanking genomic sequence；

SEQ ID NO:13 and SEQ ID NO:The primer of 12 pairings being located on T-DNA；

SEQ ID NO:14 3 ' primer on flanking genomic sequence, with SEQ ID NO:12 pairings, which can detect, to be turned Gene is homozygote or heterozygote；

SEQ ID NO:15 and SEQ ID NO:The primer of 14 pairings being located on T-DNA；

SEQ ID NO:16 Taqman detect the primer 1 of Cry1Ab；

SEQ ID NO:17 Taqman detect the primer 2 of Cry1Ab；

SEQ ID NO:18 Taqman detect the probe 1 of Cry1Ab；

SEQ ID NO:19 Taqman detect the primer 3 of EPSPS；

SEQ ID NO:20 Taqman detect the primer 4 of EPSPS；

SEQ ID NO:21 Taqman detect the probe 2 of EPSPS；

SEQ ID NO:The first primer of 22 corn endogenous gene Ubiquitin；

SEQ ID NO:The second primer of 23 corn endogenous gene Ubiquitin；

SEQ ID NO:The probe of Cry1Ab in 24 Southern hybridization checks；

SEQ ID NO:The probe of EPSPS in 25 Southern hybridization checks；

SEQ ID NO:26 are located at the primer on T-DNA, with SEQ ID NO:13 directions are consistent；

SEQ ID NO:27 are located at the primer on T-DNA, with SEQ ID NO:13 directions are on the contrary, as flank sequence is obtained Row；

SEQ ID NO:28 are located at the primer on T-DNA, with SEQ ID NO:13 directions are on the contrary, as flank sequence is obtained Row；

SEQ ID NO:29 are located at the primer on T-DNA, with SEQ ID NO:15 directions are consistent；

SEQ ID NO:30 are located at the primer on T-DNA, with SEQ ID NO:15 directions are on the contrary, as flank sequence is obtained Row；

SEQ ID NO:31 are located at the primer on T-DNA, with SEQ ID NO:15 directions are on the contrary, as flank sequence is obtained Row.

Below by drawings and examples, technical scheme of the present invention will be described in further detail.

Description of the drawings

Fig. 1 is that the transgenosis of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9953 is inserted into The structural schematic diagram of sequence and Maize genome binding site；

Fig. 2 is that the recombinant expression of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9953 carries The structural schematic diagram of body DBN10124；

Fig. 3 is the transgenic corns of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9953 Event DBN9953 is inoculated with the field efficacy figure of Ostrinia furnacalis in lobus cardiacus phase and spinning phase；

Fig. 4 is the transgenic corns of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9953 The field efficacy figure of event DBN9953 inoculation east armyworms；

Fig. 5 is the transgenic corns of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9953 The field efficacy figure of event DBN9953 inoculation bollworms；

Fig. 6 is the transgenic corns of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9953 Field efficacy figures of event DBN9953 under the conditions of dichocrocis punctiferalis naturally-occurring；

Fig. 7 is the transgenic corns of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9953 Field efficacy figures of event DBN9953 under the conditions of beet armyworm naturally-occurring.

Specific implementation mode

Below by specific embodiment further illustrate the present invention nucleic acid sequence for detecting corn plant DBN9953 and The technical solution of its detection method.

First embodiment, clone and conversion

1.1, carrier cloning

Use the gene clone technology structure recombinant expression carrier DBN10124 (as shown in Figure 2) of standard.The carrier DBN10124 includes two concatenated transgene expression cassettes, and first expression cassette is by 1 promoter of rice actin (prOsAct1), it is operably connected on arabidopsis EPSPS chloroplast transit peptides (spAtCTP2), is operably connected to soil On the 5- enol-pyrovyl shikimic acid -3- phosphate synthases (cEPSPS) of the glyphosate tolerant of earth Bacillus CP4 bacterial strains, and can It is operatively coupled on cauliflower mosaic virus 35S terminators (t35S) and forms；Second expression cassette is by containing Enhancer district The cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats in domain, is operably connected to maize Heat Shock 70kDa eggs On white introne (iZmHSP70), it is operably connected to the Cry1Ab albumen of the insect-resistant of bacillus thuringiensis (cCry1Ab) it on, and is operably connected on the transcription terminator (tNos) of nopaline synthase and forms.

The carrier DBN10124 is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA with liquid nitrogen method； Cat.No：In 18313-015), and with 5- enol-pyrovyl shikimic acid -3- phosphate synthases (EPSPS) be selected marker to turn Change cell to be screened.

1.2, Plant Transformation

It is converted using conventional Agrobacterium infestation method, by institute in the maize immature embryos of sterile culture and the present embodiment 1.1 The Agrobacterium stated co-cultures, and the T-DNA in the recombinant expression carrier DBN10124 of structure is transferred in maize chromosome group, To generate transgenic corn events DBN9953.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is detached from corn, is suspended with Agrobacterium Liquid contacts rataria, and wherein Agrobacterium can transmit the nucleotide sequence of the nucleotide sequence of Cry1Ab genes and EPSPS genes To at least one cell (step 1 of one of rataria：Infect step), in this step, rataria preferably immerses Agrobacterium suspension Liquid (OD₆₆₀=0.4-0.6 infects culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, Portugal Grape sugar 36g/L, acetosyringone (AS) 40mg/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, pH 5.3)) in start Inoculation.Rataria co-cultures one section of period (3 days) (step 2 with Agrobacterium：Co-culture step).Preferably, rataria is infecting step Afterwards in solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetyl fourth Ketone musk (AS) 100mg/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, agar 8g/L, pH 5.8) on cultivate.It trains altogether herein Support the stage after, can there are one selectivity " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS Vitamin, casein 300mg/L, sucrose 30g/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) at least exist in it is a kind of oneself know inhibit Agrobacterium growth antibiotic (cephalosporin), do not add the selection of vegetable transformant Agent (step 3：Recovering step).Preferably, rataria is cultivated on having antibiotic but the not solid medium of selective agent, to eliminate Agrobacterium simultaneously provides convalescence for infected cell.Then, the rataria of inoculation is containing selective agent (N- (phosphine carboxymerhyl) glycine) Transformed calli (the step 4 that culture and growth selection on culture medium：Select step).Preferably, rataria is having selective agent Screening solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, N- (phosphine carboxymerhyl) sweet ammonia Sour 0.25mol/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) on cultivate, cause to convert Cell selective growth.Then, callus regeneration is at plant (step 5：Regeneration step), it is preferable that containing selective agent The callus grown on culture medium is cultivated on solid medium (MS differential mediums and MS root medias) is planted with regenerating Object.

It screens obtained resistant calli and is transferred to the MS differential mediums (MS salt 4.3g/L, MS vitamin, cheese Plain 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, N- (phosphine carboxymerhyl) glycine 0.125mol/L, plant gel 3g/L, pH 5.8) on, differentiation is cultivated at 25 DEG C.It differentiates the seedling come and is transferred to the MS root medias (MS salt 2.15g/ L, MS vitamins, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH 5.8) on, at 25 DEG C Culture moves to hot-house culture to solid to about 10cm high.In the greenhouse, it is cultivated 16 hours at 28 DEG C daily, at 20 DEG C Culture 8 hours.

1.3, the identification and screening of transgenic event

770 separate transgenic T are generated altogether₀Single plant.

Pass through TaqMan^TMIt analyzes (referring to second embodiment) and detects regenerated transgenic corn plant with the presence or absence of Cry1Ab With EPSPS genes, and the copy number of insect-resistant and glyphosate herbicide tolerance strain is characterized.According to the copy of target gene Several, good insect-resistant, glyphosate herbicide tolerance and Agronomic (are implemented referring to the 5th embodiment and the 6th Example), by screening, the event DBN9953 of having selected is excellent, has single copy transgenosis, good insect-resistant, grass sweet Phosphine herbicide tolerant and Agronomic (participating in the 5th embodiment and sixth embodiment).

Second embodiment carries out transgenic corn events DBN9953 detections with TaqMan

Take the blade about 100mg of transgenic corn events DBN9953 as sample, with the DNeasy Plant of Qiagen Maxi Kit extract its genomic DNA, and the copy of Cry1Ab and EPSPS is detected by Taqman fluorescence probe quantitative PCR methods Number.Simultaneously as a contrast with wild-type corn plant, it is detected analysis according to the method described above.Experiment sets 3 repetitions, is averaged Value.

The specific method is as follows：

Step 11, the blade 100mg for taking transgenic corn events DBN9953, are ground into homogenate, each in mortar with liquid nitrogen Sample takes 3 repetitions；

Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；

Step 13, the genomic DNA concentration that above-mentioned sample is measured with NanoDrop 2000 (Thermo Scientific)；

Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the ranging from 80- of the concentration value 100ng/μl；

Step 15, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR methods, with by being copied known to identification The sample of shellfish number is as standard items, and as a contrast with the sample of wild-type corn plant, 3 repetitions of each sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively：

Following primer and probe is used for detecting Cry1Ab gene orders：

Primer 1：SEQ ID NO in CGAACTACGACTCCCGCAC such as sequence table:Shown in 16；

Primer 2：SEQ ID NO in GTAGATTTCGCGGGTCAGTTG such as sequence table:Shown in 17；

Probe 1：SEQ ID NO in CTACCCGATCCGCACCGTGTCC such as sequence table:Shown in 18；

Following primer and probe is used for detecting EPSPS gene orders：

Primer 3：SEQ ID NO in CTGGAAGGCGAGGACGTCATCAATA such as sequence table:Shown in 19；

Primer 4：SEQ ID NO in TGGCGGCATTGCCGAAATCGAG such as sequence table:Shown in 20；

Probe 2：SEQ ID NO in ATGCAGGCGATGGGCGCCCGCATCCGTA such as sequence table:Shown in 21；

PCR reaction systems are：

50 × the primer/probe mixture includes each 45 μ L of each primer of 1mM concentration, 50 μ of probe of 100 μM of concentration L and 860 μ L 1 × TE buffer solutions, and at 4 DEG C, be housed in amber tube.

PCR reaction conditions are：

Data are analyzed using SDS2.3 softwares (Applied Biosystems), obtain the transgenic corn events singly copied DBN9953。

3rd embodiment, transgenic corn events DBN9953 detections

3.1, extracting genome DNA

DNA is extracted according to CTAB (cetyl trimethylammonium bromide) method routinely used：Take 2 grams of tender transgenosis beautiful After the blade of rice event DBN9953 is pulverized in liquid nitrogen, the DNA that 0.5mL is added in 65 DEG C of preheatings of temperature extracts CTAB Buffer (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetra-acetic acid), with NaOH tune pH To 8.0), after mixing well, 90min are extracted for 65 DEG C in temperature；0.5 times of volume of phenol is added, 0.5 times of volume of chloroform overturns mixed It is even；10min is centrifuged under 12000rpm (revolutions per minute) rotating speed；2 times of volume absolute ethyl alcohols are added in Aspirate supernatant, soft to shake Dynamic centrifuge tube, in 4 DEG C of standing 30min of temperature；10min is centrifuged again under 12000rpm rotating speeds；DNA is collected to tube bottom；Supernatant is abandoned, The ethyl alcohol for being 70% with 1mL mass concentrations, washing precipitation；5min is centrifuged under 12000rpm rotating speeds；Vacuum is drained or in super-clean bench Drying；DNA is precipitated and dissolved in suitable TE buffer solutions (10mM Tris-HCl, 1mM EDTA, pH 8.0), is stored in temperature- Under the conditions of 20 DEG C.

3.2, the analysis of flanking DNA sequence

Concentration mensuration is carried out to the DNA sample of said extracted, the concentration of sample to be tested is made to be located between 80-100ng/ μ L. With the restriction enzyme Spe I, Pst I, BssH II (5 ' end analysis) and Sac I, Kpn I, Xma I, Nhe I selected (3 ' end analysis) difference digestion genomic DNA.26.5 μ L genomic DNAs are added in each digestion system, 0.5 μ L are above-mentioned to be selected Restriction enzyme and 3 μ L enzyme cutting buffering liquids, digestion 1 hour.After waiting for digestion, be added into digestion system 70 μ L without Water-ethanol, ice bath 30min, rotating speed 12000rpm centrifuge 7min, abandon supernatant, dry up, 8.5 μ L distilled waters (dd are added later H₂O)、1μL 10X T₄Buffer and 0.5 μ L T₄Ligase is stayed overnight in 4 DEG C of connections of temperature.It is carried out with a series of nested primers PCR amplification detaches 5 ' and 3 ' transgenosis/genomic DNA.Specifically, 5 ' transgenosis of separation/genomic DNA primer combination includes SEQ ID NO:13,SEQ ID NO:26 are used as the first primer, SEQ ID NO:27,SEQ ID NO:28 are used as the second primer, SEQ ID NO:13 are used as sequencing primer.It includes SEQ ID NO to detach 3 ' transgenosis/genomic DNA primer combination:15,SEQ ID NO:29 are used as the first primer, SEQ ID NO:30,SEQ ID NO:31 are used as the second primer, SEQ ID NO:15 as survey Sequence primer, PCR reaction conditions are as shown in table 3.

The amplicon obtained electrophoresis on 2.0% Ago-Gel then uses QIAquick to detach PCR reactants Gel extracts kits (catalogue #_28704, Qiagen Inc., Valencia, CA) detach target fragment from agarose matrix.So (for example, ABI PrismTM 377, PE Biosystems, Foster City, CA) is sequenced to the PCR product of purifying afterwards and is divided It analyses (for example, DNASTAR sequence analysis softwares, DNASTAR Inc., Madison, WI).

Confirm 5 ' and 3 ' flanking sequences and junction sequences using standard pcr.5 ' flanking sequences and junction sequences can make With SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9,SEQ ID NO:13 or SEQ ID NO:26 confirm. SEQ ID NO can be used in 3 ' flanking sequences and junction sequences:11 or SEQ ID NO:14, combination S EQ ID NO:10,SEQ ID NO:15 or SEQ ID NO:29 confirm.PCR reaction systems and amplification condition are as shown in table 2 and table 3.Those skilled in the art It will be understood that other primer sequences can also be used for confirming flanking sequence and junction sequences.

The DNA sequencing of PCR product provides the DNA that can be used for designing other DNA moleculars, other described DNA moleculars are made The identification of the corn plant or seed from transgenic corn events DBN9953 is used for for primer and probe.

It was found that in SEQ ID NO:5 1-1105 displays of nucleotide are maize genomic sequence in transgenic corns thing The right margin flank (5 ' flanking sequence) of part DBN9953 insetion sequences, in SEQ ID NO:5 8464-9477, nucleotide is aobvious Show the left margin flank (3 ' flanking sequence) for being maize genomic sequence in transgenic corn events DBN9953 insetion sequences. 5 ' junction sequences are in SEQ ID NO:It is listed in 1,3 ' junction sequences are in SEQ ID NO:It is listed in 2.

3.3, PCR zygosity determinations

Junction sequence is relatively short polynucleotide molecule, is new DNA sequence dna, is examined in being tested and analyzed in polynucleotide It is diagnostic for the DNA of transgenic corn events DBN9953 when measuring.SEQ ID NO:1 and SEQ ID NO:Connecing in 2 Close every side of insertion point and corn gene group DNA that sequence is transgenic corn events DBN9953 transgenic segments 11 polynucleotides.Longer or shorter polynucleotides junction sequence can be from SEQ ID NO:3 or SEQ ID NO:It is selected in 4 It selects.Junction sequence (5 ' join domain SEQ ID NO:1 and 3 ' join domain SEQ ID NO:2) DNA probe or conduct are used as DNA primer molecule is useful in DNA detection methods.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 be also transgenosis New DNA sequence dna in corn event DBN9953 can also be used as DNA probe or beautiful as DNA primer Molecular Detection transgenosis The presence of rice event DBN9953DNA.The SEQ ID NO:6(SEQ ID NO:1106-1295,3 nucleotide) it spans DBN10124 constructs DNA sequence dna and t35S transcription terminators, the SEQ ID NO:7(SEQ ID NO:4 nucleotide 1- 164) span tNos transcription terminators and DBN10124 construct DNA sequence dnas.

In addition, by using from SEQ ID NO:3 or SEQ ID NO:4 at least one primer generates amplicon, The diagnostic amplicon of transgenic corn events DBN9953 is generated when the primer is used in PCR method.

Specifically, PCR product is generated from 5 ' ends of transgene insert sequence, which is comprising from turning base Because in the genome of the vegetable material of corn event DBN9953 flank in the genomic DNA of 5 ' ends of T-DNA insetion sequences A part.This PCR product includes SEQ ID NO:3.In order to carry out PCR amplification, design is with flank in transgene insert sequence 5 ' ends genomic dna sequence hybridization (the SEQ ID NO of primer 5:8) turn with the paired transgenosis t35S that is located at Record (the SEQ ID NO of primer 6 of termination sequence:9).

PCR product is generated from 3 ' ends of transgene insert sequence, which includes to derive from transgenic corn events Flank is in a part for the genomic DNA of 3 ' ends of T-DNA insetion sequences in the genome of the vegetable material of DBN9953.This A PCR product includes SEQ ID NO:4.In order to carry out PCR amplification, design is with flank in 3 ' ends of transgene insert sequence (the SEQ ID NO of primer 8 of genomic dna sequence hybridization:11) turn with the tNos of the paired 3 ' ends positioned at insert Record (the SEQ IDNO of primer 7 of termination sequence:10).

The DNA cloning condition illustrated in table 2 and table 3 can be used for above-mentioned PCR zygosities experiment to generate transgenic corns The diagnostic amplicon of event DBN9953.The detection of amplicon can be by using Stratagene as shown in table 3 Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycles The progress such as instrument, or carried out by methods known to those skilled in the art with equipment.

Table 2, for transgenic corn events DBN9953 5 ' transgenic insertions/genome engaging zones identification PCR Step and reaction mixture condition

Table 3, Perkin-Elmer9700 thermal cycler conditions

It lightly mixes, if not having hot top on thermal cycler, 1-2 drop mineral can be added above each reaction solution Oil.Using following loop parameter (table 3) in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or PCR is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. MJ Engine or Eppendorf Mastercycler Gradient thermal cyclers should be run under the pattern of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cyclers of Perkin-Elmer are run.

The experimental results showed that：Primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in transgenic corn events DBN9953 bases When because in the PCR reactions of group DNA, the amplified production of 1295bp segments is generated, when it is used in unconverted corn gene group DNA and non- When in the PCR reactions of DBN9953 corn gene group DNAs, no segment is amplified；Primer 7 and 8 (SEQ ID NO:10 and 11), When it is used in the PCR reactions of transgenic corn events DBN9953 genomic DNAs, the amplified production of 1178bp segments is generated, When in the PCR reactions that it is used in unconverted corn gene group DNA and non-DBN9953 corn gene group DNAs, expanded without segment Increase.

PCR zygosity determinations can be additionally used in identification from transgenic corn events DBN9953 material be homozygote or It is heterozygote.By (the SEQ ID NO of primer 9:12), (the SEQ ID NO of primer 10:And (the SEQ ID NO of primer 11 13):14) it is used for Amplified reaction is to generate the diagnostic amplicon of transgenic corn events DBN9953.The DNA cloning condition illustrated in table 4 and table 5 It can be used for above-mentioned zygosity experiment to generate the diagnostic amplicon of transgenic corn events DBN9953.

Table 4, zygosity determination reaction solution

Table 5, zygosity determination Perkin-Elmer9700 thermal cycler conditions

Using following loop parameter (table 5) Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) Or it is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler PCR.MJ Engine or Eppendorf Mastercycler Gradient thermal cyclers should be run under the pattern of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cyclers of Perkin-Elmer are run.

In the amplified reaction, the biological sample containing template DNA, which contains, diagnoses the sample transgenic corn event DBN9953 there are the DNA of situation.Or reaction will generate two by the biological sample containing the DNA from Maize genome A different DNA cloning, the DNA from Maize genome in transgenic corn events DBN9953 relative to existing The corresponding allele of insertion DNA be heterozygosis.The two different amplicons, which will correspond to, derives from wild-type corn base Because group locus the first amplicon and diagnosis transgenic corn events DBN9953DNA there are the second amplicons of situation.Only Generate the maize dna sample for the single amplicon for corresponding to the second amplicon for the description of heterozygous genes group, diagnosable determination The presence of sample transgenic corn event DBN9953, and the sample in rotaring gene corn plant DBN9953 by relative to depositing The corn seed for being inserted into the corresponding allele of DNA and being homozygous produced by.

It should be noted that the primer pair of transgenic corn events DBN9953 is used to transgenic corn events DBN9953 genomic DNAs are diagnostic amplicon.These primer pairs include but not limited to primer 5 and 6 (SEQ ID NO:8 With 9) and primer 7 and 8 (SEQ ID NO:10 and 11), in the DNA cloning method.In addition, for expanding in corn One control primer 12 of source gene and 13 (SEQ ID NO:22 and 23) be included, as in one of reaction condition Standard.The analysis that sample is extracted to transgenic corn events DBN9953DNA should include a transgenic corn events The assaypositive tissue DNA extracts of DBN9953 compare, and a negative DNA from non-transgenic corn event DBN9953 is extracted Object compares and a negative control for not containing template maize dna extract.Other than these primer pairs, it can also use and From SEQ ID NO:3 or SEQ ID NO:Any primer pair of 4 or its complementary series, when they are used for DNA amplification reaction It is generated respectively for being organized as diagnostic including SEQ ID NO from transgenic event corn plant DBN9953:1 or SEQ ID NO:2 amplicon.The DNA cloning condition illustrated in table 2- tables 5 is used for suitable primer pair to generate The diagnostic amplicon of transgenic corn events DBN9953.It is generated to transgenic corns thing when being tested in DNA cloning method Part DBN9953 be diagnostic amplicon, presumption contain corn plant or seed comprising transgenic corn events DBN9953 The extract of DNA, or from the product of transgenic corn events DBN9953, it is used as the template of amplification, to determine With the presence or absence of transgenic corn events DBN9953.

Fourth embodiment carries out transgenic corn events DBN9953 detections by Southern blot hybridizations

4.1, it is extracted for the DNA of Southern blot hybridizations

Southern engram analysis is carried out using T4, T5 generation homozygous transformation event.Using mortar and pestle, in liquid nitrogen 10g plant tissues are arrived in grinding about 5.In 12.5mL Extraction buffers A (0.2M Tris pH 8.0,50mM EDTA, 0.25M NaCl, 0.1%v/v β-dredges base ethyl alcohol, 2.5%w/v Polyvinyl-pyrrolidones) in resuspension plant tissue, with 4000rpm from The heart 10 minutes (2755g).After discarding supernatant, 2.5mL Extraction buffers B (0.2M Tris pH 8.0,50mM EDTA, 0.5M NaCl, 1%v/v β-dredges base ethyl alcohol, 2.5%w/v Polyvinyl-pyrrolidones, 3% flesh aminoacyl, 20% ethyl alcohol) in be resuspended It drifts along shallow lake, and is incubated 30 minutes at 37 DEG C.It is primary with asepsis ring mixing sample during incubation.After incubation, addition is isometric Chloroform/isoamyl alcohol (24:1) it, is gently mixed by being inverted, is centrifuged 20 minutes with 4000rpm.Water-bearing layer is collected, and is being added Add and centrifuges 5 minutes with 4000rpm to precipitate DNA after 0.54 volume isopropanol.Supernatant is discarded, and is resuspended in 500 μ L TE Floating DNA precipitations.For any existing RNA that degrades, at 37 DEG C, DNA and 1 μ L 30mg/mL RNAase A are incubated 30 minutes, Centrifuged 5 minutes with 4000rpm, and in the presence of 0.5 volume 7.5M ammonium acetates and 0.54 volume isopropanol, by with 14000rpm centrifuges 10 minutes precipitation DNA.After discarding supernatant, the ethyl alcohol for being 70% with 500 μ L mass fractions washes precipitation, and After making it dry in 100 μ L TE resuspension.

4.2, enzymic digestion is limited

Utilize spectrophotometer or fluorometric quantification detection DNA concentration (utilizing 1 × TNE and Hoechst dyestuffs).

In 100 μ L reaction systems, 5 μ g DNA are digested every time.Distinguished with restriction enzyme EcoR V and Hind III The partial sequence of digested genomic dna, the Cry1Ab using on T-DNA and EPSPS are as probe.For each enzyme, in temperature appropriate Be incubated overnight digest under degree.Sample is rotated to reduce volume to 30 using SpeedVac (speed vacuum) μL。

4.3, gel electrophoresis

Bromophenol blue Loading Dye is added to each sample in the present embodiment 4.2, and by each sample pipetting volume It onto 0.7% Ago-Gel containing ethidium bromide, is separated by electrophoresis in TBE electrophoretic buffers, the electrophoresis coagulating under 20 volts Glue is stayed overnight.

Gel is washed in 0.25M HCl 15 minutes so that DNA depurinations, are then washed with water.It is miscellaneous to set Southern traces It hands over as follows：20 thick drying trace paper are placed in disk, place 4 thin drying trace paper again thereon.In 0.4M NaOH The 1 thin trace paper of moistening in advance, and be placed on the pile, then placement 1 moistens in advance in 0.4M NaOH Hybond-N+ transfer membranes (Amersham Pharmacia Biotech, #RPN303B).Gel is seated in top, it is ensured that solidifying There is no bubble between glue and film.3 trace paper in addition impregnated in advance are placed on gel top, and are filled out with 0.4M NaOH Full buffer solution disk.With the wick connection gel stack and buffer solution disk being immersed in advance in 0.4M NaOH, DNA is transferred to film On.DNA transfers in about 4 hours are carried out at room temperature.After transfer, Hybond films are rinsed in 2 × SSC 10 seconds, DNA passes through UV Crosslinking is combined with film.

4.4, hybridize

It is prepared for probe with the DNA sequence dna that PCR amplification is suitble to.The DNA probe is SEQ ID NO:24 and SEQ ID NO:25, or it is homologous or complementary with above-mentioned Sequence.25ng DNA probes are boiled 5 minutes in 45 μ L TE, are put on ice It sets 7 minutes, is then transferred into Rediprime II (Amersham Pharmacia Biotech, #RPN1633) test tube.To Rediprime test tubes add 5 μ l³²After the dCTP of P labels, in 37 DEG C of incubation probes 15 minutes.According to the manufacturer's instructions, It is centrifuged by micro- centrifugation G-50 pillars (Amersham Pharmacia Biotech, #27-5330-01), is not incorporated into removal DNTPs purifies the probe.Probe activity is measured using scintillation counter.

By in 65 DEG C of Church prehybridization solutions (500mM Na with 20mL pre-heatings₃P0₄, 1mM EDTA, 7%SDS, 1%BSA) moisten the Hybond films 30 minutes, the prehybridization Hybond films.It boils the probe of label 5 minutes, and puts on ice It sets 10 minutes.Appropriate probe (per 1,000,000 countings of 1mL pre-hybridization buffers) is added to pre-hybridization buffer, overnight at 65 DEG C Hybridized.Second day, hybridization buffer is discarded, with 1 (40mM Na of 20mL Church rinse solutions₃P0₄, 1mM EDTA, 5% SDS, 0.5%BSA) rinsing after, at 65 DEG C, film is washed 20 minutes in 150mL Church rinse solutions 1.It is rinsed with Church (the 40mM Na of solution 2₃P0₄, 1mM EDTA, 1%SDS) and repeat the process 2 times.The film is exposed to phosphorus screen or X-ray to detect The position that probe combines.

Include three kinds of control samples on each Southern：(1) DNA of the segregant of negative (unconverted) is come from, For identify it is any can be with the endogenous corn sequence of element-specific probe hybridization；(2) DNA from negative segregant, wherein The DBN10124 of Hind III- digestion is introduced, amount is equivalent to a copy number based on probe length, beautiful in detection with explanation When individual gene in rice genome copies, the sensitivity of the experiment；(3) copy number is equivalent to based on probe length The DBN10124 plasmids of Hind III- digestion, the sensitivity as the positive control hybridized and for illustrating experiment.

The evidence that hybridization data provides confirmation supports TaqMan^TMPCR is analyzed, i.e. corn plant DBN9953 contains Single copy of Cry1Ab and EPSPS genes., using the Cry1Ab probes, EcoR V and Hind III enzymolysis generate size respectively The single band of about 8kb and 6kb；Using the EPSPS probes, EcoR V and Hind III enzymolysis generate respectively size about 6kb and The single band of 5kb.This shows that each copy of Cry1Ab and EPSPS is present in corn transformation event DBN9953.

The insect-resistant detection of 5th embodiment, event

5.1, the bioassay of corn plant DBN9953

By transgenic corn events DBN9953 and wild-type corn plant (non-transgenic, NGM) 2 plants respectively to Asia Continent corn borer (Ostrinia furnacalis, ACB), dichocrocis punctiferalis (Conogethes punctiferalis, YPM), 2 points of committees Noctuid (Athetis lepigone, LPG), pink rice borer (Sesamia inferens, PSB), east armyworm (Mythimna Seperata, OAW), prodenia litura (Spodoptera litura, TCW), striped rice borer (Chilo suppressalis, SSB), Bollworm (Helicoverpa armigera, CBW) and beet armyworm (Spodoptera exigua, BAW) are as follows Carry out bioassay：

The new of transgenic corn events DBN9953 and wild-type corn plant (non-transgenic, NGM) 2 plants is taken respectively Fresh leaves (V3-V4 periods), it is clean with aseptic water washing and blotted the water on blade with gauze, then maize leaf is removed Vein, while it being cut into the strip of about 1cm × 3cm, the strip after taking 1-3 pieces (determining blade quantity according to insect appetite) to cut Blade is put on the filter paper of round plastic culture dish bottom, and the filter paper is soaked with distilled water, and 10 tribal chief are put in each culture dish Work raising newly hatched larvae, worm try culture dish capping after, 26-28 DEG C of temperature, relative humidity 70%-80%, the photoperiod (light/ Secretly) 16：Statistical result after being placed 3 days under conditions of 8.Ostrinia furnacalis counts the death rate, passes through corrected mortality antagonism water It is flat to be identified, corrected mortality (%)=(1- survival numbers/connect borer population-wild type control death rate)/(1- wild type controls are dead Die rate) × 100%.Three other insect statistical larvae development progresses, the death rate and blade injury rate indexs obtain resistance total score (full marks 300 divide)：Resistance total score=100 × corrected mortality+[100 × death rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/and connect worm sum)+10 × (negative control borer population/meet the total) &#93 of worm;+ 100 × (1- blade injuries Rate).5 plants are selected to be tested respectively from transgenic corn events DBN9953 and wild-type corn plant (non-transgenic, NGM), often Strain is repeated 6 times.As a result as shown in table 6 and table 7.

Pest-resistant bioassay results-death rate (%) of table 6, transgenic corn events DBN9953

Pest-resistant bioassay results-resistance total score of table 7, transgenic corn events DBN9953

The result shows that：Transgenic corn events DBN9953 is to Ostrinia furnacalis, dichocrocis punctiferalis, 2 committee noctuid insect, pink rice borer, east Square armyworm, prodenia litura, striped rice borer, bollworm and beet armyworm all have preferable resistance, and transgenic corn events The test worm death rate and resistance total score of DBN9953 is significantly higher than NGM.

5.2, the field effect of transgenic corn events DBN9953

The seed of transgenic corn events DBN9953 and wild-type corn plant (non-transgenic, NGM) 2 plants are set It is handled for 2, each processing is by pressing RANDOMIZED BLOCK DESIGN, 3 repetitions, plot area 30m²(5m × 6m), line-spacing 60cm, strain Away from 25cm, conventional cultivation management, the time of infertility does not spray insecticide.Different insects connect the interval for having 2m between worm experimental plot, Avoid diffusion of the insect between different community.(1) Ostrinia furnacalis

Respectively the corn lobus cardiacus phase (the toy trumpet mouth phase, plant be developed to exhibition the 6-8 leaf phases) and spin phase Artificial Inoculation of Anoplophora glabripennis, Respectively connect worm 2 times.40 plants are no less than per cell Artificial Inoculation of Anoplophora glabripennis, the newly hatched larvae of artificial feeding is connect in every plant of corn lobus cardiacus/filigree About 60, after connecing worm 3 days, worm is connect for the second time, connects borer population amount with for the first time.It is killed by strain investigation corn after connecing worm 14-21 days Situation.It institutes an inquiry within 14 days after usually connecing worm, if the rank that causes harm of negative control material (NGM) reaches sense or high sense, is considered as Effectively, it if investigation can suitably be postponed by not reaching, but connects 21 days after worm and is still not up to appropriate level, then this connects worm and is considered as nothing Effect.The lobus cardiacus phase connects worm and investigates plant middle and upper part blade by Ostrinia furnacalis feeding situation；The spinning phase investigates female fringe after connecing worm Killed degree and plant are killed situation.Each processing randomly selects 15-20 plants/row.

The lobus cardiacus phase：Ostrinia furnacalis is recorded by the description in table 8 eat leaf level by strain.Ostrinia furnacalis is calculated to each place Reason blade is caused harm the average value of degree (food leaf level)：Averagely eat leaf level=∑ (food leaf level × rank plant number)/tune Look into total strain number.According to the average value of food leaf level, resistance level of each processing to Ostrinia furnacalis is divided, such as table 9.Transgenosis The corn event DBN9953 lobus cardiacus phases are as shown in table 12 to the resistance result of Ostrinia furnacalis.

The spinning phase：It is killed situation, channel quantity, channel length of tunnel (cm) and survival instar larvae according to female fringe and deposits Quantity living calculates each cell ear period Ostrinia furnacalis and is killed rank average value to the resistance of female fringe, and criterion is as shown in table 10, Then resistance level of the judgment of standard corn ear period to Ostrinia furnacalis of table 11 is pressed.Transgenic corn events DBN9953 spinnings Phase is as shown in table 13 to the resistance result of Ostrinia furnacalis.

Table 8, Ostrinia furnacalis cause harm to corn lobus cardiacus the grade scale of degree

Eat leaf level	Symptom describes
		1	There are 1-2 aperture≤1mm worm channels on only individual blades
2	There are 3-6 aperture≤1mm worm channels on only individual blades
		3	A small number of blades have 7 or more apertures≤1mm worm channels
4	There are 1-2 aperture≤2mm worm channels on individual blades
		5	There are 3-6 aperture≤2mm worm channels on a small number of blades
6	Partial blade has 7 or more apertures≤2mm worm channels
		7	There is 1-2 aperture to be more than the worm channel of 2mm on a small number of blades
8	There is 3-6 aperture to be more than the worm channel of 2mm on partial blade
		9	There are 7 or more apertures to be more than the worm channel of 2mm on most of blade

Table 9, corn are to the evaluation criterion of Ostrinia furnacalis resistance

The lobus cardiacus phase eats leaf level average value	Resistance level
		1.0-2.9	Highly resistance (HR)
3.0-4.9	Anti- (R)
		5.0-6.9	Moderate resistance (MR)
7.0-8.9	Feel (S)
		9.0	Height sense (HS)

Table 10, corn ear period are caused harm the grade scale of degree by Ostrinia furnacalis

Female fringe is killed	Symptom describes
		1	Female fringe is not aggrieved
2	Filigree is killed <50%
		3	Most of filigree killed >=50%；There is a larvae alive, age age≤2
4	Fringe point is killed≤1cm；There is a larvae alive, age age≤3
		5	Fringe point is killed≤2cm；Or have larvae alive, age age≤4；Length of tunnel≤2cm
6	Fringe point is killed≤3cm；Or have larvae alive, Ling Qi >4 ages；Length of tunnel≤4cm
		7	Fringe point is killed≤4cm；Length of tunnel≤6cm
8	Fringe point is killed≤5cm；Length of tunnel≤8cm
		9	Fringe point is killed >5cm；Sui Daochangdu >8cm

Table 11, corn ear period are to the Evaluation standard of resistance of Ostrinia furnacalis

Female fringe is killed rank average value	Resistance level
		1.0-2.0	Highly resistance (HR)
2.1-3.0	Anti- (R)
		3.1-5.0	Moderate resistance (MR)
5.1-7.0	Feel (S)
		≥7.1	Height sense (HS)

Table 12, transgenic corn events DBN9953 lobus cardiacus phases are to the resistance result of Ostrinia furnacalis

Table 13, transgenic corn events DBN9953 spinning phase are to the resistance result of Ostrinia furnacalis

The result shows that：Either the lobus cardiacus phase still spins the phase, and transgenic corn events DBN9953 has Ostrinia furnacalis There is preferable resistance level；The food leaf level average value of lobus cardiacus phase, transgenic corn events DBN9953 are substantially less than NGM.Spinning The killed rank of female fringe percentage of injury, larvae alive number, length of tunnel and female fringe of phase, transgenic corn events DBN9953 are notable Less than NGM.Transgenic corn events DBN9953 is inoculated with field efficacy such as Fig. 3 institutes of Ostrinia furnacalis in lobus cardiacus phase and spinning phase Show.

(2) east armyworm

Experimental design and test method are substantially consistent with the evaluation resistance of Ostrinia furnacalis as described above.Different It is only to carry out Artificial Inoculation of Anoplophora glabripennis in the corn lobus cardiacus phase (plant is developed to the exhibition 4-6 leaf phases), worm is connect 2 times, in every plant of corn lobus cardiacus Connect the second instar larvae about 20 of artificial feeding.After connecing worm 3 days, worm is connect for the second time, connects borer population amount with for the first time.Connecing worm 14 days Afterwards, investigation maize leaf is caused harm degree by east armyworm.Caused harm degree by east armyworm according to maize leaf, is calculated each small Area east armyworm causes harm to maize leaf the average value of rank (food leaf level), and criterion is as shown in table 14, then presses table Resistance level of the 15 judgment of standard corn to east armyworm.The transgenic corn events DBN9953 lobus cardiacus phases are to east armyworm Resistance result is as shown in table 16.

Table 14, maize leaf are caused harm the grade scale of degree by east armyworm

Eat leaf level	Symptom describes
		1	Blade is without killed, or only has needle prick shape (≤1mm) worm channel on blade
2	There is a small amount of shell hole size (≤5mm) worm channel on only individual blades
		3	A small number of blades have shell hole size (≤5mm) worm channel
4	It is incised (≤10mm) on individual blades
		5	It is incised on a small number of blades (≤10mm)
6	It is incised on partial blade (≤10mm)
		7	Individual blade-sections have sheet to incise (≤10mm) by feeding on a small number of blades
8	A small number of blades have sheet to incise (≤10mm) by feeding on partial blade
		9	Most of blade is by feeding

Table 15, corn are to the Evaluation standard of resistance of east armyworm

The lobus cardiacus phase eats leaf level average value	Resistance level
		1.0-2.0	Highly resistance (HR)
2.1-4.0	Anti- (R)
		4.1-6.0	Moderate resistance (MR)
6.1-8.0	Feel (S)
		8.1-9.0	Height sense (HS)

Table 16, transgenic corn events DBN9953 lobus cardiacus phases are to the resistance result of east armyworm

The result shows that：Transgenic corn events DBN9953 has preferable resistance level to east armyworm, and transgenosis is beautiful Rice event DBN9953's incises ratio and food leaf level substantially less than NGM, transgenic corn events DBN9953 inoculations east The field efficacy of armyworm is as shown in Figure 4.

(3) bollworm

Experimental design and test method are substantially consistent with the evaluation resistance of Ostrinia furnacalis as described above.Different It is only to carry out Artificial Inoculation of Anoplophora glabripennis in the corn silking phase, connect worm 2 times, the newly hatched larvae of artificial feeding is connect in every plant of corn capillament about 20, after connecing worm 3 days, worm is connect for the second time, connects borer population amount with for the first time.It is killed by strain investigation female fringe after connecing worm 14-21 days Rate, each female fringe survival larva number, female fringe are killed length.It is instituted an inquiry within 14 days after usually connecing worm, if negative control material (NGM) The rank that causes harm reach sense or high sense, then be considered as effectively, if investigation can suitably be postponed by not reaching, but do not reached yet within 21 days after connecing worm To appropriate level, then this connects worm and is considered as in vain.It is killed length (cm) according to female fringe percentage of injury, survival larva number, female fringe, is calculated For each cell corn ear period bollworm to the rank average value of causing harm of female fringe, criterion is as shown in table 17, then presses the mark of table 18 Standard differentiates resistance level of the corn ear period to bollworm.Resistance knot of the transgenic corn events DBN9953 spinning phases to bollworm Fruit is as shown in table 19.

Table 17, maize ear are caused harm the grade scale of degree by bollworm

Female fringe is killed rank	Symptom describes
		0	Female fringe is not aggrieved
1	Only filigree is killed
		2	Fringe top is killed 1cm
3+	It is killed under fringe top and often increases 1cm, killed rank increases by 1 grade accordingly
		…N

Table 18, maize ear are to the Evaluation standard of resistance of bollworm

Female fringe is killed rank average value	Resistance level
		0-1.0	Highly resistance (HR)
1.1-3.0	Anti- (R)
		3.1-5.0	Moderate resistance (MR)
5.1-7.0	Feel (S)
		≥7.1	Height sense (HS)

Table 19, transgenic corn events DBN9953 spinning phase are to the resistance result of bollworm

The result shows that：Transgenic corn events DBN9953 has preferable resistance level, and transgenic corns to bollworm The female fringe percentage of injury of event DBN9953, larvae alive number, female fringe are killed length and female fringe is killed rank and is substantially less than NGM, turn base Because the field efficacy that corn event DBN9953 is inoculated with bollworm is as shown in Figure 5.

(4) dichocrocis punctiferalis

Experimental design and test method are substantially consistent with the evaluation resistance of Ostrinia furnacalis as described above.Different It is that corn only carries out natural INFESTATION in the more serious area of dichocrocis punctiferalis naturally-occurring.After insect pest occurring for the first time 14-21 days, And NGM investigates cause harm rate of the dichocrocis punctiferalis to plant when being mostly that 4-5 ages high instar larvae is endangered by strain.Transgenic corn events DBN9953 is as shown in table 20 to the resistance result of dichocrocis punctiferalis.

To the resistance result of dichocrocis punctiferalis under the conditions of table 20, transgenic corn events DBN9953 natural INFESTATIONs

The result shows that：Under the conditions of dichocrocis punctiferalis naturally-occurring, compared with NGM, dichocrocis punctiferalis is to transgenic corn events The rate significant decrease of causing harm of DBN9953, thus illustrates that transgenic corn events DBN9953 has preferable resistance to dichocrocis punctiferalis, Field efficacies of transgenic corn events DBN9953 under the conditions of dichocrocis punctiferalis naturally-occurring is as shown in Figure 6.

(5) beet armyworm

Experimental design and test method are substantially consistent with the evaluation resistance of Ostrinia furnacalis as described above.Different It is that corn only carries out natural INFESTATION in the more serious area of beet armyworm naturally-occurring.Insect pest 10-15 days is occurring for the first time Afterwards, when and NGM is mostly that 4-6 ages high instar larvae endangers, cause harm rate of the beet armyworm to plant is investigated by strain.Transgenic corns Event DBN9953 is as shown in table 21 to the resistance result of beet armyworm.

To the resistance result of beet armyworm under the conditions of table 21, transgenic corn events DBN9953 natural INFESTATIONs

The result shows that：Under the conditions of beet armyworm naturally-occurring, compared with NGM, beet armyworm is to transgenic corn events Thus it is preferable anti-to illustrate that transgenic corn events DBN9953 has beet armyworm for the rate significant decrease of causing harm of DBN9953 Property, field efficacies of transgenic corn events DBN9953 under the conditions of beet armyworm naturally-occurring is as shown in Figure 7.

What is particularly worth mentioning is that according to Chinese patent (application) number be 201210509817.2,201210511214.6, 201310576970.1, the content described in 201310578129.6 and 201310681139.2 and the application transgenic corns The field effect and its bioassay results to insect of event DBN9953, shows the application transgenic corn events DBN9953 The method and/or purposes of control pest are realized, specially 2 committee noctuid insect, dichocrocis punctiferalis, prodenia litura, pink rice borer and east is glutinous Worm；Namely control 2 committee noctuid insect, dichocrocis punctiferalis, twill may be implemented in the rotaring gene corn plant of any expression Cry1Ab albumen The method and/or purposes of noctuid, pink rice borer and/or east armyworm pest.

The herbicide tolerant detection of sixth embodiment, event

This experiment selects agriculture to be sprayed up to herbicide (41% glyphosate-isopropylammonium aqua).It is set using random district's groups Meter, 3 repetitions.Plot area is 15m²(5m × 3m), line-spacing 60cm, spacing in the rows 25cm, conventional cultivation management have 1m between cell Wide isolation strip.Transgenic corn events DBN9953 is carried out to following 2 kinds of processing respectively：1) it does not spray；2) 1680g is pressed A.e./ha dosage sprays agriculture in the V3 leaf phases and reaches herbicide, then sprays agriculture again by same dose in the V8 phases and reaches herbicide.It needs Illustrate, the glyphosate herbicidal of different content and dosage form is converted into the form of equivalent glyphosate suitable for draw a conclusion.

Symptom of chemical damage is investigated within 1 week and 2 weeks after medication respectively, and the yield of cell is measured in harvest.Symptom of chemical damage point Grade is as shown in table 22.The aggrieved rate of herbicide is used to assess the index of transformation event herbicide tolerant as evaluation index, specifically, The aggrieved rate of herbicide (%)=∑ (aggrieved strain number × number of levels at the same level)/(total strain number × highest level)；Wherein herbicide is aggrieved Rate refers to the aggrieved rate of glyphosate, and the aggrieved rate of glyphosate is 2 weeks after being handled according to glyphosate poisoning investigation results and determination.Often The corn yield of a cell is the niblet total output (weight) for weighing 3 rows among each cell, the volume variance between different disposal It is measured in the form of yield percentage, yield percentage (%)=spraying yield/does not spray yield.Transgenic corn events DBN9953 is as shown in table 23 to the result and corn yield result of herbicide tolerant.

Table 22, glyphosate herbicidal are to the grade scale of corn phytotoxicity degree

Poisoning rank	Symptom describes
		1	Growth is normal, without any damage symptoms
2	Slight poisoning, poisoning are less than 10%
		3	Medium poisoning can restore, not influence yield later
4	Poisoning is heavier, it is difficult to restore, cause the underproduction
		5	Poisoning is serious, cannot restore, and causes the apparent underproduction or total crop failure

Table 23, transgenic corn events DBN9953 are to the result and corn yield result of glyphosate herbicide tolerance

As a result illustrate, in terms of herbicide (glyphosate) aggrieved rate：1) transgenic corn events DBN9953 is removed in glyphosate Aggrieved rate is essentially 0 under careless agent (1680g a.e./ha) processing, and transgenic corn events DBN9953 has good grass as a result, Sweet phosphine herbicide tolerant.

In terms of yield：Transgenic corn events DBN9953 is not spraying and is spraying 2 kinds of 1680g a.e./ha glyphosates The lower yield of processing does not have notable difference, and after spraying glyphosate herbicidal, the yield of transgenic corn events DBN9953 does not have substantially There is reduction, further demonstrates that transgenic corn events DBN9953 has good glyphosate herbicide tolerance as a result,.

7th embodiment

Can such as agricultural product or commodity be produced by transgenic corn events DBN9953.If in the agricultural product or commodity In detect enough expression quantity, the agricultural product or commodity are expected containing can diagnose transgenic corn events DBN9953 materials Expect the nucleotide sequence present in the agricultural product or commodity.The agricultural product or commodity include but not limited to corn oil, jade Rice coarse powder, maize flour, corn gluten, corn-dodger, cornstarch and will be as food source for any other of animal consumption Food or additionally as the ingredient in swelling agent or make-up composition for cosmetic use etc..Based on probe or primer pair Nucleic acid detection method and/or kit can be developed to detect such as SEQ ID NO in biological sample:1 or SEQ ID NO:2 Shown in transgenic corn events DBN9953 nucleotide sequences, wherein probe sequence or primer sequence be selected from such as SEQ ID NO: 1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4 and SEQ ID NO:Sequence shown in 5, to diagnose transgenosis jade The presence of rice event DBN9953.

In conclusion transgenic corn events DBN9953 of the present invention has preferable resistance to lepidopterous insects, at the same it is right Glyphosate herbicidal has higher tolerance, and on yield without influence, and detection method can quickly and accurately identify biological sample Whether the DNA molecular of transgenic corn events DBN9953 is included in product.

Corresponding to the seed of transgenic corn events DBN9953 China Microbiological bacterium has been deposited on December 24th, 2014 Kind preservation administration committee's common micro-organisms center (abbreviation CGMCC, address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, in Institute of microbiology of the academy of sciences of state, postcode 100101), Classification And Nomenclature：Corn (Zea mays), deposit number CGMCC No.10220.Preserved material will be 30 years in depository's preservation.

It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, it will be understood by those of ordinary skill in the art that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit of the technical scheme of the invention and range.

Claims

1. a kind of nucleic acid sequence, which is characterized in that including SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or Its complementary series, the nucleic acid sequence be originated from transgenic corn events DBN9953, the transgenic corn events DBN9953 with The form of seed and to be preserved in China Committee for Culture Collection of Microorganisms with deposit number CGMCC No.10220 commonly micro- Bio-Centers.

2. nucleic acid sequence according to claim 1, which is characterized in that the nucleic acid sequence includes SEQ ID NO:3 or its Complementary series, and/or SEQ ID NO:4 or its complementary series.

3. nucleic acid sequence according to claim 2, which is characterized in that the nucleic acid sequence includes SEQ ID NO:5 or its Complementary series.

4. a kind of method existing for DNA of detection sample transgenic corn event DBN9953, which is characterized in that including：

Carry out nucleic acid amplification reaction；

Detect the presence of amplified production；

The amplified production includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its complementary series；

The amplified production is originated from transgenic corn events DBN9953, and the transgenic corn events DBN9953 is with the shape of seed Formula and China Committee for Culture Collection of Microorganisms's common micro-organisms center is preserved in deposit number CGMCC No.10220.

5. method existing for the DNA of detection sample transgenic corn event DBN9953 according to claim 4, feature It is, the amplified production further includes SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.

6. method existing for the DNA of the detection sample transgenic corn event DBN9953 according to claim 4 or 5, special Sign is that the primer includes the first primer and the second primer, and the first primer is selected from SEQ ID NO:1 or its complementary sequence Row, SEQ ID NO:8 and SEQ ID NO:10；Second primer is selected from SEQ ID NO:2 or its complementary series, SEQ ID NO:9 and SEQ ID NO:11.

7. a kind of method existing for DNA of detection sample transgenic corn event DBN9953, which is characterized in that including：

Detected sample is set to be contacted with probe, the probe includes SEQ ID NO:1 or its complementary series or SEQ ID NO: 2 or its complementary series, the source probe transgenic corn event DBN9953, the transgenic corn events DBN9953 is to plant Son form and China Committee for Culture Collection of Microorganisms's commonly micro- life is preserved in deposit number CGMCC No.10220 Object center；

Detect the hybridisation events of the detected sample and the probe.

8. method existing for the DNA of detection sample transgenic corn event DBN9953 according to claim 7, feature It is, the probe further includes SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

9. special according to method existing for the DNA of the detection sample transgenic corn event DBN9953 of claim 7 or 8 Sign is that at least one probe is marked at least one fluorophor.

10. a kind of method existing for DNA of detection sample transgenic corn event DBN9953, which is characterized in that including：

Detected sample is set to be contacted with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:1 or its mutually Complementary series or SEQ ID NO:2 or its complementary series, the marker nucleic acid molecules are originated from transgenic corn events DBN9953, the transgenic corn events DBN9953 are preserved in the form of seed and with deposit number CGMCC No.10220 China Committee for Culture Collection of Microorganisms's common micro-organisms center；

The hybridisation events of the detected sample and the marker nucleic acid molecules are detected, and then pass through marker assistant breeding point Analysis is to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecules are chain on science of heredity.

11. method existing for the DNA of detection sample transgenic corn event DBN9953 according to claim 10, special Sign is that the marker nucleic acid molecules further include SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its mutually Complementary series.

12. a kind of DNA detection kits, which is characterized in that including at least one DNA molecular, the DNA molecular includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series, it can be used as transgenic corn events DBN9953 or its offspring have one of DNA primer of specificity or probe；The DNA molecular is originated from transgenic corn events DBN9953, the transgenic corn events DBN9953 are preserved in the form of seed and with deposit number CGMCC No.10220 China Committee for Culture Collection of Microorganisms's common micro-organisms center.

13. according to DNA detection kits described in claim 12, which is characterized in that further include when the DNA molecular is as probe SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

14. a kind of protection corn plant is from the method for insect infestations, which is characterized in that be included in the diet of target insect and provide At least one transgenic corn plant cell, the transgenic corn plant cell include SEQ ID successively in its genome NO:1,SEQ ID NO:5 1247-8386 nucleic acid sequences and SEQ ID NO:2 or the transgenic corn plant cell Genome in include SEQ ID NO:5；Ingest the transgenic corn plant cell target insect be suppressed further ingest The corn plant.

15. a kind of method for protecting corn plant from being damaged caused by herbicide, which is characterized in that including that will contain effectively Dosage glyphosate herbicidal is applied to the big Tanaka for planting at least one rotaring gene corn plant, and the rotaring gene corn plant exists Include SEQ ID NO successively in its genome:1,SEQ ID NO:5 1247-8386 nucleic acid sequences and SEQ ID NO:2, Or comprising SEQ ID NO in the genome of the rotaring gene corn plant:5；The rotaring gene corn plant has sweet to grass The tolerance of phosphine herbicide.

16. a kind of method of the big Tanaka weeds of control maize planting plant, which is characterized in that including effective dose grass will be contained Sweet phosphine herbicide is applied to the big Tanaka for planting at least one rotaring gene corn plant, and the rotaring gene corn plant is in its gene Include SEQ ID NO successively in group:1,SEQ ID NO:5 1247-8386 nucleic acid sequences and SEQ ID NO:2, Huo Zhesuo State in the genome of rotaring gene corn plant includes SEQ ID NO:5；The rotaring gene corn plant has to Gyphosate herbicice The tolerance of agent.

17. a kind of method for cultivating the corn plant resistant to insect, which is characterized in that including：

An at least corn seed is planted, the nucleic acid sequence of specific region, the spy are included in the genome of the corn seed The nucleic acid sequence for determining region includes SEQ ID NO successively:1,SEQ ID NO:5 1247-8386 nucleic acid sequences and SEQ ID NO:2 or the specific region nucleic acid sequence include SEQ ID NO:5；

The corn seed is set to grow up to plant；

The plant described in target insect infestations harvests compared with the plant of other nucleic acid sequences for not having the specific region The plant of plant injury with decrease.

18. a kind of method that culture has glyphosate herbicidal the corn plant of tolerance, which is characterized in that including：

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of the specific region with other The plant of sequence compares the plant with the plant injury weakened.

19. a kind of method for cultivating corn plant that is resistant to insect and being resistant to glyphosate herbicidal, which is characterized in that Including：

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of the specific region with other The plant of sequence compares the plant with the plant injury weakened, and the plant pair insect with the plant injury weakened is taken the photograph Food damage is also resistant.

20. a kind of method generating the plant resistant to insect, which is characterized in that include to the plant SEQ ID NO are introduced in genome:5 1247-8386 nucleic acid sequences, and so that the genome of the plant includes spy Determine the nucleic acid sequence in region, the nucleic acid sequence of the specific region includes SEQ ID NO successively:1,SEQ ID NO:5 1247- 8386 nucleic acid sequences and SEQ ID NO:2 or the specific region nucleic acid sequence include SEQ ID NO:5, selection pair The plant with the plant injury weakened that ingests of insect.

21. according to the method for generating the plant resistant to insect described in claim 20, which is characterized in that including：

To resistant the first parental maize plants of transgenic corn events DBN9953 of insect and the of insect-resistant will be lacked Two parental maize plant sexual hybridizations, to generate a large amount of progeny plants；

The progeny plant described in target insect infestations；

It selects compared with the plant of other nucleic acid sequences for not having the specific region to have described in the plant injury weakened Progeny plant；

The transgenic corn events DBN9953 is preserved in China in the form of seed and with deposit number CGMCC No.10220 Microbiological Culture Collection administration committee common micro-organisms center.

22. a kind of method generating the plant that there is tolerance to glyphosate herbicidal, which is characterized in that including to described SEQ ID NO are introduced in the genome of plant:5 1247-8386 nucleic acid sequences, and make the base of the plant Include SEQ ID NO successively because organizing:1,SEQ ID NO:5 1247-8386 nucleic acid sequences and SEQ ID NO:2, or make The genome for obtaining the plant includes SEQ ID NO:5, the plant of selection tolerance glyphosate.

23. according to the method for generating the plant that there is tolerance to glyphosate herbicidal described in claim 22, feature It is, including：

By first parental maize plants of transgenic corn events DBN9953 to glyphosate herbicidal with tolerance and lack grass Second parental maize plant sexual hybridization of sweet phosphine tolerance, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate herbicidal；

The progeny plant of selection tolerance glyphosate；

24. a kind of method generating plant that is resistant to insect and being resistant to glyphosate herbicidal application, feature exist In, including：

By the first parental maize plants of transgenic corn events DBN9953 of glyphosate tolerance and insect-resistant and lack glyphosate Second parental maize plant sexual hybridization of tolerance and/or insect-resistant, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate；

The progeny plant of selection tolerance glyphosate, the progeny plant for being resistant to glyphosate also have the feeding damage of insect Resistance；

25. a kind of composition being produced from transgenic corn events DBN9953, which is characterized in that the composition be corn flour, Maize flour, corn oil, corn silk or cornstarch；The transgenic corn events DBN9953 is in the form of seed and to protect It hides number CGMCC No.10220 and is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center.

26. a kind of agricultural product or commodity produced by transgenic corn events DBN9953, which is characterized in that the agricultural product or Commodity are corn flour, maize flour, corn oil, cornstarch, corn gluten, corn-dodger, cosmetics or filler；The transgenosis Corn event DBN9953 is preserved in Chinese microorganism strain preservation in the form of seed and with deposit number CGMCC No.10220 Administration committee's common micro-organisms center.