CN109868273B

CN109868273B - Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof

Info

Publication number: CN109868273B
Application number: CN201910280088.XA
Authority: CN
Inventors: 刘海利; 康越景; 王诚; 王利君; 李风; 张良君; 丁德荣; 鲍晓明
Original assignee: Beijing Dabeinong Biotechnology Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2019-04-09
Filing date: 2019-04-09
Publication date: 2023-02-03
Anticipated expiration: 2039-04-09
Also published as: ZA202104864B; AR118492A1; BR112021000302A2; WO2020207125A1; MX2021010933A; CN109868273A

Abstract

The invention relates to a nucleic acid sequence for detecting corn plant DBN9501 and a detection method thereof, wherein the nucleic acid sequence comprises SEQ ID NO.1 or a complementary sequence thereof, or SEQ ID NO. 2 or a complementary sequence thereof. The corn plant DBN9501 has good resistance to lepidoptera insects, good tolerance to glufosinate herbicides and no influence on yield, and the detection method can accurately and quickly identify whether a biological sample contains the DNA molecule of the transgenic corn event DBN9501.

Description

Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof

Technical Field

The invention relates to the field of plant molecular biology, in particular to the field of transgenic crop breeding in agricultural biotechnology research. In particular, the invention relates to insect-resistant and glufosinate herbicide-tolerant transgenic corn event DBN9501 and nucleic acid sequences and methods for detecting whether a particular transgenic corn event DBN9501 is contained in a biological sample.

Background

Corn (Zea mays l.) is a major food crop in many parts of the world. Biotechnology has been applied to maize to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in corn production, particularly resistance to lepidopteran insects such as corn borer, cotton bollworm, black cutworm, and the like. The lepidopteran resistance of corn can be obtained by expressing a lepidopteran resistance gene in a corn plant by a transgenic method. Another important agronomic trait is herbicide tolerance, such as the successful maize transformation events NK603, GA21, etc., which have been widely grown in major corn growing areas such as the united states. It is worth mentioning that glufosinate herbicides, which are biocidal contact herbicides that have a different mechanism of action than glyphosate herbicides, can be used as an effective means of managing glyphosate resistant weeds. Tolerance of maize to glufosinate herbicides can be achieved by transgenically expressing a glufosinate herbicide-tolerant gene (e.g., pat) in maize plants.

It is known that expression of foreign genes in plants is influenced by their chromosomal location, possibly due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site. For this reason, it is often necessary to screen a large number of events in order to be able to identify a commercializable event (i.e., an event in which the introduced gene of interest is optimally expressed). For example, it has been observed in plants and other organisms that the amount of expression of an introduced gene may vary greatly between events; differences may also exist in the spatial or temporal pattern of expression, such as differences in the relative expression of the transgene between different plant tissues, in that the actual expression pattern may not correspond to the expression pattern expected from the transcriptional regulatory elements in the introduced gene construct. Thus, it is often desirable to generate hundreds or thousands of different events and screen those events for a single event with the amount and pattern of transgene expression expected for commercial purposes. Events with expected transgene expression levels and patterns can be used to introgress transgenes into other genetic backgrounds by sexual outcrossing using conventional breeding methods. Progeny produced by this crossing pattern retain the transgene expression characteristics of the original transformant. The use of this strategy ensures reliable gene expression in many varieties that are well adapted to local growth conditions.

It would be beneficial to be able to detect the presence of particular events to determine whether progeny of a sexual cross contain a gene of interest. Furthermore, methods of detecting specific events will also help to comply with relevant regulations, such as that foods derived from recombinant crops need to be officially approved and labeled before being placed on the market. It is possible to detect the presence of a transgene by any well-known polynucleotide detection method, such as Polymerase Chain Reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods usually focus on commonly used genetic elements, such as promoters, terminators, marker genes, and the like. Thus, unless the sequences of chromosomal DNA adjacent to the inserted transgene DNA ("flanking DNA") are known, this method cannot be used to distinguish between different events, particularly those produced with the same DNA construct. Therefore, it is now common to identify specific events of a transgene by PCR using a pair of primers spanning the junction of the inserted transgene and flanking DNA, specifically a first primer contained within the inserted sequence and a second primer contained within the inserted sequence.

Disclosure of Invention

The invention aims to provide a nucleic acid sequence for detecting a corn plant DBN9501 and a detection method thereof, wherein the transgenic corn event DBN9501 has better resistance to insects and better tolerance to glufosinate herbicide, and the detection method can accurately and quickly identify whether a biological sample contains a DNA molecule of the transgenic corn event DBN9501.

To achieve the above object, the present invention provides a nucleic acid sequence having at least 11 consecutive nucleotides at positions 1 to 384 of SEQ ID NO. 3 or its complement and at least 11 consecutive nucleotides at positions 385 to 768 of SEQ ID NO. 3 or its complement; and/or at least 11 consecutive nucleotides of positions 1 to 564 of SEQ ID NO. 4 or of its complement and at least 11 consecutive nucleotides of positions 565 to 1339 of SEQ ID NO. 4 or of its complement.

Preferably, the nucleic acid sequence has 22-25 contiguous nucleotides of positions 1-384 of SEQ ID NO. 3 or the complement thereof and 22-25 contiguous nucleotides of positions 385-768 of SEQ ID NO. 3 or the complement thereof; and/or between 22 and 25 contiguous nucleotides of positions 1 to 564 of SEQ ID NO. 4 or of its complement and between 22 and 25 contiguous nucleotides of positions 565 to 1339 of SEQ ID NO. 4 or of its complement.

Preferably, the nucleic acid sequence comprises SEQ ID NO 1 or the complement thereof, and/or SEQ ID NO 2 or the complement thereof.

The SEQ ID No.1 or its complement is a 22 nucleotide sequence located near the insertion junction at the 5 'end of the insertion in transgenic maize event DBN9501, the SEQ ID No.1 or its complement spans the flanking genomic DNA sequence of the maize insertion site and the DNA sequence at the 5' end of the insertion, and the presence of the transgenic maize event DBN9501 can be identified by the inclusion of the SEQ ID No.1 or its complement. The SEQ ID No. 2 or its complement is a 22 nucleotide long sequence located near the insertion junction at the 3 'end of the insertion sequence in transgenic corn event DBN9501, the DNA sequence of SEQ ID No. 2 or its complement spanning the 3' end of the insertion sequence and flanking genomic DNA sequences of the corn insertion site, the inclusion of the SEQ ID No. 2 or its complement can identify the presence of transgenic corn event DBN9501.

Preferably, the nucleic acid sequence comprises SEQ ID NO 3 or the complement thereof, and/or SEQ ID NO 4 or the complement thereof.

In the present invention, the nucleic acid sequence may be at least 11 or more contiguous polynucleotides of any portion of the T-DNA insert in the SEQ ID NO. 3 or its complement (first nucleic acid sequence) or at least 11 or more contiguous polynucleotides of any portion of the 5' flanking maize genomic DNA region in the SEQ ID NO. 3 or its complement (second nucleic acid sequence). The nucleic acid sequence may further be homologous or complementary to a portion of said SEQ ID NO. 3 comprising the entire said SEQ ID NO. 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences can be used as DNA primer pairs in DNA amplification methods that produce amplification products. The presence of transgenic maize event DBN9501 or progeny thereof can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO 1. The SEQ ID NO 3 or its complement is a 768 nucleotide long sequence located near the insertion junction at the 5 'end of the T-DNA insertion in transgenic corn event DBN9501, the SEQ ID NO 3 or its complement consisting of a 384 nucleotide maize genome 5' flanking sequence (nucleotides 1-384 of SEQ ID NO: 3), a 168 nucleotide DBN10707 construct DNA sequence (nucleotides 385-552 of SEQ ID NO: 3) and a 216 nucleotide DNA sequence of a tNOs (nopaline synthase) transcription terminator (nucleotides 553-768 of SEQ ID NO: 3), comprising the SEQ ID NO 3 or its complement, identified as the presence of the transgenic corn event DBN9501.

The nucleic acid sequence may be at least 11 or more contiguous polynucleotides of any portion of the T-DNA insert in the SEQ ID NO:4 or its complement (third nucleic acid sequence) or at least 11 or more contiguous polynucleotides of any portion of the 3' flanking maize genomic DNA region in the SEQ ID NO:4 or its complement (fourth nucleic acid sequence). The nucleic acid sequence may further be homologous or complementary to a portion of said SEQ ID NO. 4 comprising the entire said SEQ ID NO. 2. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences can be used as a pair of DNA primers in a DNA amplification method that produces an amplification product. The presence of transgenic maize event DBN9501 or progeny thereof can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO 2. The SEQ ID NO. 4 or its complement is a 1339 nucleotide sequence located near the T-DNA insertion junction at the 3 'end of the inserted sequence in transgenic maize event DBN9501, the SEQ ID NO. 4 or its complement consists of a 271 nucleotide pr35S transcription start sequence (nucleotides 1-271 of SEQ ID NO. 4), a 293 nucleotide DBN10707 construct DNA sequence (nucleotides 272-564 of SEQ ID NO. 4), and a 775 nucleotide maize genome 3' flanking sequence (nucleotides 565-1339 of SEQ ID NO. 4), comprising the SEQ ID NO. 4 or its complement is identifiable as the presence of transgenic maize event DBN9501.

Further, the nucleic acid sequence comprises SEQ ID NO 5 or a complement thereof.

5 or the complement thereof is a 8559 nucleotide long sequence characterizing transgenic maize event DBN9501, comprising in particular genomic and genetic elements as shown in table 1. Inclusion of the SEQ ID No. 5 or its complement identifies the presence of transgenic maize event DBN9501.

TABLE 1 genomic and genetic elements encompassed by SEQ ID NO 5

It is well known to those skilled in the art that the first, second, third and fourth nucleic acid sequences need not consist of only DNA, but may also include RNA, mixtures of DNA and RNA, or combinations of DNA, RNA or other nucleotides or analogs thereof that are not used as templates for one or more polymerases. In addition, the probe or primer of the invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides in length, which may be selected from the nucleotides set forth in SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQ ID NO 5. When selected from the nucleotides set forth in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, the probes and primers may be contiguous nucleotides of at least about 21 to about 50 or more in length.

The nucleic acid sequence or a complement thereof can be used in a DNA amplification method to produce an amplicon that is used to detect the presence of transgenic corn event DBN9501 or progeny thereof in a biological sample; the nucleic acid sequence, or a complement thereof, can be used in a nucleotide detection method to detect the presence of a transgenic maize event DBN9501 or progeny thereof in a biological sample.

To achieve the above objects, the present invention also provides a method for detecting the presence of DNA of transgenic maize event DBN9501 in a sample, comprising:

contacting a sample to be tested with at least two primers for amplifying a target amplification product in a nucleic acid amplification reaction;

performing a nucleic acid amplification reaction; and

detecting the presence of the target amplification product;

the target amplification product comprises the nucleic acid sequence.

Preferably, the target amplification product comprises SEQ ID NO.1 or a complement thereof, SEQ ID NO. 2 or a complement thereof, SEQ ID NO. 6 or a complement thereof, and/or SEQ ID NO. 7 or a complement thereof.

Specifically, the primers comprise a first primer and a second primer, wherein the first primer is selected from SEQ ID NO.1, SEQ ID NO. 8 and SEQ ID NO. 10; the second primer is selected from the group consisting of SEQ ID NO. 2, SEQ ID NO. 9 and SEQ ID NO. 11.

To achieve the above objects, the present invention also provides a method for detecting the presence of DNA of transgenic corn event DBN9501 in a sample, comprising:

contacting a sample to be tested with a probe comprising said nucleic acid sequence;

hybridizing the sample to be detected and the probe under stringent hybridization conditions; and

and detecting the hybridization condition of the sample to be detected and the probe.

The stringent conditions can be hybridization at 65 ℃ in a 6 XSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane 1 times each with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Preferably, the probe comprises SEQ ID NO 1 or its complement, SEQ ID NO 2 or its complement, SEQ ID NO 6 or its complement, and/or SEQ ID NO 7 or its complement.

Optionally, at least one of the probes is labeled with at least one fluorophore.

contacting the sample to be tested with a marker nucleic acid molecule comprising said nucleic acid sequence;

hybridizing the sample to be tested and the marker nucleic acid molecule under stringent hybridization conditions;

and detecting the hybridization condition of the sample to be detected and the marker nucleic acid molecule, and further determining that the insect resistance and/or the herbicide tolerance are genetically linked with the marker nucleic acid molecule through marker-assisted breeding analysis.

Preferably, the marker nucleic acid molecule comprises at least one selected from the group consisting of: 1 or its complement, 2 or its complement, and/or 6-11 or its complement.

To achieve the above object, the present invention also provides a DNA detection kit comprising at least one DNA molecule comprising said nucleic acid sequence, which can be one of the DNA primers or probe specific for the transgenic corn event DBN9501 or its progeny.

Preferably, the DNA molecule comprises SEQ ID NO 1 or its complement, SEQ ID NO 2 or its complement, SEQ ID NO 6 or its complement, and/or SEQ ID NO 7 or its complement.

To achieve the above object, the present invention also provides a plant cell comprising a nucleic acid sequence encoding an insect-resistant Vip3Aa protein, a nucleic acid sequence encoding a glufosinate herbicide-tolerant PAT protein, and a nucleic acid sequence of a specific region including the sequences shown in SEQ ID NO.1, SEQ ID NO. 2, SEQ ID NO. 6 and/or SEQ ID NO. 7.

Preferably, the plant cell comprises a nucleic acid sequence encoding an insect-resistant Vip3Aa protein, a nucleic acid sequence encoding a glufosinate herbicide-tolerant PAT protein and a nucleic acid sequence of a specific region comprising the sequence shown in SEQ ID No. 3 and/or SEQ ID No. 4.

Preferably, the plant cell comprises the nucleic acid sequence of SEQ ID NO.1, 553 th to 7491 th positions of SEQ ID NO. 5 and SEQ ID NO. 2 in sequence, or comprises the sequence shown in SEQ ID NO. 5.

To achieve the above objects, the present invention also provides a method for protecting a corn plant from insect infestation, comprising providing at least one transgenic corn plant cell comprising in its genome the sequence set forth in SEQ ID No.1 and/or SEQ ID No. 2 in the diet of a target insect, the target insect feeding said transgenic corn plant cell being inhibited from further feeding said transgenic corn plant.

Preferably, the transgenic maize plant cell comprises in its genome the sequence shown in SEQ ID NO 3 and/or SEQ ID NO 4.

Preferably, the transgenic maize plant cell comprises in its genome the nucleic acid sequence of SEQ ID NO 1, the nucleic acid sequence of SEQ ID NO 5 at positions 553-7491 and SEQ ID NO 2 in that order, or alternatively SEQ ID NO 5.

To achieve the above objects, the present invention also provides a method for protecting corn plants from injury caused by herbicides or controlling weeds in a field in which the corn plants are planted, comprising applying a herbicide containing an effective amount of glufosinate herbicide to a field in which at least one transgenic corn plant comprising in its genome the sequence shown in SEQ ID No.1 and/or SEQ ID No. 2 is planted, the transgenic corn plant being tolerant to glufosinate herbicide.

Preferably, the transgenic maize plant comprises in its genome the sequence shown in SEQ ID NO 3 and/or SEQ ID NO 4.

Preferably, the transgenic maize plant comprises in its genome the nucleic acid sequence of SEQ ID NO 1, the nucleic acid sequence of SEQ ID NO 5 from position 553 to 7491 and SEQ ID NO 2 in that order, or the sequence shown in SEQ ID NO 5.

To achieve the above objects, the present invention also provides a method of growing an insect resistant and/or tolerant glufosinate herbicide corn plant comprising:

planting at least one corn seed comprising in its genome a nucleic acid sequence encoding an insect-resistant Vip3Aa protein and/or a nucleic acid sequence encoding a glufosinate herbicide-tolerant PAT protein, and a nucleic acid sequence of a specific region, or comprising in its genome the nucleic acid sequence set forth in SEQ ID No. 5;

growing the corn seed into a corn plant;

(ii) attacking said maize plant with a target insect and/or spraying said maize plant with an effective dose of a glufosinate herbicide, harvesting plants having reduced plant damage compared to other plants not having the nucleic acid sequence of the specific region;

the nucleic acid sequence of the specific region is a sequence shown as SEQ ID NO.1 and/or SEQ ID NO. 2; preferably, the nucleic acid sequence of the specific region is a sequence shown in SEQ ID NO. 3 and/or SEQ ID NO. 4.

To achieve the above objects, the present invention also provides a method for producing a maize plant resistant to insects and/or tolerant to glufosinate herbicide, comprising introducing into a second maize plant a nucleic acid sequence encoding an insect-resistant Vip3Aa protein and/or a nucleic acid encoding a glufosinate-tolerant PAT protein, and specific regions, comprised in the genome of a first maize plant, or a nucleic acid sequence as set forth in SEQ ID No. 5 comprised in the genome of said first maize plant, thereby producing a plurality of progeny plants; selecting the progeny plant having the nucleic acid sequence of the particular region, and which progeny plant is resistant to an insect and/or tolerant to a glufosinate herbicide; the nucleic acid sequence of the specific region is a sequence shown as SEQ ID NO.1 and/or SEQ ID NO. 2; preferably, the nucleic acid sequence of the specific region is a sequence shown in SEQ ID NO. 3 and/or SEQ ID NO. 4.

Preferably, the method comprises sexually crossing transgenic corn event DBN9501 with corn plants lacking insect resistance and/or glufosinate tolerance, thereby producing a plurality of progeny plants, selecting the progeny plants having the nucleic acid sequence of the specified region; the nucleic acid sequence of the specific region comprises a sequence shown as SEQ ID NO.1 and/or SEQ ID NO. 2; preferably, the nucleic acid sequence of the specific region comprises the sequence shown in SEQ ID NO. 3 and/or SEQ ID NO. 4.

To achieve the above objects, the present invention also provides an agricultural or commercial product produced from transgenic corn event DBN9501, the agricultural or commercial product being corn meal, corn flour, corn oil, corn silk, corn starch, corn gluten, corn cake, cosmetics or bulking agent.

In the nucleic acid sequences and methods for detecting maize plants of the present invention, the following definitions and methods may better define the invention and guide those of ordinary skill in the art in the practice of the invention, unless otherwise indicated, the terms are understood according to their conventional usage by those of ordinary skill in the art.

The "corn" refers to maize (Zea mays) and includes all plant species that can be mated with corn, including wild corn species.

The term "comprising", "including" or "containing" means "including but not limited to".

The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps (plant tables), and intact plant cells in plants or plant parts such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stalks, roots, root tips, anthers, and the like. It is to be understood that parts of transgenic plants within the scope of the present invention, which are derived from transgenic plants or progeny thereof which have been previously transformed with a DNA molecule of the invention and thus consist at least in part of transgenic cells, include, but are not limited to, plant cells, protoplasts, tissue, callus, embryos and flowers, stems, fruits, leaves and roots.

The term "gene" refers to a nucleic acid fragment that expresses a particular protein, including regulatory sequences preceding the coding sequence (5 'non-coding sequences) and regulatory sequences following the coding sequence (3' non-coding sequences). "native gene" refers to a gene that is naturally found to have its own regulatory sequences. "chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences not found in nature. "endogenous gene" refers to a native gene that is located in its natural location in the genome of an organism. "foreign gene" is a foreign gene that exists in the genome of an organism and does not exist originally, and also refers to a gene that is introduced into a recipient cell through a transgenic step. The foreign gene may comprise a native gene or a chimeric gene inserted into a non-native organism. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The site in the plant genome at which the recombinant DNA has been inserted may be referred to as an "insertion site" or "target site".

"flanking DNA" may comprise the genome as it occurs naturally in an organism such as a plant or foreign (heterologous) DNA introduced by the transformation process, such as a fragment associated with the transformation event. Thus, flanking DNA may include a combination of native and foreign DNA. In the present invention, "flanking DNA" also known as "flanking region" or "flanking sequence" or "flanking genomic DNA" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or more in length that is directly upstream or downstream of and adjacent to the originally exogenously inserted DNA molecule. When the flanking region is located downstream, it may also be referred to as a "3' flank" or a "right border flank", etc. When the flanking region is upstream, it may also be referred to as a "5' flank" or a "left boundary flank", etc.

Transformation procedures that result in random integration of the foreign DNA will result in transformants that contain different flanking regions that are specific for each transformant. When the recombinant DNA is introduced into a plant by conventional crossing, its flanking regions are not usually altered. Transformants will also contain unique junctions between the heterologous insert DNA and segments of genomic DNA or between two segments of heterologous DNA. "ligation" is the point at which two specific DNA fragments are joined. For example, the junction is present where the insert DNA joins the flanking DNA. A junction point is also present in a transformed organism where two DNA fragments are joined together in a manner that is modified in the way found in the native organism. "junction region" or "junction sequence" refers to the DNA comprising the junction.

The present invention provides transgenic corn event, designated DBN9501, also designated corn plant DBN9501, which includes plants and seeds of transgenic corn event DBN9501 and plant cells thereof or regenerable parts thereof, and progeny of said transgenic corn event DBN9501, including but not limited to cells, pollen, ovule, flowers, buds, roots, stems, silks, inflorescences, ears, leaves, and products from corn plant DBN9501, such as corn meal, corn flour, corn oil, corn steep liquor, corn silk, corn starch, and biomass left in the corn crop field.

The transgenic corn event DBN9501 of the invention comprises a DNA construct which, when expressed in a plant cell, the transgenic corn event DBN9501 acquires resistance to insects and tolerance to glufosinate herbicides. The DNA construct comprises two expression cassettes in tandem, the first expression cassette comprising a suitable promoter for expression in plants operably linked to a nucleic acid sequence of a Vip3Aa19 protein, the nucleic acid sequence of the Vip3Aa19 protein being primarily resistant to lepidopteran insects, and a suitable polyadenylation signal sequence. The second expression cassette comprises a suitable promoter for expression in plants operably linked to a gene encoding phosphinothricin N-acetyltransferase (PAT), the nucleic acid sequence of the PAT protein being tolerant to glufosinate herbicides, and a suitable polyadenylation signal sequence. Further, the promoter may be a suitable promoter isolated from plants, including constitutive, inducible, and/or tissue-specific promoters, including, but not limited to, cauliflower mosaic virus (CaMV) 35S promoter, figwort Mosaic Virus (FMV) 35S promoter, ubiquitin protein (Ubiquitin) promoter, actin (action) promoter, agrobacterium tumefaciens (Agrobacterium tumefaciens) nopaline synthase (NOS) promoter, octopine synthase (OCS) promoter, cestrum (Cestrum) yellow leaf curly virus promoter, potato tuber storage protein (Patatin) promoter, ribulose-1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) promoter, glutathione thiotransferase (GST) promoter, E9 promoter, GOS promoter, alcA/alcR promoter, agrobacterium rhizogenes rod promoter, and Arabidopsis thaliana (Arabidopsis) promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, cauliflower mosaic virus (CaMV) 35S terminator, polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, and polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

In addition, the expression cassette may also include other genetic elements including, but not limited to, enhancers and signal/transit peptides. The enhancer may enhance the expression level of a gene, including, but not limited to, tobacco Etch Virus (TEV) translational activator, caMV35S enhancer, and FMV35S enhancer. The signal peptide/transit peptide may direct the translocation of the Vip3Aa19 protein and/or the PAT protein to a particular extracellular or intracellular organelle or compartment, e.g., targeting the chloroplast using a sequence encoding a chloroplast transit peptide, or targeting the endoplasmic reticulum using a 'KDEL' retention sequence.

The Vip3Aa19 gene can be obtained by separating from Bacillus thuringiensis (Bt for short), and the nucleotide sequence of the Vip3Aa19 gene can be changed by optimizing codons or in other modes, so that the aim of increasing the stability and the availability of transcripts in transformed cells is fulfilled.

The Lepidoptera (Lepidoptera) comprises two types of insects including moths and butterflies, and is the most common order of agricultural and forestry pests, such as black cutworms, cotton bollworms, prodenia litura, athetis lepigone, dichocrocis punctifera and the like.

The phosphinothricin N-acetyltransferase (PAT) gene may be an enzyme isolated from a Streptomyces viridochromogenes strain that catalyzes the conversion of L-phosphinothricin to its inactive form by acetylation to confer tolerance to glufosinate herbicides to plants. Phosphonothricin (PTC, 2-amino-4-methylphosphonobutyric acid) is an inhibitor of glutamine synthetase. PTC is the structural unit of the antibiotic 2-amino-4-methylphosphono-alaninyl-alanine, which tripeptide (PTT) has activity against gram-positive and gram-negative bacteria and against the fungus Botrytis cinerea. The phosphinothricin N-acetyltransferase (PAT) gene may also be used as a selectable marker gene.

The term "glufosinate", also known as glufosinate, refers to ammonium 2-amino-4- [ hydroxy (methyl) phosphono ] butanoate, and treatment with "glufosinate herbicide" refers to treatment with any of the herbicide formulations containing glufosinate. The choice of the rate of use of a certain glufosinate formulation to achieve an effective biological dosage does not exceed the skill of the ordinary agronomic artisan. Treatment of a field containing plant material derived from transgenic corn event DBN9501 with any one of the herbicide formulations containing glufosinate will control weed growth in the field and will not affect the growth or yield of plant material derived from transgenic corn event DBN9501.

The DNA construct is introduced into a plant using transformation methods including, but not limited to, agrobacterium-mediated transformation, particle gun transformation, and pollen tube channel transformation.

The Agrobacterium-mediated transformation method is a commonly used method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border consensus sequences of the vector, i.e.the T-DNA region. Said vector is transformed into an agrobacterium cell, which is subsequently used to infect plant tissue, said T-DNA region of the vector comprising the foreign DNA being inserted into the plant genome.

The biolistic transformation method is the bombardment of plant cells with vectors containing exogenous DNA (particle-mediated biolistic transformation).

The pollen tube channel transformation method is characterized in that a natural pollen tube channel (also known as a pollen tube guide tissue) formed after plant pollination is utilized, and exogenous DNA is carried into an embryo sac through a nucellar channel.

After transformation, transgenic plants must be regenerated from the transformed plant tissue and progeny with the exogenous DNA selected using appropriate markers.

A DNA construct is a combination of DNA molecules linked together, which combination provides one or more expression cassettes. The DNA construct is preferably a plasmid capable of autonomous replication in bacterial cells and containing various restriction sites for the introduction of DNA molecules providing functional genetic elements, i.e. promoters, introns, leader sequences, coding sequences, 3' terminator regions and other sequences. The expression cassette contained in the DNA construct, which includes the genetic elements necessary to provide for transcription of messenger RNA, can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of the invention are designed to be most preferably expressed in plant cells.

A transgenic "event" is obtained by transforming a plant cell with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, inserting into the plant genome by transgenic means to produce a population of plants, regenerating said population of plants, and selecting for a particular plant characterized by the insertion of a particular genomic locus. The term "event" refers to the original transformant containing the heterologous DNA and progeny of the transformant. The term "event" also refers to progeny resulting from sexual crosses between the original transformant and individuals of other varieties containing heterologous DNA, where the inserted DNA and flanking genomic DNA from the parent of the original transformant are present at the same chromosomal location in the progeny of the cross, even after repeated backcrosses to the backcrossed parent. The term "event" also refers to a DNA sequence from an original transformant that comprises an inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which DNA sequence is expected to be transferred to progeny that result from sexual crossing of a parental line containing the inserted DNA (e.g., the original transformant and its progeny produced by selfing) with a parental line that does not contain the inserted DNA, and which progeny has received the inserted DNA comprising the gene of interest.

"recombinant" in the context of the present invention refers to a form of DNA and/or protein and/or organism that is not normally found in nature and is therefore produced by human intervention. Such manual intervention may result in recombinant DNA molecules and/or recombinant plants. Such "recombinant DNA molecules" are obtained by artificially combining two sequence segments that are otherwise isolated, for example, by chemical synthesis or by genetic engineering techniques to manipulate the isolated nucleic acid segments. Techniques for performing nucleic acid manipulations are well known.

The term "transgene" includes any cell, cell line, callus, tissue, plant part or plant, the genotype of which is altered by the presence of heterologous nucleic acid, including transgenic individuals that are initially so altered, as well as progeny individuals generated from the initial transgenic individuals by sexual crosses or asexual propagation. In the present invention, the term "transgene" does not include (chromosomal or extra-chromosomal) alteration of the genome by conventional plant breeding methods or naturally occurring events such as random allofertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

By "heterologous" in the context of the present invention is meant that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule may be derived from a first species and inserted into the genome of a second species. Such molecules are therefore heterologous to the host and are artificially introduced into the genome of the host cell.

Culturing a transgenic corn event DBN9501 resistant to lepidopteran insects and tolerant to a glufosinate herbicide by: first sexually crossing a first parent corn plant consisting of a corn plant bred from transgenic corn event DBN9501 and its progeny obtained by transformation with an expression cassette of the invention that is resistant to lepidopteran insects and tolerant to glufosinate herbicides with a second parent corn plant lacking resistance to lepidopteran insects and/or tolerant to glufosinate herbicides, thereby producing a multiplicity of first generation progeny plants; progeny plants that are resistant to infestation by lepidopteran insects and/or tolerant to a glufosinate herbicide can then be selected to develop maize plants that are resistant to lepidopteran insects and tolerant to the glufosinate herbicide. These steps can further include backcrossing the lepidopteran insect-resistant and/or glufosinate-tolerant progeny plant with the second or third parent corn plant, and then selecting the progeny by infestation with the lepidopteran insect, application of a glufosinate herbicide, or by identification of a trait-related molecular marker (e.g., a DNA molecule comprising the junction site identified at the 5 'end and 3' end of the insertion sequence in transgenic corn event DBN 9501) to produce a corn plant that is resistant to lepidopteran insects and tolerant to the glufosinate herbicide.

It is also understood that two different transgenic plants may also be crossed to produce progeny containing two separate, separately added exogenous genes. Selfing of the appropriate progeny can yield progeny plants that are homozygous for both added exogenous genes. Backcrossing of parental plants and outcrossing with non-transgenic plants as described above is also contemplated, as is asexual propagation.

The term "probe" is an isolated nucleic acid molecule to which is bound a conventional detectable label or reporter molecule, e.g., a radioisotope, ligand, chemiluminescent agent or enzyme. Such a probe is complementary to a strand of the target nucleic acid, and in the present invention, the probe is complementary to a DNA strand from the genome of transgenic corn event DBN9501, whether the genomic DNA is from transgenic corn event DBN9501 or a seed or plant or seed or extract derived from transgenic corn event DBN9501. Probes of the invention include not only deoxyribonucleic or ribonucleic acids, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

The term "primer" is an isolated nucleic acid molecule that binds to a complementary target DNA strand by nucleic acid hybridization, annealing, forming a hybrid between the primer and the target DNA strand, and then extending along the target DNA strand under the action of a polymerase (e.g., a DNA polymerase). The primer pairs of the present invention are directed to their use in the amplification of a target nucleic acid sequence, for example, by Polymerase Chain Reaction (PCR) or other conventional nucleic acid amplification methods.

The length of the probes and primers is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers hybridize specifically to the target sequence under highly stringent hybridization conditions. Although probes that are different from and maintain the ability to hybridize to the target DNA sequence can be designed by conventional methods, it is preferred that the probes and primers of the present invention have complete DNA sequence identity to the contiguous nucleic acid of the target sequence.

Primers and probes based on the flanking genomic DNA and insertion sequences of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from transgenic corn event DBN9501 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises a transgene insert sequence and maize genomic flanking sequences, and fragments of the DNA molecule can be used as primers or probes.

The nucleic acid probes and primers of the invention hybridize to a target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic corn event DBN9501 in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules can be said to be capable of specifically hybridizing to each other if they are capable of forming an antiparallel, double-stranded nucleic acid structure. Two nucleic acid molecules exhibit complete complementarity, one of the nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. As used herein, a nucleic acid molecule is said to exhibit "perfect complementarity" when each nucleotide of the nucleic acid molecule is complementary to a corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under conventional "highly stringent" conditions. Deviations from complete complementarity may be tolerated as long as they do not completely prevent the formation of a double stranded structure by the two molecules. In order to allow a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in the sequence to allow formation of a stable double-stranded structure at the particular solvent and salt concentrations employed.

As used herein, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes under highly stringent conditions to the complementary strand of a matched nucleic acid molecule. Suitable stringency conditions for promoting DNA hybridization, for example, treatment with 6.0 XSSC at about 45 ℃ followed by a wash with 2.0 XSSC at 50 ℃, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from the group consisting of about 2.0 XSSC for low stringency conditions, 50 ℃ to about 0.2 XSSC for high stringency conditions, 50 ℃. In addition, the temperature conditions in the washing step can be raised from about 22 ℃ at room temperature for low stringency conditions to about 65 ℃ for high stringency conditions. Both the temperature conditions and the salt concentration may be changed, or one may be kept constant while the other is changed. Preferably, a nucleic acid molecule of the invention can specifically hybridize to one or more of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6 and SEQ ID NO 7, or complements thereof, or any fragment thereof, under moderately stringent conditions, e.g., at about 2.0 XSSC and about 65 ℃. More preferably, a nucleic acid molecule of the invention specifically hybridizes under highly stringent conditions to one or more of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6 and SEQ ID NO 7 or to the complementary sequence thereof, or to a fragment of any of the foregoing. In the context of the present invention, preferred marker nucleic acid molecules have SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 6 or SEQ ID NO 7 or the complement thereof or any fragment of the aforementioned sequences. Another preferred marker nucleic acid molecule of the invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 6 or SEQ ID NO 7 or the complement thereof or any fragment thereof. SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 6 and SEQ ID NO 7 can be used as markers in plant breeding methods to identify progeny of a genetic cross. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including, but not limited to, fluorescent labels, radioactive labels, antibody-based labels, and chemiluminescent labels.

With respect to amplification of a target nucleic acid sequence using a particular amplification primer (e.g., by PCR), "stringent conditions" refer to conditions that allow only hybridization of the primer to the target nucleic acid sequence in a DNA thermal amplification reaction, with a primer having a wild-type sequence (or its complement) corresponding to the target nucleic acid sequence that is capable of binding to the target nucleic acid sequence and preferably producing a unique amplification product, i.e., an amplicon.

The term "specifically binds (target sequence)" means that the probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample containing the target sequence.

As used herein, "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a corn plant is produced by sexual hybridization with a transgenic corn event DBN9501 of the present invention, or whether a corn sample collected from a field comprises a transgenic corn event DBN9501, or whether a corn extract, such as meal, flour, or oil, comprises a transgenic corn event DBN9501, DNA extracted from a corn plant tissue sample or extract can be amplified by a nucleic acid amplification method using a primer pair to produce an amplicon diagnostic for the presence of DNA of the transgenic corn event DBN9501. The primer pair includes a first primer derived from a flanking sequence adjacent to the insertion site of the inserted foreign DNA in the plant genome, and a second primer derived from the inserted foreign DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic corn event DBN9501. The length of the amplicons may range from the combined length of the primer pairs plus one nucleotide base pair, preferably plus about 50 nucleotide base pairs, more preferably plus about 250 nucleotide base pairs, and most preferably plus about 450 nucleotide base pairs or more.

Alternatively, primer pairs may be derived from flanking genomic sequences flanking the inserted DNA to produce amplicons that include the entire inserted nucleotide sequence. One of the primer pairs derived from a plant genomic sequence may be located at a distance from the inserted DNA sequence that may range from one nucleotide base pair to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in the DNA thermal amplification reaction.

The nucleic acid amplification reaction may be carried out by any of the nucleic acid amplification reaction methods known in the art, including the Polymerase Chain Reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify up to 22kb of genomic DNA and up to 42kb of phage DNA. These methods, as well as other DNA amplification methods known in the art, can be used in the present invention. The inserted exogenous DNA sequence and flanking DNA sequences from transgenic corn event DBN9501 can be obtained by amplifying the genome of transgenic corn event DBN9501 using the provided primer sequences and performing standard DNA sequencing of the PCR amplicons or cloned DNA after amplification.

DNA detection kits based on DNA amplification methods contain DNA molecules that serve as primers that specifically hybridize to the target DNA and amplify the diagnostic amplicon under appropriate reaction conditions. The kit may provide an agarose gel based detection method or a number of methods known in the art for detecting diagnostic amplicons. Kits containing DNA primers homologous or complementary to any portion of the maize genome of SEQ ID NO. 3 or SEQ ID NO. 4, and to any portion of the transgene insert region of SEQ ID NO. 5 are provided by the present invention. Particularly identifying primer pairs useful in DNA amplification methods are SEQ ID NO 8 and SEQ ID NO 9 which amplify a diagnostic amplicon homologous to a portion of the 5' transgene/genomic region of transgenic corn event DBN9501, wherein the amplicon comprises SEQ ID NO 1. Other DNA molecules used as DNA primers may be selected from the group consisting of SEQ ID NO 5.

The amplicons produced by these methods can be detected by a variety of techniques. One such method is Genetic Bit Analysis (Genetic Analysis) which designs a DNA oligonucleotide strand spanning the intervening DNA sequence and the adjacent flanking genomic DNA sequence. The oligonucleotide strand is immobilized within the microwell of a microwell plate, and after PCR amplification of the target region (using one primer in each of the intervening sequence and adjacent flanking genomic sequence), a single-stranded PCR product can hybridize to the immobilized oligonucleotide strand and serve as a template for a single-base extension reaction using a DNA polymerase and ddNTPs specifically labeled for the next desired base. The results can be obtained by fluorescence or ELISA-like methods. The signal represents the presence of the inserted/flanking sequence, indicating that the amplification, hybridization and single base extension reactions were successful.

Another method is Pyrosequencing (Pyrosequencing). The method designs an oligonucleotide strand that spans the insertion DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide strand is hybridized to the single-stranded PCR product of the target region (using one primer in each of the insert sequence and the adjacent flanking genomic sequence) and then incubated with DNA polymerase, ATP, sulfurylase, luciferase, triphosphatase, adenosine-5' -phosphothioate, and luciferin. dNTPs were added separately, and the resulting optical signals were measured. The light signal represents the presence of the inserted/flanking sequence, indicating that the amplification, hybridization, and single or multiple base extension reactions were successful.

Fluorescence polarization as described by Chen et al (Genome Res.) 9. Using this approach requires designing an oligonucleotide strand that spans the junction of the inserted DNA sequence and the adjacent genomic DNA. The oligonucleotide strand is hybridized to the single-stranded PCR product of the target region (one primer for each of the insert sequence and adjacent flanking genomic sequence) and then incubated with DNA polymerase and a fluorescently labeled ddNTP. Single base extension will result in insertion of ddntps. This insertion can be measured for changes in its polarization using a fluorometer. The change in polarization represents the presence of the insert/flanking sequence, indicating that the amplification, hybridization and single base extension reactions were successful.

Taqman is described as a method for detecting and quantifying the presence of DNA sequences, which is described in detail in the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe is designed to span the inserted DNA sequence and adjacent genomic flanking binding sites. The FRET probe and PCR primers (one primer for each of the flanking genomic sequences within the insert and adjacent) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage of the fluorescent and quenching moieties on the FRET probe and release of the fluorescent moiety. The generation of a fluorescent signal represents the presence of the inserted/flanking sequence, indicating that amplification and hybridization were successful.

Suitable techniques for detecting plant material derived from transgenic maize event DBN9501 based on the principle of hybridisation may also include Southern blot, northern blot and in situ hybridisation. In particular, the suitable techniques include incubating the probe and sample, washing to remove unbound probe and detecting whether the probe has hybridised. The detection method depends on the type of label attached to the probe, for example, a radiolabeled probe can be detected by X-ray film exposure and development, or an enzymatically labeled probe can be detected by a color change through substrate conversion.

Tyangi et al (Nature Biotech.) 14, 303-308, 1996, describe the use of molecular markers for sequence detection. Briefly, a FRET oligonucleotide probe is designed to span the inserted DNA sequence and adjacent genomic flanking binding sites. The unique structure of the FRET probe results in it containing a secondary structure that is capable of retaining both a fluorescent moiety and a quenching moiety in close proximity. The FRET probe and PCR primers (one for each of the insert and adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe to the target sequence results in loss of the secondary structure of the probe, thereby spatially separating the fluorescent moiety from the quencher moiety to produce a fluorescent signal. The generation of a fluorescent signal represents the presence of the inserted/flanking sequence, indicating that amplification and hybridization were successful.

Other described methods, such as microfluidics (microfluidics), provide methods and devices for isolating and amplifying DNA samples. The fluorochromes are used to detect and measure specific DNA molecules. A nano-tube (nanotube) device comprising an electronic sensor for detecting DNA molecules or nano-beads binding to specific DNA molecules and thus being detectable is useful for detecting the DNA molecules of the present invention.

The DNA detection kit can be developed using the compositions described herein and methods described or known in the DNA detection art. The kit facilitates the identification of the presence of DNA of transgenic corn event DBN9501 in a sample and can also be used to cultivate corn plants containing DNA of transgenic corn event DBN9501. The kit may contain DNA primers or probes homologous or complementary to at least a portion of

SEQ ID NO

1, 2, 3, 4 or 5, or other DNA primers or probes homologous or complementary to DNA contained in the transgenic genetic element of DNA, which DNA sequences may be used in DNA amplification reactions, or as probes in DNA hybridization methods. The DNA structure of the site of the maize genome binding of the transgene insert contained in the maize genome and illustrated in figure 1 and table 1 comprises: a genomic region flanking a maize plant DBN9501 located at the 5' end of the transgenic insert, a portion of the insert from the left border region (LB) of agrobacterium, a first expression cassette consisting of a promoter containing the maize ubiquitin gene 1 (prZmUbi 1), operably linked to phosphinothricin N-acetyltransferase (cPAT) of streptomyces, which is glufosinate tolerant, and operably linked to a transcriptional terminator (tNos) of nopaline synthase, a second expression cassette consisting of a promoter of cauliflower mosaic virus 35S (pr 35S) containing a tandem repeat of the enhancer region, operably linked to a maize heat shock 70kDa protein intron (izhsp 70), operably linked to an insect resistant Vip3Aa19 protein (cVip 3Aa 19) of bacillus thuringiensis, and operably linked to a transcriptional terminator of nopaline synthase (tNos), a portion of the insert from the right border Region (RB) of agrobacterium, and a genomic region flanking the maize plant DBN9501 ' N3N 955 ID located at the 5' end of the transgenic insert. In the DNA amplification method, the DNA molecule used as a primer can be any portion of the transgene insert sequence derived from transgenic corn event DBN9501, or any portion of the DNA sequence flanking the corn genome derived from transgenic corn event DBN9501.

Transgenic corn event DBN9501 can be combined with other transgenic corn varieties, for example, herbicide (e.g., glyphosate, dicamba, etc.) tolerant transgenic corn varieties, or transgenic corn varieties carrying other insect-resistant genes. All of these various combinations of different transgenic events, when bred with transgenic corn event DBN9501 of the present invention, can provide improved hybrid transgenic corn varieties that are resistant to a variety of insect pests and to a variety of herbicides. These varieties can exhibit more excellent characteristics such as yield improvement, compared with non-transgenic varieties and single-trait transgenic varieties.

The transgenic corn event DBN9501 of the invention is resistant to feeding damage by lepidopteran pests and is tolerant to the phytotoxic effects of glufosinate-containing agricultural herbicides. The dual-trait maize plant expresses the Vip3Aa19 protein of bacillus thuringiensis, which provides resistance to feeding damage by lepidopteran pests (such as black cutworm), and expresses the glufosinate-resistant phosphinothricin N-acetyltransferase (PAT) protein of streptomyces, which confers tolerance to glufosinate to the plant. The dual-character corn has the following advantages: 1) The method is free from economic loss caused by lepidoptera pests (such as black cutworms, cotton bollworms and the like), wherein the black cutworms, the cotton bollworms and the like are main pests in a corn planting area; 2) The ability to apply an agricultural herbicide containing glufosinate to a corn crop for broad-spectrum weed control; 3) The corn yield was not reduced. In addition, transgenes encoding insect resistance and glufosinate tolerance traits are linked on the same DNA segment and are present at a single locus in the transgenic maize event DBN9501 genome, which provides enhanced breeding efficiency and enables the use of molecular markers to track transgene inserts in breeding populations and progeny thereof. Meanwhile, SEQ ID NO 1 or a complementary sequence thereof, SEQ ID NO 2 or a complementary sequence thereof, SEQ ID NO 6 or a complementary sequence thereof, or SEQ ID NO 7 or a complementary sequence thereof in the detection method of the invention can be used as a DNA primer or a probe to generate an amplification product diagnosed as transgenic corn event DBN9501 or a progeny thereof, and the presence of plant material derived from transgenic corn event DBN9501 can be identified rapidly, accurately and stably.

Brief description of the sequences

1 transgenic maize event DBN9501 having a length of 22 nucleotides at the 5' end of the insertion sequence near the insertion junction, wherein nucleotides 1-11 and 12-22 flank the insertion site on the maize genome, respectively;

2 transgenic maize event DBN9501 having a 22 nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence wherein nucleotides 1-11 and 12-22 flank the insertion site on the maize genome, respectively;

3 transgenic maize event DBN9501 a sequence of 768 nucleotides in length located near the insertion-joining site at the 5' end of the insertion sequence;

4 transgenic maize event DBN9501 having a length of 1339 nucleotides located near the junction site of the insertion at the 3' end of the insertion;

5 entire T-DNA sequence, 5 'and 3' terminal maize genomic flanking sequences;

the sequence of SEQ ID NO 6 located at SEQ ID NO 3, spanning the left border region (LB) and the tNos transcription termination sequence;

SEQ ID NO 7 sequence located at SEQ ID NO 4, spanning the pr35S transcription start sequence and the right border Region (RB);

8 amplification of the first primer of SEQ ID NO. 3;

9 amplifying a second primer of SEQ ID NO. 3;

10 amplification of the first primer of SEQ ID NO. 4;

11 a second primer for amplifying SEQ ID NO. 4;

primers on the 5' flanking genomic sequence of SEQ ID NO 12;

13 and 12 paired primers on T-DNA;

primers on the 3' flanking genomic sequence of SEQ ID NO 14 paired with SEQ ID NO 12 can detect whether the transgene is homozygous or heterozygous;

15 and 14 on the T-DNA;

16 Taqman of SEQ ID NO. 16 is a first primer for detecting Vip3Aa19 gene;

a second primer of SEQ ID NO.17 Taqman for detecting Vip3Aa19 gene;

18 Taqman probe for detecting Vip3Aa19 gene;

19 Taqman detects the first primer of pat gene in SEQ ID NO;

20 Taqman detects the second primer of pat gene SEQ ID NO;

21 Taqman probe for detecting pat gene;

22 corn endogenous gene SSIIb;

23 of a second primer of a maize endogenous gene SSIIb;

24 Southern hybridization detection of Vip3Aa19 gene probe;

25 Southern hybridization of SEQ ID NO probe of pat gene;

26 is a primer positioned on the T-DNA and has the same direction with the SEQ ID NO. 13;

primers of SEQ ID NO. 27 on T-DNA in the opposite orientation to SEQ ID NO. 13 were used to obtain flanking sequences;

primers of SEQ ID NO 28 on T-DNA, in the opposite orientation to SEQ ID NO 13, were used to obtain flanking sequences;

29 is a primer on the T-DNA and has the same direction with the SEQ ID NO. 15;

primers of SEQ ID NO 30 on T-DNA in the opposite orientation to SEQ ID NO 15 were used to obtain flanking sequences;

primers of SEQ ID NO 31 located on the T-DNA, in the opposite orientation to SEQ ID NO 15, were used to obtain flanking sequences.

The technical solution of the present invention is further described in detail by the accompanying drawings and embodiments.

Drawings

FIG. 1 is a schematic diagram showing the structure of a junction between a transgene insert sequence and a maize genome used in a nucleic acid sequence for detecting a maize plant DBN9501 and a detection method thereof according to the present invention, and a schematic diagram showing the relative position of a nucleic acid sequence for detecting a maize plant DBN9501 (the relative position is schematically shown in B73RefGen v 3);

FIG. 2 is a schematic structural diagram of a recombinant expression vector DBN10707 used for detecting a nucleic acid sequence of a corn plant DBN9501 and a detection method thereof according to the present invention;

FIG. 3 is a field effect plot of a transgenic maize event DBN9501 under conditions naturally occurring in black cutworm, useful for detecting the nucleic acid sequence of a maize plant DBN9501 and methods of the invention;

FIG. 4 is a graph of the field effect of transgenic corn event DBN9501 inoculated with Helicoverpa armigera for use in detecting the nucleic acid sequence of corn plant DBN9501 and methods of detecting the same in accordance with the present invention;

FIG. 5 is a plot of the field effect of a transgenic maize event DBN9501 under spodoptera litura naturally occurring conditions for detecting the nucleic acid sequence of a maize plant DBN9501 and methods of the present invention;

FIG. 6 is a diagram showing the field effect of transgenic maize event DBN9501 under the conditions of spodoptera exigua nature occurrence for detecting the nucleic acid sequence of maize plant DBN9501 and the detection method thereof.

Detailed Description

The following examples further illustrate the nucleic acid sequences and methods of the invention for detecting DBN9501 from maize plants.

First example, cloning and transformation

1.1 cloning of vectors

The recombinant expression vector DBN10707 (shown in FIG. 2) was constructed using standard gene cloning techniques. The vector DBN10707 contains two transgenic expression cassettes in tandem, the first consisting of the tandem repeat cauliflower mosaic virus 35S promoter (pr 35S) containing the enhancer region, operably linked to the maize hot houke 70kDa protein intron (izmchsp 70), operably linked to the insect resistant Vip3Aa19 protein of bacillus thuringiensis (cVip 3Aa 19), and operably linked to the nopaline synthase transcription terminator (tNos); the second expression cassette consists of a promoter containing the maize ubiquitin gene 1 (prZmUbi 1), operably linked to the phosphinothricin N-acetyltransferase (cPAT) of streptomyces glufosinate tolerance, and operably linked to the transcriptional terminator of nopaline synthase (tNos).

The vector DBN10707 was transformed into Agrobacterium LBA4404 (Invitron, chicago, USA; cat. No.: 18313-015) by liquid nitrogen method, and transformed cells were screened with 4- [ hydroxy (methyl) phosphono ] -DL-homoalanine as a selection marker.

1.2 plant transformation

Transformation was performed using conventional Agrobacterium infection methods and aseptically cultured maize embryos were co-cultured with Agrobacterium as described in example 1.1 to transfer the T-DNA of the constructed recombinant expression vector DBN10707 into the maize genome to produce transgenic maize event DBN9501.

For Agrobacterium-mediated transformation of maize, briefly, immature embryos are isolated from maize and the embryos are contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the nucleotide sequence of the Vip3Aa19 gene and the nucleotide sequence of the pat gene to at least one cell of one of the embryos (step 1: the infection step), in which step the embryos are preferably immersed in an Agrobacterium suspension (OD ₆₆₀ =0.4-0.6, infect medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, pH 5.3)) to initiate inoculation. The young embryos are co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). Preferably, the young embryos are cultured on solid medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 20g/L, glucose 10g/L, AS 100mg/L, 2, 4-D1 mg/L, agar 8g/L, pH 5.8) after the invasion step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (cefamycin 150-250 mg/L) is present in the recovery medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 2, 4-D1 mg/L, cefamycin 250mg/L, plant gel 3g/L, pH 5.8) without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the immature embryos are cultured on solid medium with antibiotics but no selection agent to eliminate agrobacterium and provide a recovery period for the infected cells. Subsequently, the inoculated immature embryos are inoculated with a selection agent (4- [ hydroxy (methyl) phosphono)]DL-homoalanine) and selecting the growing transformed callus (step 4: a selection step). Preferably, the immature embryos are cultured on a selective solid medium (MS salt 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, cefamycin 250mg/L, 4- [ hydroxy (methyl) phosphono group]DL-homoalanine 10mg/L, 2, 4-D1 mg/L, plant gel 3g/L, pH 5.8), resulting in selective growth of transformed cells. Then, the callus is regenerated into a plant (step 5: regeneration step), preferably, callus grown on a medium containing a selection agent is cultured on a solid medium (MS differentiation medium and MS growth medium)Root medium) to regenerate the plant.

The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salt 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, cefamycin 250mg/L, 4- [ hydroxy (methyl) phosphono ] -DL-homoalanine 5mg/L, plant gel 3g/L, pH 5.8), and cultured and differentiated at 25 ℃. Transferring the differentiated plantlets to the MS rooting culture medium (MS salt is 2.15g/L, MS vitamins, casein is 300mg/L, sucrose is 30g/L, cefamycin is 250mg/L, indole-3-acetic acid is 1mg/L, plant gel is 3g/L, pH is 5.8), culturing at the temperature of 25 ℃ to the height of about 10cm, and transferring to a greenhouse for culturing until fructification. In the greenhouse, the culture was carried out at 28 ℃ for 16h and at 20 ℃ for 8h each day.

1.3 identification and screening of transgenic events

A total of 200 independent transgenic T were generated ₀ And (4) single plants.

Since genetic transformation, gene insertion, etc. may have an agronomic effect on maize plants (e.g., dwarf, leaf clumping, mosaic, leaf-on-pair, abnormal dusting or poor fruit set), the 200 independent transgenes T were introduced ₀ The individual plants are transplanted in the greenhouse and cultivated to identify the transgenic T ₀ The agronomic characters of a single plant at different periods (seedling stage-jointing stage, jointing stage-powder scattering stage and filling stage-mature stage) are expressed, and 136 transgenic T with normal agronomic character expression are obtained ₀ And (4) single plants.

By TaqMan ^TM Analyzing and detecting whether the 136 transgenic corn plants have single-copy Vip3Aa19 and pat genes and do not contain vector skeleton sequences, and obtaining 83 transgenic T ₀ Carrying out single plant cultivation; through transgene insertion site analysis, 28 transgene T with complete bilateral sequences of T-DNA, T-DNA not inserted into important genes of corn genome and gene insertion not generating new Open Reading Frame (ORF) are screened ₀ Carrying out single plant cultivation; through resistance evaluation and comparison of main target insects (such as black cutworm, cotton bollworm, prodenia litura or spodoptera exigua), 13 transgenic T with good insect resistance are screened ₀ Carrying out single plant cultivation; by using paraquatEvaluation and comparison of tolerance to phosphine herbicide, 12 transgenic T with good tolerance to glufosinate herbicide are screened ₀ Carrying out single plant cultivation; transgenic corn event DBN9501 was selected to be excellent with a single copy transgene (see second example), good insect resistance, glufosinate herbicide tolerance and agronomic performance (see fifth and sixth examples) by screening transgenic corn plants for agronomic traits, molecular biology, target insect resistance, glufosinate tolerance, etc., that are stably heritable under different generations, different geographical environments and/or different background materials.

Second example, transgenic corn event DBN9501 detection with TaqMan

Approximately 100mg of leaves of transgenic maize event DBN9501 were sampled, and genomic DNA thereof was extracted using a Plant DNA extraction Kit (DNeasy Plant Maxi Kit, qiagen), and the copy number of Vip3Aa19 gene and pat gene was detected by Taqman probe fluorescent quantitative PCR method. Meanwhile, wild type corn plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.

The specific method comprises the following steps:

step 1, taking 100mg of leaves (after pollination) of transgenic corn event DBN9501, grinding the leaves into homogenate by using liquid nitrogen in a mortar, and taking 3 samples for each time;

step 2, extracting the genomic DNA of the sample by using a Plant DNA extraction Kit (DNeasy Plant Maxi Kit, qiagen), and referring to the product specification of the specific method;

step 3, determining the genomic DNA concentration of the sample by using a ultramicro spectrophotometer (NanoDrop 2000, thermo Scientific);

step 4, adjusting the genomic DNA concentration of the sample to the same concentration value, wherein the concentration value ranges from 80 ng/muL to 100 ng/muL;

step 5, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with known copy number as a standard substance through identification, taking the sample of a wild maize plant as a control, repeating each sample for 3 times, and taking the average value; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:

the following primers and probes were used to detect the Vip3Aa19 gene sequence:

primer 1: the cgaatacagaaccctgtcggc is shown as SEQ ID NO 16 in the sequence table;

primer 2: cgtgaggaaggtctcagaaaatgac is shown as SEQ ID NO 17 in the sequence Listing;

1, probe 1: the cgacgatggcgtgtgtatatcttgg is shown as SEQ ID NO 18 in the sequence table;

the following primers and probes were used to detect pat gene sequences:

primer 3: the gaggtggtggctggtattg is shown as SEQ ID NO. 19 in the sequence table;

primer 4: tctcaactgtccaatcgtaagcg is shown in SEQ ID NO:20 of the sequence Listing;

and (3) probe 2: cttacgctgtggggcctctggaaggctag is shown as SEQ ID NO 21 in the sequence table;

the PCR reaction system is as follows:

the 50 × primer/probe mixture contained 45 μ L of each primer at a concentration of 1mM, 50 μ L of probe at a concentration of 100 μ M, and 860 μ L of 1 × TE buffer (10 mM Tris-HCl, 1mM EDTA, pH 8.0) and was stored in amber tubes at 4 deg.C.

The PCR reaction conditions are as follows:

data were analyzed using rapid Real-Time fluorescent quantitative PCR System software (Applied Biosystems 7900HT Fast Real-Time PCR System SDS v2.3, applied Biosystems) and the results indicated that the transgenic maize event DBN9501 obtained was a single copy.

Third example analysis of insertion site for transgenic maize event DBN9501

3.1 extraction of genomic DNA

DNA extraction was performed according to the conventionally used CTAB (cetyltrimethylammonium bromide) method: grinding 2g of young and tender leaves of transgenic corn event DBN9501 in liquid nitrogen into powder, adding 0.5mL of DNA extraction CTAB buffer solution (20 g/L CTAB, 1.4M NaCl, 100mM Tris-HCl and 20mM EDTA (ethylene diamine tetraacetic acid) preheated at 65 ℃), adjusting the pH to 8.0 by NaOH, fully mixing uniformly, and extracting at 65 ℃ for 90min; adding 0.5 times volume of phenol and 0.5 times volume of chloroform, reversing and mixing evenly; 12000 Centrifuging at rpm for 10min; sucking supernatant, adding 2 times of volume of absolute ethyl alcohol, gently shaking the centrifuge tube, and standing at 4 deg.C for 30min; centrifuging at 12000rpm for 10min; collecting DNA to the bottom of the tube; discarding the supernatant, washing the precipitate with 1mL of 70% ethanol; 12000 Centrifuging for 5min at the rpm; vacuum pumping or drying in a super clean bench; the DNA pellet was dissolved in an appropriate amount of TE buffer and stored at-20 ℃.

3.2 analysis of flanking DNA sequences

And (3) carrying out concentration measurement on the extracted DNA sample so that the concentration of the sample to be measured is between 80 and 100 ng/. Mu.L. Genomic DNA was enzymatically cut with restriction enzymes Kpn I (5 'end analysis) and Spe I (3' end analysis), respectively. 26.5. Mu.L of genomic DNA, 0.5. Mu.L of the above restriction enzymes and 3. Mu.L of an enzyme digestion buffer (the restriction enzymes used are all the enzymes from NEB and buffers or general buffers matched with the enzymes, now called NEBCutSmart) were added to each enzyme digestion system, and the enzyme digestion was carried out for 1 hour. After enzyme digestion is finished, 70 mu L of absolute ethyl alcohol is added into an enzyme digestion system, the mixture is centrifuged for 7min at the rotating speed of 12000rpm in an ice bath 30min, supernatant is discarded and dried, and then 8.5 mu L of double distilled water and 1 mu L of 10 XT are added ₄ DNA Ligase Buffer (NEB T4 DNA ligation Buffer, whose specific formulation is accessible to the NEB website or reference https:// www.neb.com/products/restriction-endicleases, https:// www.neb.com/products/b 0202-T4-DNA-ligation-Buffer) and 0.5. Mu.L T ₄ DNA ligase ligation overnight at 4 ℃. PCR amplification with a series of nested primers isolates the 5 'and 3' end genomic DNA. Specifically, the primer set for separating the 5' end genomic DNA includes SEQ ID NO 13 and SEQ ID NO 26 as the first primer, SEQ ID NO 27 and SEQ ID NO 28 as the second primer, and SEQ ID NONO 13 as sequencing primer. The primer combination for separating the 3' end genome DNA comprises SEQ ID NO. 15 and SEQ ID NO. 29 as first primers, SEQ ID NO. 30 and SEQ ID NO. 31 as second primers, SEQ ID NO. 15 as a sequencing primer, and PCR reaction conditions are shown in Table 3.

The amplification product obtained by the above-mentioned PCR amplification reaction was electrophoresed on an agarose Gel having a mass fraction of 2.0% to separate the PCR amplification product, followed by separating the target fragment from the agarose matrix using a Gel recovery Kit (QIAquick Gel Extraction Kit, catalog # 28704, qiagen Inc., valencia, calif.). The purified PCR amplification products are then sequenced (e.g., using ABI prism 377, PE biosystems, foster City, calif.) and analyzed (e.g., using DNASTAR sequence analysis software, DNASTAR Inc., madison, wis.).

The 5 'and 3' flanking and junction sequences were confirmed using standard PCR methods. The 5' flanking sequence and the joining sequence can be confirmed using SEQ ID NO 8 or SEQ ID NO 12 in combination with SEQ ID NO 9, SEQ ID NO 13 or SEQ ID NO 26. The 3' flanking sequences and the junction sequences can be confirmed using SEQ ID NO 11 or 14 in combination with SEQ ID NO 10, SEQ ID NO 15 or SEQ ID NO 29. The PCR reaction system and amplification conditions are shown in tables 2 and 3. One skilled in the art will appreciate that other primer sequences may also be used to confirm the flanking and junction sequences.

DNA sequencing of PCR amplification products provides DNA that can be used to design other DNA molecules that can be used as primers and probes to identify corn plants or seeds derived from transgenic corn event DBN9501.

It was found that the maize genomic sequence shown at nucleotides 1-384 of SEQ ID NO:5 flanked the left boundary of the transgenic maize event DBN9501 insert (the 5 'flanking sequence) and that the maize genomic sequence shown at nucleotides 7785-8559 of SEQ ID NO:5 flanked the right boundary of the transgenic maize event DBN9501 insert (the 3' flanking sequence). The 5 'junction sequence is set forth in SEQ ID NO 1 and the 3' junction sequence is set forth in SEQ ID NO 2.

3.3 PCR conjugation assay

The junction sequence is a relatively short polynucleotide molecule that is a novel DNA sequence that is diagnostic for the DNA of transgenic maize event DBN9501 when detected in a polynucleic acid detection assay. The joining sequences in SEQ ID No.1 and SEQ ID No. 2 are the insertion site of the transgene fragment in transgenic corn event DBN9501 and 11 polynucleotides on each side of the corn genomic DNA. Longer or shorter polynucleotide joining sequences may be selected from SEQ ID NO. 3 or SEQ ID NO. 4. The junction sequences (5 'junction region SEQ ID NO:1, and 3' junction region SEQ ID NO: 2) are useful in DNA detection methods as DNA probes or as DNA primer molecules. The junction sequences SEQ ID NO 6 and SEQ ID NO 7 are also novel DNA sequences in transgenic maize event DBN9501 which can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic maize event DBN9501 DNA. The SEQ ID NO. 6 (nucleotides 385-574 of SEQ ID NO. 3) spans the DBN10707 construct DNA sequence and the tNOs transcription termination sequence, and the SEQ ID NO. 7 (nucleotides 252-451 of SEQ ID NO. 4) spans the pr35S transcription initiation sequence and the DBN10707 construct DNA sequence.

In addition, an amplicon is generated by using at least one primer from SEQ ID NO. 3 or SEQ ID NO. 4 that when used in a PCR method generates a diagnostic amplicon of transgenic corn event DBN9501.

Specifically, a PCR amplification product is generated from the 5 'end of the transgenic insert, which PCR amplification product is a portion of the genomic DNA comprising the 5' end of the T-DNA insert flanking the genome of the plant material derived from transgenic maize event DBN9501. This PCR amplification product comprises SEQ ID NO. 3. For PCR amplification, primer 5 (SEQ ID NO: 8) hybridizing to the genomic DNA sequence flanking the 5' end of the transgene insert was designed, along with primer 6 (SEQ ID NO: 9) pairing to the tNos transcription termination sequence in the T-DNA insert.

Generating a PCR amplification product from the 3 'end of the transgenic insert, the PCR amplification product comprising a portion of genomic DNA flanking the 3' end of the T-DNA insert in the genome of the plant material derived from transgenic maize event DBN9501. This PCR amplification product comprises SEQ ID NO 4. For PCR amplification, primer 7 (SEQ ID NO: 10) located at the transcription start sequence of pr35S in the T-DNA insert was designed, along with primer 8 (SEQ ID NO: 11) that hybridizes to the genomic DNA sequence flanking the 3' end of the transgene insert.

The DNA amplification conditions set forth in tables 2 and 3 can be used in the PCR zygosity assay described above to produce a diagnostic amplicon of transgenic maize event DBN9501. Detection of amplicons can be performed by using a Stratagene Robocycler, MJ Engine, perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermocycler, etc., or by methods and equipment known to those skilled in the art.

TABLE 2 PCR steps and reaction mixture conditions for 5' end transgene insert/genome junction region identification for transgenic maize event DBN9501

TABLE 3 thermal cycler amplification conditions

Gently mix, if there is no incubation cap on the thermocycler, 1-2 drops of mineral oil can be added above each reaction. The PCR reactions were carried out on a Stratagene Robocycler (Stratagene, la Jolla, CA), MJ Engine (MJ R-Biorad, hercules, CA), perkin-Elmer 9700 (Perkin Elmer, boston, MA) or Eppendorf Mastercycler Gradient (Eppendorf, hamburg, germany) thermocycler using the cycling parameters in Table 3. The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a computational mode. The Perkin-Elmer 9700 thermal cycler was run with the ramp speed set to the maximum value.

The experimental results show that: primers 5 and 6 (SEQ ID NOS: 8 and 9) which, when used in a PCR reaction of transgenic corn event DBN9501 genomic DNA, produce an amplification product of a 768bp fragment, and when used in a PCR reaction of untransformed corn genomic DNA and non-DBN 9501 corn genomic DNA, NO fragment was amplified; primers 7 and 8 (SEQ ID NOS: 10 and 11), when used in a PCR reaction of transgenic corn event DBN9501 genomic DNA, produced an amplification product of a 1339bp fragment, and when used in a PCR reaction of untransformed corn genomic DNA and non-DBN 9501 corn genomic DNA, NO fragment was amplified.

PCR zygosity assays can also be used to identify whether the material derived from transgenic corn event DBN9501 is homozygote or heterozygote. Primer 9 (SEQ ID NO: 12), primer 10 (SEQ ID NO: 13) and primer 11 (SEQ ID NO: 14) were used in an amplification reaction to produce a diagnostic amplicon of transgenic maize event DBN9501. The DNA amplification conditions set forth in tables 4 and 5 can be used in the zygosity assay described above to produce a diagnostic amplicon for transgenic corn event DBN9501.

TABLE 4 reaction solution for measuring adhesiveness

TABLE 5 thermal cycler amplification conditions for connectivity measurements

The PCR reactions were carried out on a Stratagene Robocycler (Stratagene, la Jolla, CA), MJ Engine (MJ R-Biorad, hercules, CA), perkin-Elmer 9700 (Perkin Elmer, boston, MA) or Eppendorf Mastercycler Gradient (Eppendorf, hamburg, germany) thermocycler using the cycling parameters in Table 5. The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a computational mode. The Perkin-Elmer 9700 thermal cycler was operated with a ramp speed set to a maximum value.

In the amplification reaction, a biological sample containing template DNA contains DNA that is diagnostic for the presence of transgenic maize event DBN9501 in the sample. Or the amplification reaction will produce two different DNA amplicons from a biological sample containing DNA derived from the maize genome that is heterozygous for the corresponding allele of the inserted DNA present in transgenic maize event DBN9501. These two different amplicons would correspond to a first amplicon (SEQ ID NO:12 and SEQ ID NO: 14) derived from the wild type maize genomic locus and a second amplicon (SEQ ID NO:12 and SEQ ID NO: 13) diagnostic for the presence of the transgenic maize event DBN9501 DNA. A maize DNA sample that produces only a single amplicon corresponding to the second amplicon described for the heterozygous genome can be diagnostically determined for the presence of transgenic maize event DBN9501 in the sample and is produced from maize seeds that are homozygous for the allele corresponding to the insert DNA present in the transgenic maize plant DBN9501.

It is noted that primer pairs of transgenic corn event DBN9501 are used to generate amplicons diagnostic for transgenic corn event DBN9501 genomic DNA. These primer pairs include, but are not limited to, primers 5 and 6 (SEQ ID NOS: 8 and 9), and primers 7 and 8 (SEQ ID NOS: 10 and 11), which are used in the DNA amplification method described above. In addition, a control primer 12 and 13 (SEQ ID NOS: 22 and 23) for amplifying the endogenous gene of maize was included as an internal standard of the reaction conditions. Analysis of samples of transgenic corn event DBN9501DNA extracts should include a control of positive tissue DNA extracts of transgenic corn event DBN9501, a control of negative DNA extracts from non-transgenic corn event DBN9501 and a negative control containing no template corn DNA extract. In addition to these primer pairs, any primer pair from SEQ ID NO. 3 or its complement, or SEQ ID NO. 4 or its complement, which when used in a DNA amplification reaction, produces an amplicon comprising SEQ ID NO.1 or SEQ ID NO. 2, respectively, that is diagnostic for tissue derived from transgenic event maize plant DBN9501, can be used. The DNA amplification conditions illustrated in tables 2-5 can be used to generate diagnostic amplicons of transgenic maize event DBN9501 using appropriate primer pairs. An extract of corn plant or seed DNA putatively containing transgenic corn event DBN9501, or a product derived from transgenic corn event DBN9501, which produces a diagnostic amplicon for transgenic corn event DBN9501 when tested in a DNA amplification method, can be used as a template for amplification to determine the presence of transgenic corn event DBN9501.

Fourth example detection of transgenic maize event DBN9501 Using Southern blot hybridization

4.1 DNA extraction for Southern blot hybridization

Approximately 5-10g leaf tissue was ground in liquid nitrogen using a mortar and pestle. Resuspend 4-5g of the milled leaf tissue in 20mL CTAB lysis buffer (100 mM Tris-HCl pH8.0, 20mM EDTA pH8.0, 1.4M NaCl, 0.2% v/v β -mercaptoethanol, 2% w/v CTAB) and incubate at 65 ℃ for 60 min. During incubation, the samples were mixed by inversion every 10 min. After incubation, an equal volume of phenol/chloroform/isoamyl alcohol (25. The aqueous phase was extracted once more with an equal volume of chloroform/isoamyl alcohol (24. After the aqueous phase was collected again, an equal volume of isopropanol was added, and after mixing, the mixture was left at-20 ℃ for 1 hour to precipitate DNA, and then centrifuged at 4000rpm for 5min to obtain a DNA precipitate, which was then resuspended in 1mL of TE buffer (10 mM Tris-HCl, 1mM EDTA, pH 8.0). To degrade any RNA present, the DNA was incubated with 40. Mu.L of 10mg/mL RNase A at 37 ℃ for 30min, centrifuged at 4000rpm for 5min, and the DNA was precipitated by centrifugation at 12000rpm in the presence of 3M sodium acetate (pH 5.2) at 0.1 volume and 2 volumes of absolute ethanol. After discarding the supernatant, the pellet was washed with 70% (v/v) of 1mL ethanol, dried at room temperature and the DNA was redissolved in 1mL TE buffer.

4.2 restriction enzyme digestion

The genomic DNA concentration of the above samples was determined using a ultramicro spectrophotometer (NanoDrop 2000, thermo Scientific).

Mu.g of DNA was digested in a 100. Mu.L reaction system, and genomic DNA was digested with restriction enzymes Nco I and Nde I, respectively, using partial sequences of Vip3Aa19 gene and pat gene on T-DNA as probes. For each enzyme, digests were incubated overnight at the appropriate temperature. The samples were spun down to 20 μ L using a Vacuum centrifugal evaporator concentrator (speed Vacuum, thermo Scientific).

4.3 gel electrophoresis

Bromophenol blue loading buffer was added to each sample from example 4.2, and each sample was loaded on a 0.7% TAE agarose gel containing ethidium bromide, electrophoretically separated in TAE electrophoresis buffer (40 mM Tris-acetic acid, 2mM EDTA, pH 8.5), and the gel was electrophoresed overnight at 20V.

After the electrophoresis was completed, the gel was treated with 0.25M HCl for 10min to depurinate the DNA, and then treated with denaturing solution (1.5M NaCl, 0.5M NaOH) and neutralizing solution (1.5M NaCl, 0.5M Tris-HCl, pH 7.2) for 30min each. 5 XSSC (3M NaCl, 0.3M sodium citrate, pH 7.0) is poured into a porcelain dish, a glass plate is lapped, and then a soaked filter paper bridge, gel, a positively charged nylon membrane (Roche, cat. No. 11417240001), three pieces of filter paper, a paper tower and a weight are sequentially placed. After overnight rotation at room temperature, the nylon membrane was rinsed 2 times in deionized water and the DNA was immobilized on the membrane by means of an ultraviolet cross-linker (UVP, UV Crosslinker CL-1000).

4.4 hybridization

PCR was used to amplify appropriate DNA sequences for probe preparation. The DNA probe is SEQ ID NO. 24 or SEQ ID NO. 25, or is homologous or complementary with the sequence part. The DIG Labeling of the probe, southern blot hybridization, membrane washing and the like were carried out using the DNA Labeling and Detection Starter Kit II Kit (Roche, cat. No. 11585614910), and the product instructions were referred to for the specific methods. Finally, the position of the probe bound was detected with X-ray film (Roche, cat. No. 11666916001).

Two control samples were included on each Southern: (1) DNA from a negative (untransformed) isolate, which is used to identify any endogenous maize sequence that can hybridize to the element-specific probe; (2) DNA from a negative isolate, into which Nco I-digested DBN10707 plasmid was introduced in an amount equivalent to one copy number based on probe length, served as a positive control for hybridization and used to demonstrate the sensitivity of the experiment.

The hybridization data provide corroborative evidence supporting TaqMan ^TM PCR analysis, i.e., maize plant DBN9501 contained a single copy of the Vip3Aa19 gene and the pat gene. Using this Vip3Aa19 gene probe, nco I and Ned I were enzymatically cleaved to give single bands of approximately 11kb and 9kb in size, respectively; using this pat gene probe, nco I and Ned I enzymatic hydrolysis produced single bands of approximately 8.5kb and 1.3kb in size, respectively, indicating that one copy each of the Vip3Aa19 gene and pat gene is present in the maize plant DBN9501. In addition, for the backbone probe, no hybridization band was obtained, indicating that no DBN10707 vector backbone sequence entered the maize plant DBN9501 genome during transformation.

Fifth example, insect resistance detection of event

5.1 bioassay of corn plants DBN9501

Transgenic maize event DBN9501 and wild type maize plant (non-transgenic, NGM) 2 plants were bioassayed against cutworm (BCW), spodoptera litura (TCW), spodoptera exigua (BAW), sesbania inferens (PSB), sorghum striped rice borer (Chilo saccharophagus, SGB) and Chilo suppressalis (MSB) respectively according to the following methods:

fresh leaves (period V3-V4) of 2 plants of a transgenic corn event DBN9501 and a wild-type corn plant (non-transgenic, NGM) are respectively taken, washed clean by sterile water and water on the leaves is sucked dry by gauze, then the corn leaves are subjected to vein removal and are simultaneously cut into long strips of about 1cm multiplied by 3cm, 1 to 3 (the number of the leaves is determined according to insect appetite) of the cut long strips are put on filter paper at the bottom of a round plastic culture dish, the filter paper is wetted by distilled water, 5 to 10 artificially fed newly hatched larvae are put in each culture dish, and after the insect test culture dish is covered, the result is counted after the culture dish is placed under the conditions of 26 to 28 ℃, the relative humidity is 70 to 80 percent and the light cycle (light/dark) 16 for 3 days. Counting three indexes of larva development progress, mortality and leaf damage rate to obtain a total resistance score (full score 300): the total resistance score =100 × mortality + [100 × mortality +90 × (number of first hatched/number of inoculated insects) +60 × (number of first hatched-negative control insects/number of inoculated insects) +10 × (number of negative control insects/number of inoculated insects) ] +100 × (1-leaf damage rate). Wherein, the number of the inoculated insects refers to the number of the inoculated insects, namely 5 or 10 (according to the feeding amount of pests); the development progress of the larvae is reflected by a resistance general score formula; the leaf damage rate is the ratio of the area of the leaves eaten by pests to the total area of the leaves. 5 plants were selected from transgenic maize event DBN9501 and wild type maize plants (non-transgenic, NGM) for testing, each replicated 6 times. The results are shown in tables 6 and 7.

Table 6, insect-resistant bioassay results for transgenic corn event DBN 9501-mortality (%)

TABLE 7 insect resistance bioassay results for transgenic corn event DBN 9501-Total resistance score (points)

The results show that: the transgenic corn event DBN9501 has better resistance to black cutworm, prodenia litura, beet armyworm, sesamia inferen, sorghum striped rice borer and chilo suppressalis, and the death rate and the total resistance score of the test insects of the transgenic corn event DBN9501 are obviously higher than those of NGM.

5.2 field Effect of transgenic corn event DBN9501

Seeds of transgenic maize event DBN9501 and wild type maize plant (non-transgenic, NGM) 2 plantlets were set to 2 treatments, each treatment in a randomized block design, 3 replicates, and a plot area of 30m ² (5 m is multiplied by 6 m), the row spacing is 60cm, the plant spacing is 25cm, the conventional cultivation management is carried out, and the pesticide is not sprayed in the whole growth period. The interval of 2m is arranged between different insect inoculation test cells, so that the insects are prevented from spreading among different cells. (1) All-grass of meadow tiger

The natural pest-sensing is only carried out in the areas with serious natural occurrence of the black cutworm (natural pest occurrence conditions, the first generation of larvae which are harmful to the black cutworm and easily occur under appropriate environmental conditions, such as the temperature of 16-26 ℃, the relative humidity of 80-90 percent and the soil water content of 15-20 percent, and the first generation of adults are induced to a certain amount, such as more than 20 heads). In the seedling stage of the corn, when the material grows to about V2-V3, the corn plants grow to the stage of 2-3 leaves, tracking and investigating whether plant wilting occurs in the NGM, and when most of 4-6-year-old larvae are damaged near the roots of the wilting plants of the NGM, investigating the damage rate of the black cutworms to the corn plants one by one (the damage rate = the number of corn plants eaten by the pests/the total number of plants multiplied by 100%). The results of resistance of transgenic maize event DBN9501 to black cutworm are shown in table 8.

TABLE 8 resistance results to black cutworm under transgenic maize event DBN9501 Nature susceptible conditions

The results show that: under the condition of natural occurrence of the black cutworm, the damage rate of the black cutworm to the transgenic corn event DBN9501 is remarkably reduced compared with NGM, so that the transgenic corn event DBN9501 has better resistance to the black cutworm, and the field effect of the transgenic corn event DBN9501 under the condition of natural occurrence of the black cutworm is shown in figure 3.

(2) Cotton bollworm (Helicoverpa armigera Hubner, CBW)

Carrying out artificial inoculation for 2 times in the spinning period of the corn, wherein the number of the artificial inoculation is not less than 40 in each cell, inoculating about 20 newly hatched larvae which are artificially fed into each corn filament, and after 3 days, carrying out secondary inoculation, wherein the number of the inoculated larvae is the same as that of the first inoculation. After 14-21 days of inoculation, the damage rate of the ears, the number of surviving larvae per ear and the damage length of the ears were investigated plant by plant. The investigation is started 14 days after the inoculation, if the damage level of the NGM achieves the feeling or the high feeling, the NGM is effective, and if the NGM does not achieve the level which can be delayed properly, but does not achieve the corresponding level 21 days after the inoculation, the NGM is ineffective. Calculating the average damage level of the cotton bollworms in the ear stage of the corn to the female ears in each cell according to the damage rate of the female ears, the number of the surviving larvae and the damage length (cm) of the female ears, wherein the judgment standard is shown in the table 9, and then judging the resistance level of the cotton bollworms in the ear stage of the corn according to the standard of the table 10. The results of resistance to bollworm during the laying phase of transgenic maize event DBN9501 are shown in table 11.

TABLE 9 grading Standard of the degree of damage to ears of corn by Cotton bollworm

Grade of damage to ears	Description of the symptoms
		0	The female ear is not damaged
1	Only the filament is damaged
		2	Damage to ear tip of 1cm
3+	The damage level under the top of the spike is increased by 1cm every time the damage level under the top of the spike is increased by 1 level
		…N

TABLE 10 evaluation criteria for resistance of corn ears to cotton bollworms

Female earMean value of damage rating	Level of resistance
		0-1.0	High Resistance (HR)
1.1-3.0	Anti (R)
		3.1-5.0	Moderate (MR)
5.1-7.0	Seng (S)
		≥7.1	High Sensitivity (HS)

TABLE 11 resistance results to Helicoverpa armigera during transgenic maize event DBN9501 silking period

The results show that: under the conditions of artificial inoculation, the ear damage rate, larva survival number, ear damage length and ear damage grade of transgenic corn event DBN9501 were significantly lower than those of NGM, thus indicating that the level of resistance of transgenic corn event DBN9501 to cotton bollworm was at the resistance (R) level and that the field effect of transgenic corn event DBN9501 inoculated with cotton bollworm was as shown in fig. 4.

(3) Prodenia litura

The natural pest-sensing is only carried out in the areas with serious natural occurrence of prodenia litura (natural pest occurrence conditions are that the pest peak period is 7-9 months, and the optimum temperature for pest development is 28-30 ℃). After 10-15 days of initial insect pest occurrence and when NGM is mostly damaged by 4-6-instar larvae, investigating the damage rate of the spodoptera litura to the corn plants one by one (the damage rate = the number of corn plants eaten by the pests/the total number of plants multiplied by 100%). The results of resistance of transgenic maize event DBN9501 to prodenia litura are shown in table 12.

TABLE 12 resistance results of transgenic maize event DBN9501 to Spodoptera litura under naturally-permissive conditions

The results show that: under the condition of natural occurrence of prodenia litura, compared with NGM, the damage rate of the prodenia litura to the transgenic corn event DBN9501 is obviously reduced, so that the transgenic corn event DBN9501 has better resistance to the prodenia litura, and the field effect of the transgenic corn event DBN9501 under the condition of natural occurrence of the prodenia litura is shown in FIG. 5.

(4) Beet armyworm

The experimental design and method of testing is essentially consistent with the evaluation of resistance to prodenia litura as described above. In contrast, after 10-15 days of the initial discovery of insect pests, and when the NGM mostly damages 4-5-instar larvae, the damage rate of the spodoptera exigua to the corn plants is investigated plant by plant (damage rate = the number of corn plants eaten by the pests/total number of plants × 100%). The results of resistance of transgenic maize event DBN9501 to spodoptera exigua are shown in table 13.

TABLE 13 resistance results to beet armyworm under transgenic maize event DBN9501 Nature susceptible conditions

The results show that: under the condition of natural occurrence of spodoptera exigua, compared with NGM, the damage rate of spodoptera exigua to transgenic corn event DBN9501 is remarkably reduced, so that transgenic corn event DBN9501 has better resistance to spodoptera exigua, and the field effect of transgenic corn event DBN9501 under the condition of natural occurrence of spodoptera exigua is shown in FIG. 6.

Particularly noteworthy, according to the contents recorded in chinese patent (application) nos. 201310289848.6, 201310573441.6, 201410806573.3, 201510259396.6, 201610006375.8, and the field efficacy against insects and the bioassay results thereof of the transgenic corn event DBN9501 of the present application, it is shown that the transgenic corn event DBN9501 of the present application realizes a method and/or use for controlling pests, specifically, borer, prodenia litura, diaphagous, sorghum striped rice borer and dichocrocis punctiferalis; namely, any transgenic corn plant expressing Vip3Aa19 protein can realize the method and/or the application for controlling pests such as sesamia inferen, spodoptera litura, chilo suppressalis, sorghum pendula and/or dichocrocis punctiferalis.

Sixth example, herbicide tolerance test of event

In the test, a Baozhida (Basta) herbicide (a glufosinate ammonium water aqua with the active ingredient of 18%) is selected for spraying. Random block design was used, 3 replicates. The area of the cell is 15m ² (5 m multiplied by 3 m), the row spacing is 60cm, the plant spacing is 25cm, the cultivation management is carried out conventionally, and 1m wide isolation belts are arranged among cells. Transgenic maize event DBN9501 was subjected to 2 treatments as follows: (1) Spraying the herbicide while spraying the same volume of clear water in the treatment step (2) without spraying; (2) The herbicide was sprayed at the V2-V3 leaf stage at a dose of 800g a.i./ha (a.i./ha means "active ingredient per hectare"). The glufosinate-ammonium herbicide (such as Basta) is a contact-type herbicide, and if the herbicide is used improperly in the field, and if the pesticide liquid is accumulated locally, the herbicide is harmful, and the DBN9501 tolerance of the transgenic corn event is not a problem; the conversion of the glufosinate-ammonium herbicide in different contents and dosage forms to the above-mentioned equivalent amount of the active ingredient glufosinate-ammonium is applicable to the following conclusions.

Investigation of phytotoxicity symptoms at 1 and 2 weeks after drug application, respectively, and determination of cell yield at harvest; the grading of the symptoms of drug damage is shown in table 14. Using the herbicide damage rate as an index for evaluating herbicide tolerance of the transformation event, specifically, the herbicide damage rate (%) = ∑ (the number of sibling damaged strains × the number of grades)/(the total number of strains × the highest grade); wherein the herbicide damage rate refers to glufosinate damage rate, the glufosinate damage rate is determined according to phytotoxicity investigation results 2 weeks after glufosinate treatment, and the herbicide (glufosinate) damage rate is used for judging the tolerance level of the corn to the herbicide. The corn yield per cell is the total corn grain yield (weight) measured in the middle 3 rows of each cell, and the yield difference between different treatments is measured as the yield percentage (%) = spray yield/no-spray yield. Results for herbicide tolerance and corn yield results for transgenic corn event DBN9501 are shown in table 15.

TABLE 14 grading Standard for the extent of phytotoxicity of Glufosinate herbicide on corn

Grade of phytotoxicity	Description of the symptoms
		1	Normal growth without any damage symptoms
2	Slight phytotoxicity less than 10%
		3	Moderate drug injury, recovery later, no influence on yield
4	Serious damage and difficult recovery, resulting in reduced yield
		5	Serious drug damage and no recovery, resulting in obvious yield reduction or failure to produce

Table 15, results of transgenic corn event DBN9501 tolerance to glufosinate herbicide and corn yield results

The results demonstrate that, in terms of glufosinate herbicide damage: transgenic corn event DBN9501 has a 0% damage rate under glufosinate herbicide (800g a.i./ha) treatment; thus, transgenic corn event DBN9501 has good glufosinate herbicide tolerance.

In terms of yield: the yield of the transgenic corn event DBN9501 is not obviously different under the conditions that no spraying and 800g a.i./ha glufosinate-ammonium treatment are carried out, and the yield of the transgenic corn event DBN9501 is slightly increased after the glufosinate-ammonium herbicide is sprayed, so that the transgenic corn event DBN9501 is further proved to have good tolerance to the glufosinate-ammonium herbicide.

Seventh embodiment

Such as agricultural or commodity products can be produced from transgenic corn event DBN9501. If a sufficient amount of expression is detected in the agricultural product or commodity, the agricultural product or commodity is expected to contain a nucleotide sequence that is diagnostic for the presence of transgenic corn event DBN9501 material in the agricultural product or commodity. Such agricultural or commercial products include, but are not limited to, corn oil, corn meal, corn flour, corn gluten, corn tortillas, corn starch, and any other food product intended for consumption by an animal as a food source, or otherwise for cosmetic use as an ingredient in a bulking or cosmetic composition, and the like. A nucleic acid detection method and/or kit based on a probe or primer pair, wherein the probe sequence or primer sequence is selected from the group consisting of the sequences shown as SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQ ID NO 5 or portions thereof, can be developed to detect a nucleotide sequence derived from transgenic corn event DBN9501, such as shown as SEQ ID NO 1 or SEQ ID NO 2, in a biological sample to diagnose the presence of transgenic corn event DBN9501.

In conclusion, the transgenic corn event DBN9501 has good resistance to lepidoptera insects, high tolerance to glufosinate herbicide and no influence on yield, and the detection method can accurately and quickly identify whether a biological sample contains the DNA molecule of the transgenic corn event DBN9501.

The seeds corresponding to the transgenic corn event DBN9501 have been deposited in the general microbiological culture collection center of the chinese microbiological culture collection management committee (CGMCC for short, address: north cheng west way 1, 3, institute of microbiology, china academy of sciences, zip code 100101) in 2019, 23.1.2019 under budapest treaty, and are classified and named: the preservation number of the corn (Zea mays) is CGMCC No.17099. The deposit will be preserved at the depository for 30 years.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Beijing Dabei agricultural Biotechnology Limited

<120> nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof

<130> DBNBC145

<160> 31

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> DBN9501 has a Sequence of 22 nucleotides in length (Artificial Sequence) located near the junction site of insertion at the 5' end of the insertion Sequence

<400> 1

ggggaaaagt taataacaca tt 22

<210> 2

<211> 22

<212> DNA

<213> DBN9501 has a Sequence of 22 nucleotides in length (Artificial Sequence) located near the junction site of insertion at the 3' end of the insertion Sequence

<400> 2

gtttaaacta tcagtgtaac ta 22

<210> 3

<211> 768

<212> DNA

<213> DBN9501 has a Sequence of 768 nucleotides in length (Artificial Sequence) located near the insertion junction at the 5' end of the insertion Sequence

<400> 3

tgtccggcat acctgttcat catttaaata atctaacacg gagtgtcctt tcttgagtga 60

cgcgccaaac ggtgtacttc tgttgtttct tgagtgacat aaaatggtgt acttctatta 120

cctaaggcat aattctaatt tataaagaga aggtaataca gccacaaatt agtaacatct 180

aagcaaatac agcactgctt ctggaaattt tatcatctat attcagtaag ctaaacccag 240

ccactattaa gtttcatgat tttatcatat gaaaaaaaaa tccaaagaaa ccatacggtt 300

atcaaaaact tagaaaaaca ggatgccttt ttgccaaagg gatttgatag acctttattt 360

ttcaggaaaa acaggggaaa agttaataac acattgcgga tacggccagg cgcgtccctg 420

ttaacgtcct aactagctaa actaggtaca gattgcgagg ctcacgaggc gatcctggcc 480

gcgtgacagt cgcgtgcgag gctcttgact aagtaggcgg ccgcgtgcac ttaattaaga 540

attccctgca gggatctagt aacatagatg acaccgcgcg cgataattta tcctagtttg 600

cgcgctatat tttgttttct atcgcgtatt aaatgtataa ttgcgggact ctaatcataa 660

aaacccatct cataaataac gtcatgcatt acatgttaat tattacatgc ttaacgtaat 720

tcaacagaaa ttatatgata atcatcgcaa gaccggcaac aggattca 768

<210> 4

<211> 1339

<212> DNA

<213> DBN 9501A 1339-nucleotide long Sequence (Artificial Sequence) located near the junction site of insertion at the 3' end of the insertion Sequence

<400> 4

caatcggacc atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt 60

ccacgatgct cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt 120

caacgatggc ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca 180

ctatcttcac aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata 240

ttaccctttg ttgaaaagtc tcaatcggac caagcttatt taaatggtac cttaattaag 300

tgcacgttta aactacctag tcagtgccgt tgagagcgta gctgcgactt agcggcctcg 360

tctgcgaagt cggtgaggct agtgccacta attagtcatt agtttaatac aaatccacct 420

gcggccaatt cctgcagcgt tgcggttctg tcagttccaa acgtaaaacg gcttgtcccg 480

cgtcatcggc gggggtcata acgtgactcc cttaattctc cgctcatgat cagattgtcg 540

tttcccgcct tcagtttaaa ctatcagtgt aactataaat ggtatagtag tccggatttt 600

gtttccgaat aaagaaatgt tcaatgtatt tgaaatgatc aatagatact caaattatat 660

gattagcaag cttaaataga gttttttttt caggtccatt tcttttcctt agattacaga 720

agcaccataa cacattccaa aagtaattgc atgcacccaa gaatctgcta atgttccaag 780

tgttgaaaac aaccaaaact gtacttatca cttaatgaaa tacatggcac aaacaaaaaa 840

aaaaactgaa tatgcctgcg aacatagcag aagtggttgt catgtactag aaacattatt 900

gtgtcttcga acaagctgct catataatgg aagatggttc tttgcaacaa aaaccctgaa 960

cctgtaaagc aaatgagaag gacaattaag cataaataaa ggtgcaataa cacaagggaa 1020

caaaccacta aaccaatgtt ttaaagttgc ccgactaatc gtgattactc aaccttattg 1080

cagcacgatt aggattaggc tgtacgacac gactagggtg attagaactc ggatcgtctg 1140

actaatcatg attaaacggt gattagtcat cggactagga gttcaaccca ctaacctgag 1200

ccgcctgact ttttttttgg gccggaccac agtgggtaag gtttttttat tttctcttga 1260

caaaaccctg tctgccctag gatacgaacg tatcatgtac ctacagccga cggctccagt 1320

tcgcggcttt cctcctatc 1339

<210> 5

<211> 8559

<212> DNA

<213> entire T-DNA Sequence, maize genomic flanking Sequence at 5 'and 3' ends (Artificial Sequence)

<400> 5

tgtccggcat acctgttcat catttaaata atctaacacg gagtgtcctt tcttgagtga 60

cgcgccaaac ggtgtacttc tgttgtttct tgagtgacat aaaatggtgt acttctatta 120

cctaaggcat aattctaatt tataaagaga aggtaataca gccacaaatt agtaacatct 180

aagcaaatac agcactgctt ctggaaattt tatcatctat attcagtaag ctaaacccag 240

ccactattaa gtttcatgat tttatcatat gaaaaaaaaa tccaaagaaa ccatacggtt 300

atcaaaaact tagaaaaaca ggatgccttt ttgccaaagg gatttgatag acctttattt 360

ttcaggaaaa acaggggaaa agttaataac acattgcgga tacggccagg cgcgtccctg 420

ttaacgtcct aactagctaa actaggtaca gattgcgagg ctcacgaggc gatcctggcc 480

gcgtgacagt cgcgtgcgag gctcttgact aagtaggcgg ccgcgtgcac ttaattaaga 540

attccctgca gggatctagt aacatagatg acaccgcgcg cgataattta tcctagtttg 600

cgcgctatat tttgttttct atcgcgtatt aaatgtataa ttgcgggact ctaatcataa 660

aaacccatct cataaataac gtcatgcatt acatgttaat tattacatgc ttaacgtaat 720

tcaacagaaa ttatatgata atcatcgcaa gaccggcaac aggattcaat cttaagaaac 780

tttattgcca aatgtttgaa cgatcactag ttcagatctg ggtaactggc ctaactggcc 840

ttggaggagc tggcaactca aaatcccttt gccaaaaacc aacatcatgc catccaccat 900

gcttgtatcc agctgcgcgc aatgtacccc gggctgtgta tcccaaagcc tcatgcaacc 960

taacagatgg atcgtttgga aggcctataa cagcaaccac agacttaaaa ccttgcgcct 1020

ccatagactt aagcaaatgt gtgtacaatg tggatcctag gcccaacctt tgatgcctat 1080

gtgacacgta aacagtactc tcaactgtcc aatcgtaagc gttcctagcc ttccagggcc 1140

cagcgtaagc aataccagcc acaacaccct caacctcagc aaccaaccaa gggtatctat 1200

cttgcaacct ctctagatca tcaatccact cttgtggtgt ttgtggctct gtcctaaagt 1260

tcactgtaga cgtctcaatg taatggttaa cgatatcaca aaccgcggcc atatcagctg 1320

ctgtagctgg cctaatctca actggtctcc tctccggaga catggtaccc tgcagaagta 1380

acaccaaaca acagggtgag catcgacaaa agaaacagta ccaagcaaat aaatagcgta 1440

tgaaggcagg gctaaaaaaa tccacatata gctgctgcat atgccatcat ccaagtatat 1500

caagatcaaa ataattataa aacatacttg tttattataa tagataggta ctcaaggtta 1560

gagcatatga atagatgctg catatgccat catgtatatg catcagtaaa acccacatca 1620

acatgtatac ctatcctaga tcgatatttc catccatctt aaactcgtaa ctatgaagat 1680

gtatgacaca cacatacagt tccaaaatta ataaatacac caggtagttt gaaacagtat 1740

tctactccga tctagaacga atgaacgacc gcccaaccac accacatcat cacaaccaag 1800

cgaacaaaaa gcatctctgt atatgcatca gtaaaacccg catcaacatg tatacctatc 1860

ctagatcgat atttccatcc atcatcttca attcgtaact atgaatatgt atggcacaca 1920

catacagatc caaaattaat aaatccacca ggtagtttga aacagaattc tactccgatc 1980

tagaacgacc gcccaaccag accacatcat cacaaccaag acaaaaaaaa gcatgaaaag 2040

atgacccgac aaacaagtgc acggcatata ttgaaataaa ggaaaagggc aaaccaaacc 2100

ctatgcaacg aaacaaaaaa aatcatgaaa tcgatcccgt ctgcggaacg gctagagcca 2160

tcccaggatt ccccaaagag aaacactggc aagttagcaa tcagaacgtg tctgacgtac 2220

aggtcgcatc cgtgtacgaa cgctagcagc acggatctaa cacaaacacg gatctaacac 2280

aaacatgaac agaagtagaa ctaccgggcc ctaaccatgg accggaacgc cgatctagag 2340

aaggtagaga gggggggggg gggaggacga gcggcgtacc ttgaagcgga ggtgccgacg 2400

ggtggatttg ggggagatct ggttgtgtgt gtgtgcgctc cgaacaacac gaggttgggg 2460

aaagagggtg tggagggggt gtctatttat tacggcgggc gaggaaggga aagcgaagga 2520

gcggtgggaa aggaatcccc cgtagctgcc ggtgccgtga gaggaggagg aggccgcctg 2580

ccgtgccggc tcacgtctgc cgctccgcca cgcaatttct ggatgccgac agcggagcaa 2640

gtccaacggt ggagcggaac tctcgagagg ggtccagagg cagcgacaga gatgccgtgc 2700

cgtctgcttc gcttggcccg acgcgacgct gctggttcgc tggttggtgt ccgttagact 2760

cgtcgacggc gtttaacagg ctggcattat ctactcgaaa caagaaaaat gtttccttag 2820

tttttttaat ttcttaaagg gtatttgttt aatttttagt cactttattt tattctattt 2880

tatatctaaa ttattaaata aaaaaactaa aatagagttt tagttttctt aatttagagg 2940

ctaaaataga ataaaataga tgtactaaaa aaattagtct ataaaaacca ttaaccctaa 3000

accctaaatg gatgtactaa taaaatggat gaagtattat ataggtgaag ctatttgcaa 3060

aaaaaaagga gaacacatgc acactaaaaa gataaaactg tagagtcctg ttgtcaaaat 3120

actcaattgt cctttagacc atgtctaact gttcatttat atgattctct aaaacactga 3180

tattattgta gtactataga ttatattatt cgtagagtaa agtttaaata tatgtataaa 3240

gatagataaa ctgcacttca aacaagtgtg acaaaaaaaa tatgtggtaa ttttttataa 3300

cttagacatg caatgctcat tatctctaga gaggggcacg accgggtcac gctgcactgc 3360

aggccctagg atttaagtga ctagggtcac gtgactctag tcacttactg gcgcgccgat 3420

ctagtaacat agatgacacc gcgcgcgata atttatccta gtttgcgcgc tatattttgt 3480

tttctatcgc gtattaaatg tataattgcg ggactctaat cataaaaacc catctcataa 3540

ataacgtcat gcattacatg ttaattatta catgcttaac gtaattcaac agaaattata 3600

tgataatcat cgcaagaccg gcaacaggat tcaatcttaa gaaactttat tgccaaatgt 3660

ttgaacgatc tcacttgatg ctcacgtcgt aaaaatgaac aatggggccg ccgtagaggt 3720

tattcccttg ggacagttcg atataaaagt tgtccttctc aaacttcgtg gtgaacattt 3780

ctgacacatc cttagcgcca gacatgtatc tcttctcgaa gaggacttcc cgcgagttcc 3840

tgatgcgcac attcgcgtcg ccggaaactg aaaaatagac tctgtaggta gagaacgaat 3900

ccagttggag gttctgcttc agaatgcctc tcccgccctg gtaaagcgtc agggtgttcc 3960

ccgagatatt cgtgctgcca gtggatgtcc agttattggt gttaatcagc tcggggctca 4020

ggagcttctc gctaggggag atttcgagaa tgatgaagtt gtcgccccag gcctcatcgc 4080

cattctggga cttgagaata agatagaccc ccttcaggtc agtgccagtt gtgaacctct 4140

tattgattgt ctggtagtcc tccaggttgt tgttagtatc ttcgtaatgg atgtaccctg 4200

tgttctcatc cttgaggtgg atgcttggct tgcccttcac agtatattga atcacgtatt 4260

ctgtcttcgg cttcagcttg tcgccaatga actgggagat gccaccatcc ttatgcacat 4320

agagcgcctt agtgccattc accccgcctg tgtggtcaac gtatgcgttc ttattgttag 4380

ccttccacgg ttccagatta tcttcctcaa ttgacccgtt ctccacaata ttggagatga 4440

agcctgatgg cggaacgatc agcttcgttt ccttgttaga gaggtcggtg gcaagcagca 4500

gctccctgag gtagctcttg cacgtaaggg tgatcaggcg ggagttctca tctgcctgga 4560

gcccaaagcc attgatgggc gtgaggaagg tctcagaaat gaccccaaga ggcatataca 4620

cgccatcgtc gttcgccgac agggttctgt attcggcctc ggatgattcg accttcttct 4680

tgttgaggtc gatctcgccc gtagacgaat catagaagtt agccgtcacc tcgtaccgga 4740

gtgtcttcat cttcttcgta aagtcaatct tggtgatcac gtattcgttg gggaagacaa 4800

tattgttcgt atagtagatt tgctcggact gatcagggca aagcagctta tccatgtcgc 4860

cgtagataac ctctgacaga gaatccttgt ccacttgata attctgcttg agcttcgcct 4920

cgtagacctt cagcacggta attgagtcgt tagaaatctc gaacccgatg agcgcatggc 4980

caggcttggc ctcaacgatc atctttgcat cttcgtcgga gcccttgacc ttagcgtagt 5040

ttggattaga aaaagtgttc gagagtgtcg gaaggatatt cacgcggaac tcctccttct 5100

ccttgttcag gtgctcgttc atgatggagg tgtaatcgat gtctgcgagg ccgaggagct 5160

tgcggcaggt ggtcagcgtg agaaacgctt gggcctggag tgcggtgagg acgataagga 5220

agttgtaaac attcccgacc tccgagccgc tcgtcttaac gttctccttg gtgatcagtt 5280

ccgatgcagt cttgagagcg ctccgcccaa aaagattgtt gcccaccata acgtcgtgga 5340

acgtgttcag gtaaaactcg aagccatcga cgtcattctt ggtcacggac ttcgccagct 5400

cagtgagttc tgtaagctca tccaggatgt cggctggtga gccatccttc ttgaccttgc 5460

tggaagtttc tgtagcaaaa gtgagttcct cgaacttctc attcacatac ttgatcctct 5520

ggtacgccgg tgtaatctcc gtcagggtgc tgttgatgag gacgttcaca ttaatgatat 5580

ccagcttgtc cgagatttct tgaagctgct tgctcagata ctcaatttga agggacagcg 5640

cgtagttctg cttcatgacg tccgagagca tgctagtaat ctttgggagg tacacgcgaa 5700

gcattgtgtt gatggcgtcg agcttattgt tcacatcatt aagaacttgg ttctgctcat 5760

ttgcaatctt gaggatctcc ttagacagtt ctgtgttgag attcccctga gcgatgaggt 5820

cgttaagtga cccattcacg ccgtccagct tgccagagat atcgttcagg agttgctgat 5880

tcttaagaat ctcgtcgagc gtaagatccc cgccagtgtc tgtcttgaag atcatgttca 5940

taatgtcctt gatccccgta gcaaacccat agatgccatt aaagtagtca ataaaggagg 6000

gaagtgcccg tgtggagagc ttggtgttgt tcttgttcat actagtggcc gcttggtatc 6060

tgcattacaa tgaaatgagc aaagactatg tgagtaacac tggtcaacac tagggagaag 6120

gcatcgagca agatacgtat gtaaagagaa gcaatatagt gtcagttggt agatactaga 6180

taccatcagg aggtaaggag agcaacaaaa aggaaactct ttatttttaa attttgttac 6240

aacaaacaag cagatcaatg catcaaaata ctgtcagtac ttatttcttc agacaacaat 6300

atttaaaaca agtgcatctg atcttgactt atggtcacaa taaaggagca gagataaaca 6360

tcaaaatttc gtcatttata tttattcctt caggcgttaa caatttaaca gcacacaaac 6420

aaaaacagaa taggaatatc taattttggc aaataataag ctctgcagac gaacaaatta 6480

ttatagtatc gcctataata tgaatcccta tactattgac ccatgtagta tgaagcctgt 6540

gcctaaatta acagcaaact tctgaatcca agtgccctat aacaccaaca tgtgcttaaa 6600

taaataccgc taagcaccaa attacacatt tctcgtattg ctgtgtaggt tctatcttcg 6660

tttcgtacta ccatgtccct atattttgct gctacaaagg acggcaagta atcagcacag 6720

gcagaacacg atttcagagt gtaattctag atccagctaa accactctca gcaatcacca 6780

cacaagagag cattcagaga aacgtggcag taacaaaggc agagggcgga gtgagcgcgt 6840

accgaagacg gttctgctag agtcagcttg tcagcgtgtc ctctccaaat gaaatgaact 6900

tccttatata gaggaagggt cttgcgaagg atagtgggat tgtgcgtcat cccttacgtc 6960

agtggagata tcacatcaat ccacttgctt tgaagacgtg gttggaacgt cttctttttc 7020

cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag aggcatcttc 7080

aacgatggcc tttcctttat cgcaatgatg gcatttgtag gagccacctt ccttttccac 7140

tatcttcaca ataaagtgac agatagctgg gcaatggaat ccgaggaggt ttccggatat 7200

taccctttgt tgaaaagtct caatcggacc atcacatcaa tccacttgct ttgaagacgt 7260

ggttggaacg tcttcttttt ccacgatgct cctcgtgggt gggggtccat ctttgggacc 7320

actgtcggca gaggcatctt caacgatggc ctttccttta tcgcaatgat ggcatttgta 7380

ggagccacct tccttttcca ctatcttcac aataaagtga cagatagctg ggcaatggaa 7440

tccgaggagg tttccggata ttaccctttg ttgaaaagtc tcaatcggac caagcttatt 7500

taaatggtac cttaattaag tgcacgttta aactacctag tcagtgccgt tgagagcgta 7560

gctgcgactt agcggcctcg tctgcgaagt cggtgaggct agtgccacta attagtcatt 7620

agtttaatac aaatccacct gcggccaatt cctgcagcgt tgcggttctg tcagttccaa 7680

acgtaaaacg gcttgtcccg cgtcatcggc gggggtcata acgtgactcc cttaattctc 7740

cgctcatgat cagattgtcg tttcccgcct tcagtttaaa ctatcagtgt aactataaat 7800

ggtatagtag tccggatttt gtttccgaat aaagaaatgt tcaatgtatt tgaaatgatc 7860

aatagatact caaattatat gattagcaag cttaaataga gttttttttt caggtccatt 7920

tcttttcctt agattacaga agcaccataa cacattccaa aagtaattgc atgcacccaa 7980

gaatctgcta atgttccaag tgttgaaaac aaccaaaact gtacttatca cttaatgaaa 8040

tacatggcac aaacaaaaaa aaaaactgaa tatgcctgcg aacatagcag aagtggttgt 8100

catgtactag aaacattatt gtgtcttcga acaagctgct catataatgg aagatggttc 8160

tttgcaacaa aaaccctgaa cctgtaaagc aaatgagaag gacaattaag cataaataaa 8220

ggtgcaataa cacaagggaa caaaccacta aaccaatgtt ttaaagttgc ccgactaatc 8280

gtgattactc aaccttattg cagcacgatt aggattaggc tgtacgacac gactagggtg 8340

attagaactc ggatcgtctg actaatcatg attaaacggt gattagtcat cggactagga 8400

gttcaaccca ctaacctgag ccgcctgact ttttttttgg gccggaccac agtgggtaag 8460

gtttttttat tttctcttga caaaaccctg tctgccctag gatacgaacg tatcatgtac 8520

ctacagccga cggctccagt tcgcggcttt cctcctatc 8559

<210> 6

<211> 190

<212> DNA

<213> Sequence located in SEQ ID NO. 3, spanning the left border region (LB and tNos transcription termination Sequence, art Sequence)

<400> 6

aataacacat tgcggatacg gccaggcgcg tccctgttaa cgtcctaact agctaaacta 60

ggtacagatt gcgaggctca cgaggcgatc ctggccgcgt gacagtcgcg tgcgaggctc 120

ttgactaagt aggcggccgc gtgcacttaa ttaagaattc cctgcaggga tctagtaaca 180

tagatgacac 190

<210> 7

<211> 200

<212> DNA

<213> Sequence located in SEQ ID NO. 4, spanning the pr35S transcription start Sequence and the right border region (RBArtificial Sequence)

<400> 7

tgaaaagtct caatcggacc aagcttattt aaatggtacc ttaattaagt gcacgtttaa 60

actacctagt cagtgccgtt gagagcgtag ctgcgactta gcggcctcgt ctgcgaagtc 120

ggtgaggcta gtgccactaa ttagtcatta gtttaataca aatccacctg cggccaattc 180

ctgcagcgtt gcggttctgt 200

<210> 8

<211> 21

<212> DNA

<213> first primer for amplification of SEQ ID NO:3 (Artificial Sequence)

<400> 8

tgtccggcat acctgttcat c 21

<210> 9

<211> 20

<212> DNA

<213> second primer (Artificial Sequence) for amplifying SEQ ID NO:3

<400> 9

tgaatcctgt tgccggtctt 20

<210> 10

<211> 20

<212> DNA

<213> first primer (Artificial Sequence) for amplifying SEQ ID NO:4

<400> 10

gataggagga aagccgcgaa 20

<210> 11

<211> 21

<212> DNA

<213> second primer (Artificial Sequence) for amplifying SEQ ID NO:4

<400> 11

caatcggacc atcacatcaa t 21

<210> 12

<211> 22

<212> DNA

<213> primers on 5' flanking genomic Sequence (Artificial Sequence)

<400> 12

tgccaaaggg atttgataga cc 22

<210> 13

<211> 20

<212> DNA

<213> primer on T-DNA (Artificial Sequence) paired with SEQ ID NO:12

<400> 13

gccgtatccg caatgtgtta 20

<210> 14

<211> 21

<212> DNA

<213> primers on the 3' flanking genomic Sequence which, when paired with SEQ ID NO:12, can detect whether the transgene is homozygote or heterozygote (Artificial Sequence)

<400> 14

ttttggaatg tgttatggtg c 21

<210> 15

<211> 20

<212> DNA

<213> primer on T-DNA (Artificial Sequence) paired with SEQ ID NO:14

<400> 15

cgttgagagc gtagctgcga 20

<210> 16

<211> 21

<212> DNA

<213> first primer for detecting Vip3Aa19 Gene by Taqman (Artificial Sequence)

<400> 16

cgaatacaga accctgtcgg c 21

<210> 17

<211> 24

<212> DNA

<213> second primer for Taqman detection of Vip3Aa19 Gene (Artificial Sequence)

<400> 17

cgtgaggaag gtctcagaaa tgac 24

<210> 18

<211> 27

<212> DNA

<213> Probe for detecting Vip3Aa19 Gene by Taqman (Artificial Sequence)

<400> 18

cgacgatggc gtgtatatgc ctcttgg 27

<210> 19

<211> 22

<212> DNA

<213> first primer for Taqman detection of pat Gene (Artificial Sequence)

<400> 19

gagggtgttg tggctggtat tg 22

<210> 20

<211> 23

<212> DNA

<213> second primer for Taqman detection of pat Gene (Artificial Sequence)

<400> 20

tctcaactgt ccaatcgtaa gcg 23

<210> 21

<211> 25

<212> DNA

<213> Probe for detecting pat Gene by Taqman (Art Sequence)

<400> 21

cttacgctgg gccctggaag gctag 25

<210> 22

<211> 21

<212> DNA

<213> first primer of maize endogenous gene SSIIb (Artificial Sequence)

<400> 22

cggtggatgc taaggctgat g 21

<210> 23

<211> 23

<212> DNA

<213> second primer of maize endogenous gene SSIIb (Artificial Sequence)

<400> 23

aaagggccag gttcattatc ctc 23

<210> 24

<211> 348

<212> DNA

<213> Probe for Vip3Aa19 Gene in Southern hybridization assay (Artificial Sequence)

<400> 24

tctcaagtcc cagaatggcg atgaggcctg gggcgacaac ttcatcattc tcgaaatctc 60

ccctagcgag aagctcctga gccccgagct gattaacacc aataactgga catccactgg 120

cagcacgaat atctcgggga acaccctgac gctttaccag ggcgggagag gcattctgaa 180

gcagaacctc caactggatt cgttctctac ctacagagtc tatttttcag tttccggcga 240

cgcgaatgtg cgcatcagga actcgcggga agtcctcttc gagaagagat acatgtctgg 300

cgctaaggat gtgtcagaaa tgttcaccac gaagtttgag aaggacaa 348

<210> 25

<211> 310

<212> DNA

<213> Probe for pat Gene in Southern hybridization assay (Artificial Sequence)

<400> 25

cagacttaaa accttgcgcc tccatagact taagcaaatg tgtgtacaat gtggatccta 60

ggcccaacct ttgatgccta tgtgacacgt aaacagtact ctcaactgtc caatcgtaag 120

cgttcctagc cttccagggc ccagcgtaag caataccagc cacaacaccc tcaacctcag 180

caaccaacca agggtatcta tcttgcaacc tctctagatc atcaatccac tcttgtggtg 240

tttgtggctc tgtcctaaag ttcactgtag acgtctcaat gtaatggtta acgatatcac 300

aaaccgcggc 310

<210> 26

<211> 20

<212> DNA

<213> primers on T-DNA in the same orientation as SEQ ID NO:13 (Artificial Sequence)

<400> 26

gcgcgcaaac taggataaat 20

<210> 27

<211> 20

<212> DNA

<213> primers on T-DNA, in the opposite orientation to SEQ ID NO:13, were used to obtain flanking sequences (Art Sequence)

<400> 27

ccagccacaa caccctcaac 20

<210> 28

<211> 22

<212> DNA

<213> primers on T-DNA, in the opposite orientation to SEQ ID NO:13, were used to obtain flanking sequences (Artificial Sequence)

<400> 28

gtggtgtttg tggctctgtc ct 22

<210> 29

<211> 22

<212> DNA

<213> primers on T-DNA in the same orientation as SEQ ID NO:15 (Artificial Sequence)

<400> 29

tgctttgaag acgtggttgg aa 22

<210> 30

<211> 20

<212> DNA

<213> primers on T-DNA, in the opposite orientation to SEQ ID NO:15, were used to obtain flanking sequences (Artificial Sequence)

<400> 30

ctgctccttt attgtgacca 20

<210> 31

<211> 20

<212> DNA

<400> 31

tatcttgctc gatgccttct 20

Claims

1. A nucleic acid molecule having a nucleic acid sequence comprising SEQ ID No.1 or a complement thereof, and/or SEQ ID No. 2 or a complement thereof, said nucleic acid molecule being derived from transgenic corn event DBN9501, said transgenic corn event DBN9501 being deposited with the china general microbiological culture collection center under the accession number CGMCC No.17099 in the form of a seed.

2. The nucleic acid molecule according to claim 1, wherein the nucleic acid sequence comprises SEQ ID No. 3 or the complement thereof, and/or SEQ ID No. 4 or the complement thereof.

3. The nucleic acid molecule of claim 2, wherein the nucleic acid sequence comprises SEQ ID No. 5 or the complement thereof.

4. A method for detecting the presence of DNA of transgenic corn event DBN9501 in a sample, comprising:

contacting a sample to be detected with at least two primers for amplifying a target amplification product in a nucleic acid amplification reaction;

performing a nucleic acid amplification reaction; and

detecting the presence of the target amplification product;

the target amplification product comprises the nucleic acid molecule of any one of claims 1-3;

the transgenic corn event DBN9501 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms in the form of seeds with the preservation number of CGMCC No.17099.

5. The method of claim 4, wherein the amplification product of interest further comprises SEQ ID NO 6 or a complement thereof, and/or SEQ ID NO 7 or a complement thereof.

6. The method of claim 4 or 5, wherein the two primers comprise SEQ ID NO 8 and SEQ ID NO 9, or SEQ ID NO 10 and SEQ ID NO 11.

7. A method for detecting the presence of DNA of transgenic corn event DBN9501 in a sample, comprising:

contacting the sample to be tested with a probe comprising a nucleic acid molecule according to any one of claims 1 to 3;

detecting the hybridization condition of the sample to be detected and the probe;

8. The method of detecting the presence of DNA for transgenic maize event DBN9501 in a sample according to claim 7, wherein the probe further comprises SEQ ID No. 6 or its complement, and/or SEQ ID No. 7 or its complement.

9. The method of claim 7 or 8, wherein at least one of said probes is labeled with at least one fluorophore.

10. A method for detecting the presence of DNA transgenic for maize event DBN9501 in a sample, comprising:

contacting the sample to be detected with a marker nucleic acid molecule comprising a nucleic acid molecule according to any one of claims 1 to 3;

hybridizing the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions;

detecting hybridization between the sample to be detected and the marker nucleic acid molecule, and determining that insect resistance and/or herbicide tolerance is genetically linked to the marker nucleic acid molecule by marker-assisted breeding analysis;

11. The method of claim 10, wherein the marker nucleic acid molecule further comprises SEQ ID NOs 6-11 or complements thereof.

12. A DNA detection kit comprising at least one DNA molecule comprising the nucleic acid molecule of any one of claims 1-3, which can act as one of the DNA primers or probe specific for transgenic corn event DBN9501 or progeny thereof; the transgenic corn event DBN9501 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms in the form of seeds with the preservation number of CGMCC No.17099.

13. The DNA detection kit of claim 12, wherein the DNA molecule further comprises SEQ ID NO. 6 or its complement, and/or SEQ ID NO. 7 or its complement.

14. A method of protecting a corn plant from attack by a target insect inhibited by a Vip3Aa protein, comprising providing in the diet of the target insect at least one transgenic corn plant cell comprising in its genome, in order, SEQ ID No.1, the nucleic acid sequence of SEQ ID No. 5 from positions 553 to 7491 and SEQ ID No. 2, or the sequence set forth in SEQ ID No. 5, the target insect feeding the transgenic corn plant cell being inhibited from further feeding the transgenic corn plant.

15. A method of protecting a corn plant from damage caused by a herbicide or controlling weeds in a field in which the corn plant is planted, comprising applying to the field in which at least one transgenic corn plant comprising in its genome, in order, the nucleic acid sequence of SEQ ID NO 1, position 553 to 7491 of SEQ ID NO 5, and SEQ ID NO 2, or the sequence of SEQ ID NO 5 is planted, an effective amount of a glufosinate herbicide, the transgenic corn plant being tolerant to the glufosinate herbicide.

16. A method of growing a corn plant resistant to a Vip3Aa protein-inhibited target insect and/or tolerant to a glufosinate herbicide, comprising:

planting at least one corn seed, wherein the genome of the corn seed sequentially comprises a nucleic acid sequence shown in SEQ ID NO.1, a nucleic acid sequence from 553 th to 7491 st of the SEQ ID NO. 5 and the nucleic acid sequence shown in SEQ ID NO. 2, or the genome of the corn seed comprises the nucleic acid sequence shown in SEQ ID NO. 5;

growing the corn seed into a corn plant;

(ii) infesting the corn plants with a target insect and/or spraying the corn plants with an effective amount of a glufosinate herbicide, and harvesting plants having reduced plant damage compared to other plants not having the nucleic acid sequence of the specific region;

the nucleic acid sequence of the specific region is a sequence shown in SEQ ID NO.1 and/or SEQ ID NO. 2.

17. The method of growing a maize plant resistant and/or tolerant to glufosinate herbicides against target insects which are inhibited by Vip3Aa protein according to claim 16, wherein the nucleic acid sequence of said specific region is the sequence shown in SEQ ID No. 3 and/or SEQ ID No. 4.

18. A method of producing a maize plant resistant to a Vip3Aa protein-inhibited target insect and/or tolerant to glufosinate herbicide, comprising introducing into a second maize plant the nucleic acid sequence of SEQ ID No.1, 553 to 7491 of SEQ ID No. 5 and SEQ ID No. 2 comprised in succession in the genome of a first maize plant, or the nucleic acid sequence of SEQ ID No. 5 comprised in the genome of said first maize plant, thereby producing a plurality of progeny plants; selecting said progeny plant having a nucleic acid sequence of a particular region, and said progeny plant is resistant to a target insect inhibited by a Vip3Aa protein and/or tolerant to a glufosinate herbicide; the nucleic acid sequence of the specific region is a sequence shown as SEQ ID NO.1 and/or SEQ ID NO. 2.

19. The method of producing a maize plant resistant to a Vip3Aa protein-inhibited target insect and/or tolerant to glufosinate herbicide according to claim 18, wherein the nucleic acid sequence of the specific region is the sequence set forth in SEQ ID No. 3 and/or SEQ ID No. 4.

20. The method of producing a maize plant resistant to a target insect inhibited by a Vip3Aa protein and/or tolerant to glufosinate herbicide according to claim 18 or 19, comprising sexually crossing a transgenic maize event DBN9501 with a maize plant lacking target insect resistance and/or tolerance to glufosinate, thereby producing a plurality of progeny plants, selecting said progeny plants having the nucleic acid sequence of said specific region;

treating the progeny plants with a target insect infestation and/or with glufosinate;

selecting said progeny plants that are resistant to the target insect and/or tolerant to the glufosinate herbicide;

21. An agricultural or commercial product that produces an autogenic corn event DBN9501, wherein the agricultural or commercial product is corn meal, corn flour, corn oil, corn cobs, corn starch, corn gluten, corn tortillas, cosmetics, or bulking agents in the presence of a transgenic corn event DBN 9501; the transgenic corn event DBN9501 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms in the form of seeds with the preservation number of CGMCC No.17099.