CN104830846B - Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9898 - Google Patents

Abstract

The present invention relates to a kind of nucleic acid sequences and its detection method for detecting herbicide tolerant corn plant DBN9898, and the nucleic acid sequence of the corn plant includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series.Transgenic corn events DBN9898 of the present invention has preferable tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, on yield without influence, and detection method can quickly and accurately identify the DNA molecular for whether including transgenic corn events DBN9898 in biological sample.

Description

Nucleic acid sequence for detecting herbicide tolerant corn plant DBN9898 and its inspection Survey method

Technical field

The present invention relates to a kind of nucleic acid sequence and its detection sides for detecting herbicide tolerant corn plant DBN9898 Method, more particularly to it is a kind of tolerance glyphosate and glufosinate-ammonium corn plant DBN9898 and detection biological sample in whether include The method of the DNA molecular of specific transgenic corn events DBN9898.

Background technology

N- phosphonomethylglycines, also referred to as glyphosate are a kind of chronic wide spectrum steriland herbicides of inner sucting conduction type.Grass Sweet phosphine is the competing of the synthesis substrate phosphoenolpyruvate (PEP) of 5- enol pyruvylshikimate -3- phosphate synthases (EPSPS) Striving property inhibitor can inhibit both substrates of PEP and 3- phosphoric acid shikimic acids under EPSPS catalysis to 5- enolpyruvyl acyl thick grass The conversion of acid -3- phosphoric acid shikimic acids makes protein to block aromatic amino acid to synthesize the route of synthesis of precursor-shikimic acid Synthesis be interfered and lead to plant and bacterial death.

Glyphosate tolerant can be realized by expressing the EPSPS of modification.The EPSPS of modification has glyphosate lower Compatibility, thus in the presence of glyphosate, EPSPS maintains their catalytic activity, that is, it is resistance to obtain glyphosate By property.

Many areas are all main cereal crops to corn (Zea mays L.) in the world.The weeding in maize production Agent tolerance is an important economical character, especially to the tolerance of glyphosate herbicidal.Corn is to glyphosate herbicidal Tolerance can make glyphosate herbicide tolerant type gene (EPSPS, CP4) table in corn plant by transgene method It reaches and obtains, such as corn event NK603, corn event MON88017 etc..

Glyphosate tolerant tillage systems generally already lead to grass in recent years using with the increasingly increase that glyphosate uses The prevalence of sweet phosphine resistant weed.On the ground that grower changes in face of glyphosate-resistant weeds or to the weed species being more difficult to control Area, grower can be by mixing or being used interchangeably to the weak of compensation glyphosate with the other herbicides that can control omission weeds Point.

Glufosinate-ammonium is a kind of non-systemic, nonselective herbicide in phosphinothricin class herbicide.It is mainly used for 1 year It is raw or perennial broadleaf weed be unearthed after control, be by L-phosphinothricin (active constituent in glufosinate-ammonium) to glutamine Synthase (enzyme necessary to a kind of ammonolysis poison in plant) can not retroactive inhibition control weeds.Root is killed with glyphosate not Together, glufosinate-ammonium first kills leaf, can be conducted in plant xylem by plant transpiration effect, between quick-acting in paraquat and Between glyphosate.

The enzyme phosphinothricin N-acetyl transferase (PAT) detached from streptomycete is catalyzed L-phosphinothricin by acetylation and turns Turn to its inactive form.The gene of plant optimization form of PAT is expressed in soybean using to assign soybean to careless ammonium The tolerance of phosphine herbicide, such as soybean event A5547-127.Therefore glufosinate-ammonium is applied in combination with glufosinate tolerant character to remove Careless agent can be as a kind of non-selective means of effective management glyphosate-resistant weeds.

Meanwhile as transgenic insect-resistant corn large area is planted, the insect/pest survived on a small quantity breeds by several generations Afterwards, it is possible to create resistance.Herbicide-resistant transgenic maize is as non-pest-resistant transgenic corns, with transgenic insect-resistant corn with certain Ratio is planted together, and insect/pest can be delayed to develop immunity to drugs.

Expression of the known foreign gene in plant is influenced by their chromosome location, it may be possible to due to dyeing Matter structure (such as heterochromatin) or transcription regulatory element (such as enhancer) are close to integration site.Thus, it usually needs screening is a large amount of Event be possible to identify can be with commercialized event (target gene imported obtains the event of optimal expression).Example Such as, have been observed that the expression quantity of quiding gene there may be very big difference between event in plant and other organisms；In table On the space reached or temporal mode may there is also differences, such as between different plant tissues transgenosis relative expression exist it is poor Different, this species diversity shows that actual expression pattern may be pre- with the transcription regulatory element institute in the gene construct according to importing The expression pattern of phase is inconsistent.It is thus typically necessary to generate hundreds and thousands of different events and filter out from these events Single incident with transgene expression amount and expression pattern desired for the purpose of commercialization.With expected transgenosis table Event up to amount and expression pattern can be used for that transgenosis is penetrated into other by sexual cutcross using conventional breeding methods In genetic background.The offspring generated by this Crossing system maintains the transgenic expression characteristics of original transformant.Using this Kind strategy pattern may insure there is reliable gene expression in many kinds, and these kinds can well adapt to locality Growth conditions.

The presence of particular event can be detected to determine whether the offspring of sexual hybridization will be beneficial comprising target gene. In addition, the method for detection particular event also will be helpful to abide by relevant laws and regulations, such as thrown from the food of recombination crops It needs to obtain official approval and be marked before entering market.Transgenosis is detected by any well known polynucleotides detection method Presence be all it is possible, such as PCR (PCR) or using polynucleotide probes DNA hybridization.These detections Method is usually focused on common genetic elements, such as promoter, terminator, marker gene etc..Therefore, unless with insertion turn The sequence of the adjacent chromosomal DNA of gene DNA (" flanking DNA ") is known, and above-mentioned this method cannot be used to distinguish Different events, especially those events generated with identical DNA construct.Insertion is spanned so often utilizing at present The pair of primers of the junction of transgenosis and flanking DNA identifies transgenosis particular event by PCR, specifically includes The first primer of flanking sequence and the second primer comprising insetion sequence.

Invention content

The object of the present invention is to provide it is a kind of for detect herbicide tolerant corn plant DBN9898 nucleic acid sequence and Its detection method, transgenic corn events DBN9898 have preferable tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, And detection method can quickly and accurately identify the DNA for whether including specific transgenic corn events DBN9898 in biological sample Molecule.

To achieve the above object, the present invention provides a kind of nucleic acid sequences, including SEQ ID NO:3 or its complementary series in At least 11 continuous nucleotide, and/or SEQ ID NO:4 or its complementary series at least 11 continuous nucleotide.

Preferably, the nucleic acid sequence includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its mutually Complementary series.

Further, the nucleic acid sequence includes SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its Complementary series.

Further, the nucleic acid sequence includes SEQ ID NO:5 or its complementary series.

The SEQ ID NO:1 or its complementary series be transgenic corn events DBN9898 in insetion sequence 5 ' end End is located at the sequence that a length being inserted near junction is 22 nucleotide, the SEQ ID NO:1 or its complementary sequence Row span the DNA sequence dna of the flanking genomic DNA sequence of corn insertion point and 5 ' ends of insetion sequence, including described SEQ ID NO:1 or its complementary series can be accredited as the presence of transgenic corn events DBN9898.The SEQ ID NO:2 Or its complementary series is to be located to be inserted near junction in 3 ' ends of insetion sequence in transgenic corn events DBN9898 One length is the sequence of 22 nucleotide, the SEQ ID NO:2 or its complementary series span 3 ' ends of insetion sequence DNA sequence dna and corn insertion point flanking genomic DNA sequence, including the SEQ ID NO:2 or its complementary series be The presence of transgenic corn events DBN9898 can be accredited as.

In the present invention, the nucleic acid sequence can be the SEQ ID NO:3 or its complementary series transgenic be inserted into sequence Any portion of at least 11 or more continuous polynucleotides (the first nucleic acid sequence) of row, or be the SEQ ID NO: 3 or its complementary series in 5 ' flank corn gene group DNA regions any portion of at least 11 or more continuous multinuclear glycosides Sour (second nucleotide sequence).It includes the complete SEQ ID that the nucleic acid sequence, which may further be with being derived from or being complementary to, NO:The 1 SEQ ID NO:3 part.When the first nucleic acid sequence is when second nucleotide sequence is used together, these nucleic acid Sequence includes DNA primer group generating the DNA cloning method of amplified production.Using DNA primer to being produced in DNA cloning method Raw amplified production be include SEQ ID NO:When 1 amplified production, transgenic corn events DBN9898 or thereafter can be diagnosed The presence in generation.Well known to those skilled in the art, the first and second nucleic acid sequences need not be only made of DNA, may also comprise The mixture or DNA, RNA of RNA, DNA and RNA or it is other not as the nucleotide of one or more polymerase templates or its The combination of analog.In addition, heretofore described probe or primer should be at least about 11,12,13,14,15,16,17, 18, the length of 19,20,21 or 22 continuous nucleotides can be selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4 and SEQ ID NO:Nucleotide described in 5.When selected from SEQ ID NO:3,SEQ ID NO:4 Hes SEQ ID NO:Shown in 5 when nucleotide, the probe and primer can be length be at least about 21 to about 50 or More continuous nucleotides.The SEQ ID NO:3 or its complementary series be transgenic corn events DBN9898 in be inserted into sequence 5 ' ends of row are located at the sequence that a length being inserted near junction is 1399 nucleotide, the SEQ ID NO:3 Or its complementary series is by corn flanking genomic DNA sequence (the SEQ ID NO of 1144 nucleotide:3 nucleotide 1-1144), DBN10006 construct DNA sequences (the SEQ ID NO of 69 nucleotide:3 nucleotide 1145-1213) and 186 nucleotide Pr35S promoters 5 ' end DNA sequences (SEQ ID NO:3 nucleotide 1214-1399) composition, including the SEQ ID NO:3 or its complementary series can be accredited as the presence of transgenic corn events DBN9898.

The nucleic acid sequence can be the SEQ ID NO:Any portion of 4 or its complementary series transgenic insetion sequence At least 11 or more the continuous polynucleotides (third nucleic acid sequence) divided, or be the SEQ ID NO:4 or it is complementary Any portion of at least 11 or more continuous polynucleotides (the 4th cores in 3 ' flank corn gene group DNA regions in sequence Acid sequence).It includes the complete SEQ ID NO that the nucleic acid sequence, which may further be with being derived from or being complementary to,:2 it is described SEQ ID NO:4 part.When third nucleic acid sequence is when the 4th nucleic acid sequence is used together, these nucleic acid sequences are generating The DNA cloning method of amplified production includes DNA primer group.The amplification generated in DNA cloning method is produced using DNA primer Object be include SEQ ID NO:When 2 amplified production, transgenic corn events DBN9898 or the presence of its offspring can be diagnosed. The SEQ ID NO:4 or its complementary series be transgenic corn events DBN9898 in 3 ' ends of insetion sequence be located at insert Enter the sequence that a length near junction is 1371 nucleotide, the SEQ ID NO:4 or its complementary series by 158 TNos terminator sequences (the SEQ ID NO of a nucleotide:4 nucleotide 1-158), the DBN10006 structures of 152 nucleotide Body DNA sequence dna (SEQ ID NO:4 nucleotide 159-310) and 1061 nucleotide corn integration site flanking genomes DNA sequence dna (SEQ ID NO:4 311-1371) composition, including the SEQ ID NO:4 or its complementary series can be accredited as The presence of transgenic corn events DBN9898.

The SEQ ID NO:5 or its complementary series be that characterize the length of transgenic corn events DBN9898 be 7014 The sequence of nucleotide, the genome and genetic elements for including specifically are as shown in table 1.Including the SEQ ID NO:5 or its mutually Complementary series can be accredited as the presence of transgenic corn events DBN9898.

Table 1, SEQ ID NO:5 genomes for including and genetic elements

The nucleic acid sequence or its complementary series can be used in DNA cloning method to generate amplicon, the inspection of the amplicon Survey diagnosis biological sample transgenic corn event DBN9898 or the presence of its offspring；The nucleic acid sequence or its complementary series It can be used in nucleotide detection method, to detect the presence of biological sample transgenic corn event DBN9898 or its offspring.

To achieve the above object, the present invention also provides a kind of DNA of detection sample transgenic corn event DBN9898 Existing method, including：

Detected sample is set to be contacted in nucleic acid amplification reaction at least two primers；

Carry out nucleic acid amplification reaction；

Detect the presence of amplified production；

The amplified production includes SEQ ID NO:3 or its complementary series at least 11 continuous nucleotide or SEQ ID NO:4 or its complementary series at least 11 continuous nucleotide.

Further, the amplified production includes SEQ ID NO:1 or its complementary series in 1-11 or 12-22 Continuous nucleotide or SEQ ID NO:2 or its complementary series in 1-11 or 12-22 continuous nucleotides.

Further, the amplified production includes SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its mutually Complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

In the above-mentioned technical solutions, the primer includes at least one nucleic acid sequence.

Specifically, the primer includes the first primer and the second primer, and the first primer is selected from SEQ ID NO:8 Hes SEQ ID NO:10；Second primer is selected from SEQ ID NO:9 and SEQ ID NO:11.

To achieve the above object, the present invention also provides a kind of DNA of detection sample transgenic corn event DBN9898 Existing method, including：

Detected sample is set to be contacted with probe, the probe includes SEQ ID NO:3 or its complementary series at least 11 Continuous nucleotide or SEQ ID NO:4 or its complementary series at least 11 continuous nucleotide；

The detected sample and the probe is set to hybridize under stringent hybridization conditions；

Detect the hybridisation events of the detected sample and the probe.

The stringent condition can be in 6 × SSC (sodium citrate), 0.5%SDS (lauryl sodium sulfate) solution, Hybridize at 65 DEG C, then respectively washes film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.

Further, the probe includes SEQ ID NO:1 or its complementary series in 1-11 or 12-22 it is continuous Nucleotide or SEQ ID NO:2 or its complementary series in 1-11 or 12-22 continuous nucleotides.

Further, the probe has SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary sequence Row, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

Selectively, at least one probe is marked at least one fluorophor.

To achieve the above object, the present invention also provides a kind of detection sample transgenic corn event DBN9898's Method existing for DNA, including：

Detected sample is set to be contacted with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:3 or At least 11 continuous nucleotide or SEQ ID NO in its complementary series:4 or its complementary series at least 11 it is continuous Nucleotide；

The detected sample and the marker nucleic acid molecules is set to hybridize under stringent hybridization conditions；

The hybridisation events of the detected sample and the marker nucleic acid molecules are detected, and then are educated by marker auxiliary Kind analysis is to determine that glyphosate tolerant and/or glufosinate tolerant and marker nucleic acid molecules are chain on science of heredity.

Further, the marker nucleic acid molecules include SEQ ID NO:1 or its complementary series in 1-11 or 12-22 continuous nucleotides or SEQ ID NO:2 or its complementary series in 1-11 or 12-22 continuous nucleotides.

Further, the marker nucleic acid molecules have SEQ ID NO:1 or its complementary series, SEQ ID NO:2 Or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

To achieve the above object, the present invention also provides a kind of DNA detection kits, including at least one DNA molecular, institutes It includes SEQ ID NO to state DNA molecular:At least 11 continuous nucleotide or SEQ in 3 homologous sequence or its complementary series ID NO:At least 11 continuous nucleotide in 4 homologous sequence or its complementary series can be used as transgenic corns Event DBN9898 or its offspring have the DNA primer or probe of specificity.

Further, the DNA molecular includes SEQ ID NO:1 or its complementary series in 1-11 or 12-22 Continuous nucleotide or SEQ ID NO:2 or its complementary series in 1-11 or 12-22 continuous nucleotides.

Further, the DNA molecular has SEQ ID NO:1 homologous sequence or its complementary series, SEQ ID NO:2 homologous sequence or its complementary series, SEQ ID NO:6 homologous sequence or its complementary series or SEQ ID NO:7 Homologous sequence or its complementary series.

To achieve the above object, the present invention also provides a kind of plant cells, including coding glyphosate tolerant EPSPS eggs The nucleic acid sequence of the nucleic acid sequence and specific region of white nucleic acid sequence, coding glufosinate tolerant PAT albumen, the given zone The nucleic acid sequence in domain includes SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:6 or SEQ ID NO:Sequence shown in 7.

To achieve the above object, the present invention also provides a kind of corn plants for generating and having tolerance to glyphosate herbicidal The method of strain includes the nucleic acid sequence that coding glyphosate tolerant EPSPS albumen is introduced into the genome of the plant It is selected from SEQ ID NO with the nucleic acid sequence of the nucleic acid sequence of specific region, the specific region:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:The sequence of at least one of sequence nucleic acid shown in 7 Row.

Specifically, described generate includes to the method for plant of the glyphosate herbicidal with tolerance：

By to glyphosate herbicidal have tolerance the first parental maize plants of transgenic corn events DBN9898 with The the second parental maize plant sexual hybridization for lacking glyphosate tolerant, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate herbicidal；

The progeny plant of selection tolerance glyphosate.

To achieve the above object, the present invention also provides a kind of corn plants for generating and having tolerance to glufosinate-ammonium herbicide Strain method, include into the genome of the plant introduce coding glufosinate tolerant PAT albumen nucleic acid sequence and The nucleic acid sequence of the nucleic acid sequence of specific region, the specific region is selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:The sequence of at least one of sequence nucleic acid shown in 7 Row.

Specifically, described generate includes to the method for plant of the glufosinate-ammonium herbicide with tolerance：

By first parental maize plants of transgenic corn events DBN9898 to glufosinate-ammonium herbicide with tolerance and lack Second parental maize plant sexual hybridization of few glufosinate tolerant, to generate a large amount of progeny plants；

The progeny plant described in glufosinate-ammonium herbicide treatment；

The progeny plant of selection tolerance glyphosate.

To achieve the above object, the present invention also provides a kind of generations to have to glyphosate herbicidal and glufosinate-ammonium herbicide The method of the plant of tolerance includes that coding glyphosate tolerant EPSPS is introduced into the genome of the plant The nucleic acid sequence of the nucleic acid sequence of albumen, the nucleic acid sequence and specific region of coding glufosinate tolerant PAT albumen, it is described specific The nucleic acid sequence in region is selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO: 5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7.

Specifically, the method for generating the plant that there is tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide Including：

To there is the first parents of transgenic corn events DBN9898 of tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide This plant and the second parental maize plant sexual hybridization for lacking glyphosate and/or glufosinate tolerant are big to generate Measure progeny plant；

The progeny plant described in glyphosate herbicidal and glufosinate-ammonium herbicide treatment；

The progeny plant of selection tolerance glyphosate and glufosinate-ammonium.

To achieve the above object, the present invention also provides a kind of cultures has glyphosate herbicidal the corn plant of tolerance The method of object, including：

An at least corn seed is planted, the genome of the corn seed includes coding glyphosate tolerant EPSPS Nucleic acid sequence and specific region nucleic acid sequence；

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of specific region with other The plant of sequence compares the plant with the plant injury weakened；

The nucleic acid sequence of the specific region is selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7.

To achieve the above object, the present invention also provides a kind of cultures has glufosinate-ammonium herbicide the corn plant of tolerance The method of object, including：

An at least corn seed is planted, the genome of the corn seed includes coding glufosinate tolerant PAT eggs The nucleic acid sequence of white nucleic acid sequence and specific region；

The corn seed is set to grow up to plant；

The plant described in effective dose glufosinate-ammonium herbicide spray, harvest do not have the nucleic acid of specific region with other The plant of sequence compares the plant with the plant injury weakened；

The nucleic acid sequence of the specific region is selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7.

To achieve the above object, the present invention also provides a kind of cultures to have to glyphosate herbicidal and glufosinate-ammonium herbicide The method of the corn plant of tolerance, including：

An at least corn seed is planted, the genome of the corn seed includes coding glyphosate tolerant EPSPS The nucleic acid sequence of the nucleic acid sequence of albumen, the nucleic acid sequence and specific region of coding glufosinate tolerant PAT albumen；

The corn seed is set to grow up to plant；

The plant described in effective dose glyphosate herbicidal and glufosinate-ammonium herbicide spray, harvest do not have with other The plant of the nucleic acid sequence of specific region compares the plant with the plant injury weakened；

The nucleic acid sequence of the specific region is selected from SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7.

To achieve the above object, the present invention also provides a kind of sides for protecting the plants from and being damaged caused by herbicide Method, including the herbicide containing effective dose glyphosate and/or glufosinate-ammonium is applied at least one transgenic corns of plantation and is planted The big Tanaka of object, the rotaring gene corn plant include to be selected from SEQ ID NO in its genome:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence core shown in 7 Acid sequence, the rotaring gene corn plant have the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.

To achieve the above object, the present invention also provides a kind of methods of control weeds in field, including will contain effective agent Amount glyphosate and/or the herbicide of glufosinate-ammonium are applied to the big Tanaka for planting at least one rotaring gene corn plant, described to turn base Because corn plant includes to be selected from SEQ ID NO in its genome:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO: 4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7, the transgenosis are beautiful Rice plant has the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.

To achieve the above object, the present invention also provides a kind of crop field glyphosate of control glyphosate-tolerant plant is anti- Property weeds method, including the herbicide containing effective dose glufosinate-ammonium is applied at least one glyphosate tolerant of plantation The big Tanaka of rotaring gene corn plant, the rotaring gene corn plant of the glyphosate tolerant include to be selected from its genome SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:At least one of sequence nucleic acid sequence shown in 7, the rotaring gene corn plant of the glyphosate tolerant have pair simultaneously The tolerance of glufosinate-ammonium herbicide.

To achieve the above object, the present invention also provides a kind of methods delaying insect-resistant, are included in the pest-resistant jade of plantation The big Tanaka of rice plant plants at least one rotaring gene corn plant with glyphosate and/or glufosinate tolerant, the grass The rotaring gene corn plant of sweet phosphine tolerance includes to be selected from SEQ ID NO in its genome:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:The sequence of at least one of sequence nucleic acid shown in 7 Row.

To achieve the above object, include SEQ ID NO the present invention also provides one kind:1 or SEQ ID NO:2 multinuclear glycosides The agricultural product or commodity of acid, the agricultural product or commodity are corn flour, maize flour, corn oil, cornstarch, corn gluten, jade Rice cake, cosmetics or filler.

It is defined below and square in the present invention is used to detect the nucleic acid sequence and its detection method of antiweed corn plant Method can preferably define the present invention and those skilled in the art is instructed to implement the present invention, unless otherwise mentioned, according to The conventional usage of those of ordinary skill in the art understands term.

" corn " refers to maize (Zea mays), and includes all plant varieties that can be mated with corn, Including field corn kind.

Term "comprising" refers to " including but not limited to ".

Term " plant " includes that whole plant, plant cell, plant organ, plant protoplast, plant can therefrom again It is complete in raw plant cell tissue cultures, plant callus, vegetation bed (plant clumps) and plant or plant part Whole plant cell, the plant part such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stalk, root, the tip of a root, flower Medicine etc..The part for the genetically modified plants being interpreted as in the scope of the invention includes but not limited to plant cell, protoplast, group It knits, callus, embryo and flower, stem, fruit, Ye Hegen, the above plant part are originated from the DNA molecular conversion with the present invention in advance And the genetically modified plants being therefore made of at least partly transgenic cell or its filial generation.

Term " gene " refers to expressing the nucleic acid fragment of specific protein, including regulatory sequence (5 ' the non-volumes before coded sequence Code sequence) and coded sequence after regulatory sequence (3 ' non-coding sequence)." natural gene " refers to natural find with its own The gene of regulatory sequence." mosaic gene " refers to any gene for not being natural gene, it includes non-natural find adjusting and Coded sequence." endogenous gene " refers to natural gene, and the natural gene is located at its natural place in organism genome. " foreign gene " is the existing alien gene for being to be not present in the genome of biology and originally, also refers to and is imported through Transgenic procedures The gene of recipient cell.Foreign gene can include the natural gene or mosaic gene for being inserted into non-native organism." transgenosis " It is the gene that genome is had been incorporated by Transformation Program.The site that recombinant DNA has been inserted into Plant Genome can claim For " insertion point " or " target site ".

" flanking DNA " can include the genome being naturally occurring in the organism of such as plant or be drawn by conversion process External source (heterologous) DNA entered, for example, with the relevant segment of transformation event.Therefore, flanking DNA may include natural and exogenous DNA Combination.In the present invention, " flanking region " or " flanking sequence " or " genome frontier district " or " genome border sequence " refer to The base-pair of at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 is longer Sequence, be located at initial external source be inserted into DNA molecular immediately upstream or downstream and with initial external source be inserted into DNA molecular phase It is adjacent.When the flanking region is located at downstream, it is referred to as " left margin flank " or " 3 ' flank " or " 3 ' genome frontier district " Or " 3 ' border sequence of genome " etc..When the flanking region is located at upstream, it is referred to as " right margin flank " or " 5 ' sides The wing " or " 5 ' genome frontier district " or " 5 ' border sequence of genome " etc..

Cause the Transformation Program of the random integration of exogenous DNA that can lead to the transformant containing different flanking regions, the difference Flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, flanking region is logical Chang Buhui changes.Transformant also can be containing between heterologous insertion DNA and the section of genomic DNA or between two sections of genomic DNAs Or the unique engagement between two sections of allogeneic dna sequence DNAs." engagement " is the point of two specific DNA fragmentation connections.For example, engagement exists In the position of insert DNA connection flanking DNAs.Junction is also present in the organism of conversion, and two of which DNA fragmentation is to repair Adorn linking together for the mode found from native organism." engagement DNA " refers to the DNA for including junction.

The present invention provides the referred to as transgenic corn events of DBN9898 and its offspring, the transgenic corn events DBN9898 is corn plant DBN9898 comprising the Plants and Seeds of transgenic corn events DBN9898 and its plant are thin Born of the same parents or its renewable part, the plant part of the transgenic corn events DBN9898, including but not limited to cell, pollen, embryo Pearl, flower, bud, root, stem, fringe silk, inflorescence, ear fringe, leaf and the product from corn plant DBN9898, such as corn flour, corn Face, corn oil, corn steep liquor, corn silk, cornstarch and the biomass for staying in corn crop field.

Transgenic corn events DBN9898 of the present invention contains a DNA construct, when it is expressed in plant cell When, the transgenic corn events DBN9898 obtains the tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide.The DNA Construct includes two concatenated expression cassettes, and first expression cassette includes suitable promoter for being expressed in plant and suitable The polyadenylation signal sequence of conjunction, the promoter, which is operably connected, encodes 5- enol pyruvylshikimate -3- phosphoric acid The gene of synthase (EPSPS), the EPSPS have tolerance to glyphosate herbicidal.Second expression cassette includes for planting The suitable promoter expressed in object and suitable polyadenylation signal sequence, the promoter are operably connected coding The nucleic acid sequence of the gene of phosphinothricin N-acetyl transferase (PAT), the PAT albumen has tolerance to glufosinate-ammonium herbicide Property.Further, the promoter can be the suitable promoter detached from plant, including composing type, induction type and/or tissue Specificity promoter, the suitable promoter include but not limited to cauliflower mosaic virus (CaMV) 35S promoter, radix scrophulariae flower Mosaic virus (FMV) 35S promoter, Tsf1 promoters, ubiquitin protein (Ubiquitin) promoter, actin (Actin) start Son, soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum (Cestrum) yellow leaf curl virus promoter, patatin (Patatin) open Mover, ribulose-1,5-bisphosphate, 5- diphosphonic acid carboxylases/oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) start Son, E9 promoters, GOS promoters, alcA/alcR promoters, Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promoters and Arabidopsis (Arabidopsis) Suc2 promoters.The polyadenylation signal sequence can be The suitable polyadenylation signal sequence to work in plant, the suitable polyadenylation signal sequence include but unlimited In from the polyadenosine of soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Polyadenylation signal sequence derives from cauliflower mosaic virus (CaMV) 35S terminators, derives from pea ribulose -1,5- diphosphonic acid Carboxylase/oxygenase E9 terminators, from protease-inhibitor Ⅱ (PIN II) gene polyadenylation signal sequence and From the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

In addition, the expression cassette can also include other genetic elements, the genetic elements include but not limited to enhance Son and signal peptide/transit peptides.The enhancer can enhance the expression of gene, and the enhancer includes but not limited to cigarette Careless etch virus (TEV) translation activity factor, CaMV35S enhancers and FMV35S enhancers.Signal peptide/the transit peptides can be with Guide EPSPS albumen and/or PAT Protein transports to extracellular or intracellular specific organelle or compartment, for example, using compiling Code chloroplast transit peptide sequence targets chloroplaset, or utilizes ' KDEL ' to retain sequence and target endoplasmic reticulum.

5- enol pyruvylshikimates -3- phosphate synthases (EPSPS) gene can be from soil Agrobacterium It is isolated in (Agrobacterium tumefaciens sp.) CP4 bacterial strains, and can by optimize codon or with Other manner changes the polynucleotides of coding EPSPS, to reach the stability and utilizability that increase transcript in transformed cells Purpose.5- enol pyruvylshikimates -3- phosphate synthases (EPSPS) gene can also be used as selected marker.

" glyphosate " refers to the salt of N- phosphonomethylglycines and it, and it refers to using to be handled with " glyphosate herbicidal " The herbicide formulations that any type contains glyphosate are handled.In order to reach ebd and to certain glyphosate system Technical ability of the selection of agent utilization rate no more than common agronomic technique personnel.Contain the herbicide formulations of glyphosate using any type Processing contains the field of the vegetable material from antiweed corn plant DBN9898, miscellaneous in the field by controlling Grass growth, and do not influence to derive from growth or the yield of the vegetable material of herbicide tolerant corn plant DBN9898.

The enzyme phosphinothricin N-acetyl transfer detached from streptomycete (Streptomyces viridochromogenes) Enzyme (phosphinothricin N-acetyltransferase, PAT) gene is catalyzed L-phosphinothricin conversion by acetylation For its inactive form, to assign tolerance of the plant to glufosinate-ammonium herbicide.Phosphinothricin (PTC, 2- amino- 4- methylphosphine-butyric acids) be glutamine synthelase inhibitor.PTC is antibiotic 2- amino -4- methylphosphines acyl-the-the third ammonia of alanyl The structural units of acid, this tripeptides (PTT) have resisting gram-positive and gramnegative bacterium and antimycotic Botrytis cinerea The activity of (Botrytis cinerea).Phosphinothricin N-acetyl transferase (PAT) gene can also be used as selected marker Gene.

" glufosinate-ammonium " also known as glufosinate refer to 2- amino -4- [hydroxyl (methyl) phosphono] butyric acid ammonium, with " careless ammonium Phosphine herbicide " processing refers to that the herbicide formulations for containing glufosinate-ammonium using any type are handled.In order to reach effective biology Learn dosage and to certain glufosinate-ammonium preparation utilization rate selection no more than common agronomic technique personnel technical ability.Use any type Herbicide formulations processing containing glufosinate-ammonium contains the vegetable material from herbicide tolerant corn plant DBN9898 Field will control the weed growth in the field, and not influence to derive from herbicide tolerant corn plant DBN9898 Vegetable material growth or yield.

The DNA construct is introduced in using method for transformation in plant, and the method for transformation includes but not limited to agriculture bar Bacterium (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.

The Agrobacterium_mediated method is the common method of Plant Transformation.The exogenous DNA gram that will be introduced into plant Between the grand left and right boundary consensus sequence to carrier, i.e. areas T-DNA.The carrier is transformed into agrobatcerium cell, then, The agrobatcerium cell is organized for infection plant, including the areas T-DNA of the carrier of exogenous DNA are inserted into plant gene In group.

The Gene Knock-out Mice is with carrier bombardment plant cell (the biological bullet that particle mediates comprising exogenous DNA Hit conversion).

The pollen tube channel conversion method is that natural pollen tube channel (also known as pollen is formed by after pollinating using plant Pipe guides tissue), through megarchidium channel, exogenous DNA is carried into blastular.

After conversion, it is necessary to have from the plant tissue regenerating plants of conversion, and using suitable label selection The offspring of exogenous DNA.

DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassettes.DNA Construct preferably can the self-replacation in bacterial cell, and containing different restriction endonuclease sites plasmid, Contained restriction endonuclease sites provide functioning gene element, i.e. promoter, introne, targeting sequencing, volume for importing The DNA molecular of code sequence, 3 ' terminator regions and other sequences.Expression cassette contained in DNA construct includes providing courier Genetic elements necessary to the transcription of RNA, the expression cassette can be designed as expressing in prokaryotic cell or eukaryocyte.This hair Bright expression cassette is designed to most preferably express in plant cell.

Transgenosis " event " is contained including one as obtained from converting plant cell with heterologous DNA construct The expression of nucleic acid box of target gene is inserted into the plant population in Plant Genome with generation by transgene method, regeneration The plant population, and selection have the specific plant for being inserted into specific gene group site feature.Term " event " refers to including heterologous The original transformant of DNA and the offspring of the transformant.Term " event " also refers to transformant and other kinds containing allogeneic dna sequence DNA Offspring obtained from sexual hybridization is carried out between body, even if after with backcross parent be returned repeatedly, comes from transformant parent This insertion DNA and flanking genomic dna exists in the same chromosome location in filial generation.Term " event ", which also refers to, to be come From the DNA sequence dna of original transformant, the DNA sequence dna include be inserted into DNA and be inserted into the close adjacent flanking genomes sequences of DNA Row, which, which is expected, is transferred in filial generation, the filial generation by containing be inserted into DNA parental department (such as original transformant and its It is selfed the filial generation generated) it is generated with sexual hybridization is carried out without containing the parental department for being inserted into DNA, and the filial generation is received comprising mesh Mark the insertion DNA of gene.

" recombination " refers to the DNA that generally can not be found in nature and therefore be generated by manual intervention in the present invention And/or the form of albumen and/or organism.This manual intervention can generate recombinant DNA molecules and/or recombinant plant." the weight Group DNA molecular " is to be in other cases the sequence section of separation by two kinds of artificial combination by obtain, such as pass through chemistry Synthesis or the nucleic acid segment detached by genetic engineering technology operation.The technology for carrying out nucleic-acid manipulation is well-known.

Term " transgenosis " includes any cell, cell line, callus, tissue, plant part or plant, above base Because type due to heterologous nucleic acids there are due to change, " transgenosis " includes Transgenics initially changed in this way and by most The offspring individual that first Transgenics are generated by sexual hybridization or vegetative propagation.In the present invention, term " transgenosis " does not wrap (chromosome the or extrachromosomal) change by conventional plant breeding method or the natural genome that event occurs is included, it is described It is natural that for example random allogamy of event, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base or spontaneous prominent occurs Become.

" heterologous " refers to that the first molecule is not found usually and the second molecular combinations in nature in the present invention.For example, Molecule can be originated from the first species and be inserted into the genome of the second species.Therefore this molecule for host be it is heterologous and It is artificially introduced in the genome of host cell.

The transgenic corn events DBN9898 that there is tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide is cultivated, is led to Cross following steps：Make the first parental corn plants and the second parental corn plants sexual hybridization first, it is various to produce First generation progeny plant, first parental corn plants are by cultivation transgenic corn event DBN9898 and its jade of offspring Rice plant composition, transgenic corn events DBN9898 and its offspring be by using the present invention to glyphosate herbicidal and Obtained from there is glufosinate-ammonium herbicide the expression cassette of tolerance to be converted, the second parental corn plants shortage removes glyphosate The tolerance of careless agent and/or glufosinate-ammonium herbicide；Then the application tool to glyphosate herbicidal and/or glufosinate-ammonium herbicide is selected There is the progeny plant of tolerance, can cultivate there is the corn of tolerance to plant glyphosate herbicidal and glufosinate-ammonium herbicide Object.These steps, which may further include, makes the application to glyphosate herbicidal and/or glufosinate-ammonium herbicide have tolerance Progeny plant is returned with the second parental corn plants or third parental corn plants, then by applying Gyphosate herbicice Agent, glufosinate-ammonium herbicide or by with the relevant molecular marked compound of character (such as comprising being inserted into transgenic corn events DBN9898 The DNA molecular of bond site that the 5 ' ends and 3 ' ends of sequence identify) identification select filial generation, glyphosate is removed to generate Careless agent and glufosinate-ammonium herbicide have the corn plant of tolerance.

It will also be appreciated that two different genetically modified plants can also hybridize to generate containing there are two independent, separation The offspring of the foreign gene of formula addition.The selfing of appropriate offspring can obtain all being homozygous for the foreign gene of two additions The Progeny plants of son.It is also as previously described to be expected to the backcrossing of parental plant and with the cutcross of non-transgenic plant , vegetative propagation is also same.

The corn of trans Bt gene can kill insect/pest of such as Lepidoptera and coleoptera, but there is also under a small amount of survival Insect/the pest come, after several generations is bred, it is possible to create resistant insects/pest of anti-Bt albumen.In order to solve insect/evil Worm lead to the problem of resistance this, Environmental Protection Agency USA gives following guidance for the uses of genetically modified crops, need to provide one Sanctuary's corn of certainty ratio (requires have 5%, 10%, 20% etc. according to product difference about sanctuary's corn.And can be The corn of non-pest-resistant transgenic corns (such as herbicide tolerant transgenic corns) or anti-Non-target pests, not necessarily right and wrong Transgenic corns).After insect/pest of the overwhelming majority is killed on corresponding transgenic insect-resistant corn, some Insect/pest is on sanctuary's corn without extremely, ensure that insect/pest population of not resistance accounts for governance quantity.So i.e. Make have the resistant insects/pest to survive on a small quantity, with account for rule quantity non-resistance insect/pest post-coitum resistant gene also by Significantly dilute.

Term " probe " is the nucleic acid molecules of one section of separation, is combined with conventional detectable label or report point above Son, for example, radioactive isotope, ligand, chemiluminescent agent or enzyme.One chain of this probe and target nucleic acid is complementary , in the present invention, probe and a DNA chain complementation from transgenic corn events DBN9898 genomes, no matter the gene Group DNA be from transgenic corn events DBN9898 or seed be also derived from transgenic corn events DBN9898 plant or Seed or extract.The present invention probe not only include DNA or ribonucleic acid, further include specifically with target DNA sequence dna combines and can be used for detecting the existing polyamide and other probe materials of the target dna sequence.

Term " primer " is the nucleic acid molecules of one section of separation, is hybridized by nucleic acid, annealed combination to complementary target dna On chain, heterozygote is formed between primer and target dna chain, then under the action of polymerase (such as archaeal dna polymerase), along mesh DNA chain is marked to extend.The primer pair of the present invention is related to its application in target nucleic acid sequence amplification, for example, passing through polymerase chain Formula reacts (PCR) or other conventional nucleic acid amplification methods.

The length of probe and primer is usually 11 polynucleotides or more, preferably 18 polynucleotides or more, More preferably 24 polynucleotides or more, most preferably 30 polynucleotides or more.This probe and primer are in height Specifically hybridize with target sequence under degree stringent hybridization condition.Although being protected different from target dna sequence and to target dna sequence Holding the probe of hybridization ability can design by conventional method, however, it is preferred to, probe and primer in the present invention There is complete DNA sequence dna homogeneity with the continuous nucleic acid of target sequence.

It can be determined by conventional method based on the primer and probe of flanking genomic dna and insetion sequence of the invention, For example, by detaching corresponding DNA molecular from the vegetable material from transgenic corn events DBN9898, and determining should The nucleic acid sequence of DNA molecular.The DNA molecular includes transgene insert sequence and Maize genome flank region, and the DNA divides The segment of son may be used as primer or probe.

The nucleic acid probe and primer of the present invention hybridizes with target dna sequence under strict conditions.Any conventional nucleic acid is miscellaneous Friendship or amplification method may be used to identify the presence of the DNA in sample from transgenic corn events DBN9898.Nucleic acid point Son or its segment can carry out specific hybrid with other nucleic acid molecules in any case.As the present invention uses, if two A nucleic acid molecules can form antiparallel double-strandednucleic acid structure, so that it may can be carried out specifically with saying the two nucleic acid molecules to each other Property hybridization.If two nucleic acid molecules show complete complementarity, it is another nucleic acid point to claim one of nucleic acid molecules " complement " of son.As the present invention uses, when each nucleotide and another nucleic acid molecules of a nucleic acid molecules The corresponding nucleotide mutual added time, then the two nucleic acid molecules is claimed to show " complete complementarity ".If two nucleic acid molecules can be with Enough stability phase mutual crosses then claim to make them anneal and be bonded to each other under the conditions of at least conventional " low stringent " The two nucleic acid molecules are " minimum level is complementary ".Similarly, if two nucleic acid molecules can be mutual with enough stability Hybridize that them is made to anneal and be bonded to each other under the conditions of conventional " height is stringent ", then the two nucleic acid molecules is claimed to have " complementarity ".Deviateing from complete complementarity can allow, as long as not exclusively to prevent two molecules from being formed double for this deviation Chain structure.In order to enable a nucleic acid molecules as primer or probe, it is only necessary to it is adequately complementary to ensure that it has in sequence Property, so that stable duplex structure can be formed under used specific solvent and salinity.

As the present invention uses, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules are in high stringency Specific hybrid can occur with the complementary strand of another section of nucleic acid molecules to match down.Promote the suitable stringent of DNA hybridization Then condition is used for example, about being handled with 6.0 × sodium chloride/sodium citrate (SSC) under the conditions of 45 DEG C under the conditions of 50 DEG C 2.0 × SSC is washed, these conditions are well known to those skilled in the art.For example, the salinity in washing step can be selected From about 2.0 × SSC of Low stringency conditions, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C.In addition, washing step In temperature condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of the room temperature of Low stringency conditions.Temperature strip Part and salinity can all change, can also one of them remain unchanged and another variable changes.Preferably, originally Invention a nucleic acid molecules can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with SEQ ID NO: 1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:In 7 Specific hybrid occurs for any segment of one or more nucleic acid molecules or its complementary series or above-mentioned sequence.It is highly preferred that The present invention a nucleic acid molecules under high stringency with SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6 and SEQ ID NO:One or more nucleic acid molecules or its complementary series in 7, Or specific hybrid occurs for any segment of above-mentioned sequence.In the present invention, preferred marker nucleic acid molecules have SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned sequence any segment. Another preferred marker nucleic acid molecules of the present invention and SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:6 or SEQ ID NO:7 or any segment of its complementary series or above-mentioned sequence with 80% to 100% or 90% to 100% sequence it is same Property.SEQ ID NO:1,SEQ ID NO:2,SEQ ID NO:6 and SEQ ID NO:7 may be used as the mark in plant breeding method Remember object to identify the offspring of genetic cross.Probe can be art technology by any type with hybridizing for target dna molecule Method known to personnel is detected, these methods include but not limited to fluorescent marker, radioactive label, antibody class label And chemiluminescent labeling.

About the amplification (for example, passing through PCR) for using specific amplimer to carry out target nucleic acid sequence, " stringent item Part " refers to the condition for only allowing primer pair target nucleic acid sequence to hybridize in the hot amplified reactions of DNA, has and target core The primer of the corresponding wild-type sequence of acid sequence (or its complementary series), can be combined, and excellent with the target nucleic acid sequence Choosing generates unique amplified production, amplified production, that is, amplicon.

Term " specific binding (target sequence) " refer under stringent hybridization conditions probe or primer only with comprising target Target sequence in the sample of sequence hybridizes.

As the present invention uses, " by the DNA of amplification " or " amplicon " refer to the target as a nucleic acid-templated part The nucleic acid amplification product of nucleic acid sequence.For example, in order to determine corn plant whether by containing transgenic corn events of the present invention DBN9898 is generated by sexual hybridization mode, or whether acquisition includes transgenic corn events from the corn sample in field Whether DBN9898 or corn extract, such as coarse powder, powder or oil include transgenic corn events DBN9898, from corn plant Tissue sample or the DNA of extract extraction can be by using the nucleic acid amplification methods of primer pair to generate for transgenic corns The presence of the DNA of event DBN9898 is diagnostic amplicon.The primer pair include one in the Plant Genome with The first primer of the adjacent flanking sequence of exogenous DNA insertion point of insertion, and second draw from the exogenous DNA of insertion Object.Amplicon has certain length and sequence, and transgenic corn events DBN9898 described in the sequence pair is also diagnostic. The length range of amplicon can be that the combination length of primer pair adds a nucleotide base pair, preferably add about 50 cores Thuja acid base-pair more preferably adds about 250 nucleotide bases pair, most preferably adds about 450 nucleosides soda acids Base to or more.

Optionally, primer pair can derive from the flanking genomic sequence for being inserted into the both sides DNA, include entire be inserted into generate The amplicon of nucleotide sequence.One in the primer pair of plant genome sequences can be located at away from insertion DNA sequence dna At a certain distance from, which may range from a nucleotide base to arriving about 20,000 nucleotide bases pair.Term " amplification The use of son " has been particularly intended to exclude the primer dimer formed in the hot amplified reactions of DNA.

Nucleic acid amplification reaction can be realized by any type nucleic acid amplification reaction method known in the art, including polymerization Enzyme chain reaction (PCR).Various nucleic acid amplification methods have been well-known to those skilled in the art.PCR amplification method has been sent out Open up the phage DNA of the amplifiable up to genomic DNA of 22kb and up to 42kb.Other of these methods and this field DNA cloning method can be used for the present invention.The exogenous DNA array of insertion and flank from transgenic corn events DBN9898 DNA sequence dna can expand the genome of transgenic corn events DBN9898 by using the primer sequence provided, expand The DNA sequencing of standard is carried out after increasing to the DNA of PCR amplification or clone.

DNA detection kits based on DNA cloning method contain DNA primer molecule, they are under reaction condition appropriate On specific hybrid to target dna and expand diagnostic amplicon.Kit can provide the detection method based on Ago-Gel Or many methods of checkout and diagnosis amplicon known in the art.Containing with SEQ ID NO:3 or SEQ ID NO:4 Any part in Maize genome area it is homologous or complementary and with SEQ ID NO:Any part of 5 transgenosis insert district The kit of homologous or complementary DNA primer is provided by the present invention.Particularly differentiate useful in DNA cloning method draw Object is to being SEQ ID NO:8 and SEQ ID NO:9,5 ' transgenosis/genome of amplification and transgenic corn events DBN9898 A part of homologous diagnostic amplicon in area, wherein amplicon include SEQ ID NO:1.Other DNA as DNA primer points Son can be selected from SEQ ID NO:5.

Amplicon caused by these methods can be detected by multiple technologies.One of method is Genetic Bit Analysis, this method devise one across the DNA widows for being inserted into DNA sequence dna and adjacent flanking genomic DNA sequence Nucleotide chain.The oligonucleotide chain is fixed in the micropore of a microwell plate, after carrying out PCR amplification to target area ( A primer is respectively used in insetion sequence and in adjacent flanking genomic sequence), single stranded PCR products can be with fixed few core Thuja acid chain is hybridized, and as the template of single base extension, which has used archaeal dna polymerase and be next The ddNTPs of a expected base specific markers.Result can be obtained by fluorescence or ELISA class methods.Signal represents slotting Enter/the presence of flanking sequence, illustrates that amplification, hybridization and single base extension are successful.

Another method is Pyrosequencing (pyrosequencing) technology.This method devises one across insertion The oligonucleotide chain of DNA sequence dna and adjacent genomic DNA binding site.By the single-stranded of the oligonucleotide chain and target area Then and DNA PCR product (primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) is hybridized, Polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine -5 '-phosphorus sulfate and luciferin are together It is incubated.It is separately added into dNTPs, measures the optical signal of generation.Optical signal represents the presence of insertion/flanking sequence, says Bright amplification, hybridization and single base or polybase base extension are successful.

(the genome research (Genome Res.) 9 such as Chen:492-498,1999) Fluorescence polarization of description be also can For detecting a kind of method of amplicon of the present invention.It needs design one to cross in this way and is inserted into DNA sequence dna and phase The oligonucleotide chain of adjacent genomic DNA binding site.The single stranded PCR products of the oligonucleotide chain and target area (are being inserted Enter in sequence and respectively used in adjacent flanking genomic sequence a primer) hybridized, then with archaeal dna polymerase and one The ddNTP of kind fluorescent marker is incubated together.Single base extension can cause to be inserted into ddNTP.This insertion can utilize fluorescence Instrument measures the change of its polarization.The change of polarization represents the presence of insertion/flanking sequence, illustrates amplification, hybridization and single alkali Base extension is successful.

Taqman is described as a kind of detect and is carried in manufacturer with method, this method existing for quantitative analysis DNA sequence dna It is discussed in detail in the operation instruction of confession.It is now briefly illustrated below, designs one across insertion DNA sequence dna and adjacent base Because of the FRET oligonucleotide probes of group flank binding site.The FRET probes and PCR primer are (in insetion sequence and adjacent side A primer is respectively used in wing genome sequence) carry out circular response in the presence of heat-stabilised poly synthase and dNTPs.FRET probes Hybridization lead to the division of fluorescence part and quencher moieties and the release of fluorescence part on FRET probes.The generation of fluorescence signal The presence for representing insertion/flanking sequence illustrates that amplification and hybridization are successful.

Based on Hybridization principle, for detecting the plant material from herbicide tolerant transgenic corn events DBN9898 The suitable technology of material can also include Southern blot hybridizations, Northern blot hybridizations and in situ hybridization.Particularly, described The technology of being suitble to includes incubating probe and sample, is washed to remove whether unbonded probe and detection probe have hybridized.It is described Detection method depend on the appended type marked of probe, for example, by X-ray is exposed and developed can be with detection of radioactive labels Probe, or by substrate convert realize color change can detect enzyme label probe.

(the Nature Biotechnol (Nat.Biotech.) 14 such as Tyangi:303-308,1996) molecular labeling is described in sequence Application in row detection.It is briefly described as follows, designs one across insertion DNA sequence dna and adjacent flanking genomic binding site FRET oligonucleotide probes.The unique texture of the FRET probes causes it to contain secondary structure, which can be close Apart from interior holding fluorescence part and quencher moieties.The FRET probes and PCR primer are (in insetion sequence and adjacent flank base Because respectively using a primer in group sequence) in the presence of heat-stabilised poly synthase and dNTPs carry out circular response.By successful The hybridization of PCR amplification, FRET probes and target sequence leads to the forfeiture of probe secondary structure, to make fluorescence part and portion is quenched Divide and spatially detach, generates fluorescence signal.The generation of fluorescence signal represents the presence of insertion/flanking sequence, says Bright amplification and hybridization are successful.

The method of other descriptions, such as method that microfluid (microfluidics) provides separation and DNA amplification sample And equipment.Photoinitiator dye is for detecting and measuring specific DNA molecular.Including electronic sensor or knot for detecting DNA molecular Close specific DNA molecular receive pearl and thus can be detected receive test tube (nanotube) equipment for the detection present invention DNA point Son is useful.

Method can be described using composition of the present invention and DNA detection fields or known is examined to develop DNA Test agent box.The kit is conducive to identify the DNA that whether there is transgenic corn events DBN9898 in sample, can be with Corn plant for cultivating the DNA containing transgenic corn events DBN9898.The kit can contain DNA primer or Probe, it is same to be derived from or be complementary to SEQ ID NO:1,2,3,4 or 5 at least part, or contain other DNA primers or spy Needle, with being derived from or being complementary to DNA contained in the genetically modified element of DNA, these DNA sequence dnas can be used for DNA cloning Reaction, or as the probe in DNA hybridization method.It is containing in the corn genome and what is illustrated in Fig. 1 and table 1 turns base Because the DNA structure of insetion sequence and Maize genome binding site includes：Corn positioned at 5 ' end of transgene insert sequence is planted Object DBN9898 flanking genomes region, a part of insetion sequence of the left boundary area (LB) from Agrobacterium, first table Up to box by the cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats containing enhancer region, it is operably connected to On the phosphinothricin N-acetyl transferase (cPAT) of the glufosinate tolerant of streptomycete, and it is operably connected to cauliflower flower It is formed on mosaic virus 35S terminators (t35S), second expression cassette, can by 1 promoter of rice actin (prOsAct1) It is operationally connected on the coded sequence (spAtCTP2) of arabidopsis EPSPS chloroplast transit peptides, is operably connected to agrobacterium On the 5- enol-pyrovyl shikimic acid -3- phosphate synthases (cEPSPS) for belonging to the glyphosate tolerant of CP4 bacterial strains, it is operatively connected It is formed on to the transcription terminator (tNos) of nopaline synthase, the part in the right side boundary region (RB) from Agrobacterium is inserted Enter sequence, and corn plant DBN9898 flanking genomes region (the SEQ ID NO positioned at 3 ' end of transgene insert sequence: 5).In DNA cloning method, the DNA molecular as primer can be derived from corn plant DBN9898 transgenics and be inserted into sequence Any part of row can also be appointing for the region of DNA domain of the flank Maize genome in transgenic corn events DBN9898 What part.

Transgenic corn events DBN9898 can be combined with other transgenic maize varieties, such as herbicide tolerant is (such as 2,4-D, Mediben etc.) corn, or carry the transgenic maize varieties of other anti insect genes (such as Cry1Ab, Vip3A).Institute There are the various combinations of these different transgenic events, the breeding together with the transgenic corn events DBN9898 of the present invention, Ke Yiti For resisting a variety of insect pests and being resistant to the improvement hybrid transgenic corn varieties of a variety of herbicides.These kinds are compared to non-transgenic product The transformed variety of kind and unisexuality shape can show the superior features such as yield promotion.

The present invention provides a kind of nucleic acid sequence and its detections for detecting herbicide tolerant corn plant DBN9898 Method, the phytotoxic effects of agriculture herbicide of the transgenic corn events DBN9898 tolerances containing glyphosate and/or glufosinate-ammonium. 5- enol pyruvylshikimates-the 3- of the glyphosate resistance of the plant expression Agrobacterium strains CP4 of the dual character Phosphate synthase (EPSPS) albumen assigns tolerance of the plant to glyphosate, and expresses the phosphine silk of the glufosinate resistance of streptomycete Rhzomorph N- acetyltransferases (PAT) albumen assigns tolerance of the plant to glufosinate-ammonium.Dual character corn has following excellent Point：1) apply the ability that the agriculture herbicide containing glyphosate is used for broad-spectrum weeding control to corn crop；2) glufosinate tolerant Glufosinate-ammonium herbicide (mix or be used alternatingly with glyphosate herbicidal), which is applied in combination, in character can be used as a kind of effectively management grass The non-selective means of sweet phosphine resistant weed；3) herbicide tolerant transgenic corns are as non-pest-resistant transgenic corns, and turn Gene pest-resistant corn is planted together with certain proportion, and insect/pest can be delayed to generate resistance；4) corn yield does not reduce. In addition, coding glyphosate tolerant and glufosinate tolerant character gene linkage in same DNA section, and be present in turn On the term single gene seat of gene corn event DBN9898 genomes, this point provides the breeding efficiency of enhancing and makes it possible to The transgenic insert in reproductive population and its filial generation is tracked with molecular labeling.SEQ ID in detection method simultaneously NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series can be used as DNA primer or probe and be diagnosed as transgenic corn events DBN9898 or thereafter to generate The amplified production in generation, and can the plant material quick, accurately, stable that identified from transgenic corn events DBN9898 The presence of material.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO:The insertion point and corn gene of 5 ' transgenic fragments in 1 transgenic corn events DBN9898 11 nucleotide of every side of group DNA；

SEQ ID NO:The insertion point and corn gene of 3 ' transgenic fragments in 2 transgenic corn events DBN9898 11 nucleotide of every side of group DNA；

SEQ ID NO:It is located in 5 ' ends of insetion sequence in 3 transgenic corn events DBN9898 and is inserted into joint portion A length near position is the sequence of 1399 nucleotide；

SEQ ID NO:It is located in 3 ' ends of insetion sequence in 4 transgenic corn events DBN9898 and is inserted into joint portion A length near position is the sequence of 1371 nucleotide；

SEQ ID NO:The flank maize genomic sequence of 5 entire T-DNA sequences, 5 ' and 3 '；

SEQ ID NO:6 are located at SEQ ID NO:Sequence inside 3, span DBN10006 constructs DNA sequence dna and Pr35S promoter sequences；

SEQ ID NO:7 are located at SEQ ID NO:Sequence inside 4 spans tNos terminator sequences and DBN1000 6 construct DNA sequence dnas；

SEQ ID NO:8 amplification SEQ ID NO:3 the first primer；

SEQ ID NO:9 amplification SEQ ID NO:3 the second primer；

SEQ ID NO:10 amplification SEQ ID NO:4 the first primer；

SEQ ID NO:11 amplification SEQ ID NO:4 the second primer；

SEQ ID NO:12 5 ' primer on flanking genomic sequence；

SEQ ID NO:13 and SEQ ID NO:The primer of 12 pairings being located on T-DNA；

SEQ ID NO:14 3 ' primer on flanking genomic sequence, with SEQ ID NO:12 pairings, which can detect, to be turned Gene is homozygote or heterozygote；

SEQ ID NO:15 and SEQ ID NO:The primer of 14 pairings being located on T-DNA；

SEQ ID NO:16 Taqman detect the primer 1 of EPSPS；

SEQ ID NO:17 Taqman detect the primer 2 of EPSPS；

SEQ ID NO:18 Taqman detect the probe 1 of EPSPS；

SEQ ID NO:19 Taqman detect the primer 3 of PAT；

SEQ ID NO:20 Taqman detect the primer 4 of PAT；

SEQ ID NO:21 Taqman detect the probe 2 of PAT；

SEQ ID NO:The first primer of 22 corn endogenous gene Ubiquitin；

SEQ ID NO:The second primer of 23 corn endogenous gene Ubiquitin；

SEQ ID NO:The probe of PAT in 24 Southern hybridization checks；

SEQ ID NO:The probe of EPSPS in 25 Southern hybridization checks；

SEQ ID NO:26 are located at the primer on T-DNA, with SEQ ID NO:13 directions are consistent；

SEQ ID NO:27 are located at the primer on T-DNA, with SEQ ID NO:13 directions are on the contrary, as flank sequence is obtained Row；

SEQ ID NO:28 are located at the primer on T-DNA, with SEQ ID NO:13 directions are on the contrary, as flank sequence is obtained Row；

SEQ ID NO:29 are located at the primer on T-DNA, with SEQ ID NO:15 directions are consistent；

SEQ ID NO:30 are located at the primer on T-DNA, with SEQ ID NO:15 directions are on the contrary, as flank sequence is obtained Row；

SEQ ID NO:31 are located at the primer on T-DNA, with SEQ ID NO:15 directions are on the contrary, as flank sequence is obtained Row.

Below by drawings and examples, technical scheme of the present invention will be described in further detail.

Description of the drawings

Fig. 1 is nucleic acid sequence and its detection method of the present invention for detecting herbicide tolerant corn plant DBN9898 Transgene insert sequence and Maize genome binding site structural schematic diagram；

Fig. 2 is nucleic acid sequence and its detection method of the present invention for detecting herbicide tolerant corn plant DBN9898 Recombinant expression carrier DBN10006 structural schematic diagram.

Specific implementation mode

It is further illustrated the present invention below by specific embodiment for detecting herbicide tolerant corn plant The nucleic acid sequence of DBN9898 and its technical solution of detection method.

First embodiment, clone and conversion

1.1, carrier cloning

Use the gene clone technology structure recombinant expression carrier DBN10006 (as shown in Figure 2) of standard.The carrier DBN10006 include two concatenated transgene expression cassettes, first expression cassette by the tandem sequence repeats containing enhancer region flower Cauliflower mosaic virus 35S promoter (pr35S) is operably connected to the phosphinothricin N- second of the glufosinate tolerant of streptomycete On acyltransferase (cPAT), and it is operably connected on cauliflower mosaic virus 35S terminators (t35S) and forms；Second A expression cassette is operably connected to arabidopsis EPSPS chloroplast transit peptides by 1 promoter of rice actin (prOsAct1) On coded sequence (spAtCTP2), it is operably connected to 5- enols-acetone of the glyphosate tolerant of Agrobacterium CP4 bacterial strains On acyl shikimic acid -3- phosphate synthases (cEPSPS), it is operably connected on the transcription terminator (tNos) of nopaline synthase and group At.

The carrier DBN10006 is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA with liquid nitrogen method； Cat.No：In 18313-015), and with 5- enol pyruvylshikimate -3- phosphate synthases (EPSPS) be selected marker to turn Change cell to be screened.

1.2, Plant Transformation

It is converted using conventional Agrobacterium infestation method, by institute in the maize immature embryos of sterile culture and the present embodiment 1.1 The Agrobacterium stated co-cultures, and the T-DNA in the recombinant expression carrier DBN10006 of structure is transferred in maize chromosome group, To generate transgenic corn events DBN9898.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is detached from corn, is suspended with Agrobacterium Liquid contacts rataria, and the nucleotide sequence of the nucleotide sequence of EPSPS genes and pat gene can be transferred to children by wherein Agrobacterium At least one cell (step 1 of one of embryo：Infect step), in this step, rataria preferably immerses agrobacterium suspension (OD₆₆₀=0.4-0.6 infects culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, grape Sugared 36g/L, acetosyringone (AS) 40mg/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, pH 5.3)) in start connect Kind.Rataria co-cultures one section of period (3 days) (step 2 with Agrobacterium：Co-culture step).Preferably, rataria is after infecting step In solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetyl cloves Ketone (AS) 100mg/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, agar 8g/L, pH 5.8) on cultivate.It co-cultures herein After stage, can there are one selectivity " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS dimension He is life, casein 300mg/L, sucrose 30g/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) at least exist in it is a kind of oneself know inhibit Agrobacterium growth antibiotic (cephalosporin), do not add the selection of vegetable transformant Agent (step 3：Recovering step).Preferably, rataria is cultivated on having antibiotic but the not solid medium of selective agent, to eliminate Agrobacterium simultaneously provides convalescence for infected cell.Then, the rataria of inoculation is cultivated on the culture medium containing selective agent (glyphosate) And transformed calli (the step 4 that growth selection：Select step).Preferably, rataria is in the screening solid training for having selective agent Support base (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, N- (phosphine carboxymerhyl) glycine 0.25mol/ L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) on cultivate, cause conversion cell selection Property growth.Then, callus regeneration is at plant (step 5：Regeneration step), it is preferable that it is raw on the culture medium containing selective agent Long callus is cultivated on solid medium (MS differential mediums and MS root medias) with aftergrowth.

It screens obtained resistant calli and is transferred to the MS differential mediums (MS salt 4.3g/L, MS vitamin, cheese Plain 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, N- (phosphine carboxymerhyl) glycine 0.125mol/L, plant gel 3g/L, pH 5.8) on, differentiation is cultivated at 25 DEG C.It differentiates the seedling come and is transferred to the MS root medias (MS salt 2.15g/ L, MS vitamins, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH 5.8) on, at 25 DEG C Culture moves to hot-house culture to solid to about 10cm high.In the greenhouse, it is cultivated 16 hours at 28 DEG C daily, at 20 DEG C Culture 8 hours.

1.3, the identification and screening of transgenic event

332 separate transgenic T are produced altogether₀Plant.

Pass through TaqMan^TMIt analyzes (referring to second embodiment) and detects regenerated transgenic corn plant with the presence or absence of EPSPS And pat gene, and characterize the copy number of tolerance glyphosate and glufosinate-ammonium strain.By screening, the event DBN9898 of having selected is excellent Different, there is single copy transgenosis, good glyphosate herbicide tolerance, glufosinate-ammonium herbicide tolerant and economical character Performance (referring to the 5th embodiment).

Second embodiment carries out transgenic corn events DBN9898 detections with TaqMan

Take the blade about 100mg of transgenic corn events DBN9898 as sample, with the DNeasy Plant of Qiagen Maxi Kit extract its genomic DNA, and EPSPS genes and pat gene are detected by Taqman fluorescence probe quantitative PCR methods Copy number.Simultaneously as a contrast with wild-type corn plant, it is detected analysis according to the method described above.Experiment sets 3 repetitions, takes Average value.

The specific method is as follows：

Step 11, the blade 100mg for taking transgenic corn events DBN9898, are ground into homogenate, each in mortar with liquid nitrogen Sample takes 3 repetitions；

Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；

Step 13, the genomic DNA concentration that above-mentioned sample is measured with NanoDrop 2000 (Thermo Scientific)；

Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the ranging from 80- of the concentration value 100ng/μl；

Step 15, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR methods, with by being copied known to identification The sample of shellfish number is as standard items, and as a contrast with the sample of wild-type corn plant, 3 repetitions of each sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively：

Following primer and probe is used for detecting EPSPS gene orders：

Primer 1：SEQ ID NO in CTGGAAGGCGAGGACGTCATCAATA such as sequence table:Shown in 16；

Primer 2：SEQ ID NO in TGGCGGCATTGCCGAAATCGAG such as sequence table:Shown in 17；

Probe 1：SEQ ID NO in ATGCAGGCGATGGGCGCCCGCATCCGTA such as sequence table:Shown in 18；

Following primer and probe is used for detecting pat gene sequence：

Primer 3：SEQ ID NO in CAGTTGAGATTAGGCCAGCTACAG such as sequence table:Shown in 19；

Primer 4：SEQ ID NO in TTCACTGTAGACGTCTCAATGTAATGG such as sequence table:Shown in 20；

Probe 2：SEQ ID NO in CAGCTGATATGGCCGCGGTTTGTG such as sequence table:Shown in 21；

PCR reaction systems are：

50 × the primer/probe mixture includes each 45 μ L of each primer of 1mM concentration, 50 μ of probe of 100 μM of concentration L and 860 μ lL1 × TE buffer solutions, and at 4 DEG C, be housed in amber tube.

PCR reaction conditions are：

Data are analyzed using SDS2.3 softwares (Applied Biosystems), obtain the transgenic corn events singly copied DBN9898。

3rd embodiment, transgenic corn events DBN9898 detections

3.1, extracting genome DNA

DNA is extracted according to CTAB (cetyl trimethylammonium bromide) method routinely used：Take 2 grams of tender transgenosis beautiful After the blade of rice event DBN9898 is pulverized in liquid nitrogen, the DNA that 0.5mL is added in 65 DEG C of preheatings of temperature extracts CTAB Buffer (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetra-acetic acid), with NaOH tune pH To 8.0), after mixing well, extracted 90 minutes for 65 DEG C in temperature；0.5 times of volume of phenol is added, 0.5 times of volume of chloroform overturns mixed It is even；It is centrifuged 10 minutes under 12000rpm (revolutions per minute) rotating speed；2 times of volume absolute ethyl alcohols are added in Aspirate supernatant, soft to shake Dynamic centrifuge tube stands 30 minutes for 4 DEG C in temperature；It is centrifuged again under 12000rpm rotating speeds 10 minutes；DNA is collected to tube bottom；Abandon supernatant Liquid, the ethyl alcohol for being 70% with 1mL mass concentrations, washing precipitation；It is centrifuged 5 minutes under 12000rpm rotating speeds；Vacuum is drained or super Net platform drying；DNA is precipitated and dissolved in suitable TE buffer solutions (10mM Tris-HCl, 1mM EDTA, pH 8.0), is stored in Under the conditions of -20 DEG C of temperature.

3.2, the analysis of flanking DNA sequence

Concentration mensuration is carried out to the DNA sample of said extracted, the concentration of sample to be tested is made to be located between 80-100ng/ μ L. With restriction enzyme BamH I, Xma I, Kpn I, Sac II (5 ' end analysis) and Spe I, Pst I, the Eco57I selected (3 ' end analysis) difference digestion genomic DNA.It is added that 26.5 μ L genomic DNAs, 0.5 μ L are above-mentioned selects in each digestion system Restriction enzyme and 3 μ L enzyme cutting buffering liquids, digestion 1 hour.After waiting for digestion, 70 μ L are added into digestion system Absolute ethyl alcohol, ice bath 30 minutes, rotating speed 12000rpm are centrifuged 7 minutes, abandon supernatant, dry up, 8.5 μ L distilled waters (dd are added later H₂O)、1μL 10X T₄Buffer and 0.5 μ L T₄Ligase is stayed overnight in 4 DEG C of connections of temperature.It is carried out with a series of nested primers PCR amplification detaches 5 ' and 3 ' transgenosis/genomic DNA.Specifically, 5 ' transgenosis of separation/genomic DNA primer combination includes SEQ ID NO:13,SEQ ID NO:26 are used as the first primer, SEQ ID NO:27,SEQ ID NO:28 are used as the second primer, SEQ ID NO:13 are used as sequencing primer.It includes SEQ ID NO to detach 3 ' transgenosis/genomic DNA primer combination:15,SEQ ID NO:29 are used as the first primer, SEQ ID NO:30,SEQ ID NO:31 are used as the second primer, SEQ ID NO:15 as survey Sequence primer, PCR reaction conditions are as shown in table 3.

The amplicon obtained electrophoresis on 2.0% Ago-Gel then uses QIAquick to detach PCR reactants Gel extracts kits (catalogue #_28704, Qiagen Inc., Valencia, CA) detach target fragment from agarose matrix.So (for example, ABI PrismTM 377, PE Biosystems, Foster City, CA) is sequenced to the PCR product of purifying afterwards and is divided It analyses (for example, DNASTAR sequence analysis softwares, DNASTAR Inc., Madison, WI).

Confirm 5 ' and 3 ' flanking sequences and junction sequences using standard pcr.5 ' flanking sequences and junction sequences can make With SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9,SEQ ID NO:13 or SEQ ID NO:26 confirm. SEQ ID NO can be used in 3 ' flanking sequences and junction sequences:11 or SEQ ID NO:14, combination S EQ ID NO:10,SEQ ID NO:15 or SEQ ID NO:29 confirm.PCR reaction systems and amplification condition are as shown in table 2 and table 3.Those skilled in the art It will be understood that other primer sequences can also be used for confirming flanking sequence and junction sequences.

The DNA sequencing of PCR product provides the DNA that can be used for designing other DNA moleculars, other described DNA moleculars are made The identification of the corn plant or seed from transgenic corn events DBN9898 is used for for primer and probe.

It was found that in SEQ ID NO:5 1-1144 displays of nucleotide are maize genomic sequence in transgenic corns thing The right margin flank (5 ' flanking sequence) of part DBN9898 insetion sequences, in SEQ ID NO:5 5954-7014, nucleotide is aobvious Show the left margin flank (3 ' flanking sequence) for being maize genomic sequence in transgenic corn events DBN9898 insetion sequences. 5 ' junction sequences are in SEQ ID NO:It is listed in 1,3 ' junction sequences are in SEQ ID NO:It is listed in 2.

3.3, PCR zygosity determinations

Junction sequence is relatively short polynucleotide molecule, is new DNA sequence dna, is examined in being tested and analyzed in polynucleotide It is diagnostic for the DNA of transgenic corn events DBN9898 when measuring.SEQ ID NO:1 and SEQ ID NO:Connecing in 2 Close every side of insertion point and corn gene group DNA that sequence is transgenic corn events DBN9898 transgenic segments 11 polynucleotides.Longer or shorter polynucleotides junction sequence can be from SEQ ID NO:3 or SEQ ID NO:It is selected in 4 It selects.Junction sequence (5 ' join domain SEQ ID NO:1 and 3 ' join domain SEQ ID NO:2) DNA probe or conduct are used as DNA primer molecule is useful in DNA detection methods.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 be also transgenosis New DNA sequence dna in corn event DBN9898 can also be used as DNA probe or beautiful as DNA primer Molecular Detection transgenosis The presence of rice event DBN9898DNA.The SEQ ID NO:6(SEQ ID NO:1145-1399,3 nucleotide) it crosses over DBN10006 constructs DNA sequence dna and pr35S promoter sequences, the SEQ ID NO:7(SEQ ID NO:4 nucleotide 1-310) span tNos transcription terminators and DBN10006 construct DNA sequence dnas.

In addition, by using from SEQ ID NO:3 or SEQ ID NO:4 at least one primer generates amplicon, The diagnostic amplicon of transgenic corn events DBN9898 is generated when the primer is used in PCR method.

Specifically, PCR product is generated from 5 ' ends of transgene insert sequence, which is comprising from turning base Because in the genome of the vegetable material of corn event DBN9898 flank in the genomic DNA of 5 ' ends of T-DNA insetion sequences A part.This PCR product includes SEQ ID NO:3.In order to carry out PCR amplification, design is with flank in transgene insert sequence 5 ' ends genomic dna sequence hybridization (the SEQ ID NO of primer 5:8) turn with the paired transgenosis tNos that is located at Record (the SEQ ID NO of primer 6 of termination sequence:9).

PCR product is generated from 3 ' ends of transgene insert sequence, which includes to derive from transgenic corn events Flank is in a part for the genomic DNA of 3 ' ends of T-DNA insetion sequences in the genome of the vegetable material of DBN9898.This A PCR product includes SEQ ID NO:4.In order to carry out PCR amplification, design is with flank in 3 ' ends of transgene insert sequence (the SEQ ID NO of primer 8 of genomic dna sequence hybridization:And the pr35S of the paired 3 ' ends positioned at insert 11) (the SEQ IDNO of primer 7 of promoter sequence:10).

The DNA cloning condition illustrated in table 2 and table 3 can be used for above-mentioned PCR zygosities experiment to generate transgenic corns The diagnostic amplicon of event DBN9898.The detection of amplicon can be by using Stratagene as shown in table 3 Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycles The progress such as instrument, or carried out by methods known to those skilled in the art with equipment.

Table 2, for transgenic corn events DBN9898 5 ' transgenic insertions/genome engaging zones identification PCR Step and reaction mixture condition

Table 3, Perkin-Elmer9700 thermal cycler conditions

It lightly mixes, if not having hot top on thermal cycler, 1-2 drop mineral can be added above each reaction solution Oil.Using following loop parameter (table 3) in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or PCR is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. MJ Engine or Eppendorf Mastercycler Gradient thermal cyclers should be run under the pattern of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cyclers of Perkin-Elmer are run.

The experimental results showed that：Primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in transgenic corn events DBN9898 bases When because in the PCR reactions of group DNA, the amplified production of 1399bp segments is generated, when it is used in unconverted corn gene group DNA and non- When in the PCR reactions of DBN9898 corn gene group DNAs, no segment is amplified；Primer 7 and 8 (SEQ ID NO:10 and 11), When it is used in the PCR reactions of transgenic corn events DBN9898 genomic DNAs, the amplified production of 1371bp segments is generated, When in the PCR reactions that it is used in unconverted corn gene group DNA and non-DBN9898 corn gene group DNAs, expanded without segment Increase.

PCR zygosity determinations can be additionally used in identification from transgenic corn events DBN9898 material be homozygote or It is heterozygote.By (the SEQ ID NO of primer 9:12), (the SEQ ID NO of primer 10:And (the SEQ ID NO of primer 11 13):14) it is used for Amplified reaction is to generate the diagnostic amplicon of transgenic corn events DBN9898.The DNA cloning condition illustrated in table 4 and table 5 It can be used for above-mentioned zygosity experiment to generate the diagnostic amplicon of transgenic corn events DBN9898.

Table 4, zygosity determination reaction solution

Table 5, zygosity determination Perkin-Elmer9700 thermal cycler conditions

Using following loop parameter (table 5) Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) Or it is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler PCR.MJ Engine or Eppendorf Mastercycler Gradient thermal cyclers should be run under the pattern of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cyclers of Perkin-Elmer are run.

In the amplified reaction, the biological sample containing template DNA, which contains, diagnoses the sample transgenic corn event DBN9898 there are the DNA of situation.Or reaction will generate two by the biological sample containing the DNA from Maize genome A different DNA cloning, the DNA from Maize genome in transgenic corn events DBN9898 relative to existing The corresponding allele of insertion DNA be heterozygosis.The two different amplicons, which will correspond to, derives from wild-type corn base Because group locus the first amplicon and diagnosis transgenic corn events DBN9898DNA there are the second amplicons of situation.Only Generate the maize dna sample for the single amplicon for corresponding to the second amplicon for the description of heterozygous genes group, diagnosable determination The presence of sample transgenic corn event DBN9898, and the sample in rotaring gene corn plant DBN9898 by relative to depositing The corn seed for being inserted into the corresponding allele of DNA and being homozygous produced by.

It should be noted that the primer pair of transgenic corn events DBN9898 is used to transgenic corn events DBN9898 genomic DNAs are diagnostic amplicon.These primer pairs include but not limited to primer 5 and 6 (SEQ ID NO:8 With 9) and primer 7 and 8 (SEQ ID NO:10 and 11), in the DNA cloning method.In addition, for expanding in corn One control primer 12 of source gene and 13 (SEQ ID NO:22 and 23) be included, as in one of reaction condition Standard.DNA extracting sample analysis to transgenic corn events DBN9898 should include a transgenic corn events The assaypositive tissue DNA extracts of DBN9898 compare, and a negative DNA from non-transgenic corn event DBN9898 is extracted Object compares and a negative control for not containing template maize dna extract.Other than these primer pairs, it can also use and From SEQ ID NO:3 or SEQ ID NO:Any primer pair of 4 or its complementary series, when they are used for DNA amplification reaction It is generated respectively for being organized as diagnostic including SEQ ID NO from transgenic event corn plant DBN9898:1 or SEQ ID NO:2 amplicon.The DNA cloning condition illustrated in table 2- tables 5 is used for suitable primer pair to generate The diagnostic amplicon of transgenic corn events DBN9898.It is generated to transgenic corns thing when being tested in DNA cloning method Part DBN9898 be diagnostic amplicon, presumption contain corn plant or kind comprising transgenic corn events DBN9898 The extract of sub- DNA, or from the product of transgenic corn events DBN9898, it is used as the template of amplification, to determine With the presence or absence of transgenic corn events DBN9898.

Fourth embodiment carries out transgenic corn events DBN9898 detections by Southern blot hybridizations

4.1, it is extracted for the DNA of Southern blot hybridizations

Southern engram analysis is carried out using T4, T5 generation homozygous transformation event.Using mortar and pestle, in liquid nitrogen 10g plant tissues are arrived in grinding about 5.In 12.5mL Extraction buffers A (0.2M Tris pH8.0,50mM EDTA, 0.25M NaCl, 0.1%v/v β-dredges base ethyl alcohol, 2.5%w/v Polyvinyl-pyrrolidones) in resuspension plant tissue, with 4000rpm from The heart 10 minutes (2755g).After discarding supernatant, 2.5mL Extraction buffers B (0.2M Tris pH 8.0,50mM EDTA, 0.5M NaCl, 1%v/v β-dredges base ethyl alcohol, 2.5%w/v Polyvinyl-pyrrolidones, 3% flesh aminoacyl, 20% ethyl alcohol) in be resuspended It drifts along shallow lake, and is incubated 30 minutes at 37 DEG C.It is primary with asepsis ring mixing sample during incubation.After incubation, addition is isometric Chloroform/isoamyl alcohol (24:1) it, is gently mixed by being inverted, is centrifuged 20 minutes with 4000rpm.Water-bearing layer is collected, and is being added Add and centrifuges 5 minutes with 4000rpm to precipitate DNA after 0.54 volume isopropanol.Supernatant is discarded, and is resuspended in 500 μ LTE Floating DNA precipitations.For any existing RNA that degrades, at 37 DEG C, DNA and 1 μ L 30mg/mlLRNAase A are incubated 30 minutes, Centrifuged 5 minutes with 4000rpm, and in the presence of 0.5 volume 7.5M ammonium acetates and 0.54 volume isopropanol, by with 14000rpm centrifuges 10 minutes precipitation DNA.After discarding supernatant, the ethyl alcohol for being 70% with 500 μ L mass fractions washes precipitation, and After making it dry in 100 μ L TE resuspension.

4.2, enzymic digestion is limited

Utilize spectrophotometer or fluorometric quantification detection DNA concentration (utilizing 1 × TNE and Hoechst dyestuffs).

In 100 μ L reaction systems, 5 μ g DNA are digested every time.Disappeared respectively with restriction enzyme Sac I and Hind III Change genomic DNA, the partial sequence of the EPSPS using on T-DNA and PAT is as probe.It is warm at a proper temperature for each enzyme It educates and is digested overnight object.Sample is rotated to reduce volume to 30 μ L using SpeedVac (speed vacuum).

4.3, gel electrophoresis

Bromophenol blue Loading Dye is added to each sample in the present embodiment 4.2, and by each sample pipetting volume It onto 0.7% Ago-Gel containing ethidium bromide, is separated by electrophoresis in TBE electrophoretic buffers, the electrophoresis coagulating under 20 volts Glue is stayed overnight.

Gel is washed in 0.25M HCl 15 minutes so that DNA depurinations, are then washed with water.It is miscellaneous to set Southern traces It hands over as follows：20 thick drying trace paper are placed in disk, place 4 thin drying trace paper again thereon.In 0.4M NaOH The 1 thin trace paper of moistening in advance, and be placed on the pile, then placement 1 moistens in advance in 0.4M NaOH Hybond-N+ transfer membranes (Amersham Pharmacia Biotech, #RPN303B).Gel is seated in top, it is ensured that solidifying There is no bubble between glue and film.3 trace paper in addition impregnated in advance are placed on gel top, and are filled out with 0.4M NaOH Full buffer solution disk.With the wick connection gel stack and buffer solution disk being immersed in advance in 0.4M NaOH, DNA is transferred to film On.DNA transfers in about 4 hours are carried out at room temperature.After transfer, Hybond films are rinsed in 2 × SSC 10 seconds, DNA passes through UV Crosslinking is combined with film.

4.4, hybridize

It is prepared for probe with the DNA sequence dna that PCR amplification is suitble to.The DNA probe is SEQ ID NO:24 and SEQ ID NO:25, or it is homologous or complementary with above-mentioned Sequence.25ng DNA probes are boiled 5 minutes in 45 μ LTE, are put on ice It sets 7 minutes, is then transferred into Rediprime II (Amersham Pharmacia Biotech, #RPN1633) test tube.To Rediprime test tubes add 5 μ l³²After the dCTP of P labels, in 37 DEG C of incubation probes 15 minutes.According to the manufacturer's instructions, It is centrifuged by micro- centrifugation G-50 pillars (Amersham Pharmacia Biotech, #27-5330-01), is not incorporated into removal DNTPs purifies the probe.Probe activity is measured using scintillation counter.

By in 65 DEG C of Church prehybridization solutions (500mM Na with 20mL pre-heatings₃P0₄, 1mM EDTA, 7%SDS, 1%BSA) moisten the Hybond films 30 minutes, the prehybridization Hybond films.It boils the probe of label 5 minutes, and puts on ice It sets 10 minutes.Appropriate probe (per 1,000,000 countings of 1mL pre-hybridization buffers) is added to pre-hybridization buffer, overnight at 65 DEG C Hybridized.Second day, hybridization buffer is discarded, with (the 40mM Na of 20mLChurch rinse solutions 1₃P0₄, 1mM EDTA, 5% SDS, 0.5%BSA) rinsing after, at 65 DEG C, film is washed 20 minutes in 150mL Church rinse solutions 1.It is rinsed with Church (the 40mM Na of solution 2₃P0₄, 1mM EDTA, 1%SDS) and repeat the process 2 times.The film is exposed to phosphorus screen or X-ray to detect The position that probe combines.

Include three kinds of control samples on each Southern：(1) DNA of the segregant of negative (unconverted) is come from, For identify it is any can be with the endogenous corn sequence of element-specific probe hybridization；(2) DNA from negative segregant, wherein The DBN10006 of Hind III- digestion is introduced, amount is equivalent to a copy number based on probe length, beautiful in detection with explanation When individual gene in rice genome copies, the sensitivity of the experiment；(3) copy number is equivalent to based on probe length The DBN10006 plasmids of Hind III- digestion, the sensitivity as the positive control hybridized and for illustrating experiment.

The evidence that hybridization data provides confirmation supports TaqMan^TMPCR is analyzed, i.e. corn plant DBN9898 contains EPSPS It is copied with the list of pat gene.Using the EPSPS probes, Sac I and Hind III enzymolysis generate size about 7.8kb and 5kb respectively Single band；Using the PAT probes, Sac I and Hind III enzymolysis generate the single item of size about 10kb and 11kb respectively Band.This shows that each copy of EPSPS and PAT is present in corn transformation event DBN9898.

The herbicide tolerant detection of 5th embodiment, event

This experiment selects agriculture up to herbicide (41% glyphosate-isopropylammonium aqua) and protects examination up to herbicide (active ingredient 18% glufosinate-ammonium) it is sprayed.Using RANDOMIZED BLOCK DESIGN, 3 repetitions.Plot area is 15m²(5m × 3m), line-spacing 60cm, spacing in the rows 25cm, conventional cultivation management have the wide isolation strip of 1m between cell.Transgenic corn events DBN9898 is distinguished Carry out following 3 kinds of processing：1) it does not spray；2) it presses 1680g a.e./ha dosage and sprays agriculture up to herbicide, then in V8 in the V3 leaf phases Phase is sprayed agriculture by same dose and reaches herbicide again；3) it presses 800g a.i./ha dosage and sprays guarantor's examination up to (Basta) in the V3 leaf phases Then herbicide is sprayed guarantor's examination by same dose in the V8 phases and reaches (Basta) herbicide again.It should be noted that different content It is converted into the form of equivalent glyphosate with the glyphosate herbicidal of dosage form and the glufosinate-ammonium solution of various concentration is converted into Equivalent active ingredient glufosinate-ammonium is stated to be suitable for draw a conclusion.

Symptom of chemical damage is investigated within 1 week and 2 weeks after medication respectively, and the corn yield of cell is measured in harvest.Poisoning disease Shape classification is as shown in table 6.The index for using the aggrieved rate of herbicide as the herbicide tolerant of evaluation transformation event is specifically removed The careless aggrieved rate of agent (%)=∑ (aggrieved strain number × number of levels at the same level)/(total strain number × highest level)；The wherein aggrieved rate of herbicide Including the aggrieved rate of glyphosate and the aggrieved rate of glufosinate-ammonium, the aggrieved rate of herbicide is the medicine according to 2 weeks after glyphosate or glufosinate-ammonium processing Evil investigation result and determination.The corn yield of each cell is the niblet total output (weight) for weighing 3 rows among each cell, Volume variance between different disposal is measured in the form of yield percentage, and yield percentage (%)=spraying yield/does not spray Apply yield.The results are shown in Table 7 for results and corn yield of the transgenic corn events DBN9898 to herbicide tolerant.

Table 6, herbicide are to the grade scale of corn phytotoxicity degree

Poisoning rank	Symptom describes
		1	Growth is normal, without any damage symptoms
2	Slight poisoning, poisoning are less than 10%
		3	Medium poisoning can restore, not influence yield later
4	Poisoning is heavier, it is difficult to restore, cause the underproduction
		5	Poisoning is serious, cannot restore, and causes the apparent underproduction or total crop failure

Table 7, transgenic corn events DBN9898 are to the result and corn yield result of herbicide tolerant

As a result illustrate, in terms of herbicide (glyphosate and glufosinate-ammonium) aggrieved rate：1) transgenic corn events DBN9898 exists Aggrieved rate is essentially 0 under glyphosate herbicidal (1680g a.e./ha) processing；Transgenic corn events DBN9898 is in glufosinate-ammonium Aggrieved rate is also essentially 0 under herbicide (800g a.i./ha) processing；Transgenic corn events DBN9898 has good as a result, Herbicide (glyphosate and glufosinate-ammonium) tolerance.

In terms of yield：Transgenic corn events DBN9898 do not spray, glyphosate herbicidal (1680g a.e./ha) There is no notable difference with the lower yield of 3 kinds of processing of glufosinate-ammonium herbicide (800g a.i./ha)；After herbicide spraying, transgenosis is beautiful The yield of rice event DBN9898 does not reduce substantially, and it is good to further demonstrate that transgenic corn events DBN9898 has as a result, Herbicide (glyphosate and glufosinate-ammonium) tolerance.

Sixth embodiment

Can such as agricultural product or commodity be produced by transgenic corn events DBN9898.If in the agricultural product or commodity In detect enough expression quantity, the agricultural product or commodity are expected containing can diagnose transgenic corn events DBN9898 materials Expect the nucleotide sequence present in the agricultural product or commodity.The agricultural product or commodity include but not limited to corn oil, jade Rice coarse powder, maize flour, corn gluten, corn-dodger, cornstarch and will be as food source for any other of animal consumption Food or additionally as the ingredient in swelling agent or make-up composition for cosmetic use etc..Based on probe or primer pair Nucleic acid detection method and/or kit can be developed to detect such as SEQ ID NO in biological sample:1 or SEQ ID NO:2 Shown in transgenic corn events DBN9898 nucleotide sequences, wherein probe sequence or primer sequence be selected from such as SEQ ID NO: 1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4 and SEQ ID NO:Sequence shown in 5, to diagnose transgenosis jade The presence of rice event DBN9898.

In conclusion transgenic corn events DBN9898 of the present invention has glyphosate herbicidal and glufosinate-ammonium herbicide Preferable tolerance, on yield without influence, and whether it includes to turn base that detection method can be identified quickly and accurately in biological sample Because of the DNA molecular of corn event DBN9898.

Corresponding to the seed of transgenic corn events DBN9898 China Microbiological bacterium has been deposited on December 24th, 2014 Kind preservation administration committee's common micro-organisms center (abbreviation CGMCC, address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, in Institute of microbiology of the academy of sciences of state, postcode 100101), Classification And Nomenclature：Corn (Zea mays), deposit number CGMCC No.10217.Preserved material will be 30 years in depository's preservation.

It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, it will be understood by those of ordinary skill in the art that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit of the technical scheme of the invention and range.

Claims (27)

1. a kind of nucleic acid sequence, which is characterized in that including SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or Its complementary series, the nucleic acid sequence be originated from transgenic corn events DBN9898, the transgenic corn events DBN9898 with The form of seed and to be preserved in China Committee for Culture Collection of Microorganisms with deposit number CGMCC No.10217 commonly micro- Bio-Centers.

2. nucleic acid sequence according to claim 1, which is characterized in that the nucleic acid sequence includes SEQ ID NO:3 or its Complementary series, and/or SEQ ID NO:4 or its complementary series.

3. nucleic acid sequence according to claim 2, which is characterized in that the nucleic acid sequence includes SEQ ID NO:5 or its Complementary series.

4. a kind of method existing for DNA of detection sample transgenic corn event DBN9898, which is characterized in that including：

Detected sample is set to be contacted in nucleic acid amplification reaction at least two primers；

Carry out nucleic acid amplification reaction；

Detect the presence of amplified production；

The amplified production includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its complementary series；

The amplified production is originated from transgenic corn events DBN9898, and the transgenic corn events DBN9898 is with the shape of seed Formula and China Committee for Culture Collection of Microorganisms's common micro-organisms center is preserved in deposit number CGMCC No.10217.

5. method existing for the DNA of detection sample transgenic corn event DBN9898 according to claim 4, feature It is, the amplified production further includes SEQ ID NO:6 or its complementary series and/or SEQ ID NO:7 or its complementary series.

6. method existing for the DNA of the detection sample transgenic corn event DBN9898 according to claim 4 or 5, special Sign is that described two primers include SEQ ID NO:8 and SEQ ID NO:9 or SEQ ID NO:10 and SEQ ID NO: 11。

7. a kind of method existing for DNA of detection sample transgenic corn event DBN9898, which is characterized in that including：

Detected sample is set to be contacted with probe, the probe includes SEQ ID NO:1 or its complementary series or SEQ ID NO: 2 or its complementary series, the source probe transgenic corn event DBN9898, the transgenic corn events DBN9898 is to plant Son form and China Committee for Culture Collection of Microorganisms's commonly micro- life is preserved in deposit number CGMCC No.10217 Object center；

The detected sample and the probe is set to hybridize under stringent hybridization conditions；

Detect the hybridisation events of the detected sample and the probe.

8. method existing for the DNA of detection sample transgenic corn event DBN9898 according to claim 7, feature It is, the probe also has SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

9. special according to method existing for the DNA of the detection sample transgenic corn event DBN9898 of claim 7 or 8 Sign is that at least one probe is marked at least one fluorophor.

10. a kind of method existing for DNA of detection sample transgenic corn event DBN9898, which is characterized in that including：

Detected sample is set to be contacted with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:1 or its mutually Complementary series or SEQ ID NO:2 or its complementary series, the marker nucleic acid molecules are originated from transgenic corn events DBN9898, the transgenic corn events DBN9898 are preserved in the form of seed and with deposit number CGMCC No.10217 China Committee for Culture Collection of Microorganisms's common micro-organisms center；

The detected sample and the marker nucleic acid molecules is set to hybridize under stringent hybridization conditions；

The hybridisation events of the detected sample and the marker nucleic acid molecules are detected, and then pass through marker assistant breeding point Analysis is to determine that glyphosate tolerant and/or glufosinate tolerant and marker nucleic acid molecules are chain on science of heredity.

11. method existing for the DNA of detection sample transgenic corn event DBN9898 according to claim 10, special Sign is that the marker nucleic acid molecules further include SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its mutually Complementary series.

12. a kind of DNA detection kits, which is characterized in that including at least one DNA molecular, the DNA molecular includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series, it can be used as transgenic corn events DBN9898 or its offspring have one of DNA primer of specificity or probe；The DNA molecular is originated from transgenic corn events DBN9898, the transgenic corn events DBN9898 are preserved in the form of seed and with deposit number CGMCC No.10217 China Committee for Culture Collection of Microorganisms's common micro-organisms center.

13. according to DNA detection kits described in claim 12, which is characterized in that further include when the DNA molecular is as probe SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.

14. a kind of method generating the plant that there is tolerance to glyphosate herbicidal, which is characterized in that including by gene Include SEQ ID NO successively in group:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 corn is planted Strain, hybridizes with another plant, to generate a large amount of progeny plants；It includes SEQ ID NO to select genome successively:1, SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or genome include SEQ ID NO:5 filial generation Plant, and the progeny plant has glyphosate tolerant.

15. according to the method for generating the plant that there is tolerance to glyphosate herbicidal described in claim 14, feature It is, including：

By first parental maize plants of transgenic corn events DBN9898 to glyphosate herbicidal with tolerance and lack grass Second parental maize plant sexual hybridization of sweet phosphine tolerance, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate herbicidal；

The progeny plant of selection tolerance glyphosate；

The transgenic corn events DBN9898 is preserved in China in the form of seed and with deposit number CGMCC No.10217 Microbiological Culture Collection administration committee common micro-organisms center.

16. a kind of method generating the plant that there is tolerance to glufosinate-ammonium herbicide, which is characterized in that including by gene Include SEQ ID NO successively in group:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 corn is planted Strain, hybridizes with another plant, to generate a large amount of progeny plants；It includes SEQ ID NO to select genome successively:1, SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or genome include SEQ ID NO:5 filial generation Plant, and the progeny plant has glufosinate tolerant.

17. according to the method for generating the plant that there is tolerance to glufosinate-ammonium herbicide described in claim 16, feature It is, including：

By first parental maize plants of transgenic corn events DBN9898 to glufosinate-ammonium herbicide with tolerance and lack grass Second parental maize plant sexual hybridization of ammonium phosphine tolerance, to generate a large amount of progeny plants；

The progeny plant described in glufosinate-ammonium herbicide treatment；

The progeny plant of selection tolerance glufosinate-ammonium；

The transgenic corn events DBN9898 is preserved in China in the form of seed and with deposit number CGMCC No.10217 Microbiological Culture Collection administration committee common micro-organisms center.

18. a kind of method generating the plant that there is tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, feature It is, including will includes SEQ ID NO successively in genome:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 plant hybridizes with another plant, to generate a large amount of progeny plants；Selection genome wraps successively The NO of ID containing SEQ:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or genome include SEQ ID NO:5 progeny plant, and the progeny plant has glyphosate and glufosinate tolerant.

19. according to the plant that there is tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide is generated described in claim 18 Method, which is characterized in that including：

There to be the first parents of transgenic corn events DBN9898 of tolerance beautiful glyphosate herbicidal and glufosinate-ammonium herbicide Rice plant and the second parental maize plant sexual hybridization for lacking glyphosate and/or glufosinate tolerant, to generate big quantum For plant；

The progeny plant described in glyphosate herbicidal and glufosinate-ammonium herbicide treatment；

The progeny plant of selection tolerance glyphosate and glufosinate-ammonium；

The transgenic corn events DBN9898 is preserved in China in the form of seed and with deposit number CGMCC No.10217 Microbiological Culture Collection administration committee common micro-organisms center.

20. a kind of method that culture has glyphosate herbicidal the corn plant of tolerance, which is characterized in that including：

An at least corn seed is planted, the nucleic acid sequence of specific region, the spy are included in the genome of the corn seed The nucleic acid sequence for determining region includes SEQ ID NO successively:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or the specific region nucleic acid sequence include SEQ ID NO:5；

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of the specific region with other The plant of sequence compares the plant with the plant injury weakened.

21. a kind of method that culture has glufosinate-ammonium herbicide the corn plant of tolerance, which is characterized in that including：

An at least corn seed is planted, the nucleic acid sequence of specific region, the spy are included in the genome of the corn seed The nucleic acid sequence for determining region includes SEQ ID NO successively:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or the specific region nucleic acid sequence include SEQ ID NO:5；

The corn seed is set to grow up to plant；

The plant described in effective dose glufosinate-ammonium herbicide spray, harvest do not have the nucleic acid of the specific region with other The plant of sequence compares the plant with the plant injury weakened.

22. a kind of method that culture has glyphosate herbicidal and glufosinate-ammonium herbicide the corn plant of tolerance, feature It is, including：

An at least corn seed is planted, the nucleic acid sequence of specific region, the spy are included in the genome of the corn seed The nucleic acid sequence for determining region includes SEQ ID NO successively:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or the specific region nucleic acid sequence include SEQ ID NO:5；

The corn seed is set to grow up to plant；

The plant described in effective dose glyphosate herbicidal and glufosinate-ammonium herbicide spray, harvest do not have described with other The plant of the nucleic acid sequence of specific region compares the plant with the plant injury weakened.

23. a kind of protecting the plants from the method damaged caused by herbicide, which is characterized in that including effective dose will be contained Glyphosate and/or the herbicide of glufosinate-ammonium are applied to the big Tanaka for planting at least one rotaring gene corn plant, the transgenosis Corn plant includes SEQ ID NO successively in its genome:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or the rotaring gene corn plant genome in include SEQ ID NO:5；The rotaring gene corn plant tool There is the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.

24. a kind of method of control weeds in field, which is characterized in that including effective dose glyphosate and/or glufosinate-ammonium will be contained Herbicide be applied to the big Tanaka for planting at least one rotaring gene corn plant, the rotaring gene corn plant is in its genome In successively include SEQ ID NO:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or described Include SEQ ID NO in the genome of rotaring gene corn plant:5；The rotaring gene corn plant has to glyphosate herbicidal And/or the tolerance of glufosinate-ammonium herbicide.

25. a kind of method of the crop field glyphosate resistance weeds of control glyphosate-tolerant plant, which is characterized in that including inciting somebody to action Herbicide containing effective dose glufosinate-ammonium is applied to the big of the rotaring gene corn plant for planting at least one glyphosate tolerant The rotaring gene corn plant of Tanaka, the glyphosate tolerant include SEQ ID NO successively in its genome:1,SEQ ID NO:5 1214-5801 nucleic acid sequences and SEQ ID NO:2 or the glyphosate tolerant rotaring gene corn plant Include SEQ ID NO in genome:5；The rotaring gene corn plant of the glyphosate tolerant has to glufosinate-ammonium weeding simultaneously The tolerance of agent.

26. a kind of method delaying insect-resistant, which is characterized in that be included in plant pest-resistant corn plant big Tanaka plant to A kind of few rotaring gene corn plant with glyphosate and/or glufosinate tolerant, the glyphosate and/or glufosinate tolerant Rotaring gene corn plant in its genome successively include SEQ ID NO:1,SEQ ID NO:5 1214-5801 nucleic acid Sequence and SEQ ID NO:2 or the rotaring gene corn plant of the glyphosate and/or glufosinate tolerant genome in wrap The NO of ID containing SEQ:5.

27. a kind of agricultural product or commodity being produced from transgenic corn events DBN9898, which is characterized in that the agricultural product or Commodity are corn flour, maize flour, corn oil, cornstarch, corn gluten, corn-dodger, cosmetics or filler；The transgenosis Corn event DBN9898 is preserved in Chinese microorganism strain preservation in the form of seed and with deposit number CGMCC No.10217 Administration committee's common micro-organisms center.