CN116640761B

CN116640761B - Transgenic maize event LP018-1 and detection method thereof

Info

Publication number: CN116640761B
Application number: CN202310890063.8A
Authority: CN
Inventors: 吕玉平; 李树秀; 石小堰; 王强; 林黎彦; 陈佳宇
Original assignee: Longping Biotechnology Hainan Co ltd
Current assignee: Longping Biotechnology Hainan Co ltd
Priority date: 2023-07-20
Filing date: 2023-07-20
Publication date: 2023-09-22
Anticipated expiration: 2043-07-20
Also published as: CN116640761A

Abstract

The present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO. 1-7 or a complement thereof, said nucleic acid sequence being derived from transgenic maize event LP018-1, a representative sample of seed comprising said event having been deposited with accession number CCTCC NO. P202313. The transgenic corn event LP018-1 of the present invention not only has good resistance to ingestion by lepidopteran, coleopteran and other pests, but also is tolerant to glyphosate-containing agricultural herbicides. The maize plant with the double characters has the following advantages: the economic loss caused by pests such as lepidoptera and coleopteran is avoided; corn crops that can tolerate the common commercial herbicide glyphosate; the corn yield is not reduced; enhancing breeding efficiency, enabling the use of molecular markers to track transgene inserts in the breeding populations and their offspring. Meanwhile, the detection method provided by the invention can rapidly, accurately and stably identify the existence of the LP018-1 plant material derived from the transgenic corn event.

Description

Transgenic maize event LP018-1 and detection method thereof

Technical Field

The invention belongs to the technical field of molecular biology, relates to a detection method of transgenic plants and products thereof, and in particular relates to a transgenic corn event LP018-1 which is resistant to insects and resistant to glyphosate herbicide application, and a nucleic acid sequence and a method for detecting the transgenic corn LP 018-1.

Background

Corn (Zea mays l.) is the predominant food crop in many parts of the world. Biotechnology has been applied to corn to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in corn production, particularly resistance to lepidopteran insects (e.g., corn borer, cotton bollworm, spodoptera frugiperda, etc.) and coleoptera (western corn rootworm, northern corn rootworm, mexico corn rootworm, etc.). Resistance of maize to lepidopteran and coleopteran insects can be obtained by transgenic methods to express lepidopteran and coleopteran insect resistance genes in maize plants. Another important agronomic trait is herbicide tolerance, particularly glyphosate tolerance. Tolerance to glyphosate herbicide in corn can be achieved by transgenic approaches to express glyphosate herbicide tolerance genes (e.g., epsps) in corn plants.

In addition to the functional gene itself, the choice of regulatory elements and their sequential arrangement are critical for obtaining good transformation events and their technical effects are unpredictable. In addition, the expression of exogenous genes in plants is affected by their insertion into the maize genome, possibly due to the proximity of chromatin structures (e.g., heterochromatin) or transcriptional regulatory elements (e.g., enhancers) to the integration site. For this reason, it is often necessary to screen a large number of events to make it possible to identify events that can be commercialized (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene may vary greatly between events; there may also be differences in the spatial or temporal pattern of expression, such as differences in the relative expression of transgenes between different plant tissues, which differences may be manifested in actual expression patterns that are inconsistent with the expression patterns expected for the transcriptional regulatory elements in the introduced gene construct. Thus, it is often desirable to generate hundreds or thousands of different events and screen those events for a single event having transgene expression levels and patterns that are expected for commercialization purposes. Such transformation events have excellent lepidopteran pest (e.g., asian corn borer, spodoptera frugiperda, cotton bollworm, etc.), coleoptera pest (western corn rootworm, northern corn rootworm, mexico corn rootworm, etc.), and glyphosate herbicide resistance without affecting corn yield, and conventional breeding methods can be used to backcross transgenic traits into other genetic backgrounds by crossing. The progeny produced by this crossing maintains the transgene expression characteristics and trait performance of the original transformant. The application of the strategy mode can ensure reliable gene expression in a plurality of varieties, has stable lepidoptera pests (such as Asian corn borer, spodoptera frugiperda, cotton bollworm and the like), coleoptera pests (western corn rootworm, northern corn rootworm, mexico corn rootworm and the like) and glyphosate herbicide resistance, prevents the varieties from being harmful to main lepidoptera pests and coleoptera pests, has broad-spectrum weed control capability, and can be well suitable for the growth conditions of places.

It would be beneficial to be able to detect the presence of a particular event to determine whether the progeny of a sexual cross contain a gene of interest. In addition, methods of detecting specific events will also help to comply with relevant regulations, such as the need for formal approval and marking of foods derived from recombinant crops prior to their being put on the market. It is possible to detect the presence of the transgene by any well known polynucleotide detection method, such as Polymerase Chain Reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods are generally focused on commonly used genetic elements such as promoters, terminators, marker genes, and the like. Thus, unless the sequence of chromosomal DNA adjacent to the inserted transgenic DNA ("flanking DNA") is known, such a method as described above cannot be used to distinguish between different events, particularly those generated with the same DNA construct. Therefore, it is common today to identify a transgene specific event by PCR using a pair of primers spanning the junction of the inserted T-DNA and flanking DNA, specifically a first primer comprising the flanking sequence and a second primer comprising the inserted sequence.

Disclosure of Invention

The invention aims to provide a transgenic corn event LP018-1, a nucleic acid sequence for detecting corn plant LP018-1 event and a detection method thereof, which can accurately and rapidly identify whether a biological sample contains a DNA molecule of a specific transgenic corn event LP 018-1.

To achieve the above object, the present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO 1-7 (i.e., SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7) or the complement thereof. In some embodiments, the nucleic acid sequence is derived from a plant, seed, or cell comprising transgenic maize event LP018-1, a representative sample of seed comprising said event having been deposited at the chinese typical culture collection (CCTCC, address: eight of the kangaroo university, wuhan university, postal code 430072, wuhan university, wuhan, the city of lakuh) under accession number cctccc No. P202313 for 2023, classification nomenclature: corn (Zea mays l.). In some embodiments, the nucleic acid sequence is an amplicon diagnostic for the presence of transgenic maize event LP 018-1.

In some embodiments of the invention, the invention provides a nucleic acid sequence comprising at least 11 consecutive nucleotides of SEQ ID NO. 3 or a complement thereof and/or at least 11 consecutive nucleotides of SEQ ID NO. 4 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 1 or a complement thereof, and/or SEQ ID NO. 2 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 3 or a complement thereof, and/or SEQ ID NO. 4 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 5 or a complement thereof.

The SEQ ID NO. 1 or the complementary sequence thereof is a sequence with the length of 22 nucleotides, which is positioned near the insertion junction at the 5 '-end of the insertion sequence in the transgenic corn event LP018-1, the SEQ ID NO. 1 or the complementary sequence thereof spans the flanking genomic DNA sequence of the corn insertion site and the DNA sequence at the 5' -end of the insertion sequence, and the existence of the transgenic corn event LP018-1 can be identified by comprising the SEQ ID NO. 1 or the complementary sequence thereof. The SEQ ID NO. 2 or the complementary sequence thereof is a sequence with the length of 22 nucleotides, which is positioned near the insertion junction at the 3 '-end of the insertion sequence in the transgenic corn event LP018-1, the SEQ ID NO. 2 or the complementary sequence thereof spans the DNA sequence at the 3' -end of the insertion sequence and the flanking genomic DNA sequence of the corn insertion site, and the existence of the transgenic corn event LP018-1 can be identified by comprising the SEQ ID NO. 2 or the complementary sequence thereof.

The nucleic acid sequences provided herein can be at least 11 or more contiguous polynucleotides (first nucleic acid sequences) of any portion of the transgene insert sequence in SEQ ID No. 3 or its complement, or at least 11 or more contiguous polynucleotides (second nucleic acid sequences) of any portion of the 5' flanking maize genomic DNA region in SEQ ID No. 3 or its complement. The nucleic acid sequence may further be homologous or complementary to a portion of the SEQ ID NO. 3 comprising the complete SEQ ID NO. 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a pair of DNA primers in a DNA amplification method that produces an amplification product. The presence of transgenic maize event LP018-1 or a progeny thereof can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO. 1. It is well known to those skilled in the art that the first and second nucleic acid sequences need not consist of only DNA, but may include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogs thereof that do not serve as templates for one or more polymerases. Furthermore, the probes or primers described in the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which may be selected from the nucleotides set forth in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5. When selected from the group consisting of the nucleotides set forth in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, the probes and primers may be about 17 to 50 or more consecutive nucleotides in length. The sequence of SEQ ID NO. 3 or its complement is 1129 nucleotides in length near the 5 '-end of the insertion junction in transgenic maize event LP018-1, the SEQ ID NO. 3 or its complement consists of 643 nucleotides of maize flanking genomic DNA sequence (nucleotides 1-643 of SEQ ID NO. 3), 369 nucleotides of pLP018 construct DNA sequence (nucleotides 644-1012 of SEQ ID NO. 3) and 117 nucleotides of the 3' -end DNA sequence of the tNos terminator (nucleotides 1013-1129 of SEQ ID NO. 3), comprising the SEQ ID NO. 3 or its complement can be identified as the presence of transgenic maize event LP 018-1.

The nucleic acid sequence may be at least 11 or more contiguous polynucleotides (third nucleic acid sequence) of any portion of the transgene insert sequence in the SEQ ID NO. 4 or its complement, or at least 11 or more contiguous nucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking maize genomic DNA region in the SEQ ID NO. 4 or its complement. The nucleic acid sequence may further be homologous or complementary to a portion comprising the complete SEQ ID NO. 2 or SEQ ID NO. 4. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, the method of amplifying DNA to produce an amplified product includes a pair of DNA primers. The presence of transgenic maize event LP018-1 or a progeny thereof can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO. 2. The sequence of SEQ ID NO. 4 or its complement is a 825 nucleotide long sequence located near the insertion junction at the 3' end of the insertion sequence in transgenic maize event LP018-1, the SEQ ID NO. 4 or its complement consists of a 53 nucleotide tNos (nopaline synthase) transcription terminator sequence (nucleotides 1-53 of SEQ ID NO. 4), a 183 nucleotide pLP018 construct DNA sequence (nucleotides 54-236 of SEQ ID NO. 4) and a 589 nucleotide maize integration site flanking genomic DNA sequence (nucleotides 237-825 of SEQ ID NO. 4), comprising the SEQ ID NO. 4 or its complement can be identified as the presence of transgenic maize event LP 018-1.

The SEQ ID NO. 5 or its complement is a sequence of 16725 nucleotides in length characterizing transgenic maize event LP018-1, which specifically contains the genomic and genetic elements as shown in Table 1. The presence of transgenic maize event LP018-1 can be identified by inclusion of the SEQ ID NO. 5 or a complement thereof.

Table 1, genome and genetic element contained in SEQ ID NO. 5

The nucleic acid sequence or the complement thereof may be used in a DNA amplification method to produce an amplification product, the presence of transgenic maize event LP018-1 or a progeny thereof in a biological sample being diagnosed by detection of the amplification product; the nucleic acid sequence or its complement can be used in a nucleotide assay to detect the presence of transgenic maize event LP018-1 or a progeny thereof in a biological sample.

The present invention provides a DNA primer pair comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a fragment of SEQ ID No. 5 or a complement thereof and when used in an amplification reaction with DNA comprising a transgenic maize event LP018-1, produce an amplification product of a transgenic maize event LP018-1 in a test sample.

In some embodiments, the first primer is selected from the group consisting of SEQ ID NO. 1 or a complement thereof, SEQ ID NO. 8 or SEQ ID NO. 12; the second primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14.

In some embodiments of the invention, the amplification product comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement.

Further, the amplification product comprises consecutive nucleotides 1 to 11 or 12 to 22 in SEQ ID NO. 1 or its complement, or consecutive nucleotides 1 to 11 or 12 to 22 in SEQ ID NO. 2 or its complement.

Still further, the amplification product comprises SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, or SEQ ID NO. 7 or its complement.

In the above technical scheme, the primer comprises at least one of the nucleic acid sequences. Specifically, the primer comprises a first primer and a second primer, wherein the first primer is selected from SEQ ID NO. 1 or a complementary sequence thereof, SEQ ID NO. 8 or SEQ ID NO. 12, and the second primer is selected from SEQ ID NO. 9 or SEQ ID NO. 13; or the first primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 10 or SEQ ID NO. 15, and the second primer is selected from SEQ ID NO. 11 or SEQ ID NO. 14.

The present invention also provides a DNA probe comprising a fragment of SEQ ID NO. 5 or a complementary sequence thereof, which hybridizes under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO. 1-7 or a complementary sequence thereof and does not hybridize under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from SEQ ID NO. 1-7 or a complementary sequence thereof.

In some embodiments, the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, and SEQ ID NO. 7 or its complement.

In some embodiments, the DNA probe is labeled with a fluorescent group.

In some embodiments, the probe comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement; further, the probe comprises continuous nucleotides at positions 1-11 or 12-22 in SEQ ID NO. 1 or the complementary sequence thereof, or continuous nucleotides at positions 1-11 or 12-22 in SEQ ID NO. 2 or the complementary sequence thereof.

The present invention also provides a marker nucleic acid molecule comprising a fragment of SEQ ID NO. 5 or a complement thereof, which hybridizes under stringent hybridization conditions with a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1-7 or a complement thereof and does not hybridize under stringent hybridization conditions with a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1-7 or a complement thereof.

In some embodiments, the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, and SEQ ID NO. 7 or its complement.

In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement;

in some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides 1-11 or 12-22 of SEQ ID NO. 1 or its complement, or consecutive nucleotides 1-11 or 12-22 of SEQ ID NO. 2 or its complement.

Further, the present invention provides a method of detecting the presence of DNA comprising transgenic maize event LP018-1 in a sample, comprising:

(1) Contacting a sample to be detected with the pair of DNA primers in a nucleic acid amplification reaction;

(2) Performing a nucleic acid amplification reaction;

(3) Detecting the presence of an amplification product;

the amplification product comprises a nucleic acid sequence selected from the group consisting of the sequences SEQ ID NOs 1-7 or the complement thereof, i.e., is indicative of the presence of DNA comprising the transgenic maize event LP018-1 in the test sample.

The invention also provides a method of detecting the presence of DNA comprising transgenic maize event LP018-1 in a sample, comprising:

(1) Contacting a sample to be detected with said DNA probe, and/or said marker nucleic acid molecule;

(2) Hybridizing the sample to be detected with the probe and/or the marker nucleic acid molecule under stringent hybridization conditions;

(3) Detecting hybridization of the sample to be detected with the probe and/or the marker nucleic acid molecule.

The stringent conditions may be hybridization in 6 XSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate) solution at 65℃and then washing the membrane 1 time with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS, respectively.

Wherein hybridization of the sample to be tested and the marker nucleic acid molecule is detected, and further by marker assisted breeding analysis to determine that insect resistance and/or herbicide tolerance is genetically linked to the marker nucleic acid molecule.

The invention also provides a DNA detection kit, comprising: a DNA primer pair that produces an amplicon diagnostic for transgenic maize event LP018-1, a probe specific for SEQ ID NOs 1-7 or a marker nucleic acid molecule specific for SEQ ID NOs 1-7. Specifically, the detection kit comprises the probe, the primer pair or the marker nucleic acid molecule.

In some embodiments, the invention provides a DNA detection kit comprising at least one DNA molecule comprising at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO. 3 or the complement thereof, or at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO. 4 or the complement thereof, which can be used as a DNA primer or probe specific for transgenic maize event LP018-1 or a progeny thereof.

Further, the DNA molecule comprises the continuous nucleotides at positions 1-11 or 12-22 in SEQ ID NO. 1 or the complementary sequence thereof, or the continuous nucleotides at positions 1-11 or 12-22 in SEQ ID NO. 2 or the complementary sequence thereof.

Still further, the DNA molecule comprises a homologous sequence of SEQ ID NO. 1 or a complement thereof, a homologous sequence of SEQ ID NO. 2 or a complement thereof, a homologous sequence of SEQ ID NO. 6 or a complement thereof, or a homologous sequence of SEQ ID NO. 7 or a complement thereof. To achieve the above object, the present invention also provides a plant cell comprising a nucleic acid sequence encoding insect-resistant Cry3Aa, cry3Bb and Cry1Fa proteins, a nucleic acid sequence encoding a glyphosate herbicide tolerance EPSPS protein and a nucleic acid sequence of a specific region comprising the sequence set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO: 7.

The sequences provided by the present invention include the sequences listed in table 2 below:

TABLE 2 related sequences of the invention

The present invention also provides a method of protecting a maize plant from insect infestation comprising providing at least one transgenic maize plant cell in the diet of a target insect, said transgenic maize plant genome comprising in sequence SEQ ID NO. 1, SEQ ID NO. 5, nucleotide sequences at positions 655-16125 and SEQ ID NO. 2; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5; target insects that ingest the transgenic corn plant cells are inhibited from further ingest the corn plant.

The present invention also provides a method of protecting a maize plant from injury caused by a herbicide, planting at least one transgenic maize plant comprising in sequence SEQ ID NO. 1, SEQ ID NO. 5, nucleotide sequences 655-16125 and SEQ ID NO. 2 in the genome of the transgenic maize plant; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5. In some embodiments, the method comprises applying an effective dose of glyphosate herbicide to a field in which at least one transgenic corn plant comprising transgenic corn event LP018-1 is grown.

The present invention also provides a method of controlling weeds in a field in which corn plants are grown, comprising applying to the field in which at least one transgenic corn plant is grown an effective dose of a glyphosate herbicide, said transgenic corn plant comprising in genome in sequence SEQ ID NO. 1, SEQ ID NO. 5, nucleotide sequences 655 to 16125, and SEQ ID NO. 2; or the genome of the transgenic corn plant comprises a sequence shown in SEQ ID NO. 5.

The present invention also provides a method of growing a maize plant that is resistant to insects comprising: planting at least one corn seed, wherein the genome of the corn seed sequentially comprises a nucleic acid sequence of SEQ ID NO. 1, a nucleic acid sequence of 655-16125 of SEQ ID NO. 5 and a nucleic acid sequence of SEQ ID NO. 2; or the genome of the corn seed comprises a sequence shown as SEQ ID NO. 5;

Growing the corn seed into a corn plant;

the corn plants are affected with the target insect and/or sprayed with an effective dose of glyphosate herbicide, and plants are harvested having reduced plant damage compared to other plants not the corn seeds.

In some embodiments, the invention provides a method of culturing a corn plant that is resistant to insects and tolerant to a glyphosate herbicide comprising:

planting at least one corn seed, wherein the genome of the corn seed sequentially comprises a nucleic acid sequence of SEQ ID NO. 1, a nucleic acid sequence of 655-16125 of SEQ ID NO. 5 and a nucleic acid sequence of SEQ ID NO. 2; or the genome of the corn seed comprises a sequence shown as SEQ ID NO. 5;

growing the corn seed into a corn plant;

spraying said corn plants with an effective dose of glyphosate herbicide to harvest plants having reduced plant damage as compared to other plants not said corn seeds, said plants having reduced plant damage also being resistant to insect feeding damage.

In some embodiments, the invention also provides a method of producing a maize plant that is resistant to insects, comprising introducing into the genome of said maize plant a transgenic maize event LP018-1, selecting a maize plant that has reduced plant damage to insect ingestion. In some embodiments, the method comprises: sexual crossing a transgenic corn event LP018-1 first parent corn plant having resistance to an insect with a second parent corn plant lacking insect resistance, thereby producing a plurality of progeny plants; attack the progeny plant with a target insect; selecting said progeny plants having reduced plant damage compared to other plants not having transgenic maize event LP 018-1.

In some embodiments, the invention also provides a method of producing a maize plant that is tolerant to a glyphosate herbicide, comprising introducing into the genome of the maize plant a transgenic maize event LP018-1, selecting a maize plant that is tolerant to glyphosate. In some embodiments, the method comprises: sexual crossing a transgenic corn event LP018-1 first parent corn plant having tolerance to a glyphosate herbicide with a second parent corn plant lacking glyphosate tolerance, thereby producing a plurality of progeny plants; treating said progeny plants with a glyphosate herbicide; selecting said progeny plants that are tolerant to glyphosate.

In some embodiments, the invention also provides a method of producing a corn plant that is resistant to insects and tolerant to glyphosate herbicide application, comprising: transgenic maize event LP018-1 was introduced into the genome of the maize plant and a glyphosate tolerant and insect resistant maize plant was selected. In some embodiments, the methods comprise sexually crossing a glyphosate-tolerant and insect-resistant transgenic corn event LP018-1 first parent corn plant with a second parent corn plant lacking glyphosate tolerance and/or insect resistance, thereby producing a plurality of progeny plants; treating said progeny plants with glyphosate; the progeny plants that are tolerant to glyphosate are also selected to be resistant to insect feeding damage.

The invention also provides a composition produced from transgenic corn event LP018-1, said composition being corn meal, corn flour, corn oil, corn silk or corn starch. In some embodiments, the composition may be an agricultural product or commodity such as corn meal, corn flour, corn oil, corn starch, corn gluten, tortilla, cosmetics, or bulking agent. If sufficient expression is detected in the composition, the composition is expected to contain a nucleic acid sequence capable of diagnosing the presence of transgenic maize event LP018-1 material in the composition. In particular, the compositions include, but are not limited to, corn oil, corn meal, corn flour, corn gluten, tortilla, corn starch, any other food product to be consumed by an animal as a food source, or otherwise used for cosmetic purposes, etc., as an ingredient in an expanding agent or cosmetic composition.

The probe or primer pair-based detection methods and/or kits of the invention can be employed to detect a transgenic maize event LP018-1 nucleic acid sequence, such as shown in SEQ ID NO. 1 or SEQ ID NO. 2, in a biological sample, wherein the probe or primer sequence is selected from the group consisting of the sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, to diagnose the presence of the transgenic maize event LP 018-1.

In conclusion, the transgenic corn event LP018-1 has the dual characteristics of insect resistance and herbicide resistance, and has the following advantages: 1) Is free from economic losses caused by lepidoptera pests (such as Asiatic corn borer, spodoptera frugiperda, cotton bollworm, etc.) and coleoptera pests (Western corn rootworm, northern corn rootworm, mexico corn rootworm, etc.), which are the main pests in corn planting areas; 2) The ability to apply glyphosate-containing agricultural herbicides to corn crops for broad spectrum weed control; 3) The corn yield was not reduced. Specifically, the event LP018-1 of the invention has a medium or high resistance to the target pest, and can lead the pest mortality to reach 100% at most; the herbicide composition has high tolerance to glyphosate herbicide, and can protect plants to ensure that the damage rate is as low as 0% under the condition that the application amount of the glyphosate herbicide is four times of the recommended dosage; and the agronomic characters of the plants containing the event are excellent, and the yield percentage can reach as high as 101 percent. Furthermore, genes encoding insect resistance and glyphosate tolerance traits are linked on the same DNA segment and are present at a single locus in the transgenic maize event LP018-1 genome, which increases breeding efficiency and enables molecular markers to be used to track transgene inserts in the breeding populations and their progeny. Meanwhile, the primer or probe sequence provided in the detection method can generate an amplification product identified as the transgenic corn event LP018-1 or a progeny thereof, and can rapidly, accurately and stably identify the existence of plant materials derived from the transgenic corn event LP 018-1.

Terminology

The following definitions and methods may better define the present invention and instruct those of ordinary skill in the art to practice the present invention, and unless otherwise indicated, terms are understood according to their conventional usage by those of ordinary skill in the art.

The term "maize" refers to maize (Zea mays) and includes all plant varieties that can be mated to maize, including wild maize varieties.

The term "comprising" means "including but not limited to. The "processed product" refers to a product obtained by processing a raw material such as a plant or a seed, for example, a composition.

The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps (plant cones), and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. It is to be understood that parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos and flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny which have been previously transformed with the DNA molecules of the present invention and thus at least partially consist of the transgenic cells.

The term "gene" refers to a nucleic acid fragment that expresses a particular protein, including regulatory sequences preceding (5 'non-coding sequences) and regulatory sequences following (3' non-coding sequences) the coding sequences. "native gene" refers to a gene that is found naturally to have its own regulatory sequences. By "chimeric gene" is meant any gene that is not a native gene, comprising regulatory and coding sequences found in a non-native manner. "endogenous gene" refers to a native gene that is located in its natural location in the genome of an organism. "exogenous gene" is a foreign gene that is present in the genome of an organism and that is not originally present, and also refers to a gene that has been introduced into a recipient cell by a transgenic procedure. The exogenous gene may comprise a native gene or chimeric gene inserted into a non-native organism. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted may be referred to as an "insertion site" or "target site".

"flanking DNA" may comprise genomic or foreign (heterologous) DNA introduced by a transformation process, such as fragments associated with a transformation event, naturally occurring in an organism such as a plant. Thus, flanking DNA may include a combination of native and foreign DNA. In the present invention, a "flanking region" or "flanking sequence" or "genomic border region" or "genomic border sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or more that is immediately upstream or downstream of and adjacent to the initial exogenous inserted DNA molecule. When this flanking region is located downstream, it may also be referred to as a "left border flanking" or a "3 'genomic border region" or a "genomic 3' border sequence", etc. When this flanking region is located upstream, it may also be referred to as a "right-hand border flanking" or a "5 'genomic border region" or a "genomic 5' border sequence", etc.

Transformation procedures that cause random integration of the foreign DNA will result in transformants that contain different flanking regions that each transformant specifically contains. When recombinant DNA is introduced into plants by conventional hybridization, its flanking regions are generally not altered. Transformants will also contain unique junctions between the heterologous insert DNA and segments of genomic DNA or between two segments of heterologous DNA. "ligation" is the point at which two specific DNA fragments are ligated. For example, the junction exists where the insert DNA joins the flanking DNA. The junction point is also present in transformed organisms, where the two DNA fragments are joined together in a manner that modifies what is found in the native organism. "adapter DNA" refers to DNA that contains an adapter.

The present invention provides transgenic corn event LP018-1, i.e., corn plant LP018-1, comprising plants and seeds of transgenic corn event LP018-1 and plant cells thereof or regenerable parts thereof, and progeny thereof, comprising plant parts of transgenic corn event LP018-1, including but not limited to cells, pollen, ovules, flowers, shoots, roots, stems, silks, inflorescences, ears, leaves and products from corn plant LP018-1, such as corn meal, corn oil, corn steep liquor, corn cobs, corn starch and biomass left in the corn crop field.

The transgenic maize event LP018-1 of the invention comprises a DNA construct that, when expressed in a plant cell, confers resistance to insects and tolerance to glyphosate herbicide to the transgenic maize event LP 018-1.

In some embodiments of the invention, the DNA construct comprises four expression cassettes in tandem, the first expression cassette comprising a suitable promoter for expression in a plant operably linked to a nucleic acid sequence of a bacillus thuringiensis insect-resistant Cry3Bb protein (Cry 3 Bb) having coleopteran insect resistance and a suitable polyadenylation signal sequence; the second expression cassette consists of a nucleic acid sequence comprising a suitable promoter for expression in plants operably linked to an insect-resistant Cry3Aa protein (Cry 3 Aa) of bacillus thuringiensis, said Cry3Aa having coleopteran insect resistance, and a suitable polyadenylation signal sequence; the third expression cassette comprises a suitable promoter for expression in plants operably linked to a nucleic acid sequence of a Cry1Fa protein that is predominantly resistant to lepidopteran insects and a suitable polyadenylation signal sequence. The fourth expression cassette comprises a suitable promoter for expression in plants operably linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) and a suitable polyadenylation signal sequence, the nucleic acid sequence of which EPSPS protein is tolerant to glyphosate herbicide. Further, the promoter may be a suitable promoter isolated from plants, including constitutive, inducible, and/or tissue-specific promoters, including, but not limited to, the cauliflower mosaic virus (CaMV) p35S promoter, the Figwort Mosaic Virus (FMV) 35S promoter, the Ubiquitin protein (Ubiquitin) promoter, the Actin (action) promoter, the agrobacterium (Agrobacterium tumefaciens) nopaline synthase (NOS) promoter, the octopine synthase (OCS) promoter, the night yellow leaf curly virus (cestron) promoter, the tuber storage protein (Patatin) promoter, the ribulose-1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) promoter, the Glutathione S Transferase (GST) promoter, the E9 promoter, the GOS promoter, the alcA/alcR promoter, the agrobacterium (Agrobacterium rhizogenes) rod promoter, and the arabidopsis (Arabidopsis thaliana) promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence for functioning in plants, including, but not limited to, polyadenylation signal sequences derived from the Agrobacterium tumefaciens (Agrobacterium tumefaciens) nopaline synthase (NOS) gene, from the cauliflower mosaic virus (CaMV) t35S terminator, from the protease inhibitor II (PIN II) gene, and from the alpha-tubulin (alpha-tubulin) gene.

In addition, the expression cassette may also include other genetic elements including, but not limited to, enhancers and signal peptide/transit peptide nucleic acid coding sequences. The enhancer may enhance the expression level of a gene, including, but not limited to, tobacco Etch Virus (TEV) translational activator, caMV35S enhancer, and FMV35S enhancer. The signal peptide/transit peptide may direct the transit of the EPSPS protein to a specific organelle or compartment outside or inside the cell, for example, targeting to the chloroplast using a sequence encoding a chloroplast transit peptide, or targeting to the endoplasmic reticulum using a 'KDEL' retention sequence.

The cry3Bb, cry3Aa and cry1Fa genes may be isolated from Bacillus thuringiensis (Bacillus thuringiensis, bt for short) and the nucleic acid sequences of the cry3Bb, cry3Aa and cry1Fa genes may be modified by optimizing codons or otherwise for the purpose of increasing the stability and availability of transcripts in transformed cells.

In some embodiments of the invention, a maize cell, seed or plant comprising transgenic maize event LP018-1 comprises in its genome the nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 5, positions 655-16125 and SEQ ID NO. 2, or SEQ ID NO. 5, in that order.

The Lepidoptera, the school name Lepidotera, including moths and butterflies, is one of the most agricultural and forestry pests, such as corn borers, cotton bollworms, oriental armyworms, spodoptera frugiperda, athetis lepigone, and carpopodium borers.

The term Coleoptera is the most widely distributed 1 st order of the class of insects and even of the kingdom animalia. The variety is large and the system is complex. This group of anterior fins keratinized, stiff, and finless, known as "coleopterans". The main pests of corn include western corn rootworm, northern corn rootworm, mexico corn rootworm, etc.

The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene may be isolated from agrobacterium tumefaciens CP4 strain and the polynucleotide encoding the EPSPS gene may be modified by optimizing codons or otherwise for the purpose of increasing the stability and availability of transcripts in transformed cells. The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selectable marker gene.

The term "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with a "glyphosate herbicide" refers to treatment with any herbicide formulation containing glyphosate. The rate of use of a glyphosate formulation is selected to achieve an effective biological dosage that does not exceed the skill of an ordinarily skilled artisan. Treatment of a field containing plant material derived from transgenic corn event LP018-1 with any herbicide formulation containing glyphosate will control weed growth in the field and will not affect the growth or yield of plant material derived from transgenic corn event LP 018-1.

The DNA construct is introduced into a plant using transformation methods including, but not limited to, agrobacterium-mediated transformation, gene gun transformation, and pollen tube channel transformation.

The agrobacterium-mediated transformation method is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border consensus sequences of the vector, i.e., the T-DNA region. The vector is transformed into an agrobacterium cell, which is subsequently used to infect plant tissue, and the T-DNA region of the vector comprising exogenous DNA is inserted into the plant genome.

The gene gun transformation method is to bombard plant cells (particle-mediated biolistic transformation) with a vector containing exogenous DNA.

The pollen tube channel transformation method utilizes a natural pollen tube channel (also called pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into embryo sacs through a bead core channel.

After transformation, the transgenic plants must be regenerated from the transformed plant tissue and offspring with the exogenous DNA selected using appropriate markers.

A DNA construct is a combination of DNA molecules that are linked to one another to provide one or more expression cassettes. The DNA construct is in particular a plasmid capable of self-replication in bacterial cells and containing various restriction enzyme sites for the introduction of DNA molecules providing functional genetic elements, i.e. promoters, introns, leader sequences, coding sequences, 3' terminator regions and other sequences. The expression cassette contained in the DNA construct includes the genetic elements necessary to provide for transcription of messenger RNA, and can be designed for expression in prokaryotic or eukaryotic cells. The expression cassette of the invention is designed to be most specifically expressed in plant cells.

A transgenic "event" is obtained by transforming a plant cell with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, inserting into the plant genome by transgenic means to produce a plant population, regenerating the plant population, and selecting a particular plant having the characteristics of being inserted into a particular genomic locus. The term "event" refers to both the original transformant comprising the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny of a sexual cross between a transformant and other species of individuals containing heterologous DNA, even after repeated backcrosses with a backcross parent, the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the hybrid progeny. The term "event" also refers to a DNA sequence from an original transformant that comprises an inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which DNA sequence is expected to be transferred into progeny resulting from sexual crossing of a parental line containing the inserted DNA (e.g., the original transformant and progeny resulting from its selfing) with a parental line not containing the inserted DNA, and which progeny received the inserted DNA comprising the gene of interest.

"recombinant" in the context of the present invention refers to forms of DNA and/or proteins and/or organisms that are not normally found in nature and are therefore produced by manual intervention. Such manual intervention may result in recombinant DNA molecules and/or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two otherwise isolated sequence segments, for example by chemical synthesis or by manipulation of isolated nucleic acid segments by genetic engineering techniques. Techniques for performing nucleic acid manipulations are well known.

The term "transgene" includes any cell, cell line, callus, tissue, plant part or plant, the genotype of which is altered by the presence of a heterologous nucleic acid, and includes the transgene originally so altered as well as progeny individuals produced from the original transgene by sexual crosses or asexual propagation. In the present invention, the term "transgene" does not include genomic (chromosomal or extrachromosomal) alterations by conventional plant breeding methods or naturally occurring events such as random allofertilisation, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

By "heterologous" in the present invention is meant that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule may originate from a first species and be inserted into the genome of a second species. Such molecules are thus heterologous to the host and are artificially introduced into the genome of the host cell.

Culturing transgenic corn event LP018-1 resistant to lepidopteran and coleopteran insects and resistant to glyphosate herbicide can be accomplished by the steps of: first sexual crossing a first parent corn plant consisting of a corn plant grown from a transgenic corn event LP018-1 and progeny thereof obtained by transformation with an expression cassette of the invention resistant to lepidopteran and coleopteran insects and tolerant to glyphosate herbicide, with a second parent corn plant lacking resistance to lepidopteran and coleopteran insects and/or tolerant to glyphosate herbicide, thereby producing a multiplicity of first generation progeny plants; progeny plants that are resistant to attack by lepidopteran and coleopteran insects and/or tolerant to the glyphosate herbicide are then selected, and corn plants that are resistant to lepidopteran and coleopteran insects and tolerant to the glyphosate herbicide can be grown. These steps may further include backcrossing a progeny plant that is lepidopteran and coleopteran insect resistant and/or glyphosate tolerant with the second parent corn plant or the third parent corn plant, and then selecting the progeny plant by infestation with lepidopteran and coleopteran insects, application of a glyphosate herbicide, or by identification of a molecular marker associated with the trait (such as a DNA molecule comprising the junction site identified at the 5 'and 3' ends of the insertion sequence in transgenic corn event LP 018-1), thereby producing a corn plant that is lepidopteran and coleopteran insect resistant and tolerant to the glyphosate herbicide.

It will also be appreciated that two different transgenic plants can also be crossed to produce offspring containing two independent, separately added exogenous genes. Selfing of appropriate offspring can result in offspring plants that are homozygous for both added exogenous genes. Backcrossing of parent plants and outcrossing with non-transgenic plants as previously described are also contemplated, as are asexual propagation.

The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, e.g., a radioisotope, ligand, chemiluminescent agent, or enzyme, can be attached. Such a probe is complementary to one strand of the target nucleic acid, and in the present invention, the probe is complementary to one strand of DNA from the genome of transgenic maize event LP018-1, whether the genomic DNA is from transgenic maize event LP018-1 or seed or plant or seed or extract derived from transgenic maize event LP 018-1. Probes of the present invention include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

The term "primer" is an isolated nucleic acid molecule that binds to a complementary target DNA strand by nucleic acid hybridization, anneals to form a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of the invention relate to their use in the amplification of a target nucleic acid sequence, for example, by the Polymerase Chain Reaction (PCR) or other conventional nucleic acid amplification methods.

Methods of designing and using primers and probes are well known in the art. The DNA molecules comprising the full length or fragments of SEQ ID NOS: 1-7 can be used as primers and probes for detecting transgenic maize event LP018-1 and can be readily designed by one skilled in the art using the sequences provided herein.

The length of the probes and primers is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers hybridize specifically to the target sequence under highly stringent hybridization conditions. Although probes other than the target DNA sequence and maintaining hybridization ability to the target DNA sequence can be designed by conventional methods, it is preferred that the probes and primers of the present invention have complete DNA sequence identity to a contiguous nucleic acid of the target sequence.

Primers and probes based on flanking genomic DNA and insert sequences of the invention may be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from transgenic maize event LP018-1 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises a transgene insert and maize genomic flanking regions, and fragments of the DNA molecule may be used as primers or probes.

The nucleic acid probes and primers of the invention hybridize to a target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic maize event LP018-1 in a sample. The nucleic acid molecule or fragment thereof is capable of specifically hybridizing to other nucleic acid molecules under certain conditions. As used herein, two nucleic acid molecules can be said to specifically hybridize to each other if they are capable of forming antiparallel double-stranded nucleic acid structures. Two nucleic acid molecules are said to be "complements" of one nucleic acid molecule if they exhibit complete complementarity. As used herein, a nucleic acid molecule is said to exhibit "complete complementarity" when each nucleotide of the two molecules is complementary to a corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under conventional "highly stringent" conditions. Deviations from complete complementarity are permissible provided that such deviations do not completely prevent the formation of double-stranded structures by the two molecules. In order to enable a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in sequence to allow the formation of a stable double-stranded structure at the particular solvent and salt concentration employed.

As used herein, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing under highly stringent conditions to the complementary strand of a matching other nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45℃followed by washing with 2.0 XSSC at 50℃are well known to those skilled in the art. For example, the salt concentration in the washing step may be selected from about 2.0 XSSC at low stringency conditions, about 0.2 XSSC at 50℃to high stringency conditions, about 50 ℃. In addition, the temperature conditions in the washing step may be raised from about 22 ℃ at room temperature under low stringency conditions to about 65 ℃ under high stringency conditions. The temperature conditions and salt concentration may both be varied, or one may remain unchanged while the other variable is varied. In particular, a nucleic acid molecule of the invention may specifically hybridize under moderately stringent conditions, e.g., at about 2.0 XSSC and about 65℃to one or more of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7, or to a complement thereof, or to any fragment of the foregoing. More specifically, a nucleic acid molecule of the invention hybridizes specifically under highly stringent conditions to one or more of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7, or to the complement thereof, or to any fragment of the above sequences. In the present invention, preferred marker nucleic acid molecules have SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 or SEQ ID NO. 7 or a sequence complementary thereto, or a fragment of any of the above sequences. Another preferred marker nucleic acid molecule of the invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 or SEQ ID NO. 7 or the complement thereof, or any fragment of the above sequences. SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 and SEQ ID NO. 7 can be used as markers in plant breeding methods to identify offspring of genetic crosses. Hybridization of the probe to the target DNA molecule may be detected by any method known to those skilled in the art, including, but not limited to, fluorescent labels, radiolabels, antibody-based labels, and chemiluminescent labels.

With respect to amplification (e.g., by PCR) of a target nucleic acid sequence using specific amplification primers, "stringent conditions" refer to conditions that allow hybridization of only the primer pair to the target nucleic acid sequence in a DNA thermal amplification reaction, and primers having a wild-type sequence (or its complement) corresponding to the target nucleic acid sequence are capable of binding to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

The term "specific binding (target sequence)" means that under stringent hybridization conditions, the probe or primer hybridizes only to the target sequence in a sample containing the target sequence.

As used herein, "amplified DNA," "amplification product," or "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a maize plant is produced by sexual hybridization with a maize event LP018-1 containing the present invention, or whether a maize sample collected from the field contains a transgenic maize event LP018-1, or a maize extract, such as meal, flour or oil, contains a transgenic maize event LP018-1, DNA extracted from a maize plant tissue sample or extract may be amplified by a nucleic acid amplification method using a primer pair to produce an amplicon diagnostic for the presence of DNA of the transgenic maize event LP 018-1. The primer pair includes a first primer derived from a flanking sequence in the genome of the plant adjacent to the insertion site of the inserted foreign DNA, and a second primer derived from the inserted foreign DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic maize event LP 018-1. The length of the amplicon may range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred fifty nucleotide base pairs, and most preferably plus about four hundred fifty nucleotide base pairs or more.

Alternatively, the primer pair may be derived from flanking genomic sequences flanking the inserted DNA to produce an amplicon comprising the entire inserted nucleic acid sequence. One of the primer pairs derived from the plant genomic sequence may be located at a distance from the inserted DNA sequence that may range from one nucleotide base pair to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in the DNA thermal amplification reaction.

The nucleic acid amplification reaction may be accomplished by any nucleic acid amplification reaction method known in the art, including the Polymerase Chain Reaction (PCR). Various methods of nucleic acid amplification are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22kb genomic DNA and 42kb phage DNA. These methods, as well as other DNA amplification methods in the art, may be used in the present invention. The inserted exogenous DNA sequence and flanking DNA sequences from transgenic maize event LP018-1 may be obtained by amplifying the genome of transgenic maize event LP018-1 using the provided primer sequences, and standard DNA sequencing of PCR amplicons or cloned DNA after amplification.

DNA detection kits based on DNA amplification methods may contain DNA primer molecules that specifically hybridize to target DNA and amplify diagnostic amplicons under appropriate reaction conditions. The kit may provide agarose gel-based detection methods or a number of methods known in the art for detecting diagnostic amplicons. Kits comprising DNA primers homologous or complementary to any portion of the maize genomic region of SEQ ID NO. 3 or SEQ ID NO. 4 and homologous or complementary to any portion of the transgene insertion region of SEQ ID NO. 5 are provided by the invention. In particular, primer pairs identified as useful in DNA amplification methods are SEQ ID NO. 8 and SEQ ID NO. 9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene/genomic region of transgenic maize event LP018-1, wherein the amplicon comprises SEQ ID NO. 1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO. 5.

Amplicons produced by these methods can be detected by a variety of techniques. One of the methods is Genetic Bit Analysis, which designs a DNA oligonucleotide strand that spans the insert DNA sequence and adjacent flanking genomic DNA sequences. The oligonucleotide strand is immobilized in a microwell of a microwell plate, and after PCR amplification of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product can hybridize to the immobilized oligonucleotide strand and serve as a template for a single base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next desired base. The results may be obtained by fluorescence or ELISA-like methods. The signal represents the presence of an insertion/flanking sequence, which indicates that the amplification, hybridization and single base extension reactions were successful.

Another method is Pyrosequencing technology. The method contemplates an oligonucleotide strand spanning the insertion DNA sequence and adjacent genomic DNA binding sites. The oligonucleotide strand and the single stranded PCR product of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences) are hybridized and then incubated with DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine-5' -phosphosulfate and luciferin. dNTPs are added separately and the resulting optical signal is measured. The optical signal represents the presence of an insertion/flanking sequence, which indicates that amplification, hybridization, and single base or multiple base extension reactions were successful.

Fluorescence polarization as described by Chen et al (Genome Res.) 9:492-498, 1999) is also one method that may be used to detect the amplicons of the present invention. The use of this method requires the design of an oligonucleotide strand spanning the insertion DNA sequence and adjacent genomic DNA binding sites. The oligonucleotide strand is hybridized to a single stranded PCR product of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences) and then incubated with DNA polymerase and a fluorescent-labeled ddNTPs. Single base extension results in insertion of ddNTPs. Such an insertion can measure the change in its polarization using a fluorometer. The change in polarization represents the presence of an insertion/flanking sequence, which indicates that amplification, hybridization, and single base extension reactions were successful.

Taqman is described as a method for detecting and quantifying the presence of a DNA sequence, which is described in detail in the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe is designed that spans the intervening DNA sequence and adjacent genomic flanking binding sites, as described below. The FRET probe and PCR primers (one primer in each of the insert sequence and adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage of the fluorescent moiety and the quencher moiety on the FRET probe and release of the fluorescent moiety. The generation of a fluorescent signal is representative of the presence of the insertion/flanking sequences, which indicates that amplification and hybridization were successful.

Suitable techniques for detecting plant material derived from transgenic maize event LP018-1 may also include Southern blot hybridization, northern blot hybridization, and in situ hybridization, based on the hybridization principle. In particular, the suitable technique includes incubating the probe and sample, washing to remove unbound probe and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe, for example, radiolabeled probes can be detected by X-ray exposure and development, or enzymatically labeled probes can be detected by substrate conversion to effect a color change.

Tyangi et al (Nat. Biotech.) 14:303-308, 1996) describe the use of molecular markers in sequence detection. Briefly described, a FRET oligonucleotide probe is designed that spans the intervening DNA sequence and adjacent genomic flanking binding sites. The unique structure of the FRET probe results in it containing a secondary structure that is capable of retaining both the fluorescent moiety and the quenching moiety in close proximity. The FRET probe and PCR primers (one primer in each of the insert sequence and adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe to the target sequence results in a loss of secondary structure of the probe, thereby spatially separating the fluorescent moiety from the quenching moiety, producing a fluorescent signal. The generation of a fluorescent signal is representative of the presence of the insertion/flanking sequences, which indicates that amplification and hybridization were successful.

Other described methods, such as microfluidics (microfluidics), provide methods and apparatus for isolating and amplifying DNA samples. The photodyes are used to detect and determine specific DNA molecules. A nano tube (nano tube) device comprising an electronic sensor for detecting DNA molecules or a nano bead binding to a specific DNA molecule and thus being detectable is useful for detecting the DNA molecules of the invention.

DNA detection kits may be developed using the compositions of the present invention and methods described in or known to the DNA detection arts. The kit facilitates the identification of the presence or absence of DNA from transgenic corn event LP018-1 in a sample, and can also be used to cultivate corn plants containing DNA from transgenic corn event LP 018-1. The kit may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO. 1, 2, 3, 4 or 5, or other DNA primers or probes homologous to or complementary to DNA contained in the transgenic genetic element of DNA, which DNA sequences may be used in DNA amplification reactions or as probes in DNA hybridization methods.

The DNA structure of the transgene insert contained in the corn genome and the binding site to the corn genome illustrated in fig. 1 and table 1 comprises: a maize LP018-1 flanking genomic region located 5' of the transgene insert sequence; a portion of the insert from the right border Region (RB) of agrobacterium; the first expression cassette consists of a cauliflower mosaic virus (CaMV) p35S promoter operably linked to the maize heat shock protein gene HSP70 protein intron (iZmHSP 70), to the insect-resistant Cry3Bb protein of Bacillus thuringiensis (Cry 3 Bb), and to the nopaline synthase transcription terminator (tNos); the second expression cassette consisted of a promoter containing rice pOsAct1 operably linked to the insect resistance gene Cry3Aa (Cry 3 Aa) of Bacillus thuringiensis operably linked to a terminator from the maize In gene (tIn); the third expression cassette consists of the pZmUbi1 promoter of the maize polyubquitin-1 gene operably linked to the insect-resistant Cry1Fa protein of Bacillus thuringiensis (Cry 1 Fa) and operably linked to the ORF25PolyA terminator from Agrobacterium tumefaciens pTi 15955; a fourth expression cassette consists of a figwort mosaic virus (pFMV) pFMV promoter operably linked to a maize heat shock protein intron (iZmHsp 70) and a maize zmcp transit peptide operably linked to a glyphosate tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of an agrobacterium CP4 strain and operably linked to a nopaline synthase transcription terminator (tNos); a portion of the insert from the left border region (LB) of agrobacterium; and the genomic region flanking maize plant LP018-1 at the 3' -end of the transgene insert sequence (SEQ ID NO: 5). In the DNA amplification method, the DNA molecule used as a primer may be any part derived from the transgene insert sequence in transgenic maize event LP018-1 or any part derived from the DNA region of the flanking maize genome in transgenic maize event LP 018-1.

The transgenic corn event LP018-1 may be combined with other transgenic corn varieties, such as herbicide (e.g., glufosinate, dicamba, etc.) tolerant corn, or transgenic corn varieties carrying other insect resistance genes (e.g., chafer, grub, diabrotica, etc.). Various combinations of all of these different transgenic events, when bred with transgenic maize event LP018-1 of the present invention, can provide improved hybrid transgenic maize varieties that are resistant to multiple pests and tolerant to multiple herbicides. These varieties may exhibit superior characteristics such as yield enhancement compared to non-transgenic varieties and transgenic varieties of single trait.

The present invention provides transgenic corn event LP018-1, a nucleic acid sequence for detecting a corn plant comprising the event, and methods of detecting the same, the transgenic corn event LP018-1 being resistant to ingestion damage by lepidopteran and coleopteran pests and tolerant to the phytotoxic effects of glyphosate-containing agricultural herbicides. The dual trait maize plants express the Cry3Bb, cry3Aa, and Cry1Fa proteins of bacillus thuringiensis, which provide resistance to feeding injury to lepidopteran (e.g., asian corn borer, spodoptera frugiperda) and coleoptera (e.g., western corn rootworm, northern corn rootworm) pests; and which expresses a glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of agrobacterium strain CP4, which confers on plants tolerance to glyphosate.

Drawings

FIG. 1 is a schematic structural diagram of a transgene insert sequence and a maize genomic binding site for detecting a nucleic acid sequence of maize plant LP018-1 and a method of detecting the same according to the present invention;

FIG. 2 is a schematic diagram showing the structure of a recombinant expression vector pLP018 used for detecting a nucleic acid sequence of maize plant LP018-1 and a detection method thereof according to the present invention;

FIG. 3 is a graph of the in vitro resistance effect of transgenic corn comprising transgenic corn event LP018-1 of the present invention on lepidopteran pests;

FIG. 4 is a graph showing the effect of the transgenic corn comprising transgenic corn event LP018-1 of the present invention on Asian corn borer field artificial inoculation during the cotyledonary stage;

FIG. 5 is a graph of the field effect of transgenic corn comprising transgenic corn event LP018-1 of the present invention under spodoptera frugiperda naturally occurring conditions;

FIG. 6 is a plot of the field effect of the recommended spray concentration of transgenic corn of the invention comprising transgenic corn event LP018-1 in a field sprayed with 4-fold doses of glyphosate herbicide.

Detailed Description

The nucleic acid sequence of the present invention for detecting maize plants LP018-1 and the method for detecting the same are further described below by way of specific examples.

EXAMPLE 1 cloning and transformation

1.1 vector cloning

The recombinant expression vector pLP018 (shown in FIG. 2) was constructed using standard gene cloning techniques. The vector pLP018 comprises 4 tandem transgenic expression cassettes, the first consisting of a cauliflower mosaic virus (CaMV) p35S promoter operably linked to the maize heat shock protein gene HSP70 protein intron (iZmHSP 70), operably linked to the bacillus thuringiensis insect-resistant Cry3Bb protein (Cry 3 Bb), and operably linked to the nopaline synthase transcription terminator (tNos); the second expression cassette consisted of a promoter containing rice pOsAct1 operably linked to the insect resistance gene Cry3Aa (Cry 3 Aa) of Bacillus thuringiensis operably linked to a terminator from the maize In gene (tIn); the third expression cassette consists of the pZmUbi1 promoter of the maize polyubquitin-1 gene operably linked to the insect-resistant Cry1Fa protein of Bacillus thuringiensis (Cry 1 Fa) and operably linked to the ORF25PolyA terminator from Agrobacterium tumefaciens pTi 15955; the fourth expression cassette consisted of a Figwort Mosaic Virus (FMV) pFWV promoter operably linked to maize heat shock protein intron (iZmHsp 70) and maize zmcp transit peptide, to glyphosate tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of agrobacterium CP4 strain, and to the transcription terminator (tNos) of nopaline synthase. The vector pLP018 was transformed into Agrobacterium LBA4404 (Invitrogen, chicago, USA; cat. No. 18313-015) by liquid nitrogen method, and the transformed cells were screened using 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) as a selection marker.

1.2 plant transformation

Transformation was performed using conventional agrobacterium infection, and aseptically cultured maize (AX 808 variety) young embryos were co-cultured with agrobacterium as described in this example 1.1 to transfer T-DNA in the constructed recombinant expression vector pLP018 into the maize chromosome bank to generate transgenic maize events.

For agrobacterium-mediated maize transformation, briefly, immature young embryos are isolated from maize, the young embryos are contacted with an agrobacterium suspension, wherein the agrobacterium is capable of transferring the nucleic acid sequences of cry3Bb, cry3Aa, and cry1Fa genes and the nucleic acid sequence of epsps genes to at least one cell of one of the young embryos (step 1: an infestation step) in which the young embryos are immersed in a suspension of agrobacteria (OD 660 = 0.4-0.6), in a infestation medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, ph 5.3) to initiate inoculation, in a period of time (3 days) after the infestation step (step 2: co-cultivation step) in particular, the young embryos are cultivated after the infestation step on a solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, agar 8g/L, ph 5.8) in a period of co-cultivation in which the young embryos can be recovered in a selective recovery medium (MS salt 4.3 g/3 mg, 2, 35 g/L) of 2, 4-dichlorophenoxyacetic acid, pH 5.8) at least one antibiotic known to inhibit the growth of agrobacterium (cephalosporin), without the addition of a selection agent for plant transformants (step 3: and (5) a recovery step). Specifically, young embryos are cultured on solid medium with antibiotics but no selection agent to eliminate agrobacterium and provide a recovery period for the infected cells. The inoculated chick embryos are then cultured on a medium containing a selection agent (N- (phosphonomethyl) glycine) and the growing transformed calli are selected (step 4: selection step). Specifically, the young embryos are cultured on a selective solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, N- (phosphonomethyl) glycine 0.25mol/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, plant gel 3g/L, pH 5.8) with a selective agent, resulting in selective growth of the transformed cells. Then, the callus is regenerated into plants (step 5: regeneration step), specifically, the callus grown on the medium containing the selection agent is cultured on solid medium (MS differentiation medium and MS rooting medium) to regenerate the plants.

The selected resistant calli were transferred to MS differentiation medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyl adenine 2mg/L, N- (phosphonomethyl) glycine 0.125mol/L, plant gel 3g/L, pH=5.8) and cultured at 25 ℃. The differentiated plantlets were transferred to the MS rooting medium (MS salt 2.15 g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH=5.8), cultured to about 10cm high at 25℃and transferred to a greenhouse for cultivation until set. In the greenhouse, the cells were cultured at 28℃for 16 hours and at 20℃for 8 hours each day.

1.3 identification and screening of transgenic events

A total of 3000 independent transgenic T0 individuals were generated. Through means of multi-generation agronomic trait screening, insect resistance screening, copy number screening and the like, the method obtains the single-copy LP018-1 with good agronomic trait performance, high resistance to corn borer, spodoptera frugiperda and other pests and high glyphosate resistance.

Example 2 detection of transgenic maize event LP018-1 Using TaqMan

About 100mg of leaf of transgenic maize event LP018-1 was taken as a sample, its genomic DNA was extracted by Qiagen DNeasyPlant Maxi Kit and the copy numbers of cry3Bb, cry3Aa, cry1Fa and epsps were detected by Taqman probe fluorescent quantitative PCR. Meanwhile, wild-type maize plants (non-transgenic, transformed recipients) were used as controls for detection analysis as described above. Experiments were repeated 3 times and averaged.

The specific method comprises the following steps:

step 1, taking 100mg of leaves of transgenic corn event LP018-1, grinding into homogenates in a mortar by using liquid nitrogen, and taking 3 repeats of each sample;

step 2, extracting genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, wherein the specific method refers to the product instruction;

step 3, determining the concentration of the genomic DNA of the sample by using NanoDrop 2000 (Thermo Scientific);

step 4, adjusting the concentration of the genome DNA of the sample to the same concentration value, wherein the concentration value ranges from 80 ng/mu l to 100 ng/mu l;

step 5, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with the identified known copy number as a standard substance, taking the sample of the wild type corn plant as a control, repeating each sample for 3 times, and taking the average value; the fluorescent quantitative PCR primer and the probe sequences are respectively as follows:

the following primers and probes were used to detect cry3Bb gene sequences:

primer 1: CACCTTTGTAACGCCCAGGTA, as shown in SEQ ID NO. 16 of the sequence Listing;

primer 2: CTATCGCCAACACCGATGTG, as shown in SEQ ID NO. 17 of the sequence Listing;

probe 1: ACCTTCCCATTCGGCCAGGCA, as shown in SEQ ID NO. 18 of the sequence Listing;

the following primers and probes were used to detect cry3Aa gene sequences:

Primer 3: CAGGGCCTCCAGAACAATGT, as shown in SEQ ID NO 19 of the sequence Listing;

primer 4: GCGCGGCTGGGTTCTT, as shown in SEQ ID NO. 20 of the sequence Listing;

probe 2: AGGACTACGTTTCTGCGCTGTCCAGCT, as shown in SEQ ID NO. 21 of the sequence Listing;

the following primers and probes were used to detect cry1Fa gene sequence:

primer 5: GCTATGTCCAGTCCCCAACCT, as shown in SEQ ID NO. 22 of the sequence Listing;

primer 6: CAAGCTGCTAACCTGCACTTGT, as shown in SEQ ID NO. 23 of the sequence Listing;

probe 3: CCCAAACGACACAGCGTCGCG, as shown in SEQ ID NO. 24 of the sequence Listing;

the following primers and probes were used to detect the epsps gene sequence:

primer 7: GCAAATCCTCTGGCCTTTCC, as shown in SEQ ID NO. 25 of the sequence Listing;

primer 8: TGAAGGACCGGTGGGAGAT, as shown in SEQ ID NO. 26 of the sequence Listing;

probe 4: CGTCCGCATTCCCGGCGA, as shown in SEQ ID NO 27 of the sequence Listing;

the PCR reaction system is that

The 50 Xprimer/probe mixture contained 45. Mu.L of each primer at a concentration of 1mM, 50. Mu.L of probe at a concentration of 100. Mu.M and 860. Mu.L of 1 XTE buffer, and was stored in amber tubes at 4 ℃.

The PCR reaction conditions were

Data were analyzed using SDS2.3 software (applied biosystems) to obtain a single copy of transgenic maize event LP018-1.

Example 3 transgenic maize event LP018-1 detection

3.1 genomic DNA extraction

DNA extraction according to the conventionally employed CTAB (cetyltrimethylammonium bromide) method: 2 g of tender transgenic corn event LP018-1 leaves are ground into powder in liquid nitrogen, added with 0.5mL of DNA preheated at 65 ℃ to extract CTAB Buffer [20g/L CTAB,1.4M NaCl,100mM Tris-HCl,20mM EDTA (ethylenediamine tetraacetic acid) ], pH-adjusted to 8.0 by NaOH, fully and uniformly mixed, and extracted for 90min at 65 ℃; adding 0.5 volume of phenol and 0.5 volume of chloroform, and mixing the mixture upside down; centrifuging at 12000rpm for 10min; sucking the supernatant, adding 1-time volume of isopropanol, gently shaking the centrifuge tube, and standing at-20deg.C for 30min; further centrifuging at 12000rpm for 10min; collecting DNA to the bottom of the tube; discarding the supernatant, washing the precipitate with 0.5mL of 70% ethanol by volume; centrifuging at 12000rpm for 5min; vacuum pumping or blow-drying in an ultra clean bench; the DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl,1mM EDTA,pH 8.0), and stored at a temperature of-20 ℃.

3.2 analysis of flanking DNA sequences

And (3) carrying out concentration measurement on the extracted DNA sample, so that the concentration of the sample to be measured is between 80 and 100 ng/. Mu.L. Genomic DNA was digested with selected restriction enzymes SpeI, pstI, bssHII (5 'end assay) and SacI, kpnI, xmaI, nheI (3' end assay), respectively. 26.5. Mu.L of genomic DNA, 0.5. Mu.L of the above-selected restriction enzyme and 3. Mu.L of the cleavage buffer were added to each cleavage system, and the cleavage was performed at an appropriate temperature for 1 hour. After the completion of the digestion, 70. Mu.L of absolute ethyl alcohol was added to the digestion system, the mixture was ice-washed for 30min, centrifuged at 12000rpm for 7min, the supernatant was discarded, and the mixture was dried, followed by 8.5. Mu.L of double distilled water (ddH 2O), 1. Mu.L of 10 XT 4 Buffer and 0.5. Mu. L T4 ligase at 4℃overnight. PCR amplification was performed with a series of nested primers to isolate 5 'and 3' transgenes/genomic DNA. Specifically, the isolated 5' transgene/genomic DNA primer combination includes SEQ ID NO. 13, SEQ ID NO. 34 as a first primer, SEQ ID NO. 35, SEQ ID NO. 36 as a second primer, and SEQ ID NO. 13 as a sequencing primer. The isolated 3' transgene/genomic DNA primer combination included SEQ ID NO. 15, SEQ ID NO. 37 as the first primer, SEQ ID NO. 38, SEQ ID NO. 39 as the second primer, SEQ ID NO. 15 as the sequencing primer, and the PCR reaction conditions are shown in Table 3.

The resulting amplicons were electrophoresed on a 2.0% agarose Gel to isolate the PCR reaction, followed by isolation of the fragment of interest from the agarose matrix using the QIAquick Gel extraction kit (catalogue # 28704, qiagen Inc., valencia, CA). The purified PCR product is then sequenced (e.g., ABI prism 377, PE Biosystems, foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR inc., madison, WI).

The 5 'and 3' flanking sequences and the junction sequences were confirmed using standard PCR methods. The 5' flanking sequences and the junction sequences can be confirmed using SEQ ID NO. 8 or SEQ ID NO. 12 in combination with SEQ ID NO. 9, SEQ ID NO. 13 or SEQ ID NO. 34. The 3' flanking sequences and the junction sequences can be confirmed using SEQ ID NO. 11 or SEQ ID NO. 14 in combination with SEQ ID NO. 10, SEQ ID NO. 15 or SEQ ID NO. 37. The PCR reaction system and the amplification conditions are shown in tables 3 and 4. Those skilled in the art will appreciate that other primer sequences may be used to confirm flanking and junction sequences.

DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules as primers and probes for identification of maize plants or seeds derived from transgenic maize event LP 018-1.

It was found that nucleotide 1-643 of SEQ ID NO. 5 shows the maize genomic sequence flanking the right border (5 'flanking sequence) of the insert sequence of transgenic maize event LP018-1 and nucleotide 16137-16725 of SEQ ID NO. 5 shows the maize genomic sequence flanking the left border (3' flanking sequence) of the insert sequence of transgenic maize event LP 018-1. The 5 'junction sequence is set forth in SEQ ID NO. 1 and the 3' junction sequence is set forth in SEQ ID NO. 2.

3.3 PCR zygosity assay

The junction sequence is a relatively short polynucleotide molecule, which is a novel DNA sequence that is diagnostic for DNA of transgenic maize event LP018-1 when detected in a polynucleic acid detection assay. The binding sequence of SEQ ID NO. 1 consists of 11bp each on one side of the T-DNARB region insertion site and the maize genomic DNA insertion site of the transgenic maize event LP018-1, and the binding sequence of SEQ ID NO. 2 consists of 11bp each on the other side of the T-DNALB region insertion site and the maize genomic DNA insertion site of the transgenic maize event LP 018-1. Longer or shorter polynucleotide binding sequences may be selected from SEQ ID NO. 3 or SEQ ID NO. 4. The junction sequences (5 'junction region SEQ ID NO:1, and 3' junction region SEQ ID NO: 2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The junction sequences SEQ ID NO. 6 and SEQ ID NO. 7 are also novel DNA sequences in transgenic maize event LP018-1, which can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic maize event LP018-1 DNA. The sequence of SEQ ID NO. 6 (nucleotides 644-1129 of SEQ ID NO. 3) spans the LP018 construct DNA sequence and the tNos transcription termination sequence, and the sequence of SEQ ID NO. 7 (nucleotides 1-236 of SEQ ID NO. 4) spans the tNos transcription termination sequence and the LP018 construct DNA sequence.

Furthermore, the amplicon is generated by using primers from at least one of SEQ ID NO. 3 or SEQ ID NO. 4, which primers when used in a PCR method generate a diagnostic amplicon for transgenic maize event LP 018-1.

Specifically, a PCR product is generated from the 5 'end of the transgenic insert that is a portion of genomic DNA flanking the 5' end of the T-DNA insert in the genome comprising plant material derived from transgenic maize event LP 018-1. This PCR product contains SEQ ID NO 3. For PCR amplification, primers 11 (SEQ ID NO: 8) hybridizing to the genomic DNA sequence flanking the 5' -end of the transgene insert and primers 12 (SEQ ID NO: 9) located in the transcription termination sequence of the transgene tNos were designed to pair with them.

A PCR product was generated from the 3 'end of the transgenic insert comprising a portion of genomic DNA flanking the 3' end of the T-DNA insert in the genome of plant material derived from transgenic maize event LP 018-1. This PCR product contains SEQ ID NO. 4. For PCR amplification, primers 14 (SEQ ID NO: 11) hybridizing to the genomic DNA sequences flanking the 3 '-end of the transgene insert and primers 13 (SEQ ID NO: 10) of the tNos transcription termination sequence at the 3' -end of the insert were designed to pair with.

The DNA amplification conditions described in tables 3 and 4 can be used in the PCR zygosity assay described above to generate a diagnostic amplicon of transgenic maize event LP 018-1. Detection of the amplicon may be performed by using a Stratagene Robotcycle, MJ Engine, perkin-Elmer9700 or Eppendorf MastercyclerGradien thermocycler, or the like, or by methods and apparatus known to those skilled in the art.

TABLE 3 PCR step and reaction mixtures for identification of 5' transgenic insert/genomic combination region of transgenic maize event LP018-1

Table 4, perkin-Elmer9700 thermal cycler conditions

Mix gently, if there is no thermal cap on the thermocycler, 1-2 drops of mineral oil can be added above each reaction solution. PCR was performed on a Stratagene Robotcycler (Stratagene, la Jolla, calif.), MJ Engine (MJ R-Biorad, hercules, calif.), perkin-Elmer9700 (Perkin Elmer, boston, mass.) or Eppendorf Mastercycler Gradient (Eppendorf, hamburg, germany) thermocycler using the cycling parameters of Table 4. The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a calculated mode. The Perkin-Elmer9700 thermocycler is operated with a ramp rate (ramp speed) set to a maximum value.

The experimental results show that: primers 11 and 12 (SEQ ID NOS: 8 and 9), which when used in a PCR reaction of transgenic maize event LP018-1 genomic DNA, produced an amplification product of 1129bp fragment, and when used in a PCR reaction of untransformed maize genomic DNA and non-LP 018-1 maize genomic DNA, NO fragment was amplified; primers 13 and 14 (SEQ ID NOS: 10 and 11), when used in the PCR reaction of transgenic maize event LP018-1 genomic DNA, produced an amplified product of 825bp fragment, when used in the PCR reaction of untransformed maize genomic DNA and non-LP 018-1 maize genomic DNA, NO fragment was amplified.

The PCR zygosity assay can also be used to identify whether material derived from transgenic maize event LP018-1 is homozygous or heterozygous. Primer 15 (SEQ ID NO: 12), primer 16 (SEQ ID NO: 13) and primer 17 (SEQ ID NO: 14), or primer 16 (SEQ ID NO: 13), primer 17 (SEQ ID NO: 14) and primer 18 (SEQ ID NO: 15) are used in an amplification reaction to generate a diagnostic amplicon of transgenic maize event LP 018-1. The DNA amplification conditions illustrated in tables 5 and 6 can be used in the above-described zygosity assay to generate a diagnostic amplicon of transgenic maize event LP 018-1.

TABLE 5 reaction solution for measuring the bondability

TABLE 6 determination of the bondability Perkin-Elmer9700 thermal cycler conditions

PCR was performed on a Stratagene Robotcycler (Stratagene, la Jolla, calif.), MJ Engine (MJ R-Biorad, hercules, calif.), perkin-Elmer9700 (Perkin Elmer, boston, mass.) or Eppendorf MastercyclerGradient (Eppendorf, hamburg, germany) thermocycler using the cycling parameters of Table 6. The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a calculated mode. The Perkin-Elmer9700 thermocycler is operated with a ramp rate (ramp speed) set to a maximum value.

In the amplification reaction, the biological sample containing the template DNA contained DNA diagnostic for the presence of transgenic maize event LP018-1 in the sample. Or the reaction will produce two different DNA amplicons from a biological sample containing DNA derived from the corn genome that is heterozygous for the allele corresponding to the insert DNA present in transgenic corn event LP 018-1. These two different amplicons would correspond to a first amplicon derived from the wild-type maize genomic locus and a second amplicon diagnostic for the presence of transgenic maize event LP018-1 DNA. Only a corn DNA sample corresponding to a single amplicon of the second amplicon described for the heterozygous genome is generated, the presence of transgenic corn event LP018-1 can be diagnostically determined in the sample, and the sample is generated from a corn seed homozygous for the allele corresponding to the insert DNA present in transgenic corn plant LP 018-1.

It should be noted that the primer pair for transgenic maize event LP018-1 was used to generate an amplicon diagnostic for transgenic maize event LP018-1 genomic DNA. These primer pairs include, but are not limited to, primers 11 and 12 (SEQ ID NOS: 8 and 9), and primers 13 and 14 (SEQ ID NOS: 10 and 11) for use in the DNA amplification method. In addition, a control primer 9 and 10 (SEQ ID NO:28 and SEQ ID NO: 29) for amplifying the maize endogenous gene was included as an intrinsic criterion for the reaction conditions. Analysis of the DNA extract sample of transgenic maize event LP018-1 should include a positive tissue DNA extract control of transgenic maize event LP018-1, a negative DNA extract control derived from non-transgenic maize event LP018-1 and a negative control containing no template maize DNA extract. In addition to these primer pairs, any primer pair from SEQ ID NO. 3 or SEQ ID NO. 4, or the complement thereof, which when used in a DNA amplification reaction, produces an amplicon comprising SEQ ID NO. 1 or SEQ ID NO. 2, respectively, that is diagnostic for tissue derived from transgenic event maize plant LP018-1, may be used. The DNA amplification conditions set forth in tables 3-6 can be used to generate diagnostic amplicons of transgenic maize event LP018-1 using appropriate primer pairs. Extracts that are presumed to contain corn plant or seed DNA comprising transgenic corn event LP018-1, or products derived from transgenic corn event LP018-1, that when tested in a DNA amplification method, produce an amplicon diagnostic for transgenic corn event LP018-1, can be used as templates for amplification to determine the presence of transgenic corn event LP018-1.

Example 4 detection of transgenic maize event LP018-1 by Southern blot hybridization

4.1 DNA extraction for Southern blot hybridization

Southern blot analysis was performed using transformation events homozygous for the T3, T4 generation. Approximately 5 to 10g of plant tissue was ground in liquid nitrogen using a mortar and pestle. Plant tissue was resuspended in 12.5mL extraction buffer a (0.2M Tris ph=8.0, 50mM EDTA,0.25M NaCl,0.1%v/v β -mercaptoethanol, 2.5% w/v polyvinylpyrrolidone) and centrifuged at 4000rpm for 10 min (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5mL of extraction buffer B (0.2M Tris ph=8.0, 50mM EDTA,0.5M NaCl,1%v/v β -mercaptoethanol, 2.5% w/v polyvinylpyrrolidone, 3% myo-aminoacyl, 20% ethanol) and incubated for 30 min at 37 ℃. During the incubation period, the samples were mixed once with a sterile loop. After incubation, an equal volume of chloroform/isoamyl alcohol (24:1) was added, gently mixed by inversion and centrifuged at 4000rpm for 20 minutes. The aqueous layer was collected and centrifuged at 4000rpm for 5 minutes after the addition of 0.54 volume of isopropanol to precipitate the DNA. The supernatant was discarded and the DNA pellet was resuspended in 500. Mu.L TE. To degrade any RNA present, the DNA was incubated with 1. Mu.L of 30mg/mL RNAaseA for 30 min at 37℃and centrifuged at 4000rpm for 5 min, and the DNA was precipitated by centrifugation at 14000rpm for 10 min in the presence of 0.5 volumes of 7.5M ammonium acetate and 0.54 volumes of isopropanol. After discarding the supernatant, the pellet was washed with 500. Mu.L of 70% ethanol and dried and resuspended in 100. Mu.L TE.

4.2 restriction enzyme digestion

DNA concentrations were quantitatively detected using a spectrophotometer or fluorometer (using 1 xTAE and GelRED dyes). In a 100. Mu.L reaction system, 5. Mu.g of DNA was digested each time. Genomic DNA was digested with restriction enzymes MfeI and HindIII, respectively, and partial sequences of cry3Bb, cry3Aa, cry1Fa and epsps on T-DNA were used as probes. For each enzyme, the digestate was incubated at the appropriate temperature overnight. The samples were spun down to a volume of 30 μl using a vacuum centrifugal evaporative concentrator (speed vacuum).

4.3 gel electrophoresis

Bromophenol blue loading dye was added to each sample from this example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide, electrophoretically separated in TBE electrophoresis buffer, and the gel was electrophoresed overnight at 20 volts.

The gel was washed in 0.25M HCl for 15 minutes to depurinate the DNA, then washed with water. Southern blot hybridization was set as follows: in the tray 20 thick dry blotting papers were placed, and 4 thin dry blotting papers were placed thereon. In 0.4M NaOH, 1 sheet of Bao Yinji paper was pre-moistened and placed on the paper stack, followed by 1 sheet of Hybond-N+ transfer film pre-moistened in 0.4M NaOH (Amersham Pharmacia Biotech, # RPN 303B). The gel is placed on top, ensuring that there are no bubbles between the gel and the membrane. 3 additional pre-soaked blotters were placed on top of the gel and the buffer tray was filled with 0.4M NaOH. The gel stack and the buffer disc were connected with a wick pre-immersed in 0.4M NaOH, and the DNA was transferred to the membrane. DNA transfer was performed at room temperature for about 4 hours. After transfer, the Hybond membranes were rinsed in 2 XSSC for 10 seconds and the DNA was bound to the membrane by UV cross-linking.

4.4 hybridization

PCR was used to amplify the appropriate DNA sequences for probe preparation. The DNA probes are SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32 and SEQ ID NO. 33, or are homologous or complementary with the sequence parts. 25ng of probe DNA was boiled in 45. Mu.L TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5. Mu.l of 32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37℃for 15 minutes. The probe was purified by centrifugation through a microcentrifuge G-50 column (Amersham Pharmacia Biotech, # 27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. Probe activity was measured using a scintillation counter. The Hybond membrane was prehybridized by wetting it with 20mL of prewarmed Church prehybridization solution (500mM Na3P04,1mM EDTA,7%SDS,1%BSA) for 30 min at 65 ℃. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. To the pre-hybridization buffer, an appropriate amount of probe (1 million counts per 1mL of pre-hybridization buffer) was added and hybridization was performed overnight at 65 ℃. The next day, hybridization buffer was discarded, and after rinsing with 20mL Church rinse solution 1 (40mM Na3P04,1mM EDTA,5% SDS,0.5% BSA), the membrane was washed in 150mL Church rinse solution 1 at 65℃for 20 minutes. This procedure was repeated 2 times with Church rinse solution 2 (40mM Na3P04,1mM EDTA,1%SDS). The membrane is exposed to a phosphor screen or X-ray film to detect the location of probe binding.

Two control samples were included on each Southern: (1) DNA from negative (untransformed) isolates that are used to identify any endogenous maize sequences that can hybridize to the element-specific probe; (2) DNA from positive segregants into which HindIII digested pLP018 was introduced in an amount equivalent to one copy number based on probe length to account for the sensitivity of the experiment when detecting single gene copies within the maize genome.

The hybridization data provides corroborative evidence that supports TaqMan PCR analysis, i.e., maize plants LP018-1 contain single copies of cry3Bb, cry3Aa, cry1Fa, and epsps genes. Using the cry3Bb probe, mfeI and HindIII enzymatic hydrolysis produced single bands of about 11.8kb and 38.0kb, respectively; using cry3Aa probe, mfeI and HindIII enzymatic hydrolysis produced single bands of about 11.8kb and 38.0kb, respectively; using cry1Fa probe, mfeI and HindIII enzymatic hydrolysis produced single bands of about 11.7kb and 38.0kb, respectively; using the epsps probe, mfeI and HindIII enzymatic hydrolysis produced single bands of approximately 11.7kb and 38.0kb, respectively. This indicates that one copy of cry3Bb, cry3Aa, cry1Fa and epsps each are present in maize transformation event LP 018-1.

Example 5 insect resistance detection

5.1 bioassays of maize plant LP018-1

Transgenic maize event LP018-1 and wild type maize plants (non-transgenic, transformed recipient control (CK-)) 2 plants were bioassay of Asian corn borer (Ostriniafilana calis), spodoptera frugiperda (Spodoptera frugiperda) and Helicoverpa armigera (Helicoverpa) respectively, as follows:

fresh leaves (V3-V4 period) of 2 plants of transgenic corn event LP018-1 and wild type corn plants (non-transgenic, transformed acceptor control (CK-)) were taken respectively, washed clean with sterile water and blotted dry with absorbent paper, then corn leaves were vein removed while being cut into strips of about 1cm by 3cm in size, 1-3 (leaf number was determined according to insect diet) pieces of cut strips were placed on filter paper at the bottom of a circular plastic petri dish, the filter paper was moistened with distilled water, 10 artificially fed initially hatched larvae were inoculated into each petri dish, the petri dish was capped, and after capping, the temperature was 26-28 ℃, relative humidity was 70% -80%, photoperiod (light/dark) 16: statistics were carried out after 5 days of standing under 8 conditions. The statistical mortality (mortality= (number of dead insects/number of test insects) ×100%) was identified as an antagonistic level, and the results are shown in table 7 and fig. 3.

Table 7, in vitro insect-resistant bioassay results for transgenic maize event LP 018-1-mortality (%)

5.2 determination of the field insect-repellent Effect of transgenic maize event LP018-1

(1) Corn borer

The transgenic corn event LP018-1 is subjected to resistance identification of Asiatic corn borer serving as a main target pest in the field by adopting a living body insect-grafting method. The insects are grafted in the 4-6 leaf period and the silk-laying period (female silk-laying 3-5 cm), the insects are grafted for 2 times in each period, 50 heads are grafted each time, and the interval between the two times is one week. After 14-d of the leaf-stage insect, the feeding condition of upper leaves in corn plants by Asian corn borers is investigated, and the leaf feeding grade of the Asian corn borers is recorded. After the silk-laying period is inoculated, the damage degree of female ears and the damage condition of plants are investigated before harvesting, wherein the damage degree comprises the damage length of the female ears, the number of boreholes, the tunnel length of the boreholes, the age of surviving larvae and the survival number of the surviving larvae. The resistance of transgenic corn event LP018-1 to asian corn borers was evaluated based on the "grading criteria for the extent of corn borers' damage to corn cob (table 8)" and "evaluation criteria for the resistance of corn cob stage to asian corn borers (table 9)", and the results are shown in fig. 4 and table 12. Ear cutting investigation was performed on ears during the silking period, and the resistance of transgenic corn event LP018-1 to Asian corn borers was evaluated based on the "grading standard of the extent of damage to Asian corn borers during the ear period (Table 10)" and the "evaluation standard of the resistance to Asian corn borers during the ear period (Table 11)", and the statistical results are shown in Table 13. The results indicate that the leaf level average for transgenic maize event LP018-1 is significantly lower than the transformation recipient control (CK-); during the laying period, the female ear pest rate, larval survival, tunnel length, and female ear pest level of transgenic maize event LP018-1 were all significantly lower than the transformation recipient control (CK-). Overall, transgenic maize event LP018-1 had good resistance to asian corn borers during both the cotyledonary and silking phases.

Table 8, grading criteria for extent of corn borer damage to corn cob

Table 9 evaluation criteria for resistance to Asian corn borer during corn cob leaf stage

TABLE 10 grading Standard for the extent to which the ear period is affected by Asian corn borer

Table 11 evaluation criteria for resistance of ear stage to Asian corn borer

Table 12 results of resistance of transgenic corn event LP018-1 heart leaf stage to Asian corn borer

TABLE 13 results of resistance of transgenic maize event LP018-1 silking period to Asian corn borer

(2) Bollworm (Bowls)

The transgenic corn event LP018-1 is artificially inoculated for 2 times in the period of corn laying, and artificially raised first hatched larvae are inoculated for 20 heads in each corn filament, and after 3 days, the second time of insect inoculation is carried out, and the insect inoculation quantity is the same as the first time. After 14-21 days of insect inoculation, the pest rate of female ears, the number of surviving larvae of each female ear and the pest length of the female ears are investigated plant by plant. Investigation was usually started 14 days after insect inoculation, and if the harmful level of the negative control material (CK-) reached the sense or high sense, then the investigation was considered to be effective, and if the investigation was not properly postponed, but the corresponding level was not reached yet 21 days after insect inoculation, then the insect inoculation was considered to be ineffective. Calculating the average value of the damage level of the cotton bollworms in the corn ear period of each cell to the female spike according to the damage rate of the female spike, the number of surviving larvae and the damage length (cm) of the female spike, wherein the judging standard is shown in the table 14, and then judging the resistance level of the cotton bollworms in the corn ear period according to the standard of the table 15. The results of resistance to cotton bollworms of transgenic maize event LP018-1 silking period vaccination are shown in table 16. The results indicate that transgenic corn event LP018-1 has a higher level of resistance to cotton bollworm and that the female ear pest rate, larval survival, female ear pest length, and female ear pest level of transgenic corn event LP018-1 are all significantly lower than the conversion receptor control (CK-).

TABLE 14 grading Standard for the extent to which corn females are damaged by Helicoverpa armigera

TABLE 15 evaluation criteria for resistance of maize female ear to Heliothis armigera

Table 16, results of resistance to Helicoverpa armigera during the silking period of transgenic maize event LP018-1

(3) Spodoptera frugiperda (L.) kurz

The field natural pest-sensing test of spodoptera frugiperda was performed at 2022 in 3 months at a corn planting base of the state of the three-quarter cliff in the south of the hainan province. After 10-15 days of initial pest occurrence, and when most of 4-6-year-old larvae are harmful in the transformation receptor control (CK-) control, the pest rate of spodoptera frugiperda on corn plants is investigated plant by plant. The results of resistance of transgenic corn event LP018-1 to Spodoptera frugiperda are shown in Table 17 and the field resistance effect is shown in FIG. 5. The results show that the spodoptera littoralis has a significantly reduced rate of damage to the transgenic corn event LP018-1 as compared to the control (CK-) under naturally occurring conditions of spodoptera littoralis, thereby demonstrating that the transgenic corn event LP018-1 has a higher resistance to spodoptera littoralis.

Table 17 results of resistance of transgenic corn event LP018-1 to Spodoptera frugiperda under natural pest-sensing conditions

(4) Western corn rootworm

Through the identification of American cooperative units, western corn rootworm eggs are placed in an evaluation test plot in the V2 period of corn, the transgenic corn rootworm eggs and a control (CK-) are treated identically, roots of plants in the evaluation region are dug out and washed when corn grows to the V10 period, the situation that corn rootworm damages the roots of the plants is investigated one by one, the resistance result of the transgenic corn event LP018-1 to the corn rootworm is shown in a table 18, and the result shows that the pest rate of the corn rootworm to the transgenic corn event LP018-1 is remarkably reduced compared with the control (CK-) so as to indicate that the transgenic corn event LP018-1 has higher resistance to the corn rootworm.

Table 18, results of resistance of transgenic corn event LP018-1 to Spodoptera frugiperda under natural pest-sensing conditions

Example 6 herbicide tolerance detection of maize transformation event

The test selects the pesticide (41% glyphosate isopropyl ammonium salt aqua) for spraying. A random block design was used, 3 replicates. The area of the cells is 15m2 (5 m multiplied by 3 m), the row spacing is 60cm, the plant spacing is 25cm, and the cells are subjected to conventional cultivation management, and a 1m wide isolation belt is arranged between the cells. Transgenic maize event LP018-1 and the transformation receptor control (CK-) were treated with 2 treatments, respectively: 1) Spraying clear water; 2) The pesticide was sprayed at 3360 g a.e./ha (4 times the recommended dose) during the V3 leaf stage and then again at the same dose during the V8 stage. It should be noted that the conversion of glyphosate herbicide of different content and dosage forms to equivalent amounts of glyphosate acid is applicable to the following conclusion. The phytotoxicity symptoms were investigated at 1 and 2 weeks after dosing, respectively, and the yield of the cells was determined at harvest. The phytotoxicity symptoms were ranked as shown in table 19. The herbicide damage rate is used as an evaluation index to evaluate an index of herbicide tolerance of a transformation event, specifically, the herbicide damage rate (%) Σ (peer damage number×number of ranks)/(total number×highest rank); the herbicide damage rate refers to the glyphosate damage rate, and the glyphosate damage rate is determined according to the phytotoxicity investigation result of 2 weeks after the glyphosate treatment. The corn yield per cell is measured as the total yield (weight) of corn kernels in the middle 3 rows of each cell, and the yield difference between the different treatments is measured as a yield percentage (% yield = glyphosate yield sprayed/clear water sprayed). The results of the tolerance of transgenic maize event LP018-1 to herbicides are shown in FIG. 6 and Table 20.

Table 19, grading Standard for the extent of phytotoxicity of glyphosate herbicide to corn

Table 20, results of transgenic corn event LP018-1 on glyphosate herbicide tolerance and corn yield results

The results show that in terms of herbicide (glyphosate) damage: 1) The transgenic corn event LP018-1 had a victim rate of substantially 0 under glyphosate herbicide (3360 g a.e./ha) treatment, whereby the transgenic corn event LP018-1 had good glyphosate herbicide tolerance.

In terms of yield: the yield of the transgenic corn event LP018-1 was not significantly different under the treatment of spraying clear water and spraying 3360 g a.e./ha glyphosate 2, and after spraying the glyphosate herbicide, the yield of the transgenic corn event LP018-1 was slightly improved compared to spraying Shi Qingshui, thereby further indicating that the transgenic corn event LP018-1 had good glyphosate herbicide tolerance.

In summary, regenerated transgenic maize plants were examined for the presence of cry3Bb, cry3Aa, cry1Fa and epsps genes by taqman analysis (see example 2) and characterized for insect resistance and copy number of glyphosate herbicide tolerant lines. The selected event LP018-1 was excellent by screening, with single copy transgenes, good insect resistance, glyphosate herbicide tolerance and agronomic trait performance, according to copy number of the gene of interest, good insect resistance, glyphosate herbicide tolerance and agronomic trait performance (see example 5 and example 6).

Claims

1. A nucleic acid molecule for detecting transgenic corn event LP018-1, wherein the sequence of the nucleic acid molecule is one or more of SEQ ID No. 1-2, SEQ ID No. 3-4 or SEQ ID No. 5, wherein the nucleic acid molecule is derived from transgenic corn event LP018-1, and wherein corn seeds of transgenic corn event LP018-1 have been deposited with the chinese collection of typical cultures under deposit number cctccc No. P202313.

2. A method of protecting a maize plant from insect infestation comprising providing transgenic maize plant cells in a diet of a target insect; target insects that ingest the transgenic corn plant cells are inhibited from further ingest the transgenic corn plant; the insect is a lepidopteran or coleopteran insect; the corn seeds of the transgenic corn plants are preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO: P202313.

3. A method of protecting corn plants from injury caused by glyphosate herbicide, characterized by planting a transgenic corn plant; applying an effective dose of a glyphosate herbicide; the corn seeds of the transgenic corn plants are preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO: P202313.

4. A method of controlling weeds in a field containing corn plants, comprising applying an effective amount of a glyphosate herbicide to the field containing transgenic corn plants; the corn seeds of the transgenic corn plants are preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO: P202313.