CN104878096B - For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 - Google Patents

For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 Download PDF

Info

Publication number
CN104878096B
CN104878096B CN201510219912.2A CN201510219912A CN104878096B CN 104878096 B CN104878096 B CN 104878096B CN 201510219912 A CN201510219912 A CN 201510219912A CN 104878096 B CN104878096 B CN 104878096B
Authority
CN
China
Prior art keywords
seq
plant
nucleic acid
dbn9868
corn
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510219912.2A
Other languages
Chinese (zh)
Other versions
CN104878096A (en
Inventor
康越景
郭明欣
刘海利
张成伟
丁德荣
焦国伟
魏雪松
汤波
夏祖灵
熊冠军
徐亮
鲍晓明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Dabeinong Biotechnology Co Ltd
Original Assignee
Beijing Dabeinong Technology Group Co Ltd
Beijing Dabeinong Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Dabeinong Technology Group Co Ltd, Beijing Dabeinong Biotechnology Co Ltd filed Critical Beijing Dabeinong Technology Group Co Ltd
Priority to CN201510219912.2A priority Critical patent/CN104878096B/en
Publication of CN104878096A publication Critical patent/CN104878096A/en
Priority to ARP160101207A priority patent/AR104438A1/en
Priority to PCT/CN2016/080676 priority patent/WO2016173539A1/en
Application granted granted Critical
Publication of CN104878096B publication Critical patent/CN104878096B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G7/00—Botany in general
    • A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N25/00—Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of application, e.g. seed treatment or sequential application; Substances for reducing the noxious effect of the active ingredients to organisms other than pests
    • A01N25/32—Ingredients for reducing the noxious effect of the active substances to organisms other than pests, e.g. toxicity reducing compositions, self-destructing compositions
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N47/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid
    • A01N47/40—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid the carbon atom having a double or triple bond to nitrogen, e.g. cyanates, cyanamides
    • A01N47/42—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid the carbon atom having a double or triple bond to nitrogen, e.g. cyanates, cyanamides containing —N=CX2 groups, e.g. isothiourea
    • A01N47/44—Guanidine; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/18—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds
    • A01N57/20—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds containing acyclic or cycloaliphatic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275—Glyphosate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8277—Phosphinotricin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Abstract

The present invention relates to a kind of for detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868, and the nucleic acid sequence of the corn plant includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series.Transgenic corn events DBN9868 of the present invention has preferable tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, on yield without influence, and detection method can quickly and accurately identify in biological sample whether include transgenic corn events DBN9868 DNA molecular.

Description

For detecting the nucleic acid sequence and its inspection of herbicide tolerant corn plant DBN9868 Survey method
Technical field
The nucleic acid sequence and its detection side that the present invention relates to a kind of for detecting herbicide tolerant corn plant DBN9868 Method, more particularly to it is a kind of tolerance glyphosate and glufosinate-ammonium corn plant DBN9868 and detection biological sample in whether include The method of the DNA molecular of specific transgenic corn events DBN9868.
Background technique
N- phosphonomethylglycine, also referred to as glyphosate are a kind of chronic wide spectrum steriland herbicides of inner sucting conduction type.Grass Sweet phosphine is the competing of the synthesis substrate phosphoenolpyruvate (PEP) of 5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) Striving property inhibitor can inhibit both substrates of PEP and 3- phosphoric acid shikimic acid under EPSPS catalysis to 5- enolpyruvyl acyl thick grass The conversion of acid -3- phosphoric acid shikimic acid makes protein so that aromatic amino acid be blocked to synthesize precursor-shikimic acid route of synthesis Synthesis be interfered and lead to plant and bacterial death.
Glyphosate tolerant can be realized by the EPSPS of expression modification.The EPSPS of modification has glyphosate lower Compatibility, thus in the presence of glyphosate, EPSPS maintains their catalytic activity, that is, it is resistance to obtain glyphosate By property.
Many areas are all main cereal crops to corn (Zea mays L.) in the world.The weeding in maize production Agent tolerance is an important economical character, especially to the tolerance of glyphosate herbicidal.Corn is to glyphosate herbicidal Tolerance can make glyphosate herbicide tolerant type gene (EPSPS, CP4) table in corn plant by transgene method It reaches and obtains, such as corn event NK603, corn event MON88017 etc..
The increasingly increase that generally use and the glyphosate of glyphosate tolerant tillage systems use already leads to careless in recent years The prevalence of sweet phosphine resistant weed.In grower in face of glyphosate-resistant weeds or the ground changed to the weed species being more difficult to control Area, grower can be by mixing or being used interchangeably to the weak of compensation glyphosate with the other herbicides that can control omission weeds Point.
Glufosinate-ammonium is one of phosphinothricin class herbicide non-systemic, nonselective herbicide.It is mainly used for 1 year It is raw or perennial broadleaf weed be unearthed after control, be by L-phosphinothricin (active constituent in glufosinate-ammonium) to glutamine Synthase (a kind of the ammonolysis poison in plant necessary to enzyme) can not retroactive inhibition control weeds.Root is killed not with glyphosate Together, glufosinate-ammonium first kills leaf, can be conducted in plant xylem by plant transpiration effect, between quick-acting in paraquat and Between glyphosate.
The enzyme phosphinothricin N-acetyl transferase (PAT) separated from streptomycete is catalyzed L-phosphinothricin by acetylation and turns Turn to its inactive form.The gene of plant optimization form of PAT is expressed in soybean using to assign soybean to careless ammonium The tolerance of phosphine herbicide, such as soybean event A5547-127.Therefore glufosinate-ammonium is applied in combination with glufosinate tolerant character to remove Careless agent can be used as a kind of non-selective means of effectively management glyphosate-resistant weeds.
Meanwhile as transgenic insect-resistant corn large area is planted, the insect/pest survived on a small quantity breeds by several generations Afterwards, it is possible to create resistance.Herbicide-resistant transgenic maize is as non-pest-resistant transgenic corns, with transgenic insect-resistant corn with certain Ratio is planted together, and insect/pest can be delayed to develop drug resistance.
Known foreign gene is influenced in the intracorporal expression of plant by their chromosome location, it may be possible to due to dyeing Matter structure (such as heterochromatin) or transcription regulatory element (such as enhancer) are close to integration site.Thus, it usually needs screening is a large amount of Event be possible to identify can be with commercialized event (event that the target gene imported obtains optimal expression).Example Such as, have been observed that the expression quantity of quiding gene there may be very big difference between event in plant and other organisms；In table On the space reached or time mode may there is also differences, such as between different plant tissues transgenosis relative expression exist it is poor Different, this species diversity shows that actual expression pattern may be pre- with the transcription regulatory element institute in the gene construct according to importing The expression pattern of phase is inconsistent.It is thus typically necessary to generate hundreds and thousands of different events and filter out from these events Single incident with transgene expression amount and expression pattern desired for the purpose of being commercialized.With expected transgenosis table Event up to amount and expression pattern can be used for that transgenosis is penetrated into other by sexual cutcross using conventional breeding methods In genetic background.The transgenic expression characteristics of original transformant are maintained by the offspring that this Crossing system generates.Using this Kind strategy pattern may insure there is reliable gene expression in many kinds, and these kinds can well adapt to locality Growth conditions.
It will be beneficial that the presence of particular event, which is able to detect, so that whether the offspring for determining sexual hybridization includes target gene. In addition, the method for detection particular event also will be helpful to abide by relevant laws and regulations, such as thrown from the food of recombination crops It needs to obtain official approval before entering market and is marked.Transgenosis is detected by any well known polynucleotides detection method Presence be all it is possible, such as polymerase chain reaction (PCR) or using polynucleotide probes DNA hybridization.These detections Method is usually focused on common genetic elements, such as promoter, terminator, marker gene etc..Therefore, unless with insertion turn The sequence of the adjacent chromosomal DNA of gene DNA (" flanking DNA ") be it is known, above-mentioned this method cannot be used to distinguish Different events, especially those events generated with identical DNA construct.Insertion is spanned so often utilizing at present The pair of primers of the junction of transgenosis and flanking DNA identifies transgenosis particular event by PCR, specifically includes The first primer of flanking sequence and the second primer comprising insetion sequence.
Summary of the invention
The nucleic acid sequence that the object of the present invention is to provide a kind of for detecting herbicide tolerant corn plant DBN9868 and Its detection method, transgenic corn events DBN9868 have preferable tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, And detection method can quickly and accurately identify in biological sample whether include specific transgenic corn events DBN9868 DNA Molecule.
To achieve the above object, the present invention provides in a kind of nucleic acid sequence, including SEQ ID NO:3 or its complementary series At least 11 continuous nucleotide at least 11 continuous nucleotide, and/or SEQ ID NO:4 or its complementary series.
Preferably, the nucleic acid sequence includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or it is mutual Complementary series.
Further, the nucleic acid sequence include SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its Complementary series.
Further, the nucleic acid sequence includes SEQ ID NO:5 or its complementary series.
The SEQ ID NO:1 or its complementary series are 5 ' ends in transgenic corn events DBN9868 in insetion sequence End is located at the sequence that a length near insertion junction is 22 nucleotide, the SEQ ID NO:1 or its complementary sequence Column span the DNA sequence dna of the flanking genomic DNA sequence of corn insertion point and 5 ' ends of insetion sequence, comprising described SEQ ID NO:1 or its complementary series can be accredited as the presence of transgenic corn events DBN9868.The SEQ ID NO:2 Or its complementary series is to be located near insertion junction in transgenic corn events DBN9868 in 3 ' ends of insetion sequence One length is the sequence of 22 nucleotide, and the SEQ ID NO:2 or its complementary series span 3 ' ends of insetion sequence DNA sequence dna and corn insertion point flanking genomic DNA sequence, be comprising the SEQ ID NO:2 or its complementary series The presence of transgenic corn events DBN9868 can be accredited as.
In the present invention, the nucleic acid sequence can be inserted into sequence for the SEQ ID NO:3 or its complementary series transgenic Any portion of at least 11 or more continuous polynucleotides (the first nucleic acid sequence) of column, or be the SEQ ID NO: 3 or its complementary series in 5 ' flank corn gene group DNA regions any portion of at least 11 or more continuous multicore glycosides Sour (second nucleotide sequence).The nucleic acid sequence may further be derived from or be complementary to comprising the complete SEQ ID to be same A part of the SEQ ID NO:3 of NO:1.When the first nucleic acid sequence is used together with second nucleotide sequence, these nucleic acid Sequence includes DNA primer group in the DNA cloning method for generating amplified production.It is produced using DNA primer in DNA cloning method Raw amplified production is that can diagnose transgenic corn events DBN9868 or thereafter when including the amplified production of SEQ ID NO:1 The presence in generation.Well known to those skilled in the art, the first and second nucleic acid sequences need not be only made of DNA, may also comprise The mixture or DNA, RNA of RNA, DNA and RNA or it is other not as the nucleotide of one or more polymerase templates or its The combination of analog.In addition, heretofore described probe or primer should be at least about 11,12,13,14,15,16,17, 18, the length of 19,20,21 or 22 continuous nucleotides can be selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID Nucleotide described in NO:3, SEQ ID NO:4 and SEQ ID NO:5.When selected from SEQ ID NO:3, SEQ ID NO:4 and When nucleotide shown in SEQ ID NO:5, the probe and primer can be for length at least about 21 to about 50 or More continuous nucleotides.The SEQ ID NO:3 or its complementary series are in transgenic corn events DBN9868 in insertion sequence 5 ' ends of column are located at the sequence that a length near insertion junction is 1456 nucleotide, the SEQ ID NO:3 Or its complementary series by 1132 nucleotide corn flanking genomic DNA sequence (the nucleotide 1-1132 of SEQ ID NO:3), The DBN10006 construct DNA sequence dna (the nucleotide 1133-1297 of SEQ ID NO:3) of 165 nucleotide and 159 nucleosides 3 ' end DNA sequences (the nucleotide 1298-1456 of the SEQ ID NO:3) composition of the tNos terminator sequence of acid, comprising described SEQ ID NO:3 or its complementary series can be accredited as the presence of transgenic corn events DBN9868.
The nucleic acid sequence can be any portion of the SEQ ID NO:4 or its complementary series transgenic insetion sequence At least 11 or more the continuous polynucleotides (third nucleic acid sequence) divided, or be the SEQ ID NO:4 or its complementation Any portion of at least 11 or more continuous polynucleotides (the 4th cores in 3 ' flank corn gene group DNA regions in sequence Acid sequence).The nucleic acid sequence may further be derived from or be complementary to comprising the described of the complete SEQ ID NO:2 to be same A part of SEQ ID NO:4.When third nucleic acid sequence is used together with the 4th nucleic acid sequence, these nucleic acid sequences are being generated It include DNA primer group in the DNA cloning method of amplified production.The amplification generated in DNA cloning method is produced using DNA primer Object is can to diagnose transgenic corn events DBN9868 or the presence of its offspring when including the amplified production of SEQ ID NO:2. The SEQ ID NO:4 or its complementary series are to be located to insert in 3 ' ends of insetion sequence in transgenic corn events DBN9868 Enter the sequence that a length near junction is 1018 nucleotide, the SEQ ID NO:4 or its complementary series are by 103 The DBN10006 building of the pr35S promoter sequence (the nucleotide 1-103 of SEQ ID NO:4) of a nucleotide, 70 nucleotide The corn integration site flanking genomic dna of body DNA sequence dna (the nucleotide 104-173 of SEQ ID NO:4) and 845 nucleotide Sequence (174-1018 of SEQ ID NO:4) composition, can be accredited as comprising the SEQ ID NO:4 or its complementary series and turn base Because of the presence of corn event DBN9868.
The SEQ ID NO:5 or its complementary series are that the length of characterization transgenic corn events DBN9868 is 6800 The sequence of nucleotide, the genome and genetic elements for specifically including are as shown in table 1.Comprising the SEQ ID NO:5 or its mutually Complementary series can be accredited as the presence of transgenic corn events DBN9868.
The genome and genetic elements that table 1, SEQ ID NO:5 include
The nucleic acid sequence or its complementary series can be used in DNA cloning method to generate amplicon, the inspection of the amplicon Survey diagnosis biological sample transgenic corn event DBN9868 or the presence of its offspring；The nucleic acid sequence or its complementary series It can be used in nucleotide detection method, to detect the presence of biological sample transgenic corn event DBN9868 or its offspring.
To achieve the above object, the present invention also provides the DNA of test sample transgenic corn event DBN9868 a kind of Existing method, comprising:
Contact sample to be tested in nucleic acid amplification reaction at least two primers；
Carry out nucleic acid amplification reaction；
Detect the presence of amplified production；
The amplified production includes at least 11 continuous nucleotide or SEQ in SEQ ID NO:3 or its complementary series At least 11 continuous nucleotide in ID NO:4 or its complementary series.
Further, the amplified production includes 1-11 or 12-22 in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleotides in continuous nucleotide or SEQ ID NO:2 or its complementary series.
Further, the amplified production include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its mutually Complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.
In the above-mentioned technical solutions, the primer includes at least one nucleic acid sequence.
Specifically, the primer includes the first primer and the second primer, the first primer be selected from SEQ ID NO:8 and SEQ ID NO:10；Second primer is selected from SEQ ID NO:9 and SEQ ID NO:11.
To achieve the above object, the present invention also provides the DNA of test sample transgenic corn event DBN9868 a kind of Existing method, comprising:
Contact sample to be tested with probe, the probe includes at least 11 in SEQ ID NO:3 or its complementary series At least 11 continuous nucleotide in continuous nucleotide or SEQ ID NO:4 or its complementary series；
Hybridize the sample to be tested and the probe under stringent hybridization conditions；
Detect the hybridisation events of the sample to be tested and the probe.
The stringent condition can in 6 × SSC (sodium citrate), 0.5%SDS (lauryl sodium sulfate) solution, Hybridize at 65 DEG C, is then respectively washed film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.
Further, the probe include in SEQ ID NO:1 or its complementary series 1-11 or 12-22 it is continuous 1-11 or 12-22 continuous nucleotides in nucleotide or SEQ ID NO:2 or its complementary series.
Further, the probe has SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary sequence Column, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.
Selectively, at least one fluorophor label of at least one described probe.
To achieve the above object, the present invention also provides a kind of test sample transgenic corn event DBN9868's Method existing for DNA, comprising:
Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:3 or In its complementary series at least 11 continuous nucleotide or SEQ ID NO:4 or its complementary series at least 11 it is continuous Nucleotide；
Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions；
The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then are educated by marker auxiliary Kind analysis is to determine that glyphosate tolerant and/or glufosinate tolerant and marker nucleic acid molecules are chain on science of heredity.
Further, the marker nucleic acid molecules include 1-11 or in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleotides in 12-22 continuous nucleotides or SEQ ID NO:2 or its complementary series.
Further, the marker nucleic acid molecules have SEQ ID NO:1 or its complementary series, SEQ ID NO:2 Or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.
To achieve the above object, the present invention also provides a kind of DNA detection kit, including at least one DNA molecular, institutes Stating DNA molecular includes at least 11 continuous nucleotide or SEQ in the homologous sequence or its complementary series of SEQ ID NO:3 At least 11 continuous nucleotide, can be used as transgenic corns in the homologous sequence of ID NO:4 or its complementary series Event DBN9868 or its offspring have the DNA primer or probe of specificity.
Further, the DNA molecular includes 1-11 or 12-22 in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleotides in continuous nucleotide or SEQ ID NO:2 or its complementary series.
Further, the DNA molecular has the homologous sequence or its complementary series, SEQ ID of SEQ ID NO:1 The homologous sequence of NO:2 or its complementary series, the homologous sequence of SEQ ID NO:6 or its complementary series or SEQ ID NO:7 Homologous sequence or its complementary series.
To achieve the above object, the present invention also provides a kind of plant cells, include coding glyphosate tolerant EPSPS egg White nucleic acid sequence, the nucleic acid sequence of coding glufosinate tolerant PAT albumen and the nucleic acid sequence of specific region, the given zone The nucleic acid sequence in domain includes SEQ ID NO:1, SEQ ID NO:2, sequence shown in SEQ ID NO:6 or SEQ ID NO:7.
To achieve the above object, the present invention also provides a kind of corn plants for generating and having tolerance to glyphosate herbicidal The method of strain, the nucleic acid sequence including introducing coding glyphosate tolerant EPSPS albumen into the genome of the plant SEQ ID NO:1, SEQ ID NO:2, SEQ ID are selected from the nucleic acid sequence of the nucleic acid sequence of specific region, the specific region At least one of NO:3, SEQ ID NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence Column.
Specifically, the method for generating the plant for having tolerance to glyphosate herbicidal includes:
By to glyphosate herbicidal have tolerance the first parental maize plant of transgenic corn events DBN9868 with The the second parental maize plant sexual hybridization for lacking glyphosate tolerant, to generate a large amount of progeny plants；
The progeny plant is handled with glyphosate herbicidal；
The progeny plant of selection tolerance glyphosate.
To achieve the above object, the present invention also provides a kind of corn plants for generating and having tolerance to glufosinate-ammonium herbicide Strain method, including into the genome of the plant introduce coding glufosinate tolerant PAT albumen nucleic acid sequence and The nucleic acid sequence of the nucleic acid sequence of specific region, the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID At least one of NO:3, SEQ ID NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence Column.
Specifically, the method for generating the plant for having tolerance to glufosinate-ammonium herbicide includes:
By first parental maize plant of transgenic corn events DBN9868 to glufosinate-ammonium herbicide with tolerance and lack Second parental maize plant sexual hybridization of few glufosinate tolerant, to generate a large amount of progeny plants；
The progeny plant described in glufosinate-ammonium herbicide treatment；
The progeny plant of selection tolerance glyphosate.
To achieve the above object, the present invention also provides a kind of generations to have to glyphosate herbicidal and glufosinate-ammonium herbicide The method of the plant of tolerance, including introducing coding glyphosate tolerant EPSPS into the genome of the plant The nucleic acid sequence of the nucleic acid sequence of albumen, the nucleic acid sequence for encoding glufosinate tolerant PAT albumen and specific region, it is described specific The nucleic acid sequence in region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO: 5, at least one of sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.
Specifically, the method for generating the plant that there is tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide Include:
To there is the first parent of transgenic corn events DBN9868 of tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide This plant and the second parental maize plant sexual hybridization for lacking glyphosate and/or glufosinate tolerant, to generate big Measure progeny plant；
The progeny plant described in glyphosate herbicidal and glufosinate-ammonium herbicide treatment；
The progeny plant of selection tolerance glyphosate and glufosinate-ammonium.
To achieve the above object, the present invention also provides a kind of cultures has the corn plant of tolerance to glyphosate herbicidal The method of object, comprising:
An at least corn seed is planted, includes coding glyphosate tolerant EPSPS in the genome of the corn seed Nucleic acid sequence and specific region nucleic acid sequence；
The corn seed is set to grow up to plant；
The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of specific region with other The plant of sequence compares the plant with the plant injury weakened；
The nucleic acid sequence of the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.
To achieve the above object, the present invention also provides a kind of cultures has the corn plant of tolerance to glufosinate-ammonium herbicide The method of object, comprising:
An at least corn seed is planted, includes coding glufosinate tolerant PAT egg in the genome of the corn seed The nucleic acid sequence of white nucleic acid sequence and specific region；
The corn seed is set to grow up to plant；
The plant described in effective dose glufosinate-ammonium herbicide spray, harvest do not have the nucleic acid of specific region with other The plant of sequence compares the plant with the plant injury weakened；
The nucleic acid sequence of the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.
To achieve the above object, the present invention also provides a kind of cultures to have to glyphosate herbicidal and glufosinate-ammonium herbicide The method of the corn plant of tolerance, comprising:
An at least corn seed is planted, includes coding glyphosate tolerant EPSPS in the genome of the corn seed The nucleic acid sequence of the nucleic acid sequence of albumen, the nucleic acid sequence for encoding glufosinate tolerant PAT albumen and specific region；
The corn seed is set to grow up to plant；
The plant described in effective dose glyphosate herbicidal and glufosinate-ammonium herbicide spray, harvest do not have with other The plant of the nucleic acid sequence of specific region compares the plant with the plant injury weakened；
The nucleic acid sequence of the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.
To achieve the above object, the present invention also provides a kind of sides for protecting the plants from the damage as caused by herbicide Method is planted including the herbicide containing effective dose glyphosate and/or glufosinate-ammonium is applied at least one transgenic corns of plantation The big Tanaka of object, the rotaring gene corn plant include selected from SEQ ID NO:1, SEQ ID NO:2, SEQ in its genome At least one of ID NO:3, SEQ ID NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 core Acid sequence, the rotaring gene corn plant have the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.
To achieve the above object, the present invention also provides a kind of methods for controlling weeds in field, including will contain effective agent Amount glyphosate and/or the herbicide of glufosinate-ammonium are applied to the big Tanaka for planting at least one rotaring gene corn plant, described to turn base Because corn plant includes selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO in its genome: 4, at least one of sequence shown in SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence, the transgenosis are beautiful Rice plant has the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.
To achieve the above object, the present invention also provides a kind of crop field glyphosate for controlling glyphosate-tolerant plant is anti- Property weeds method, including the herbicide containing effective dose glufosinate-ammonium is applied at least one glyphosate tolerant of plantation The big Tanaka of rotaring gene corn plant, the rotaring gene corn plant of the glyphosate tolerant include to be selected from its genome SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ At least one of sequence shown in ID NO:7 nucleic acid sequence, the rotaring gene corn plant of the glyphosate tolerant have pair simultaneously The tolerance of glufosinate-ammonium herbicide.
To achieve the above object, the present invention also provides a kind of methods for delaying insect-resistant, are included in the pest-resistant jade of plantation The big Tanaka of rice plant plants at least one rotaring gene corn plant with glyphosate and/or glufosinate tolerant, the grass The rotaring gene corn plant of sweet phosphine tolerance includes selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID in its genome At least one of NO:3, SEQ ID NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence Column.
To achieve the above object, the present invention also provides a kind of multicore glycosides comprising SEQ ID NO:1 or SEQ ID NO:2 The agricultural product or commodity of acid, the agricultural product or commodity are corn flour, maize flour, corn oil, cornstarch, corn gluten, jade Rice cake, cosmetics or filler.
It is defined below and square in nucleic acid sequence and its detection method of the present invention for detecting antiweed corn plant Method can preferably define the present invention and those skilled in the art is instructed to implement the present invention, unless otherwise mentioned, according to The conventional usage of those of ordinary skill in the art understands term.
" corn " refers to maize (Zea mays), and all plant varieties including that can mate with corn, Including field corn kind.
Term "comprising" refers to " including but not limited to ".
Term " plant " includes that whole plant, plant cell, plant organ, plant protoplast, plant can therefrom again It is complete in raw plant cell tissue cultures, plant callus, vegetation bed (plant clumps) and plant or plant part Whole plant cell, the plant part such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stalk, root, the tip of a root, flower Medicine etc..The part for the genetically modified plants being interpreted as in the scope of the invention includes but is not limited to plant cell, protoplast, group It knits, callus, embryo and flower, stem, fruit, Ye Hegen, the above plant part are originated from advance with DNA molecular conversion of the invention And the genetically modified plants being therefore at least partly made of transgenic cell or its filial generation.
Term " gene " refers to the nucleic acid fragment of expression specific protein, including adjusting sequence (5 ' the non-volumes before coded sequence Code sequence) and coded sequence after adjusting sequence (3 ' non-coding sequence)." natural gene ", which refers to, is naturally found to have its own Adjust the gene of sequence." mosaic gene " refer to be not natural gene any gene, it includes non-natural discovery adjusting and Coded sequence." endogenous gene " refers to natural gene, and the natural gene is located in organism genome its natural place. " foreign gene " is the alien gene being not present in the existing genome for being biology and originally, also refers to and imports through Transgenic procedures The gene of recipient cell.Foreign gene may include the natural gene or mosaic gene of insertion non-native organism." transgenosis " It is the gene that genome is had been incorporated by Transformation Program.The site that recombinant DNA has been inserted into Plant Genome can claim For " insertion point " or " target site ".
" flanking DNA " may include the genome being naturally present in the organism of such as plant or be drawn by conversion process External source (heterologous) DNA entered, such as segment relevant to transformation event.Therefore, flanking DNA may include natural and exogenous DNA Combination.In the present invention, " flanking region " or " flanking sequence " or " genome frontier district " or " genome border sequence " refer to The base-pair of at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 is longer Sequence, be located at initial external source insertion DNA molecular immediately upstream or downstream and with initial external source be inserted into DNA molecular phase It is adjacent.When the flanking region is located at downstream, it is referred to as " left margin flank " or " 3 ' flank " or " 3 ' genome frontier district " Or " 3 ' border sequence of genome " etc..When the flanking region is located at upstream, it is referred to as " right margin flank " or " 5 ' sides The wing " or " 5 ' genome frontier district " or " 5 ' border sequence of genome " etc..
The Transformation Program of the random integration of exogenous DNA is caused to will lead to the transformant containing different flanking regions, the difference Flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, flanking region is logical Chang Buhui changes.Transformant also can be containing between heterologous insertion DNA and the section of genomic DNA or between two sections of genomic DNAs Or the unique engagement between two sections of allogeneic dna sequence DNAs." engagement " is the point of two specific DNA fragmentation connections.For example, engagement exists In the position of insert DNA connection flanking DNA.Junction is also present in the organism of conversion, and two of them DNA fragmentation is to repair Adorn linking together for the mode found from native organism." engagement DNA " refers to the DNA comprising junction.
The present invention provides the referred to as transgenic corn events of DBN9868 and its offspring, the transgenic corn events DBN9868 is corn plant DBN9868 comprising the Plants and Seeds of transgenic corn events DBN9868 and its plant are thin Born of the same parents or its renewable part, the plant part of the transgenic corn events DBN9868, including but not limited to cell, pollen, embryo Pearl, flower, bud, root, stem, silk, inflorescence, ear fringe, leaf and the product from corn plant DBN9868, such as corn flour, corn Face, corn oil, corn pulp, corn silk, cornstarch and the biomass for staying in corn crop field.
Transgenic corn events DBN9868 of the present invention contains a DNA construct, when it is expressed in plant cell When, the transgenic corn events DBN9868 obtains the tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide.The DNA Construct includes two concatenated expression cassettes, and first expression cassette is comprising the suitable promoter for expressing in plant and fits The polyadenylation signal sequence of conjunction, the promoter, which is operably connected, encodes 5- enol pyruvylshikimate -3- phosphoric acid The gene of synthase (EPSPS), the EPSPS have tolerance to glyphosate herbicidal.Second expression cassette includes for planting The suitable promoter expressed in object and suitable polyadenylation signal sequence, the promoter are operably connected coding The nucleic acid sequence of the gene of phosphinothricin N-acetyl transferase (PAT), the PAT albumen has tolerance to glufosinate-ammonium herbicide Property.Further, the promoter can be the suitable promoter separated from plant, including composing type, induction type and/or tissue Specificity promoter, the suitable promoter include but is not limited to cauliflower mosaic virus (CaMV) 35S promoter, radix scrophulariae flower Mosaic virus (FMV) 35S promoter, Tsf1 promoter, ubiquitin protein (Ubiquitin) promoter, actin (Actin) starting Son, soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum (Cestrum) yellow leaf curl virus promoter, patatin (Patatin) open Mover, ribulose-1,5-bisphosphate, 5- diphosphonic acid carboxylase/oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) starting Son, E9 promoter, GOS promoter, alcA/alcR promoter, Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promoter and Arabidopsis (Arabidopsis) Suc2 promoter.The polyadenylation signal sequence can for The suitable polyadenylation signal sequence to work in plant, the suitable polyadenylation signal sequence include but unlimited In from the polyadenosine of soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Polyadenylation signal sequence derives from cauliflower mosaic virus (CaMV) 35S terminator, derives from pea ribulose -1,5- diphosphonic acid Carboxylase/oxygenase E9 terminator, the polyadenylation signal sequence for deriving from protease-inhibitor Ⅱ (PIN II) gene With the polyadenylation signal sequence for deriving from alpha-tubulin (α-tubulin) gene.
In addition, the expression cassette can also include other genetic elements, the genetic elements include but is not limited to enhance Son and signal peptide/transit peptides.The expression of gene can be enhanced in the enhancer, and the enhancer includes but is not limited to cigarette Careless etch virus (TEV) translation activity factor, CaMV35S enhancer and FMV35S enhancer.Signal peptide/the transit peptides can be with Guide EPSPS albumen and/or PAT Protein transport to extracellular or intracellular specific organelle or compartment, for example, using compiling Code chloroplast transit peptide sequence targets chloroplaset, or utilizes ' KDEL ' to retain sequence and target endoplasmic reticulum.
5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) gene can be from soil Agrobacterium It is isolated in (Agrobacterium tumefaciens sp.) CP4 bacterial strain, and can by optimization codon or with Other way changes the polynucleotides of coding EPSPS, to reach the stability and utilizability that increase transcript in transformed cells Purpose.5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) gene can also be used as selected marker.
" glyphosate " refers to the salt of N- phosphonomethylglycine and it, is handled with " glyphosate herbicidal " and refers to use Any one is handled containing the herbicide formulations of glyphosate.In order to reach ebd and to certain glyphosate system The selection of agent utilization rate is no more than the technical ability of common agronomic technique personnel.Herbicide formulations using any one containing glyphosate Processing contains the field of the vegetable material from antiweed corn plant DBN9868, miscellaneous in the field by controlling Grass growth, and the growth or yield of the vegetable material from herbicide tolerant corn plant DBN9868 are not influenced.
The enzyme phosphinothricin N-acetyl transfer separated from streptomycete (Streptomyces viridochromogenes) Enzyme (phosphinothricin N-acetyltransferase, PAT) gene is catalyzed L-phosphinothricin conversion by acetylation For its inactive form, to assign plant to the tolerance of glufosinate-ammonium herbicide.Phosphinothricin (PTC, 2- amino- 4- methylphosphine-butyric acid) be glutamine synthelase inhibitor.PTC is antibiotic 2- amino -4- methylphosphine acyl-the-the third ammonia of alanyl The structural units of acid, this tripeptides (PTT) have resisting gram-positive and gramnegative bacterium and antimycotic Botrytis cinerea The activity of (Botrytis cinerea).Phosphinothricin N-acetyl transferase (PAT) gene can also be used as selected marker Gene.
" glufosinate-ammonium " also known as glufosinate refer to 2- amino -4- [hydroxyl (methyl) phosphono] butyric acid ammonium, with " careless ammonium Phosphine herbicide " processing, which refers to, to be handled using any one containing the herbicide formulations of glufosinate-ammonium.In order to reach effective biology Learn dosage and to certain glufosinate-ammonium preparation utilization rate selection be no more than common agronomic technique personnel technical ability.Use any one Herbicide formulations processing containing glufosinate-ammonium contains the vegetable material from herbicide tolerant corn plant DBN9868 Field, the weed growth in the field will be controlled, and do not influence from herbicide tolerant corn plant DBN9868 Vegetable material growth or yield.
The DNA construct is introduced in plant using method for transformation, and the method for transformation includes but is not limited to agriculture bar Bacterium (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.
The Agrobacterium_mediated method is the common method of Plant Transformation.The exogenous DNA gram that will be introduced into plant Between the grand left and right boundary consensus sequence to carrier, i.e. the area T-DNA.The carrier is transformed into agrobatcerium cell, then, The agrobatcerium cell is organized for infection plant, and the area T-DNA of the carrier comprising exogenous DNA is inserted into plant gene In group.
The Gene Knock-out Mice is with carrier bombardment plant cell (the biological bullet that particle mediates comprising exogenous DNA Hit conversion).
The pollen tube channel conversion method is that natural pollen tube channel (also known as pollen is formed by after pollinating using plant Pipe guides tissue), through megarchidium channel, exogenous DNA is carried into blastular.
After conversion, it is necessary to have from the plant tissue regenerating plants of conversion, and using suitable label selection The offspring of exogenous DNA.
DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassettes.DNA Construct preferably can the self-replacation in bacterial cell, and contain different restriction endonuclease sites plasmid, Contained restriction endonuclease sites provide functioning gene element, i.e. promoter, introne, leader sequence, volume for importing The DNA molecular of code sequence, 3 ' terminator regions and other sequences.Expression cassette contained in DNA construct includes providing courier Genetic elements necessary to the transcription of RNA, the expression cassette can be designed as expressing in prokaryotic cell or eukaryocyte.This hair Bright expression cassette is designed to most preferably express in plant cell.
Transgenosis " event " is to include one as obtained from converting plant cell with heterologous DNA construct and contain The expression of nucleic acid box of target gene is inserted into the plant population in Plant Genome with generation by transgene method, regeneration The plant population, and selection have the specific plant of insertion specific gene group site feature.Term " event " refers to including heterologous The original transformant of DNA and the offspring of the transformant.Term " event " also refers to transformant and other kinds containing allogeneic dna sequence DNA Offspring obtained from sexual hybridization is carried out between body, even if after be returned repeatedly with backcross parent, from transformant parent This insertion DNA and flanking genomic dna exists in the same chromosome location in filial generation.Term " event ", which also refers to, to be come From the DNA sequence dna of original transformant, the DNA sequence dna include insertion DNA and with the close adjacent flanking genomes sequence of insertion DNA Column, which, which is expected, is transferred in filial generation, the filial generation by containing insertion DNA parental department (such as original transformant and its It is selfed the filial generation generated) sexual hybridization is carried out with the parental department without containing insertion DNA and is generated, and the filial generation is received comprising mesh Mark the insertion DNA of gene.
" recombination " refers to the DNA that generally can not be found and therefore generate by manual intervention in nature in the present invention And/or the form of albumen and/or organism.This manual intervention can produce recombinant DNA molecules and/or recombinant plant." the weight To be by two kinds of artificial combination be in other cases, and isolated sequence section obtains group DNA molecular ", such as passing through It learns synthesis or operates isolated nucleic acid segment by genetic engineering technology.The technology for carrying out nucleic-acid manipulation is well-known.
Term " transgenosis " includes any cell, cell line, callus, tissue, plant part or plant, above base Because type due to heterologous nucleic acids there are due to change, " transgenosis " includes Transgenics initially changed in this way and by most The offspring individual that first Transgenics are generated by sexual hybridization or vegetative propagation.In the present invention, term " transgenosis " does not wrap (chromosome the or extrachromosomal) change by conventional plant breeding method or the natural genome that event occurs is included, it is described It is natural that for example random allogamy of event, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base or spontaneous prominent occurs Become.
" heterologous " refers to that the first molecule is not found usually and the second molecular combinations in nature in the present invention.For example, Molecule can be originated from the first species and be inserted into the genome of the second species.Therefore this molecule for host be it is heterologous and It is artificially introduced in the genome of host cell.
The transgenic corn events DBN9868 that there is tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide is cultivated, is led to It crosses following steps: making the first parental corn plants and the second parental corn plants sexual hybridization first, to produce multiplicity First generation progeny plant, first parental corn plants are by cultivation transgenic corn event DBN9868 and its jade of offspring Rice plant composition, transgenic corn events DBN9868 and its offspring be by using it is of the invention to glyphosate herbicidal and Obtained from there is glufosinate-ammonium herbicide the expression cassette of tolerance to be converted, the second parental corn plants shortage removes glyphosate The tolerance of careless agent and/or glufosinate-ammonium herbicide；Then the application to glyphosate herbicidal and/or glufosinate-ammonium herbicide is selected to have There is the progeny plant of tolerance, can cultivate there is the corn of tolerance to plant glyphosate herbicidal and glufosinate-ammonium herbicide Object.These steps, which may further include, makes the application to glyphosate herbicidal and/or glufosinate-ammonium herbicide have tolerance Progeny plant is returned with the second parental corn plants or third parental corn plants, then passes through application Gyphosate herbicice Agent, glufosinate-ammonium herbicide or by molecular marked compound relevant to character (such as comprising being inserted into transgenic corn events DBN9868 The DNA molecular of bond site that the 5 ' ends and 3 ' ends of sequence identify) identification select filial generation, glyphosate is removed to generate Careless agent and glufosinate-ammonium herbicide have the corn plant of tolerance.
It will also be appreciated that two different genetically modified plants can also hybridize to generate containing there are two independent, separation The offspring of the foreign gene of formula addition.It is all homozygous for the available foreign gene added to two of the selfing of appropriate offspring The Progeny plants of son.It is also as previously described to be expected to the backcrossing of parental plant and with the cutcross of non-transgenic plant , vegetative propagation is also same.
The corn of trans Bt gene can kill insect/pest of such as Lepidoptera and coleoptera, but there is also under a small amount of survival Insect/the pest come, after several generations is bred, it is possible to create resistant insects/pest of anti-Bt albumen.In order to solve insect/evil Worm generates resistance this problem, and Environmental Protection Agency USA gives following guidance for the use of genetically modified crops, need to provide one Sanctuary's corn of certainty ratio (requires have 5%, 10%, 20% etc. according to product difference about sanctuary's corn.And it can be The corn of non-pest-resistant transgenic corns (such as herbicide tolerant transgenic corns) or anti-Non-target pests, not necessarily right and wrong Transgenic corns).After insect/pest of the overwhelming majority is killed on corresponding transgenic insect-resistant corn, some Insect/pest is on sanctuary's corn without extremely, ensure that insect/pest population of not resistance accounts for governance quantity.So i.e. Make have the resistant insects/pest to survive on a small quantity, is also shown with the non-resistance insect/pest post-coitum resistant gene for ruling quantity is accounted for What is write dilutes.
Term " probe " is the nucleic acid molecules of one section of separation, is combined with conventional detectable label or report point above Son, for example, radioactive isotope, ligand, chemiluminescent agent or enzyme.This probe is complementary with a chain of target nucleic acid , in the present invention, probe is complementary with a DNA chain from transgenic corn events DBN9868 genome, no matter the gene Group DNA be also be derived from from transgenic corn events DBN9868 or seed transgenic corn events DBN9868 plant or Seed or extract.Probe of the invention not only includes DNA or ribonucleic acid, further include specifically with target DNA sequence dna combines and can be used for detecting the existing polyamide and other probe materials of the target dna sequence.
Term " primer " is the nucleic acid molecules of one section of separation, is hybridized by nucleic acid, annealed combination to complementary target dna On chain, heterozygote is formed between primer and target dna chain, then under the action of polymerase (such as archaeal dna polymerase), along mesh DNA chain is marked to extend.Primer pair of the invention is related to its application in target nucleic acid sequence amplification, for example, passing through polymerase chain Formula reacts (PCR) or other conventional nucleic acid amplification methods.
The length of probe and primer is usually 11 polynucleotides or more, preferably 18 polynucleotides or more, More preferably 24 polynucleotides or more, most preferably 30 polynucleotides or more.This probe and primer are in height Specifically hybridize under degree stringent hybridization condition with target sequence.Although being different from target dna sequence and being protected to target dna sequence The probe for holding hybridization ability can design by conventional method, however, it is preferred to, probe and primer in the present invention There is complete DNA sequence dna identity with the continuous nucleic acid of target sequence.
It can be determined by conventional method based on the primer and probe of flanking genomic dna and insetion sequence of the invention, For example, by separating corresponding DNA molecular from from the vegetable material of transgenic corn events DBN9868, and determining should The nucleic acid sequence of DNA molecular.The DNA molecular includes transgene insert sequence and Maize genome flank region, and the DNA divides The segment of son may be used as primer or probe.
Nucleic acid probe and primer of the invention hybridizes with target dna sequence under strict conditions.Any conventional nucleic acid is miscellaneous It hands over or amplification method may be used to identify in sample from the presence of the DNA of transgenic corn events DBN9868.Nucleic acid point Son or its segment can carry out specific hybrid with other nucleic acid molecules in any case.As the present invention uses, if two A nucleic acid molecules can form antiparallel double-strandednucleic acid structure, so that it may say that the two nucleic acid molecules are able to carry out specifically to each other Property hybridization.If two nucleic acid molecules show complete complementarity, claiming one of nucleic acid molecules is another nucleic acid point " complement " of son.As the present invention uses, when each nucleotide and another nucleic acid molecules of a nucleic acid molecules The corresponding nucleotide mutual added time, then the two nucleic acid molecules is claimed to show " complete complementarity ".If two nucleic acid molecules can be with Enough stability phase mutual crosses then claim to make them anneal and be bonded to each other under the conditions of at least conventional " low stringent " The two nucleic acid molecules are " minimum level is complementary ".Similarly, if two nucleic acid molecules can be mutual with enough stability Hybridization then claims the two nucleic acid molecules to have to make them anneal and be bonded to each other under the conditions of conventional " height is stringent " " complementarity ".Deviateing from complete complementarity can permit, as long as not exclusively to prevent two molecules from being formed double for this deviation Chain structure.In order to enable a nucleic acid molecules as primer or probe, it is only necessary to it is adequately complementary to guarantee that it has in sequence Property, so that stable duplex structure can be formed under used specific solvent and salinity.
As the present invention uses, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules are in high stringency Specific hybrid can occur with the complementary strand of another section of nucleic acid molecules to match down.Promote the suitable stringent of DNA hybridization Condition is then used under the conditions of 50 DEG C for example, about being handled under the conditions of 45 DEG C with 6.0 × sodium chloride/sodium citrate (SSC) 2.0 × SSC washing, these conditions are well known to those skilled in the art.For example, the salinity in washing step can be selected About 2.0 × SSC, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C from Low stringency conditions.In addition, washing step In temperature condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of room temperature of Low stringency conditions.Temperature strip Part and salinity can all change, can also one of them remain unchanged and another variable changes.Preferably, originally Invention a nucleic acid molecules can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, in SEQ ID NO:6 and SEQ ID NO:7 Specific hybrid occurs for any segment of one or more nucleic acid molecules or its complementary series or above-mentioned sequence.It is highly preferred that A nucleic acid molecules of the invention under high stringency with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, one or more nucleic acid molecules or its complementary series in SEQ ID NO:6 and SEQ ID NO:7, Or specific hybrid occurs for any segment of above-mentioned sequence.In the present invention, preferred marker nucleic acid molecules have SEQ ID Any segment of NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned sequence. Another preferred marker nucleic acid molecules of the present invention and SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID Any segment of NO:7 or its complementary series or above-mentioned sequence is same with 80% to 100% or 90% to 100% sequence Property.SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 may be used as the mark in plant breeding method Object is remembered to identify the offspring of genetic cross.Probe can be art technology by any one with hybridizing for target dna molecule Method known to personnel detects, these methods include but is not limited to fluorescent marker, radioactive label, antibody class label And chemiluminescent labeling.
About the amplification (for example, passing through PCR) for using specific amplimer to carry out target nucleic acid sequence, " stringent item Part " refers to the condition for only allowing primer pair target nucleic acid sequence to hybridize in the hot amplified reaction of DNA, has and target core The primer of the corresponding wild-type sequence of acid sequence (or its complementary series), can be and excellent in conjunction with the target nucleic acid sequence Choosing generates unique amplified production, amplified production, that is, amplicon.
Term " specific binding (target sequence) " refers to probe under stringent hybridization conditions or primer only and comprising target Target sequence in the sample of sequence hybridizes.
As the present invention uses, " by the DNA of amplification " or " amplicon " refer to the target as nucleic acid-templated a part The nucleic acid amplification product of nucleic acid sequence.For example, in order to determine corn plant whether by containing transgenic corn events of the present invention DBN9868 is generated by sexual hybridization mode, or whether the corn sample acquired from field includes transgenic corn events Whether DBN9868 or corn extract, such as coarse powder, powder or oil include transgenic corn events DBN9868, from corn plant The DNA that tissue sample or extract extract can be by using the nucleic acid amplification method of primer pair to generate for transgenic corns The presence of the DNA of event DBN9868 is diagnostic amplicon.The primer pair include one in the Plant Genome with The first primer of the adjacent flanking sequence of the exogenous DNA insertion point of insertion, and second draw from the exogenous DNA of insertion Object.Amplicon has certain length and sequence, and the sequence is also diagnostic to the transgenic corn events DBN9868. The length range of amplicon can be the combination length of primer pair plus a nucleotide base pair, preferably add about 50 cores Thuja acid base-pair more preferably adds about 250 nucleotide bases pair, most preferably adds about 450 nucleosides soda acids Base to or more.
Optionally, primer pair can include entire insertion to generate from the flanking genomic sequence of the insertion two sides DNA The amplicon of nucleotide sequence.One in the primer pair of plant genome sequences can be located at away from insertion DNA sequence dna At a certain distance from, which may range from a nucleotide base to about 20,000 nucleotide bases pair.Term " amplification The use of son " has been particularly intended to exclude the primer dimer formed in the hot amplified reaction of DNA.
Nucleic acid amplification reaction can be realized by any nucleic acid amplification reaction method known in the art, including polymerization Enzyme chain reaction (PCR).Various nucleic acid amplification methods have been well-known to those skilled in the art.PCR amplification method has been sent out Open up the phage DNA of the amplifiable up to genomic DNA of 22kb and up to 42kb.Other of these methods and this field DNA cloning method can be used for the present invention.The exogenous DNA array of insertion and flank from transgenic corn events DBN9868 DNA sequence dna can be expanded by being expanded using genome of the provided primer sequence to transgenic corn events DBN9868 The DNA sequencing of standard is carried out after increasing to the DNA of PCR amplification or clone.
DNA detection kit based on DNA cloning method contains DNA primer molecule, they are under reaction condition appropriate On specific hybrid to target dna and expand diagnostic amplicon.Kit can provide the detection method based on Ago-Gel Or many methods of checkout and diagnosis amplicon known in the art.Containing with SEQ ID NO:3 or SEQ ID NO:4's Any part in Maize genome area is homologous or complementary and any part with the transgenosis insert district of SEQ ID NO:5 The kit of homologous or complementary DNA primer is provided by the present invention.Particularly identify useful in DNA cloning method draw Object expands 5 ' transgenosis/genome with transgenic corn events DBN9868 to being SEQ ID NO:8 and SEQ ID NO:9 A part of homologous diagnostic amplicon in area, wherein amplicon includes SEQ ID NO:1.Other DNA as DNA primer points Son can be selected from SEQ ID NO:5.
Amplicon caused by these methods can be detected by multiple technologies.One of method is Genetic Bit Analysis, this method devise one across the DNA of insertion DNA sequence dna and adjacent flanking genomic DNA sequence widow Nucleotide chain.The oligonucleotide chain is fixed in the micropore of a microwell plate, after carrying out PCR amplification to target area ( A primer is respectively used in insetion sequence and in adjacent flanking genomic sequence), single stranded PCR products can be with fixed few nucleosides Sour chain is hybridized, and the template as single base extension, which has used archaeal dna polymerase and be next The ddNTPs of a expected base specific markers.Result can be obtained by fluorescence or ELISA class method.Signal represents slotting Enter/the presence of flanking sequence, illustrates that amplification, hybridization and single base extension are successful.
Another method is Pyrosequencing (pyrosequencing) technology.This method devises one across insertion The oligonucleotide chain of DNA sequence dna and adjacent genomic DNA binding site.By the single-stranded of the oligonucleotide chain and target area Then and DNA PCR product (primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) is hybridized, Polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine -5 '-phosphorus sulfate and luciferin are together It is incubated.It is separately added into dNTPs, measures the optical signal of generation.Optical signal represents the presence of insertion/flanking sequence, says Bright amplification, hybridization and single base or polybase base extension are successful.
The Fluorescence polarization of Chen etc. (genome research (Genome Res.) 9:492-498,1999) description is also can In a kind of method for detecting amplicon of the present invention.Need to design one in this way across insertion DNA sequence dna and phase The oligonucleotide chain of adjacent genomic DNA binding site.The single stranded PCR products of the oligonucleotide chain and target area (are being inserted Enter in sequence and respectively use in adjacent flanking genomic sequence a primer) hybridized, then with archaeal dna polymerase and one The ddNTP of kind fluorescent marker is incubated together.Single base extension will lead to insertion ddNTP.This insertion can use fluorescence Instrument measures the change of its polarization.The change of polarization represents the presence of insertion/flanking sequence, illustrates amplification, hybridization and single alkali Base extension is successful.
Taqman is described as a kind of detect and is mentioned with method existing for quantitative analysis DNA sequence dna, this method in manufacturer It is discussed in detail in the operation instruction of confession.It is now briefly illustrated below, designs one across insertion DNA sequence dna and adjacent base Because of the FRET oligonucleotide probe of group flank binding site.The FRET probe and PCR primer are (in insetion sequence and adjacent side A primer is respectively used in wing genome sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.FRET probe Hybridization lead to the division of fluorescence part and quencher moieties and the release of fluorescence part on FRET probe.The generation of fluorescence signal The presence of insertion/flanking sequence is represented, illustrates amplification and hybridization is successful.
Based on Hybridization principle, for detecting the plant material for deriving from herbicide tolerant transgenic corn events DBN9868 The suitable technology of material can also include Southern blot hybridization, Northern blot hybridization and in situ hybridization.Particularly, described The technology of being suitble to includes incubating probe and sample, is washed to remove whether unbonded probe and detection probe have hybridized.It is described Detection method depend on the appended type marked of probe, for example, can detecte radioactive label by X-ray exposure and imaging Probe, or by substrate convert realize color change can detecte enzyme label probe.
Tyangi etc. (Nature Biotechnol (Nat.Biotech.) 14:303-308,1996) describes molecular labeling in sequence Application in column detection.It is briefly described as follows, designs one across insertion DNA sequence dna and adjacent flanking genomic binding site FRET oligonucleotide probe.The unique texture of the FRET probe causes it to contain secondary structure, which can be close Apart from interior holding fluorescence part and quencher moieties.The FRET probe and PCR primer are (in insetion sequence and adjacent flanking gene A primer is respectively used in group sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.By successful PCR Amplification, the hybridization of FRET probe and target sequence leads to the forfeiture of probe secondary structure, to make fluorescence part and quencher moieties It spatially separates, generates fluorescence signal.The generation of fluorescence signal represents the presence of insertion/flanking sequence, explanation Amplification and hybridization are successful.
The method of other descriptions, such as the method that microfluid (microfluidics) provides separation and DNA amplification sample And equipment.Photoinitiator dye is for detecting and measuring specific DNA molecular.Include the electronic sensor or knot for detecting DNA molecular Close specific DNA molecular receive pearl and thus can be detected receive test tube (nanotube) equipment for detecting DNA of the invention points Son is useful.
Method that composition and DNA detection field of the present invention describes or known can be used to develop DNA inspection Test agent box.The kit is conducive to identify the DNA that whether there is transgenic corn events DBN9868 in sample, can be with For cultivating the corn plant of the DNA containing transgenic corn events DBN9868.The kit can containing DNA primer or Probe at least part for being derived from or being complementary to SEQ ID NO:1,2,3,4 or 5, or contains other DNA primers or spy Needle, with being derived from or being complementary to DNA contained in the genetically modified element of DNA, these DNA sequence dnas can be used for DNA cloning Reaction, or as the probe in DNA hybridization method.It is containing in the corn genome and what is illustrated in Fig. 1 and table 1 turns base Because the DNA structure of insetion sequence and Maize genome binding site includes: the corn for being located at 5 ' end of transgene insert sequence is planted Object DBN9868 flanking genomes region, a part of insetion sequence in the right side boundary region (RB) from Agrobacterium, first table Up to box by 1 promoter of rice actin (prOsAct1), it is operably connected to the coding of arabidopsis EPSPS chloroplast transit peptides In sequence (spAtCTP2), the 5- enol-pyrovyl for being operably connected to the glyphosate tolerant of Agrobacterium CP4 bacterial strain is big On oxalic acid -3- phosphate synthase (cEPSPS), it is operably connected on the transcription terminator (tNos) of nopaline synthase and forms, the Two expression cassettes by the tandem sequence repeats containing enhancer region cauliflower mosaic virus 35 S promoter (pr35S), operationally It is connected on the phosphinothricin N-acetyl transferase (cPAT) of the glufosinate tolerant of streptomycete, and is operably connected to flower It is formed on cauliflower mosaic virus 35S terminator (t35S), a part insertion of the left boundary area (LB) from Agrobacterium Sequence, and be located at 3 ' end of transgene insert sequence corn plant DBN9868 flanking genomes region (SEQ ID NO: 5).In DNA cloning method, the DNA molecular as primer, which can be, is inserted into sequence from corn plant DBN9868 transgenic Any part of column is also possible to times from the region of DNA domain of flank Maize genome in transgenic corn events DBN9868 What part.
Transgenic corn events DBN9868 can be combined with other transgenic maize varieties, such as herbicide tolerant is (such as 2,4-D, dicamba etc.) corn, or carry the transgenic maize varieties of other anti insect genes (such as Cry1Ab, Vip3A).Institute There are the various combinations of these different transgenic events, the breeding together with transgenic corn events DBN9868 of the invention, Ke Yiti For resisting a variety of insect pests and being resistant to the improvement hybrid transgenic corn varieties of a variety of herbicides.These kinds are compared to non-transgenic product The transformed variety of kind and unisexuality shape can show the superior features such as yield promotion.
The present invention provides a kind of for detecting the nucleic acid sequence and its inspection of herbicide tolerant corn plant DBN9868 Survey method, the phytotoxicity that transgenic corn events DBN9868 is resistant to the agriculture herbicide containing glyphosate and/or glufosinate-ammonium are made With.The 5- enol pyruvylshikimate-of the glyphosate resistance of the plant expression Agrobacterium strains CP4 of the dual character 3- phosphate synthase (EPSPS) albumen assigns plant to the tolerance of glyphosate, and expresses the phosphine of the glufosinate resistance of streptomycete Silk rhzomorph N- acetyltransferase (PAT) albumen assigns plant to the tolerance of glufosinate-ammonium.Dual character corn has as follows Advantage: 1) apply agriculture herbicide containing glyphosate and be used for the ability that broad-spectrum weeding controls to corn crop；2) glufosinate-ammonium is resistant to Property character glufosinate-ammonium herbicide (mix or be used alternatingly with glyphosate herbicidal) be applied in combination can be used as a kind of effectively management The non-selective means of glyphosate-resistant weeds；3) herbicide tolerant transgenic corns are as non-pest-resistant transgenic corns, with Transgenic insect-resistant corn is planted together with certain proportion, and insect/pest can be delayed to generate resistance；4) corn yield does not drop It is low.In addition, the gene linkage of coding glyphosate tolerant and glufosinate tolerant character and exists in same DNA section In on the term single gene seat of transgenic corn events DBN9868 genome, this point provides the breeding efficiency of enhancing and makes The transgenic insert in reproductive population and its filial generation can be tracked with molecular labeling.Simultaneously in detection method SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series can be used as DNA primer or probe and be diagnosed as transgenic corn events DBN9868 to generate Or the amplified production of its offspring, and can be quick, accurate, stable identify from transgenic corn events DBN9868's The presence of vegetable material.
BRIEF DESCRIPTION OF THE SEQUENCES
The insertion point and Maize genome of 5 ' transgenic fragments in SEQ ID NO:1 transgenic corn events DBN9868 11 nucleotide of every side of DNA；
The insertion point and Maize genome of 3 ' transgenic fragments in SEQ ID NO:2 transgenic corn events DBN9868 11 nucleotide of every side of DNA；
It is located at insertion junction in 5 ' ends of insetion sequence in SEQ ID NO:3 transgenic corn events DBN9868 A neighbouring length is the sequence of 1456 nucleotide；
It is located at insertion junction in 3 ' ends of insetion sequence in SEQ ID NO:4 transgenic corn events DBN9868 A neighbouring length is the sequence of 1018 nucleotide；
The flank maize genomic sequence of the entire T-DNA sequence of SEQ ID NO:5,5 ' and 3 '；
SEQ ID NO:6 is located at the sequence inside SEQ ID NO:3, span DBN10006 construct DNA sequence and TNos transcription terminator；
SEQ ID NO:7 is located at the sequence inside SEQ ID NO:4, spans pr35S promoter sequence and DBN10006 Construct DNA sequence dna；
The first primer of SEQ ID NO:8 amplification SEQ ID NO:3；
The second primer of SEQ ID NO:9 amplification SEQ ID NO:3；
The first primer of SEQ ID NO:10 amplification SEQ ID NO:4；
The second primer of SEQ ID NO:11 amplification SEQ ID NO:4；
Primer on 5 ' flanking genomic sequence of SEQ ID NO:12；
The primer of SEQ ID NO:13 and SEQ ID NO:12 pairing being located on T-DNA；
Primer on 3 ' flanking genomic sequence of SEQ ID NO:14 can detecte with SEQ ID NO:12 pairing and turn Gene is homozygote or heterozygote；
The primer of SEQ ID NO:15 and SEQ ID NO:14 pairing being located on T-DNA；
The primer 1 of SEQ ID NO:16 Taqman detection EPSPS；
The primer 2 of SEQ ID NO:17 Taqman detection EPSPS；
The probe 1 of SEQ ID NO:18 Taqman detection EPSPS；
The primer 3 of SEQ ID NO:19 Taqman detection PAT；
The primer 4 of SEQ ID NO:20 Taqman detection PAT；
The probe 2 of SEQ ID NO:21 Taqman detection PAT；
The first primer of SEQ ID NO:22 corn endogenous gene Ubiquitin；
The second primer of SEQ ID NO:23 corn endogenous gene Ubiquitin；
The probe of PAT in SEQ ID NO:24 Southern hybridization check；
The probe of EPSPS in SEQ ID NO:25 Southern hybridization check；
SEQ ID NO:26 is located at the primer on T-DNA, consistent with the direction ID NO:13 SEQ；
SEQ ID NO:27 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains flank sequence Column；
SEQ ID NO:28 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains flank sequence Column；
SEQ ID NO:29 is located at the primer on T-DNA, consistent with the direction ID NO:15 SEQ；
SEQ ID NO:30 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains flank sequence Column；
SEQ ID NO:31 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains flank sequence Column.
Below by drawings and examples, technical scheme of the present invention will be described in further detail.
Detailed description of the invention
Fig. 1 is the present invention for detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 Transgene insert sequence and Maize genome binding site structural schematic diagram；
Fig. 2 is the present invention for detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 Recombinant expression carrier DBN10006 structural schematic diagram.
Specific embodiment
Further illustrate the present invention for detecting herbicide tolerant corn plant DBN9868 below by specific embodiment Nucleic acid sequence and its detection method technical solution.
First embodiment, clone and conversion
1.1, carrier cloning
Recombinant expression carrier DBN10006 (as shown in Figure 2) is constructed using the gene clone technology of standard.The carrier DBN10006 includes two concatenated transgene expression cassettes, and first expression cassette is by 1 promoter of rice actin (prOsAct1), it is operably connected on the coded sequence (spAtCTP2) of arabidopsis EPSPS chloroplast transit peptides, it can the company of operation It is connected to the 5- enol-pyrovyl shikimic acid -3- phosphate synthase (cEPSPS) of the glyphosate tolerant of Agrobacterium CP4 bacterial strain On, it is operably connected on the transcription terminator (tNos) of nopaline synthase and forms；Second expression cassette is by containing enhancer The cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats in region, the glufosinate-ammonium for being operably connected to streptomycete are resistance to By on the phosphinothricin N-acetyl transferase (cPAT) of property, and it is operably connected to cauliflower mosaic virus 35S terminator (t35S) it is formed on.
The carrier DBN10006 is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA with liquid nitrogen method； Cat.No:18313-015 in), and with 5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) be selected marker to turn Change cell to be screened.
1.2, Plant Transformation
It is converted using conventional Agrobacterium infestation method, by institute in the maize immature embryos of sterile culture and the present embodiment 1.1 The Agrobacterium stated co-cultures, and the T-DNA in the recombinant expression carrier DBN10006 of building is transferred in maize chromosome group, To generate transgenic corn events DBN9868.
For the corn transformation of mediated by agriculture bacillus, briefly, immature rataria is separated from corn, is suspended with Agrobacterium Liquid contacts rataria, and wherein the nucleotide sequence of the nucleotide sequence of EPSPS gene and pat gene can be transferred to children by Agrobacterium At least one cell (step 1: infecting step) of one of embryo, in this step, rataria preferably immerses agrobacterium suspension (OD660=0.4-0.6 infects culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, grape Sugared 36g/L, acetosyringone (AS) 40mg/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH 5.3)) in starting connect Kind.Rataria and Agrobacterium co-culture one period (3 days) (step 2: co-culturing step).Preferably, rataria is after infecting step In solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetyl cloves Ketone (AS) 100mg/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH 5.8) on cultivate.It co-cultures herein After stage, there can be " recovery " step of a selectivity.In " recovery " step, recovery media (MS salt 4.3g/L, MS dimension He is life, casein 300mg/L, sucrose 30g/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) at least in the presence of one kind, oneself knows the antibiotic (cephalosporin) for inhibiting Agrobacterium growth in, does not add the selection of vegetable transformant Agent (step 3: recovering step).Preferably, rataria is cultivated on having antibiotic but the not solid medium of selective agent, to eliminate Agrobacterium simultaneously provides convalescence for infected cell.Then, the rataria of inoculation is cultivated on the culture medium containing selective agent (glyphosate) And select the transformed calli (step 4: selection step) grown.Preferably, rataria is in the screening solid training for having selective agent Support base (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30 g/L, N- (phosphine carboxymerhyl) glycine 0.25mol/ L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) on cultivate, cause conversion cell selection Property growth.Then, callus regeneration is at plant (step 5: regeneration step), it is preferable that raw on the culture medium containing selective agent Long callus is cultivated on solid medium (MS differential medium and MS root media) with aftergrowth.
It screens obtained resistant calli and is transferred to the MS differential medium (MS salt 4.3g/L, MS vitamin, cheese Plain 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, N- (phosphine carboxymerhyl) glycine 0.125mol/L, plant gel 3g/L, pH 5.8) on, differentiation is cultivated at 25 DEG C.It differentiates the seedling come and is transferred to the MS root media (MS salt 2.15g/ L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH 5.8) on, at 25 DEG C Culture moves to hot-house culture to solid to about 10cm high.In the greenhouse, it is cultivated 16 hours at 28 DEG C daily, at 20 DEG C Culture 8 hours.
1.3, the identification and screening of transgenic event
332 separate transgenic T are produced altogether0Plant.
Pass through TaqManTMIt analyzes (referring to second embodiment) and detects regenerated transgenic corn plant with the presence or absence of EPSPS And pat gene, and characterize the copy number of tolerance glyphosate and glufosinate-ammonium strain.By screening, the event DBN9868 of having selected is excellent Different, there is single copy transgenosis, good glyphosate herbicide tolerance, glufosinate-ammonium herbicide tolerant and economical character Performance (referring to the 5th embodiment).
Second embodiment carries out transgenic corn events DBN9868 detection with TaqMan
Take the blade about 100mg of transgenic corn events DBN9868 as sample, with the DNeasy Plant of Qiagen Maxi Kit extracts its genomic DNA, detects EPSPS gene and pat gene by Taqman fluorescence probe quantitative PCR method Copy number.Simultaneously using wild-type corn plant as control, tested and analyzed according to the method described above.Experiment sets 3 repetitions, takes Average value.
The specific method is as follows:
Step 11, the blade 100mg for taking transgenic corn events DBN9868, are ground into homogenate with liquid nitrogen in mortar, each Sample takes 3 repetitions；
Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；
Step 13, the genomic DNA concentration that above-mentioned sample is measured with NanoDrop 2000 (Thermo Scientific)；
Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the range of the concentration value is 80- 100ng/μl；
Step 15, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR method, by being copied known to identification The sample of shellfish number is as standard items, and using the sample of wild-type corn plant as control, 3 repetitions of each sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively:
Following primer and probe is used to detect EPSPS gene order:
Primer 1:CTGGAAGGCGAGGACGTCATCAATA is as shown in SEQ ID NO:16 in sequence table；
Primer 2: TGGCGGCATTGCCGAAATCGAG is as shown in SEQ ID NO:17 in sequence table；
Probe 1:ATGCAGGCGATGGGCGCCCGCATCCGTA is as shown in SEQ ID NO:18 in sequence table；
Following primer and probe is used to detect pat gene sequence:
Primer 3:CAGTTGAGATTAGGCCAGCTACAG is as shown in SEQ ID NO:19 in sequence table；
Primer 4:TTCACTGTAGACGTCTCAATGTAATGG is as shown in SEQ ID NO:20 in sequence table；
Probe 2:CAGCTGATATGGCCGCGGTTTGTG is as shown in SEQ ID NO:21 in sequence table；
PCR reaction system are as follows:
50 × the primer/probe mixture includes each 45 μ L of every kind of primer, 50 μ of probe of 100 μM of concentration of 1mM concentration L and 860 μ lL1 × TE buffers, and at 4 DEG C, it is housed in amber tube.
PCR reaction condition are as follows:
Data are analyzed using SDS2.3 software (Applied Biosystems), obtain the transgenic corn events singly copied DBN9868。
3rd embodiment, transgenic corn events DBN9868 detection
3.1, extracting genome DNA
DNA is extracted according to CTAB (cetyl trimethylammonium bromide) method routinely used: taking 2 grams of tender transgenosis beautiful After the blade of rice event DBN9868 is pulverized in liquid nitrogen, the DNA that 0.5mL is preheated in 65 DEG C of temperature is added and extracts CTAB Buffer (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetra-acetic acid), with NaOH tune pH To 8.0), after mixing well, extracted 90 minutes in 65 DEG C of temperature；0.5 times of volume of phenol is added, 0.5 times of volume of chloroform overturns mixed It is even；It is centrifuged 10 minutes under 12000rpm (revolutions per minute) revolving speed；2 times of volume dehydrated alcohols are added in Aspirate supernatant, soft to shake Dynamic centrifuge tube stands 30 minutes in 4 DEG C of temperature；It is centrifuged again under 12000rpm revolving speed 10 minutes；DNA is collected to tube bottom；Abandon supernatant Liquid, the ethyl alcohol for being 70% with 1mL mass concentration, washing precipitating；It is centrifuged 5 minutes under 12000rpm revolving speed；Vacuum is drained or super Net platform drying；DNA is precipitated and dissolved in suitable TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0), is stored in Under the conditions of -20 DEG C of temperature.
3.2, the analysis of flanking DNA sequence
Concentration mensuration is carried out to the DNA sample of said extracted, is located at the concentration of sample to be tested between 80-100ng/ μ L. With the restriction enzyme Spe I, Pst I, Eco57 I (5 ' end analysis) and BamH I, Xma I, Kpn I, Sac selected II (3 ' end analysis) difference digestion genomic DNA.26.5 μ L genomic DNAs, the 0.5 above-mentioned selection of μ L are added in each digestion system Restriction enzyme and 3 μ L enzyme cutting buffering liquids out, digestion 1 hour.After to digestion, 70 μ are added into digestion system L dehydrated alcohol, ice bath 30 minutes, revolving speed 12000rpm was centrifuged 7 minutes, abandoned supernatant, and 8.5 μ L distilled water (dd are added in drying later H2O)、1μL 10X T4Buffer and 0.5 μ L T4Ligase is stayed overnight in 4 DEG C of temperature connections.It is carried out with a series of nested primers PCR amplification separates 5 ' and 3 ' transgenosis/genomic DNA.Specifically, 5 ' transgenosis of separation/genomic DNA primer combination includes SEQ ID NO:13, SEQ ID NO:26 as the first primer, SEQ ID NO:27, SEQ ID NO:28 as the second primer, SEQ ID NO:13 is as sequencing primer.Separating 3 ' transgenosis/genomic DNA primer combination includes SEQ ID NO:15, SEQ ID NO:29 is as the first primer, and SEQ ID NO:30, SEQ ID NO:31 are as the second primer, and SEQ ID NO:15 is as survey Sequence primer, PCR reaction condition are as shown in table 3.
Amplicon obtained electrophoresis on 2.0% Ago-Gel then uses QIAquick to separate PCR reactant Gel extracts kit (catalogue #_28704, Qiagen Inc., Valencia, CA) separates target fragment from agarose matrix.So (for example, ABI PrismTM 377, PE Biosystems, Foster City, CA) is sequenced to the PCR product of purifying afterwards and is divided It analyses (for example, DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).
5 ' and 3 ' flanking sequences and junction sequences are confirmed using standard pcr.5 ' flanking sequences and junction sequences can make Confirmed with SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:26. SEQ ID NO:11 or SEQ ID NO:14, combination S EQ ID NO:10, SEQ ID can be used in 3 ' flanking sequences and junction sequences NO:15 or SEQ ID NO:29 confirms.PCR reaction system and amplification condition are as shown in table 2 and table 3.Those skilled in the art It will be understood that other primer sequences can also be used for confirmation flanking sequence and junction sequences.
The DNA sequencing of PCR product provides the DNA that can be used for designing other DNA moleculars, other described DNA moleculars are made The identification of the corn plant or seed from transgenic corn events DBN9868 is used for for primer and probe.
It was found that 1-1132, the nucleotide displays in SEQ ID NO:5 are maize genomic sequence in transgenic corns thing The right margin flank (5 ' flanking sequence) of part DBN9868 insetion sequence, 5956-6800, nucleotide in SEQ ID NO:5 are aobvious Show the left margin flank (3 ' flanking sequence) for being maize genomic sequence in transgenic corn events DBN9868 insetion sequence. 5 ' junction sequences are listed in SEQ ID NO:1, and 3 ' junction sequences are listed in SEQ ID NO:2.
3.3, PCR zygosity determination
Junction sequence is relatively short polynucleotide molecule, is new DNA sequence dna, examines when in polynucleotide tests and analyzes It is diagnostic for the DNA of transgenic corn events DBN9868 when measuring.Connecing in SEQ ID NO:1 and SEQ ID NO:2 Close every side of insertion point and corn gene group DNA that sequence is transgenic corn events DBN9868 transgenic segment 11 polynucleotides.Longer or shorter polynucleotides junction sequence can be selected from SEQ ID NO:3 or SEQ ID NO:4 It selects.Junction sequence (5 ' the join domain SEQ ID join domain SEQ ID of NO:1 and 3 ' NO:2) is used as DNA probe or conduct DNA primer molecule is useful in DNA detection method.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 is also transgenosis New DNA sequence dna in corn event DBN9868 can also be used as DNA probe or beautiful as DNA primer Molecular Detection transgenosis The presence of rice event DBN9868DNA.The SEQ ID NO:6 (1133-1456, the nucleotide of SEQ ID NO:3) is crossed over DBN10006 construct DNA sequence dna and tNos transcription terminator, the SEQ ID NO:7 (nucleotide of SEQ ID NO:4 1-173) span pr35S promoter sequence and DBN10006 construct DNA sequence dna.
In addition, amplicon is generated by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4, The diagnostic amplicon of transgenic corn events DBN9868 is generated when the primer is in PCR method.
Specifically, PCR product is generated from 5 ' ends of transgene insert sequence, which is to turn base comprising deriving from Because in the genome of the vegetable material of corn event DBN9868 flank in the genomic DNA of 5 ' ends of T-DNA insetion sequence A part.This PCR product includes SEQ ID NO:3.In order to carry out PCR amplification, design and flank are in transgene insert sequence 5 ' ends genomic dna sequence hybridization primer 5 (SEQ ID NO:8) and the paired transgenosis tNos that is located at turn Record the primer 6 (SEQ ID NO:9) of termination sequence.
PCR product is generated from 3 ' ends of transgene insert sequence, which includes to derive from transgenic corn events Flank is in a part of the genomic DNA of 3 ' ends of T-DNA insetion sequence in the genome of the vegetable material of DBN9868.This A PCR product includes SEQ ID NO:4.In order to carry out PCR amplification, design and flank are in 3 ' ends of transgene insert sequence The pr35S of primer 8 (the SEQ ID NO:11) and the paired 3 ' ends positioned at insert of genomic dna sequence hybridization The primer 7 (SEQ IDNO:10) of promoter sequence.
The DNA cloning condition illustrated in table 2 and table 3 can be used for above-mentioned PCR zygosity test to generate transgenic corns The diagnostic amplicon of event DBN9868.The detection of amplicon can be by using Stratagene as shown in table 3 Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycle Instrument etc. carries out, or carries out by methods known to those skilled in the art with equipment.
Table 2,5 ' transgenic insertions/genome engaging zones identification PCR for transgenic corn events DBN9868 Step and reaction mixture condition
Table 3, Perkin-Elmer9700 thermal cycler condition
It lightly mixes, if not having hot top on thermal cycler, 1-2 drop mineral can be added above each reaction solution Oil.Using following loop parameter (table 3) in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or PCR is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run under the mode of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.
The results showed that primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in transgenic corn events DBN9868 base When because in the PCR reaction of group DNA, the amplified production of 1456bp segment is generated, when it is used in unconverted corn gene group DNA and non- When in the PCR reaction of DBN9868 corn gene group DNA, no segment is amplified；Primer 7 and 8 (SEQ ID NO:10 and 11), When it is used in the PCR reaction of transgenic corn events DBN9868 genomic DNA, the amplified production of 1018bp segment is generated, When in the PCR reaction that it is used in unconverted corn gene group DNA and non-DBN9868 corn gene group DNA, expanded without segment Increase.
PCR zygosity determination can also be used in identification from transgenic corn events DBN9868 material be homozygote or It is heterozygote.Primer 9 (SEQ ID NO:12), primer 10 (SEQ ID NO:13) and primer 11 (SEQ ID NO:14) are used for Amplified reaction is to generate the diagnostic amplicon of transgenic corn events DBN9868.The DNA cloning condition illustrated in table 4 and table 5 It can be used for above-mentioned zygosity test to generate the diagnostic amplicon of transgenic corn events DBN9868.
Table 4, zygosity determination reaction solution
Table 5, zygosity determination Perkin-Elmer9700 thermal cycler condition
Using following loop parameter (table 5) Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) Or it is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler PCR.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run under the mode of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.
In the amplified reaction, the biological sample containing template DNA, which contains, diagnoses the sample transgenic corn event DBN9868 there are the DNA of situation.Or reaction will generate two by the biological sample containing the DNA from Maize genome A different DNA cloning, the DNA from Maize genome in transgenic corn events DBN9868 relative to existing The corresponding allele of insertion DNA be heterozygosis.The two different amplicons, which will correspond to, derives from wild-type corn base Because group locus the first amplicon and diagnosis transgenic corn events DBN9868DNA there are the second amplicons of situation.Only Generate the maize dna sample for corresponding to the single amplicon of the second amplicon for the description of heterozygous genes group, diagnosable determination The presence of sample transgenic corn event DBN9868, and the sample in rotaring gene corn plant DBN9868 by relative to depositing The corresponding allele of insertion DNA be produced by homozygous corn seed.
It should be noted that the primer pair of transgenic corn events DBN9868 is used to transgenic corn events DBN9868 genomic DNA is diagnostic amplicon.These primer pairs include but is not limited to (the SEQ ID NO:8 of primer 5 and 6 With 9) and primer 7 and 8 (SEQ ID NO:10 and 11), in the DNA cloning method.In addition, for expanding in corn One control primer 12 and 13 (SEQ ID NO:22 and 23) of source gene is included, as in one of reaction condition Standard.DNA extracting sample analysis to transgenic corn events DBN9868 should include a transgenic corn events The assaypositive tissue DNA extract of DBN9868 compares, and a negative DNA from non-transgenic corn event DBN9868 is extracted Object control and a negative control without containing template maize dna extract.Other than these primer pairs, it can also use and From any primer pair of SEQ ID NO:3 or SEQ ID NO:4 or its complementary series, when they are used for DNA amplification reaction Generate respectively for the tissue from transgenic event corn plant DBN9868 be it is diagnostic comprising SEQ ID NO:1 or The amplicon of SEQ ID NO:2.The DNA cloning condition illustrated in table 2- table 5 is used for suitable primer pair to generate The diagnostic amplicon of transgenic corn events DBN9868.It generates when being tested in DNA cloning method to transgenic corns thing Part DBN9868 be diagnostic amplicon, presumption contain corn plant or kind comprising transgenic corn events DBN9868 The extract of sub- DNA, or from the product of transgenic corn events DBN9868, it is used as the template of amplification, to determine With the presence or absence of transgenic corn events DBN9868.
Fourth embodiment carries out transgenic corn events DBN9868 detection by Southern blot hybridization
4.1, it is extracted for the DNA of Southern blot hybridization
Southern engram analysis is carried out using T4, T5 generation homozygous transformation event.Using mortar and pestle, in liquid nitrogen 10g plant tissue is arrived in grinding about 5.In 12.5mL Extraction buffer A (0.2M Tris pH8.0,50mM EDTA, 0.25M NaCl, 0.1%v/v β-dredges base ethyl alcohol, 2.5%w/v Polyvinyl-pyrrolidone) in resuspension plant tissue, with 4000rpm from The heart 10 minutes (2755g).After discarding supernatant, 2.5mL Extraction buffer B (0.2M Tris pH 8.0,50mM EDTA, 0.5M NaCl, 1%v/v β-dredges base ethyl alcohol, 2.5%w/v Polyvinyl-pyrrolidone, 3% flesh aminoacyl, 20% ethyl alcohol) in be resuspended It drifts along shallow lake, and is incubated 30 minutes at 37 DEG C.It is primary with asepsis ring mixing sample during incubation.After incubation, addition is isometric Chloroform/isoamyl alcohol (24:1), by be inverted be gently mixed, with 4000rpm centrifugation 20 minutes.Water-bearing layer is collected, and is being added Add after 0.54 volume isopropanol with 4000rpm centrifugation 5 minutes to precipitate DNA.Supernatant is discarded, and is resuspended in 500 μ LTE Floating DNA precipitating.DNA and 1 μ L 30mg/mlLRNAase A is incubated 30 minutes in order to degrade any existing RNA at 37 DEG C, With 4000rpm centrifugation 5 minutes, and in the presence of 0.5 volume 7.5M ammonium acetate and 0.54 volume isopropanol, by with 14000rpm is centrifuged 10 minutes precipitating DNA.After discarding supernatant, precipitating is washed with the ethyl alcohol that 500 μ L mass fractions are 70%, and After making it dry in 100 μ L TE resuspension.
4.2, enzymic digestion is limited
Utilize spectrophotometer or fluorometric quantification detection DNA concentration (utilizing 1 × TNE and Hoechst dyestuff).
In 100 μ L reaction systems, 5 μ g DNA are digested every time,.Distinguished with restriction enzyme Sac I and Hind III The partial sequence of digested genomic dna, the EPSPS using on T-DNA and PAT are as probe.For every kind of enzyme, at a proper temperature Be incubated overnight digest.Using SpeedVac (speed vacuum) rotation sample to reduce volume to 30 μ L.
4.3, gel electrophoresis
Bromophenol blue Loading Dye is added to each sample in the present embodiment 4.2, and by each sample pipetting volume It onto 0.7% Ago-Gel containing ethidium bromide, is separated by electrophoresis in TBE electrophoretic buffer, the electrophoresis coagulating under 20 volts Glue is stayed overnight.
Gel is washed in 0.25M HCl 15 minutes so that DNA depurination, is then washed with water.It is miscellaneous to set Southern trace It hands over as follows: placing 20 thick drying trace paper in disk, place 4 thin drying trace paper again thereon.In 0.4M NaOH 1 thin trace paper is moistened in advance, and is placed on the pile, and then placement 1 moistens in advance in 0.4M NaOH Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B).Gel is seated in top, it is ensured that solidifying There is no bubble between glue and film.3 trace paper in addition impregnated in advance are placed on gel top, and are filled out with 0.4M NaOH Full buffer disk.With the wick connection gel stack and buffer disk being immersed in 0.4M NaOH in advance, DNA is transferred to film On.DNA transfer in about 4 hours is carried out at room temperature.After transfer, rinsed Hybond film 10 seconds in 2 × SSC, DNA passes through UV Crosslinking is in conjunction with film.
4.4, hybridize
It is prepared with the DNA sequence dna that PCR amplification is suitble to for probe.The DNA probe is SEQ ID NO:24 and SEQ ID NO:25, or it is homologous or complementary with above-mentioned Sequence.25ng DNA probe is boiled 5 minutes in 45 μ LTE, is put on ice It sets 7 minutes, is then transferred into Rediprime II (Amersham Pharmacia Biotech, #RPN1633) test tube.To Rediprime test tube adds 5 μ l32P label dCTP after, 37 DEG C incubation probe 15 minutes.According to the manufacturer's instructions, It is centrifuged by micro- centrifugation G-50 pillar (Amersham Pharmacia Biotech, #27-5330-01), is not incorporated into removal DNTPs purifies the probe.Probe activity is measured using scintillation counter.
By in 65 DEG C of Church prehybridization solution (500mM Na with 20mL pre-heating3P04, 1mM EDTA, 7%SDS, 1%BSA) moisten the Hybond film 30 minutes, the prehybridization Hybond film.It boils the probe of label 5 minutes, and puts on ice It sets 10 minutes.Appropriate probe (every 1mL pre-hybridization buffer 1,000,000 times countings) is added to pre-hybridization buffer, overnight at 65 DEG C Hybridized.Second day, hybridization buffer is discarded, with (the 40mM Na of 20mLChurch rinse solution 13P04, 1mM EDTA, 5% SDS, 0.5%BSA) rinsing after, at 65 DEG C, wash film 20 minutes in 150mL Church rinse solution 1.It is rinsed with Church (the 40mM Na of solution 23P04, 1mM EDTA, 1%SDS) and it repeats the process 2 times.The film is exposed to phosphorus screen or X-ray to detect The position that probe combines.
Include three kinds of control samples on each Southern: (1) DNA of the segregant from negative (unconverted), For identify it is any can be with element-specific probe hybridization endogenous corn sequence；(2) DNA from negative segregant, wherein The DBN10006 of Hind III- digestion is introduced, amount is based on probe length and is equivalent to a copy number, beautiful in detection with explanation When individual gene in rice genome copies, the sensitivity of the experiment；(3) copy number is equivalent to based on probe length The DBN10006 plasmid of Hind III- digestion, the sensitivity as the positive control hybridized and for illustrating experiment.
The evidence that hybridization data provides confirmation supports TaqManTMPCR analysis, i.e. corn plant DBN9868 contain EPSPS It is copied with the list of pat gene.Using the EPSPS probe, Sac I and Hind III enzymatic hydrolysis generate size about 9kb and 11kb respectively Single band；Using the PAT probe, Sac I and Hind III enzymatic hydrolysis generate the single band of size about 5.5kb.This table Each copy of bright EPSPS and PAT is present in corn transformation event DBN9868.
The herbicide tolerant detection of 5th embodiment, event
This test selects agriculture up to herbicide (41% glyphosate-isopropylammonium aqua) and protects examination up to herbicide (effective component 18% glufosinate-ammonium) it is sprayed.Using RANDOMIZED BLOCK DESIGN, 3 repetitions.Plot area is 15m2(5m × 3m), line-spacing 60cm, spacing in the rows 25cm, conventional cultivation management have the wide isolation strip of 1m between cell.Transgenic corn events DBN9868 is distinguished It carries out following 3 kinds of processing: 1) not spraying；2) agriculture is sprayed up to herbicide, then in V8 in the V3 leaf phase by 1680g a.e./ha dosage Phase is sprayed agriculture by same dose up to herbicide again；3) guarantor's examination is sprayed up to (Basta) in the V3 leaf phase by 800g a.i./ha dosage Then herbicide is sprayed guarantor's examination up to (Basta) herbicide again in the V8 phase by same dose.It should be noted that different content The form of equivalent glyphosate is converted into the glyphosate herbicidal of dosage form and the glufosinate-ammonium solution of various concentration is converted into Equivalent effective component glufosinate-ammonium is stated to be suitable for draw a conclusion.
The 1 week and 2 weeks investigation symptom of chemical damage after medication respectively, and harvest when measure cell corn yield.Phytotoxicity disease Shape classification is as shown in table 6.The index for using the aggrieved rate of herbicide as the herbicide tolerant of evaluation transformation event is specifically removed The careless aggrieved rate of agent (%)=∑ (aggrieved strain number × number of levels at the same level)/(total strain number × highest level)；The wherein aggrieved rate of herbicide Including the aggrieved rate of glyphosate and the aggrieved rate of glufosinate-ammonium, the aggrieved rate of herbicide is the medicine according to 2 weeks after glyphosate or glufosinate-ammonium processing Evil investigation result and determination.The corn yield of each cell is the niblet total output (weight) for weighing 3 rows among each cell, Volume variance between different disposal is measured in the form of yield percentage, and yield percentage (%)=spraying yield/does not spray Apply yield.The results are shown in Table 7 for result and corn yield of the transgenic corn events DBN9868 to herbicide tolerant.
Table 6, herbicide are to the grade scale of corn phytotoxicity degree
Phytotoxicity rank Symptom description
1 Growth is normal, without any damage symptoms
2 Slight phytotoxicity, phytotoxicity are less than 10%
3 Medium phytotoxicity can restore later, not influence yield
4 Phytotoxicity is heavier, it is difficult to restore, cause the underproduction
5 Phytotoxicity is serious, cannot restore, and causes the obvious underproduction or total crop failure
Table 7, transgenic corn events DBN9868 are to the result and corn yield result of herbicide tolerant
As a result illustrate, in terms of herbicide (glyphosate and glufosinate-ammonium) aggrieved rate: 1) transgenic corn events DBN9868 exists Aggrieved rate is essentially 0 under glyphosate herbicidal (1680g a.e./ha) processing；Transgenic corn events DBN9868 is in glufosinate-ammonium Aggrieved rate is also essentially 0 under herbicide (800g a.i./ha) processing；Transgenic corn events DBN9868 has good as a result, Herbicide (glyphosate and glufosinate-ammonium) tolerance.
In terms of yield: transgenic corn events DBN9868 do not spray, glyphosate herbicidal (1680g a.e./ha) Handling lower yield with 3 kinds of glufosinate-ammonium herbicide (800g a.i./ha) does not have notable difference；After herbicide spraying, transgenosis is beautiful The yield of rice event DBN9868 does not reduce substantially, and it is good to further demonstrate that transgenic corn events DBN9868 has as a result, Herbicide (glyphosate and glufosinate-ammonium) tolerance.
Sixth embodiment
Such as agricultural product or commodity can be produced by transgenic corn events DBN9868.If in the agricultural product or commodity In detect enough expression quantity, the agricultural product or commodity are expected containing can diagnose transgenic corn events DBN9868 material Expect the nucleotide sequence present in the agricultural product or commodity.The agricultural product or commodity include but is not limited to corn oil, jade Rice coarse powder, maize flour, corn gluten, corn-dodger, cornstarch and will be as food source for any other of animal consumption Food or additionally as the ingredient in swelling agent or make-up composition for cosmetic use etc..Based on probe or primer pair Nucleic acid detection method and/or kit can be developed to detect such as SEQ ID NO:1 or SEQ ID NO:2 in biological sample Shown in transgenic corn events DBN9868 nucleotide sequence, wherein probe sequence or primer sequence are selected from such as SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, sequence shown in SEQ ID NO:4 and SEQ ID NO:5, to diagnose transgenosis jade The presence of rice event DBN9868.
In conclusion transgenic corn events DBN9868 of the present invention has glyphosate herbicidal and glufosinate-ammonium herbicide Preferable tolerance, on yield without influence, and whether detection method can quickly and accurately be identified in biological sample comprising turning base Because of the DNA molecular of corn event DBN9868.
Seed corresponding to transgenic corn events DBN9868 is deposited in China Microbiological bacterium on December 24th, 2014 Kind preservation administration committee common micro-organisms center (abbreviation CGMCC, address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, in Institute of microbiology of the academy of sciences of state, postcode 100101), classification naming: corn (Zea mays), deposit number CGMCC No.10213.Preserved material will be 30 years in depository's preservation.
It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, those skilled in the art should understand that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit and scope of the technical solution of the present invention.

Claims (27)

1. a kind of nucleic acid sequence, which is characterized in that including SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or Its complementary series, the nucleic acid sequence be originated from transgenic corn events DBN9868, the transgenic corn events DBN9868 with The form of seed and to be preserved in China Committee for Culture Collection of Microorganisms with deposit number CGMCC No.10213 commonly micro- Bio-Centers.
2. nucleic acid sequence according to claim 1, which is characterized in that the nucleic acid sequence include SEQ ID NO:3 or its Complementary series, and/or SEQ ID NO:4 or its complementary series.
3. nucleic acid sequence according to claim 2, which is characterized in that the nucleic acid sequence include SEQ ID NO:5 or its Complementary series.
4. a kind of method existing for DNA of test sample transgenic corn event DBN9868 characterized by comprising
Contact sample to be tested in nucleic acid amplification reaction at least two primers；
Carry out nucleic acid amplification reaction；
Detect the presence of amplified production；
The amplified production includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its complementary series；
The amplified production is originated from transgenic corn events DBN9868, and the transgenic corn events DBN9868 is with the shape of seed Formula and China Committee for Culture Collection of Microorganisms's common micro-organisms center is preserved in deposit number CGMCC No.10213.
5. method existing for the DNA of test sample transgenic corn event DBN9868 according to claim 4, feature It is, the amplified production further includes SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.
6. method existing for the DNA of test sample transgenic corn event DBN9868 according to claim 4 or 5, special Sign is that the primer includes the first primer and the second primer, and the first primer is selected from SEQ ID NO:1 or its complementary sequence Column, SEQ ID NO:8 and SEQ ID NO:10；Second primer is selected from SEQ ID NO:2 or its complementary series, SEQ ID NO:9 and SEQ ID NO:11.
7. a kind of method existing for DNA of test sample transgenic corn event DBN9868 characterized by comprising
Contact sample to be tested with probe, the probe includes SEQ ID NO:1 or its complementary series or SEQ ID NO: 2 or its complementary series, the source probe transgenic corn event DBN9868, the transgenic corn events DBN9868 is to plant Son form and China Committee for Culture Collection of Microorganisms's commonly micro- life is preserved in deposit number CGMCC No.10213 Object center；
Hybridize the sample to be tested and the probe under stringent hybridization conditions；
Detect the hybridisation events of the sample to be tested and the probe.
8. method existing for the DNA of test sample transgenic corn event DBN9868 according to claim 7, feature It is, the probe also has SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.
9. special according to method existing for the DNA of the test sample transgenic corn event DBN9868 of claim 7 or 8 Sign is that at least one described probe is marked at least one fluorophor.
10. a kind of method existing for DNA of test sample transgenic corn event DBN9868 characterized by comprising
Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:1 or it is mutual Complementary series or SEQ ID NO:2 or its complementary series, the marker nucleic acid molecules are originated from transgenic corn events DBN9868, the transgenic corn events DBN9868 are preserved in the form of seed and with deposit number CGMCC No.10213 China Committee for Culture Collection of Microorganisms's common micro-organisms center；
Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions；
The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then pass through marker assistant breeding point Analysis is to determine that glyphosate tolerant and/or glufosinate tolerant and marker nucleic acid molecules are chain on science of heredity.
11. method existing for the DNA of test sample transgenic corn event DBN9868 according to claim 10, special Sign is that the marker nucleic acid molecules further include SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or it is mutual Complementary series.
12. a kind of DNA detection kit, which is characterized in that including at least one DNA molecular, the DNA molecular includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series, can be used as transgenic corn events DBN9868 or its offspring have one of DNA primer of specificity or probe；The DNA molecular is originated from transgenic corn events DBN9868, the transgenic corn events DBN9868 are preserved in the form of seed and with deposit number CGMCC No.10213 China Committee for Culture Collection of Microorganisms's common micro-organisms center.
13. DNA detection kit according to claim 12, which is characterized in that further include when the DNA molecular is as probe SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.
14. a kind of method for generating the plant that there is tolerance to glyphosate herbicidal, which is characterized in that including to described 1298-5885 nucleic acid sequences of SEQ ID NO:5 are introduced in the genome of plant, and make the base of the plant Include successively SEQ ID NO:1,1298-5885 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2 because organizing, or makes The genome for obtaining the plant includes SEQ ID NO:5, the plant of selection tolerance glyphosate.
15. 4 method for generating the plant that there is tolerance to glyphosate herbicidal according to claim 1, feature It is, comprising:
By first parental maize plant of transgenic corn events DBN9868 to glyphosate herbicidal with tolerance and lack grass Second parental maize plant sexual hybridization of sweet phosphine tolerance, to generate a large amount of progeny plants；
The progeny plant is handled with glyphosate herbicidal；
The progeny plant of selection tolerance glyphosate；
The transgenic corn events DBN9868 is preserved in China in the form of seed and with deposit number CGMCC No.10213 Microbiological Culture Collection administration committee common micro-organisms center.
16. a kind of method for generating the plant that there is tolerance to glufosinate-ammonium herbicide, which is characterized in that including to described 1298-5885 nucleic acid sequences of SEQ ID NO:5 are introduced in the genome of plant, and make the base of the plant Include successively SEQ ID NO:1,1298-5885 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2 because organizing, or makes The genome for obtaining the plant includes SEQ ID NO:5, the plant of selection tolerance glufosinate-ammonium.
17. 6 method for generating the plant that there is tolerance to glufosinate-ammonium herbicide according to claim 1, feature It is, comprising:
By first parental maize plant of transgenic corn events DBN9868 to glufosinate-ammonium herbicide with tolerance and lack grass Second parental maize plant sexual hybridization of ammonium phosphine tolerance, to generate a large amount of progeny plants；
The progeny plant described in glufosinate-ammonium herbicide treatment；
The progeny plant of selection tolerance glufosinate-ammonium；
The transgenic corn events DBN9868 is preserved in China in the form of seed and with deposit number CGMCC No.10213 Microbiological Culture Collection administration committee common micro-organisms center.
18. a kind of method for generating the plant that there is tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, feature It is, including introducing 1298-5885 nucleic acid sequences of SEQ ID NO:5 into the genome of the plant, and makes The genome of the plant successively includes SEQ ID NO:1,1298-5885 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2, or the genome of the plant is made to include SEQ ID NO:5, selection tolerance glyphosate and glufosinate-ammonium Plant.
19. 8 plant generated to glyphosate herbicidal and glufosinate-ammonium herbicide with tolerance according to claim 1 Method characterized by comprising
There to be the first parent of transgenic corn events DBN9868 of tolerance beautiful glyphosate herbicidal and glufosinate-ammonium herbicide Rice plant and the second parental maize plant sexual hybridization for lacking glyphosate and/or glufosinate tolerant, to generate big quantum For plant；
The progeny plant described in glyphosate herbicidal and glufosinate-ammonium herbicide treatment；
The progeny plant of selection tolerance glyphosate and glufosinate-ammonium；
The transgenic corn events DBN9868 is preserved in China in the form of seed and with deposit number CGMCC No.10213 Microbiological Culture Collection administration committee common micro-organisms center.
20. a kind of method that culture has the corn plant of tolerance to glyphosate herbicidal characterized by comprising
An at least corn seed is planted, includes the nucleic acid sequence of specific region, the spy in the genome of the corn seed The nucleic acid sequence for determining region successively includes SEQ ID NO:1,1298-5885 nucleic acid sequences of SEQ ID NO:5 and SEQ ID The nucleic acid sequence of NO:2 or the specific region includes SEQ ID NO:5；
The corn seed is set to grow up to plant；
The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of the specific region with other The plant of sequence compares the plant with the plant injury weakened.
21. a kind of method that culture has the corn plant of tolerance to glufosinate-ammonium herbicide characterized by comprising
An at least corn seed is planted, includes the nucleic acid sequence of specific region, the spy in the genome of the corn seed The nucleic acid sequence for determining region successively includes SEQ ID NO:1,1298-5885 nucleic acid sequences of SEQ ID NO:5 and SEQ ID The nucleic acid sequence of NO:2 or the specific region includes SEQ ID NO:5；
The corn seed is set to grow up to plant；
The plant described in effective dose glufosinate-ammonium herbicide spray, harvest do not have the nucleic acid of the specific region with other The plant of sequence compares the plant with the plant injury weakened.
22. a kind of method that culture has the corn plant of tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, feature It is, comprising:
An at least corn seed is planted, includes the nucleic acid sequence of specific region, the spy in the genome of the corn seed The nucleic acid sequence for determining region successively includes SEQ ID NO:1,1298-5885 nucleic acid sequences of SEQ ID NO:5 and SEQ ID The nucleic acid sequence of NO:2 or the specific region includes SEQ ID NO:5；
The corn seed is set to grow up to plant；
The plant described in effective dose glyphosate herbicidal and glufosinate-ammonium herbicide spray, harvest do not have described with other The plant of the nucleic acid sequence of specific region compares the plant with the plant injury weakened.
23. a kind of method for protecting the plants from the damage as caused by herbicide, which is characterized in that including effective dose will be contained Glyphosate and/or the herbicide of glufosinate-ammonium are applied to the big Tanaka for planting at least one rotaring gene corn plant, the transgenosis Corn plant in its genome successively comprising SEQ ID NO:1, SEQ ID NO:5 1298-5885 nucleic acid sequence and It include SEQ ID NO:5 in the genome of SEQ ID NO:2 or the rotaring gene corn plant；The transgenic corns are planted Object has the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.
24. a kind of method for controlling weeds in field, which is characterized in that including effective dose glyphosate and/or glufosinate-ammonium will be contained Herbicide be applied to the big Tanaka for planting at least one rotaring gene corn plant, the rotaring gene corn plant is in its genome In successively comprising SEQ ID NO:1, the nucleic acid sequence of SEQ ID NO:5 1298-5885 and SEQ ID NO:2, Huo Zhesuo It states in the genome of rotaring gene corn plant comprising SEQ ID NO:5；The rotaring gene corn plant has to Gyphosate herbicice The tolerance of agent and/or glufosinate-ammonium herbicide.
25. a kind of method for the crop field glyphosate resistance weeds for controlling glyphosate-tolerant plant, which is characterized in that including inciting somebody to action Herbicide containing effective dose glufosinate-ammonium is applied to the big of the rotaring gene corn plant for planting at least one glyphosate tolerant Tanaka, the rotaring gene corn plant of the glyphosate tolerant successively include SEQ ID NO:1, SEQ ID in its genome The rotaring gene corn plant of nucleic acid sequence and SEQ ID NO:2 or the glyphosate tolerant that NO:5 is 1298-5885 Genome in include SEQ ID NO:5；The rotaring gene corn plant of the glyphosate tolerant has simultaneously removes glufosinate-ammonium The tolerance of careless agent.
26. a kind of method for delaying insect-resistant, which is characterized in that including planted in the big Tanaka for planting pest-resistant corn plant to A kind of few rotaring gene corn plant with glyphosate and/or glufosinate tolerant, the glyphosate and/or glufosinate tolerant Rotaring gene corn plant in its genome successively comprising SEQ ID NO:1, SEQ ID NO:5 1298-5885 core In the genome of the rotaring gene corn plant of acid sequence and SEQ ID NO:2 or the glyphosate and/or glufosinate tolerant Include SEQ ID NO:5.
27. a kind of agricultural product or commodity produced by transgenic corn events DBN9868, which is characterized in that the agricultural product or Commodity are corn flour, maize flour, corn oil, cornstarch, corn gluten, corn-dodger, cosmetics or filler；The transgenosis Corn event DBN9868 is preserved in Chinese microorganism strain preservation in the form of seed and with deposit number CGMCC No.10213 Administration committee's common micro-organisms center.
CN201510219912.2A 2015-04-30 2015-04-30 For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 Active CN104878096B (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201510219912.2A CN104878096B (en) 2015-04-30 2015-04-30 For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868
ARP160101207A AR104438A1 (en) 2015-04-30 2016-04-28 CORN PLANT DBN9868 TOLERANT TO HERBICIDES AND SEQUENCE OF NUCLEIC ACID AND METHOD FOR DETECTION
PCT/CN2016/080676 WO2016173539A1 (en) 2015-04-30 2016-04-29 Herbicide-tolerant maize plant dbn9868, and nucleic acid sequence and method for detecting same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510219912.2A CN104878096B (en) 2015-04-30 2015-04-30 For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868

Publications (2)

Publication Number Publication Date
CN104878096A CN104878096A (en) 2015-09-02
CN104878096B true CN104878096B (en) 2019-01-15

Family

ID=53945770

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510219912.2A Active CN104878096B (en) 2015-04-30 2015-04-30 For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868

Country Status (3)

Country Link
CN (1) CN104878096B (en)
AR (1) AR104438A1 (en)
WO (1) WO2016173539A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113201531B (en) * 2021-04-27 2023-06-27 隆平生物技术(海南)有限公司 Transgenic corn event LW2-1 and detection method thereof

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104878096B (en) * 2015-04-30 2019-01-15 北京大北农科技集团股份有限公司 For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868
CN109868273B (en) * 2019-04-09 2023-02-03 北京大北农生物技术有限公司 Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof
CN111247255B (en) * 2019-08-09 2023-06-27 北京大北农生物技术有限公司 Nucleic acid sequence for detecting soybean plant DBN8007 and detection method thereof
CN112852991B (en) * 2021-01-27 2023-08-04 隆平生物技术(海南)有限公司 Transgenic corn event LP007-7 and detection method thereof
CN112831584B (en) * 2021-01-27 2023-06-06 隆平生物技术(海南)有限公司 Transgenic corn event LP007-2 and detection method thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014004458A2 (en) * 2012-06-25 2014-01-03 Dow Agrosciences Llc Insect resistant and herbicide tolerant soybean event pdab9582.816.15.1

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998020144A2 (en) * 1996-11-07 1998-05-14 Zeneca Limited Herbicide resistant plants
BRPI0100752B1 (en) * 2000-06-22 2015-10-13 Monsanto Co DNA Molecules and Pairs of Molecules, Processes for Detecting DNA Molecules and for Creating a Glyphosate Tolerant Trait in Corn Plants, as well as DNA Detection Kit
KR20090033840A (en) * 2006-05-26 2009-04-06 몬산토 테크놀로지 엘엘씨 Corn plant and seed corresponding to transgenic event mon89034 and methods for detection and use thereof
CN101641443A (en) * 2006-10-30 2010-02-03 先锋高级育种国际公司 Maize event DP-098140-6 and compositions and methods for the identification and/or detection thereof
EP2737067A1 (en) * 2011-07-28 2014-06-04 Genective Glyphosate tolerant corn event vco-ø1981-5 and kit and method for detecting the same
CN104878096B (en) * 2015-04-30 2019-01-15 北京大北农科技集团股份有限公司 For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014004458A2 (en) * 2012-06-25 2014-01-03 Dow Agrosciences Llc Insect resistant and herbicide tolerant soybean event pdab9582.816.15.1

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Cry1Ab/1Ac基因在转基因玉米中的表达研究;王艳辉等;《分子植物育种》;20101231;第8卷(第5期);摘要、第880页左栏第3段 *
转基因玉米育种研究进展;刘小丹等;《玉米科学》;20121231;第20卷(第6期);1-8 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113201531B (en) * 2021-04-27 2023-06-27 隆平生物技术(海南)有限公司 Transgenic corn event LW2-1 and detection method thereof

Also Published As

Publication number Publication date
WO2016173539A1 (en) 2016-11-03
AR104438A1 (en) 2017-07-19
CN104878096A (en) 2015-09-02

Similar Documents

Publication Publication Date Title
CN104830845B (en) Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878
CN106086010B (en) For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9008
CN104427861B (en) Corn event mon 87411
CN104878094B (en) For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888
CN104830847B (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9936
CN104878091B (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9978
CN104830846B (en) Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9898
CN106086011B (en) For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9004
CN104878096B (en) For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868
CN113201531B (en) Transgenic corn event LW2-1 and detection method thereof
CN112852801B (en) Transgenic corn event LP007-1 and detection method thereof
CN109868273B (en) Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof
CN104878092B (en) Nucleic acid sequence and its detection method for detecting corn plant DBN9953
CN104878095B (en) Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9858
CN109971880B (en) Nucleic acid sequence for detecting corn plant DBN9508 and detection method thereof
CN111406117A (en) Nucleic acid sequence for detecting soybean plant DBN8002 and detection method thereof
CN104830983B (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9968
CN106119245B (en) For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001
CN110881367A (en) Corn event Ttrans-4 and methods of use thereof
CN104846084B (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9927
CN104878097B (en) Nucleic acid sequence and its detection method for detecting corn plant DBN9981
CN113278721B (en) Transgenic corn event LW2-2 and detection method thereof
CN104878090B (en) For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9877
CN110129471A (en) It is a kind of for detecting the nucleic acid sequence and its detection method of rice plants ZUPM01

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: 100080 Zhongguancun street, Beijing, No. 14, layer 27,

Applicant after: Beijing Dabeinong Technology Group Co., Ltd.

Applicant after: BEIJING DBN BIOTECH CO., LTD.

Address before: 100080 Zhongguancun street, Beijing, No. 14, layer 27,

Applicant before: Beijing Dabeinong Technology Group Co., Ltd.

Applicant before: Biotechnology Center of Beijing Dabeinong Technology Group Co., Ltd.

COR Change of bibliographic data
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20200810

Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49

Patentee after: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd.

Address before: 100080, 14, Zhongguancun Avenue, 27, Beijing, Haidian District

Co-patentee before: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd.

Patentee before: BEIJING DABEINONG TECHNOLOGY GROUP Co.,Ltd.

TR01 Transfer of patent right