CN116640879A

CN116640879A - Transgenic maize event p2DBEN-CP-BZ-12 and detection method thereof

Info

Publication number: CN116640879A
Application number: CN202310889917.0A
Authority: CN
Inventors: 宋喻鑫睿; 陈茹梅; 曹筠嵩; 柳小庆; 马旭辉; 吕一帆
Original assignee: Jiekang Biotechnology Hainan Co ltd
Current assignee: Jiekang Biotechnology Hainan Co ltd
Priority date: 2023-07-20
Filing date: 2023-07-20
Publication date: 2023-08-25

Abstract

The present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO. 1-7 or the complement thereof, said nucleic acid sequence being derived from the maize event p2DBEN-CP-BZ-12. The transgenic corn event of the invention contains a gene associated with an astaxanthin synthesis pathwayCrBKT、HpCrtZ、PaCrtI、ZmPSY1The metabolic flux of astaxanthin synthesis in corn seeds is broadened, thereby generating astaxanthin-rich corn events which can be used as a reliable source of monascus purpureus astaxanthin in the feed industry. The corn plant of the invention has the following advantages: can produce high contentAstaxanthin corn of (a); corn crops that can tolerate the common commercial herbicide glufosinate; the corn yield is not reduced; the economic benefit of corn is enhanced, and the molecular markers can be used for tracking transgenic inserts in breeding populations and offspring thereof.

Description

Transgenic maize event p2DBEN-CP-BZ-12 and detection method thereof

Technical Field

The invention belongs to the technical field of molecular biology, relates to a detection method of transgenic plants and products thereof, and particularly relates to a nucleic acid sequence and a method for functional verification of astaxanthin, wherein the nucleic acid sequence and the method are used for detecting transgenic corn event p2DBEN-CP-BZ-12 which synthesizes astaxanthin by utilizing corn and tolerates application of glufosinate-ammonium herbicide.

Background

The plant growth only needs the greenhouse conditions such as sunlight, water, soil and the like. The construction of a greenhouse is cheaper than the bioreactor set required for culture systems for bacteria, mammalian and insect cells, etc. In addition, the yield of various beneficial plant nutrients may be increased or decreased proportionally to the number of plants planted. Unlike conventional production systems, zoopathogens cannot infect plants and therefore do not become a source of contamination for molecular agricultural derived products. The safety and feasibility of this approach was also demonstrated in the development of edible vaccines in phase 1 clinical trials of proof of concept, indicating that new edible plant vaccines can now produce meaningful immune responses. However, further optimization is required prior to clinical acceptance of these candidate vaccines. Ensuring that edible plant vaccines do not cause plant allergy critical to the production, especially for widely consumed plants such as rice, grain and maize. Since then, the yield of recombinant proteins produced in plants has increased substantially, indicating that new edible plant vaccines can now produce meaningful immune responses. Zhou Qin, liu Yaoguang et al, in Trends in Biotechnology, entitled "Molecular farming using transgenic rice endosperm" and the like, summarize the advantages and disadvantages of rice endosperm as a bioreactor and expand the concept of molecular farms. The rice endosperm is the main synthesis site of starch and the main edible part of rice. Because of the advantages of rich genetic and biological information resources, capability of expressing exogenous proteins and metabolites, easiness in extracting and processing target products, lower production cost, higher biosafety and the like, the recombinant medical protein polypeptide and bioactive substances are widely used for producing recombinant medical protein polypeptides and bioactive substances in molecular agriculture. Corn (Zea mays l.) is the predominant food crop in many parts of the world. Biotechnology has been applied to corn to improve its agronomic traits and quality. How to increase the content of target products, the rice endosperm and corn endosperm active substances are utilized to represent the future development direction of plant molecular farms.

As ketocarotenoids, astaxanthin synthesis has a complete anabolic pathway in bacteria, fungi, algae and a few plants. The anabolic pathway of carotenoids varies greatly among species, for example flowering plants (Hirschberg, 2001), and geranylgeranyl pyrophosphate (GGPP) is produced by a multi-step reaction with glyceraldehyde-3-phosphate (GA 3P) and pyruvic acid as starting substrates. The latter two molecules of GGPP form phytoene under the action of Phytoene Synthase (PSY), which is the rate-limiting node for carotenoid synthesis. After lycopene is formed by oxidation, branching is carried out, one path is carried out towards the direction of lutein (lutein) under the action of LCY-e, the other path is carried out towards the direction of beta-carotene (beta-carotenes), and finally abscisic acid ABA is formed. However, accumulation of some intermediates such as β -carotene and zeaxanthin (zeaxanthin) can cause the corresponding tissue and organ to appear yellow to orange-red in various transition colors. Whereas beta-carotene is widely used for commercial development as a precursor substance of vitamin a.

Astaxanthin has a high added value as an additive in foods, feeds, health products, pharmaceuticals and cosmetics, and thus genetic engineering studies on astaxanthin have been carried out in algae and microorganisms first. Because these recipient organisms lack a mechanism to store astaxanthin, the yields of astaxanthin produced by algae and microorganisms in bioreactors are generally not high. Thus, astaxanthin genetic engineering with plants as bioreactors has been developed. First, attempts were made in model plant tobacco, where PaCrtI-introduced tobacco first synthesized astaxanthin in flowers (Mann et al, 2000), and astaxanthin synthesized in transgenic tobacco leaves using the same genes but with a constitutive promoter was 165 μg/g dry weight (Zhu et al, 2007). While the amount of astaxanthin accumulated in transgenic tobacco and tomato expressing marine bacteria (Paracoccus) CrtW and CrtZ simultaneously was increased but still very small (Ralley et al 2004), crtW and CrtZ of the other marine bacteria (Brevundimonas sp., strain SD 212) gave astaxanthin contents in transgenic tobacco leaves as high as 5.44 mg/g dry weight by chloroplast transformation (Hasunuma et al 2008). After transfer of the ketolase gene BKT from Haematococcus pluvialis to potato and carrot, the amount of astaxanthin accumulated was 14. Mu.g/g dry weight (Morris et al, 2006) and 91.6. Mu.g fresh weight (Jayaraj et al, 2008), respectively. After transformation of the task of the university of Beijing Chen Feng into the ketolase genes BKT from three species of algae, respectively, from Arabidopsis thaliana and tobacco, comparative analysis found that CrBKT from Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) resulted in the accumulation of astaxanthin up to 2.07 mg/g dry weight (Zhong et al, 2011) and 1.60 mg/g dry weight (Huang et al, 2012), respectively, in transgenic crops, which further expressed CrBKT and hydroxylase gene HpBHY from Haematococcus pluvialis in tomatoes at the same time, the astaxanthin accumulation in transgenic tomato fruits reached 16.1 mg/g dry weight (Huang et al, 2013). Only one example of the studies on astaxanthin genetic engineering in corn has been conducted, and the studies have obtained transgenic corn kernels simultaneously expressing CrBKT and BrCrtZ (Brevundimonas sp., strain SD 212) by means of gene gun co-transformation, and accumulated 16.77. Mu.g/g dry weight of astaxanthin (Farre et al., 2016), but there have been problems of foreign gene fragmentation and gene isolation due to transformation and lack of evaluation of astaxanthin characteristics in germplasm, and no similar study has been conducted in corn to serve the astaxanthin market demand in China. Lycopene is an important node in the supply chain of precursors for astaxanthin biosynthesis, and there are various enzymes in astaxanthin production that catalyze the biosynthetic pathway of beta-carotene or zeaxanthin to astaxanthin. The corn lacks lycopene, so compared with tomatoes and algae, the astaxanthin content is low, but the astaxanthin-rich corn is created, the effectiveness and ductility of the nutrition-enriched product are improved to a great extent, and the created nutrition-enriched product has a wide application prospect.

In addition to the functional gene itself, the choice of regulatory elements and their sequential arrangement are critical for obtaining good transformation events and their technical effects are unpredictable. It is also known that the expression of exogenous genes in plants is affected by their insertion into maize genome, possibly due to the proximity of chromatin structures (e.g., heterochromatin) or transcriptional regulatory elements (e.g., enhancers) to the site of integration. For this reason, it is often necessary to screen a large number of events to make it possible to identify events that can be commercialized (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene may vary greatly between events; there may also be differences in the spatial or temporal pattern of expression, such as differences in the relative expression of transgenes between different plant tissues, which differences may be manifested in actual expression patterns that are inconsistent with the expression patterns expected for the transcriptional regulatory elements in the introduced gene construct. Thus, it is often desirable to generate hundreds or thousands of different events and screen those events for a single event having transgene expression levels and patterns that are expected for commercialization purposes.

It would be beneficial to be able to detect the presence of a particular event to determine whether the progeny of a sexual cross contain a gene of interest. In addition, methods of detecting specific events will also help to comply with relevant regulations, such as the need for formal approval and marking of foods derived from recombinant crops prior to their being put on the market. It is possible to detect the presence of the transgene by any well known polynucleotide detection method, such as Polymerase Chain Reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods are generally focused on commonly used genetic elements such as promoters, terminators, marker genes, and the like. Thus, unless the sequence of chromosomal DNA adjacent to the inserted transgenic DNA ("flanking DNA") is known, such a method as described above cannot be used to distinguish between different events, particularly those generated with the same DNA construct. Therefore, it is common today to identify a transgene specific event by PCR using a pair of primers spanning the junction of the inserted T-DNA and flanking DNA, specifically a first primer comprising the flanking sequence and a second primer comprising the inserted sequence.

Disclosure of Invention

The invention aims to provide a transgenic corn event P2DBEN-CP-BZ-12, a nucleic acid sequence for detecting corn plant P2DBEN-CP-BZ-12 event and a detection method thereof, which can accurately and rapidly identify whether a biological sample contains a DNA molecule of a specific transgenic corn event P2 DBEN-CP-BZ-12.

To achieve the above object, the present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO 1-7 (i.e., SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7) or the complement thereof. In some embodiments, the nucleic acid sequence is derived from a plant, seed, or cell comprising the maize event P2DBEN-CP-BZ-12, a representative sample of the seed comprising the event having been deposited at the chinese collection of typical culture under accession number cctccc No. P202331 at day 29 of 2023 (abbreviated cccc, address: within the university of armed forces, inc. Of kangaroo, no. 299, university of armed university, inc. Of armed forces, inc. Of hubei.), classification nomenclature: corn seed 2DBEN-CP-BZ-12 Zea mays L.2 DBEN-CP-BZ-12. In some embodiments, the nucleic acid sequence is an amplicon diagnostic for the presence of maize event p 2DBEN-CP-BZ-12.

In some embodiments of the invention, the invention provides a nucleic acid sequence comprising at least 11 consecutive nucleotides of SEQ ID NO. 3 or a complement thereof and/or at least 11 consecutive nucleotides of SEQ ID NO. 4 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 1 or a complement thereof, and/or SEQ ID NO. 2 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 3 or a complement thereof, and/or SEQ ID NO. 4 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID NO. 5 or a complement thereof.

The SEQ ID NO. 1 or the complementary sequence thereof is a sequence with the length of 31 nucleotides, which is positioned near the insertion junction at the 5 '-end of the insertion sequence in the transgenic corn event p2DBEN-CP-BZ-12, the SEQ ID NO. 1 or the complementary sequence thereof spans the flanking genomic DNA sequence of the corn insertion site and the DNA sequence at the 5' -end of the insertion sequence, and the existence of the transgenic corn event p2DBEN-CP-BZ-12 can be identified by the SEQ ID NO. 1 or the complementary sequence thereof. The SEQ ID NO. 2 or the complementary sequence thereof is a sequence with the length of 22 nucleotides, which is positioned near the insertion junction position at the 3 '-end of the insertion sequence in the transgenic corn event P2DBEN-CP-BZ-12, the SEQ ID NO. 2 or the complementary sequence thereof spans the DNA sequence at the 3' -end of the insertion sequence and the flanking genomic DNA sequence of the corn insertion site, and the existence of the transgenic corn event P2DBEN-CP-BZ-12 can be identified by the SEQ ID NO. 2 or the complementary sequence thereof.

The nucleic acid sequences provided herein can be at least 11 or more contiguous polynucleotides (first nucleic acid sequences) of any portion of the transgene insert sequence in SEQ ID No. 3 or its complement, or at least 11 or more contiguous polynucleotides (second nucleic acid sequences) of any portion of the 5' flanking maize genomic DNA region in SEQ ID No. 3 or its complement. The nucleic acid sequence may further be homologous or complementary to a portion of the SEQ ID NO. 3 comprising the complete SEQ ID NO. 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a pair of DNA primers in a DNA amplification method that produces an amplification product. The presence of transgenic maize event p2DBEN-CP-BZ-12 or its progeny can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO 1. It is well known to those skilled in the art that the first and second nucleic acid sequences need not consist of only DNA, but may include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogs thereof that do not serve as templates for one or more polymerases. Furthermore, the probes or primers described in the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which may be selected from the nucleotides set forth in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5. When selected from the group consisting of the nucleotides set forth in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, the probes and primers may be about 17 to 50 or more consecutive nucleotides in length. The sequence of SEQ ID NO. 3 or the complementary sequence thereof is a 1012 nucleotide long sequence positioned near the insertion junction at the 5 'end of the insertion sequence in transgenic maize event p2DBEN-CP-BZ-12, the SEQ ID NO. 3 or the complementary sequence thereof consists of 725 nucleotide maize flanking genomic DNA sequence (nucleotides 1-725 of SEQ ID NO. 3), 25 nucleotide p2BDEN-CP-BZ construct DNA sequence (nucleotides 735-759 of SEQ ID NO. 3) and 253 nucleotide 3' end DNA sequence of the Nos terminator (nucleotides 760-1012 of SEQ ID NO. 3), and the inclusion of the SEQ ID NO. 3 or the complementary sequence thereof can be identified as the presence of transgenic maize event p2 DBEN-CP-BZ-12.

The nucleic acid sequence may be at least 11 or more contiguous polynucleotides (third nucleic acid sequence) of any portion of the transgene insert sequence in the SEQ ID NO. 4 or its complement, or at least 11 or more contiguous nucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking maize genomic DNA region in the SEQ ID NO. 4 or its complement. The nucleic acid sequence may further be homologous or complementary to a portion of the SEQ ID NO. 4 comprising the complete SEQ ID NO. 2. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, the method of amplifying DNA to produce an amplified product includes a pair of DNA primers. The presence of transgenic maize event p2DBEN-CP-BZ-12 or its progeny can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO. 2. The sequence of SEQ ID NO. 4 or the complementary sequence thereof is 834 nucleotide in length near the insertion junction in the 3' -end of the insertion sequence of transgenic corn event p2DBEN-CP-BZ-12, the SEQ ID NO. 4 or the complementary sequence thereof consists of 150 nucleotide phosphomeflavone acetyl transferase gene Bar sequence (nucleotide 1-150 of SEQ ID NO. 4), 271 nucleotide p2BDEN-CP-BZ construct DNA sequence (nucleotide 151-421 of SEQ ID NO. 4) and 413 nucleotide corn integration site flanking genomic DNA sequence (nucleotide 422-834 of SEQ ID NO. 4), and the inclusion of the SEQ ID NO. 4 or the complementary sequence thereof can be identified as the presence of transgenic corn event p2 DBEN-CP-BZ-12.

The SEQ ID NO. 5 or the complementary sequence thereof is a sequence which characterizes transgenic corn event p2DBEN-CP-BZ-12 and has the length of 11127 nucleotides, and the genome and genetic elements which the SEQ ID NO. 5 specifically comprises are shown in Table 1. The presence of the transgenic maize event p2DBEN-CP-BZ-12 can be identified by inclusion of the SEQ ID NO 5 or its complement.

Table 1, genome and genetic element contained in SEQ ID NO. 5

Genetic element	Length of	At position on SEQ ID NO. 5
			5' genome	725bp	1-725
RB region	25bp	735-759
			Nos	253bp	760-1012
Nos	253bp	1047-1299
			CrBKT	984bp	1306-2289
ssu1	141bp	2290-2430
			p2R5SGPA	902bp	2437-3338
ssu1	141bp	3345-3485
			HpCrtZ	891bp	3486-4376
35S	215bp	4383-4597
			Nos	253bp	4604-4856
PaCrtI	1476bp	4863-6338
			ssu1	141bp	6339-6479
p2R5SGPA	902bp	6486-7387
			ZmPSY1	1233bp	7394-8626
35S	215bp	8633-8847
			pCaMV35S	781bp	9105-9885
bar	552bp	9892-10443
			35S	185bp	10444-10628
LB zone	86bp	10629-10714
			3' genome	413bp	10715-11127

The nucleic acid sequence or the complement thereof may be used in a DNA amplification method to produce an amplification product, the presence of the transgenic corn event p2DBEN-CP-BZ-12 or its progeny in a biological sample being diagnosed by detection of the amplification product; the nucleic acid sequence or its complement can be used in a nucleotide assay to detect the presence of transgenic maize event p2DBEN-CP-BZ-12 or its progeny in a biological sample.

The present invention provides a DNA primer pair comprising a first primer and a second primer, wherein each of the first primer and the second primer comprises a fragment of SEQ ID No. 5 or a complement thereof and when used in an amplification reaction with DNA comprising the maize event p2DBEN-CP-BZ-12, produces an amplification product of the maize event p2DBEN-CP-BZ-12 in a test sample.

In some embodiments, the first primer is selected from the group consisting of SEQ ID NO. 1 or a complement thereof, SEQ ID NO. 8 or SEQ ID NO. 10; the second primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14.

In some embodiments of the invention, the amplification product comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement.

Further, the amplification product comprises consecutive nucleotides 1 to 11 or 21 to 31 in SEQ ID NO. 1 or its complement, or consecutive nucleotides 1 to 11 or 12 to 22 in SEQ ID NO. 2 or its complement.

Still further, the amplification product comprises SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, or SEQ ID NO. 7 or its complement.

In the above technical scheme, the primer comprises at least one of the nucleic acid sequences. Specifically, the primer comprises a first primer and a second primer, wherein the first primer is selected from SEQ ID NO. 1 or a complementary sequence thereof, SEQ ID NO. 8 or SEQ ID NO. 12, and the second primer is selected from SEQ ID NO. 9 or SEQ ID NO. 13; or the first primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 10 or SEQ ID NO. 15, and the second primer is selected from SEQ ID NO. 11 or SEQ ID NO. 14.

The present invention also provides a DNA probe comprising a fragment of SEQ ID NO. 5 or a complementary sequence thereof, which hybridizes under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO. 1-7 or a complementary sequence thereof and does not hybridize under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from SEQ ID NO. 1-7 or a complementary sequence thereof.

In some embodiments, the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, and SEQ ID NO. 7 or its complement.

In some embodiments, the DNA probe is labeled with a fluorescent group.

In some embodiments, the probe comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement; further, the probe comprises continuous nucleotides at 1-11 or 21-31 in SEQ ID NO. 1 or the complementary sequence thereof, or continuous nucleotides at 1-11 or 12-22 in SEQ ID NO. 2 or the complementary sequence thereof.

The present invention also provides a marker nucleic acid molecule comprising a fragment of SEQ ID NO. 5 or a complement thereof, which hybridizes under stringent hybridization conditions with a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1-7 or a complement thereof and does not hybridize under stringent hybridization conditions with a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1-7 or a complement thereof.

In some embodiments, the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO. 1 or its complement, SEQ ID NO. 2 or its complement, SEQ ID NO. 6 or its complement, and SEQ ID NO. 7 or its complement.

In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides of SEQ ID NO. 3 or its complement, or at least 11 consecutive nucleotides of SEQ ID NO. 4 or its complement;

in some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides 1-11 or 21-31 of SEQ ID NO. 1 or its complement, or consecutive nucleotides 1-11 or 12-22 of SEQ ID NO. 2 or its complement.

Further, the present invention provides a method of detecting the presence of DNA comprising transgenic maize event p2DBEN-CP-BZ-12 in a sample comprising:

(1) Contacting a sample to be detected with the pair of DNA primers in a nucleic acid amplification reaction;

(2) Performing a nucleic acid amplification reaction;

(3) Detecting the presence of an amplification product;

the amplification product comprises a nucleic acid sequence selected from the sequences SEQ ID NO. 1-7 or the complement thereof, i.e., is indicative of the presence of DNA comprising the transgenic maize event p2DBEN-CP-BZ-12 in the test sample.

The invention also provides a method of detecting the presence of DNA comprising transgenic maize event p2DBEN-CP-BZ-12 in a sample comprising:

(1) Contacting a sample to be detected with said DNA probe, and/or said marker nucleic acid molecule;

(2) Hybridizing the sample to be detected with the probe and/or the marker nucleic acid molecule under stringent hybridization conditions;

(3) Detecting hybridization of the sample to be detected with the probe and/or the marker nucleic acid molecule.

The stringent conditions may be hybridization in 6 XSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate) solution at 65℃and then washing the membrane 1 time with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS, respectively.

Wherein hybridization of the sample to be tested and the marker nucleic acid molecule is detected, and further by marker assisted breeding analysis to determine that astaxanthin synthesis and/or herbicide tolerance is genetically linked to the marker nucleic acid molecule.

The invention also provides a DNA detection kit, comprising: a DNA primer pair that generates an amplicon diagnostic for the transgenic maize event p2DBEN-CP-BZ-12, a probe that is specific for SEQ ID NOs 1-7 or a marker nucleic acid molecule that is specific for SEQ ID NOs 1-7. Specifically, the detection kit comprises the probe, the primer pair or the marker nucleic acid molecule.

In some embodiments, the invention provides a DNA detection kit comprising at least one DNA molecule comprising at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO. 3 or the complement thereof, or at least 11 contiguous nucleotides of the homologous sequence of SEQ ID NO. 4 or the complement thereof, which can be used as a DNA primer or probe specific for the transgenic maize event p2DBEN-CP-BZ-12 or progeny thereof.

Further, the DNA molecule comprises the 1 st to 11 th or 21 st to 31 st continuous nucleotide in SEQ ID NO. 1 or the complementary sequence thereof, or the 1 st to 11 th or 12 nd to 22 nd continuous nucleotide in SEQ ID NO. 2 or the complementary sequence thereof.

Still further, the DNA molecule comprises a homologous sequence of SEQ ID NO. 1 or a complement thereof, a homologous sequence of SEQ ID NO. 2 or a complement thereof, a homologous sequence of SEQ ID NO. 6 or a complement thereof, or a homologous sequence of SEQ ID NO. 7 or a complement thereof. To achieve the above object, the present invention also provides a plant cell comprising a nucleic acid sequence encoding astaxanthin synthesis pathway CrBKT, hpCrtZ, paCrtI and ZmPSY1 protein, a nucleic acid sequence encoding glufosinate herbicide tolerance Bar protein and a nucleic acid sequence of a specific region comprising the sequence shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO: 7.

The sequences provided by the present invention include the sequences listed in table 2 below:

TABLE 2 related sequences of the invention

Sequence number (SEQ ID) NO）	DESCRIPTION OF THE SEQUENCES
		1	The RB end cross-junction sequence (containing part of the T-DNA RB end sequence and genome sequence,31bp）
2	LB terminal cross junction sequence (containing partial T-DNA LB terminal sequence and genome sequence, 22 bp)
		3	The nucleotide sequence located near the insertion binding site at the 5' -end of the insertion sequence is the RB-end (containing the base for T-DNA The sequence of the genome is about 700bp, and the T-DNA is about 300 bp)
4	The nucleotide sequence of the 3' -end of the insertion sequence located near the insertion binding site is the LB-end (containing the base for T-DNA The sequence of the genome is about 400bp, and the T-DNA is about 400bp
		5	T-DNA full-length sequence (containing LB and RB end about 50bp sequence, genome sequence, two ends extending about 400 and 700 bp)
6	Sequence located inside SEQ ID NO. 3, p2DBEN-CP-BZ T-DNA sequence
		7	Sequence located inside SEQ ID NO. 4, p2DBEN-CP-BZ T-DNA sequence
8	First primer for amplifying SEQ ID NO. 3, primer 11
		9	Second primer, primer 12, for amplifying SEQ ID NO. 3
10	First primer for amplifying SEQ ID NO. 4, primer 13
		11	Second primer, primer 14, for amplifying SEQ ID NO. 4
12	Primer on 5' flanking genome, primer 15
		13	Primer 16 on T-DNA paired with sequence 12
14	Primer on 3' flanking genome, primer 17
		15	Primer 18 on T-DNA paired with sequence 14
16	Taqman detection CrBKT primer 1
		17	Taqman detection CrBKT primer 2
18	Taqman detection CrBKT probe 1
		19	Taqman detection HpCrtZ primer 3
20	Taqman detection HpCrtZ primer 4
		21	Taqman detection HpCrtZ probe 2
22	Taqman assay PaCrtI primer 5
		23	Taqman assay PaCrtI primer 6
24	Taqman assay PaCrtI Probe 3
		25	Taqman assay ZmPSY1 primer 7
26	Taqman assay ZmPSY1 primer 8
		27	Taqman detection ZmPSY1 Probe 4
28	Taqman detection Bar primer 9
		29	Taqman detection Bar primer 10
30	Taqman detection Bar probe 5
		31	First primer 19 of maize endogenous gene Ubiqutin
32	Second primer 20 of maize endogenous gene Ubiqutin
		33	Probe 6 of CrBKT in Southern hybridization detection
34	Probe 7 of HpCrtZ in Southern hybridization detection
		35	Probe 8 of PaCrtI in Southern hybridization detection
36	Probe 9 of ZmPSY1 in Southern hybridization detection
		37	Probe 10 for Bar in Southern hybridization detection
38	Primer 21 located on the T-DNA, which hybridizes to SEQ ID NO:13 are consistent in direction
		39	Primer 22 located on the T-DNA, which hybridizes to SEQ ID NO:13 opposite direction
40	Primer 23 located on the T-DNA, which hybridizes to SEQ ID NO:13 opposite direction
		41	Primer 24 located on the T-DNA, which hybridizes to SEQ ID NO:15 direction is consistent
42	Primer 25 on the T-DNA, which hybridizes to SEQ ID NO:15 opposite directions
		43	Primer 26 located on the T-DNA, which hybridizes to SEQ ID NO:15 opposite directions

The invention also provides a novel method for producing astaxanthin by using corn kernels to form transgenic astaxanthin corn, and also provides a method for extracting and measuring the content of the transgenic astaxanthin corn, and the transgenic astaxanthin corn is added into feed to be used as laying hen feed, so that eggs Huang Fuji astaxanthin are produced, and eggs rich in astaxanthin are produced.

The invention also provides a method for protecting a maize plant from herbicide-induced damage, growing at least one transgenic maize plant comprising in sequence the nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 5, positions 746-10703 and SEQ ID NO. 2 in the genome of the transgenic maize plant, or comprising the sequence of SEQ ID NO. 5 in the genome of the transgenic maize plant. In some embodiments, the method comprises applying an effective dose of glufosinate herbicide to a field where at least one transgenic corn plant comprising transgenic corn event p2DBEN-CP-BZ-12 is grown.

The present invention also provides a method of controlling weeds in a field in which corn plants are grown, comprising applying to the field in which at least one transgenic corn plant is grown an effective dose of a glufosinate herbicide, said transgenic corn plant comprising in its genome the nucleic acid sequences of SEQ ID NO. 1, SEQ ID NO. 5, positions 746-10703 and SEQ ID NO. 2 in that order, or said transgenic corn plant comprising in its genome the sequence of SEQ ID NO. 5.

The invention also provides a method for producing astaxanthin by using the corn bioreactor, which comprises the following steps: planting at least one corn seed comprising transgenic corn event p2 DBEN-CP-BZ-12;

growing the corn seed into a corn plant.

In some embodiments, the present invention provides a method of producing a corn plant enriched in astaxanthin and tolerant to glufosinate herbicide comprising:

planting at least one corn seed comprising transgenic corn event p2 DBEN-CP-BZ-12;

growing the corn seed into a corn plant;

spraying the maize plants with an effective dose of glufosinate herbicide, harvesting plants having reduced plant damage compared to other plants not having the transgenic maize event p2DBEN-CP-BZ-12, the plants having reduced plant damage producing enriched astaxanthin maize kernels.

In some embodiments, the invention also provides a method of producing a maize plant that is biosynthesized for astaxanthin, comprising introducing into the genome of said maize plant a transgenic maize event p2DBEN-CP-BZ-12, selecting a maize plant that is enriched in astaxanthin maize kernels. In some embodiments, the method comprises: sexual crossing a transgenic maize event p2DBEN-CP-BZ-12 first parent maize plant comprising four genes associated with a synthetic astaxanthin maize pathway with a second parent maize plant lacking the four genes, thereby producing a plurality of progeny plants; red astaxanthin seeds are used as screening indexes; plants with red astaxanthin compared to other plants not having transgenic maize event p2DBEN-CP-BZ-12 were selected for the progeny plants.

In some embodiments, the invention also provides a method of producing a maize plant that is tolerant to glufosinate herbicide comprising introducing into the genome of the maize plant a transgenic maize event p2DBEN-CP-BZ-12, selecting a glufosinate tolerant maize plant. In some embodiments, the method comprises: sexual crossing a transgenic corn event p2DBEN-CP-BZ-12 first parent corn plant having tolerance to glufosinate herbicide with a second parent corn plant lacking glufosinate tolerance, thereby producing a plurality of progeny plants; treating said progeny plants with a glufosinate herbicide; selecting said progeny plants that are tolerant to glufosinate.

In some embodiments, the invention also provides a method of using corn for astaxanthin biosynthesis and tolerance to glufosinate herbicide application comprising: transgenic maize event p2DBEN-CP-BZ-12 was introduced into the genome of the maize plant, and maize plants were selected that were resistant to glufosinate and maize for astaxanthin biosynthesis. In some embodiments, the methods comprise sexually crossing a transgenic corn event p2DBEN-CP-BZ-12 first parent corn plant that is glufosinate tolerant and corn with astaxanthin biosynthesis with a second parent corn plant that lacks glufosinate tolerance and/or does not undergo astaxanthin biosynthesis, thereby producing a plurality of progeny plants; treating said progeny plants with glufosinate; selecting said progeny plants that are tolerant to glufosinate, said progeny plants that are tolerant to glufosinate and performing corn for astaxanthin biosynthesis.

The present invention also provides a composition that produces a transgenic corn event p2DBEN-CP-BZ-12 that is corn meal, corn flour, corn oil, or corn starch. In some embodiments, the composition may be an agricultural product or commodity such as corn meal, corn flour, corn oil, corn starch, corn gluten, tortilla, cosmetics, or bulking agent. If sufficient expression is detected in the composition, the composition is expected to contain a nucleic acid sequence capable of diagnosing the presence of the transgenic maize event p2DBEN-CP-BZ-12 material in the composition. In particular, the compositions include, but are not limited to, corn oil, corn meal, corn flour, corn gluten, tortilla, corn starch, any other food product to be consumed by an animal as a food source, or otherwise used for cosmetic purposes, etc., as an ingredient in an expanding agent or cosmetic composition.

The probe or primer pair-based detection methods and/or kits of the invention can be employed to detect a transgenic corn event p2DBEN-CP-BZ-12 nucleic acid sequence, such as shown in SEQ ID NO. 1 or SEQ ID NO. 2, in a biological sample, wherein the probe sequence or primer sequence is selected from the sequences shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, to diagnose the presence of the transgenic corn event p2 DBEN-CP-BZ-12.

In conclusion, the transgenic corn event p2DBEN-CP-BZ-12 has the dual characteristics of being rich in astaxanthin and resistant to glufosinate herbicide, and has the following advantages: 1) The corn genetic and biological information resources are rich, the corn genetic and biological information resources have the advantages of capability of expressing exogenous proteins and metabolites, easiness in extracting and processing target products, lower production cost, higher biological safety and the like, and the corn genetic and biological information resources are used for producing recombinant medical protein polypeptides and bioactive substances in molecular agriculture, particularly astaxanthin production with good effects of deferring aging, resisting oxidation and the like, so that a biological product rich in astaxanthin can be obtained; 2) The ability to apply glufosinate-containing agricultural herbicides to corn crops for broad spectrum weed control; 3) The corn yield was not reduced. Specifically, the astaxanthin content of the event p2DBEN-CP-BZ-12 reaches 72.50 mug/g; the tolerance to glufosinate herbicide is high, and the plants can be protected under the condition of 4 times of recommended dosage so that the damage rate is as low as 0%; and the agronomic characters of the plants containing the event are excellent, and the yield percentage can reach as high as 102 percent. Furthermore, the four synthetic pathway genes encoding astaxanthin are linked to the gene for the glufosinate tolerance trait on the same DNA segment and are present at a single locus in the transgenic maize event p2DBEN-CP-BZ-12 genome, which increases breeding efficiency and enables molecular markers to be used to track transgene inserts in the breeding populations and their offspring. Meanwhile, the primer or probe sequence provided in the detection method can generate an amplification product identified as the transgenic corn event p2DBEN-CP-BZ-12 or the progeny thereof, and can rapidly, accurately and stably identify the existence of plant materials derived from the transgenic corn event p2 DBEN-CP-BZ-12.

Terminology

The following definitions and methods may better define the present invention and instruct those of ordinary skill in the art to practice the present invention, and unless otherwise indicated, terms are understood according to their conventional usage by those of ordinary skill in the art.

The term "maize" refers to maize (Zea mays) and includes all plant varieties that can be mated to maize, including wild maize varieties.

The term "comprising" means "including but not limited to. The "processed product" refers to a product obtained by processing a raw material such as a plant or a seed, for example, a composition.

The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps (plant cones), and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. It is to be understood that parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos and flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny which have been previously transformed with the DNA molecules of the present invention and thus at least partially consist of the transgenic cells.

The term "gene" refers to a nucleic acid fragment that expresses a particular protein, including regulatory sequences preceding (5 'non-coding sequences) and regulatory sequences following (3' non-coding sequences) the coding sequences. "native gene" refers to a gene that is found naturally to have its own regulatory sequences. By "chimeric gene" is meant any gene that is not a native gene, comprising regulatory and coding sequences found in a non-native manner. "endogenous gene" refers to a native gene that is located in its natural location in the genome of an organism. "exogenous gene" is a foreign gene that is present in the genome of an organism and that is not originally present, and also refers to a gene that has been introduced into a recipient cell by a transgenic procedure. The exogenous gene may comprise a native gene or chimeric gene inserted into a non-native organism. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted may be referred to as an "insertion site" or "target site".

"flanking DNA" may comprise genomic or foreign (heterologous) DNA introduced by a transformation process, such as fragments associated with a transformation event, naturally occurring in an organism such as a plant. Thus, flanking DNA may include a combination of native and foreign DNA. In the present invention, a "flanking region" or "flanking sequence" or "genomic border region" or "genomic border sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or more that is immediately upstream or downstream of and adjacent to the initial exogenous inserted DNA molecule. When this flanking region is located downstream, it may also be referred to as a "left border flanking" or a "3 'genomic border region" or a "genomic 3' border sequence", etc. When this flanking region is located upstream, it may also be referred to as a "right-hand border flanking" or a "5 'genomic border region" or a "genomic 5' border sequence", etc.

Transformation procedures that cause random integration of the foreign DNA will result in transformants that contain different flanking regions that each transformant specifically contains. When recombinant DNA is introduced into plants by conventional hybridization, its flanking regions are generally not altered. Transformants will also contain unique junctions between the heterologous insert DNA and segments of genomic DNA or between two segments of heterologous DNA. "ligation" is the point at which two specific DNA fragments are ligated. For example, the junction exists where the insert DNA joins the flanking DNA. The junction point is also present in transformed organisms, where the two DNA fragments are joined together in a manner that modifies what is found in the native organism. "adapter DNA" refers to DNA that contains an adapter.

The present invention provides transgenic corn event designated p2DBEN-CP-BZ-12 and progeny thereof, wherein the transgenic corn event p2DBEN-CP-BZ-12 is corn plant p2DBEN-CP-BZ-12 comprising the plants and seeds of the transgenic corn event p2DBEN-CP-BZ-12 and plant cells thereof or regenerable parts thereof, and plant parts of the transgenic corn event p2DBEN-CP-BZ-12 including, but not limited to, cells, pollen, ovules, flowers, shoots, roots, stems, spikes, inflorescences, ears, leaves and products from the corn plant p2DBEN-CP-BZ-12 such as corn flour, corn meal, corn oil, corn steep liquor, corn cobs, corn starch and biomass left in the corn crop field.

The transgenic maize event p2DBEN-CP-BZ-12 of the invention comprises a DNA construct that is enriched in astaxanthin and tolerance to glufosinate herbicide when expressed in plant cells.

In some embodiments of the invention, the DNA construct comprises five expression cassettes in tandem, the vector p2BDEN-CP-BZ comprising 5 transgene expression cassettes in tandem, wherein the first and second expression cassettes comprise a first expression cassette comprising a bi-directional promoter p2R5SGPA specifically expressed in corn seed operably linked to a signal peptide ssu1 from the small strand of corn genomic ribulose-bisphosphate carboxylase followed by a maize codon optimized β -carotene 4-ketolase gene CrBKT from chlamydomonas reinhardtii operably linked to a transcription terminator (Nos); the other side is operably linked to a maize codon optimized beta-carotene hydroxylase gene HpCrtZ from Haematococcus pluvialis after operably linking to a signal peptide ssu1 from the maize genomic ribulose-bisphosphate carboxylase small chain, and then operably linked to a cauliflower mosaic virus 35S terminator (35S) constitutes a second expression cassette; wherein the third and fourth expression cassettes consist of a bi-directional promoter p2R5SGPA specifically expressed in maize seed operably linked to a signal peptide ssu1 from the maize genomic ribulose-bisphosphate carboxylase small chain operably linked to a phytoene dehydrogenase gene PaCrtI from Erwinia, which is then operably linked to a nopaline synthase transcription terminator (Nos); and operably linking the phytoene synthase gene ZmPSY1 from the maize genome followed by operably linking to the cauliflower mosaic virus 35S terminator (35S) constitutes a fourth expression cassette; the fifth expression cassette consisted of the cauliflower mosaic virus 35S promoter (pCaMv 35S), operably linked to the maize codon optimized phosphomeflavone acetyltransferase gene Bar from Streptomyces hygroscopicus, and operably linked to the cauliflower mosaic virus 35S terminator (35S).

The nucleic acid sequence of the PAT protein is tolerant to glufosinate herbicides. Further, the promoter may be a suitable promoter isolated from plants, including constitutive, inducible, and/or tissue-specific promoters, including, but not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, the Figwort Mosaic Virus (FMV) 35S promoter, the Ubiquitin protein (Ubiquitin) promoter, the Actin (action) promoter, the agrobacterium (Agrobacterium tumefaciens) nopaline synthase (NOS) promoter, the octopine synthase (OCS) promoter, the night yellow leaf curly virus (cestron) promoter, the tuber storage protein (Patatin) promoter, the ribulose-1, 5-bisphosphate carboxylase/oxygenase (rusco) promoter, the Glutathione S Transferase (GST) promoter, the E9 promoter, the GOS promoter, the alcA/alcR promoter, the agrobacterium (Agrobacterium rhizogenes) roller promoter, and the arabidopsis (Arabidopsis thaliana) promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence for functioning in plants, including, but not limited to, polyadenylation signal sequences derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, the 35S terminator derived from cauliflower mosaic virus (CaMV), the polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, and the polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

In addition, the expression cassette may also include other genetic elements including, but not limited to, enhancers and signal peptide/transit peptide nucleic acid coding sequences. The enhancer may enhance the expression level of a gene, including, but not limited to, tobacco Etch Virus (TEV) translational activator, caMV35S enhancer, and FMV35S enhancer. The signal peptide/transit peptide can direct the transport of CrBKT, hprtz, and PaCrtI proteins to specific organelles or compartments outside or inside the cell, for example, targeting to the chloroplast using a sequence encoding a chloroplast transit peptide, or targeting to the endoplasmic reticulum using a 'KDEL' retention sequence.

The CrBKT can be separated from Chlamydomonas reinhardtii, hpCrtZ can be separated from Haematococcus pluvialis, paCrtI can be separated from European bacteria, zmPSY1 can be separated from corn genes, and other CrBKT, hpCrtZ and PaCrtI can be obtained by optimizing codons or otherwise changing the nucleic acid sequences of the CrBKT, hpCrtZ and PaCrtI and ZmPSY1 genes except the ZmPSY1 genes from corn so as to achieve the purpose of increasing the stability and availability of transcripts in transformed cells.

In some embodiments of the invention, a maize cell, seed or plant comprising transgenic maize event p2DBEN-CP-BZ-12 comprises in its genome the nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 5, positions 746-10703 and SEQ ID NO. 2, or the sequence shown in SEQ ID NO. 5, in that order.

The phosphorylating acetyl transferase (Bar) gene may be isolated from a strain of streptomyces hygroscopicus and the polynucleotides encoding the Bar gene may be modified by codon optimisation or otherwise for the purpose of increasing the stability and availability of transcripts in transformed cells. The phosphorylating acetyltransferase gene may also be used as a selectable marker gene.

The "glufosinate" refers to glufosinate, also called glufosinate, and is named as Basta and Baiston, and the chemical name is 4- [ hydroxy (methyl) phosphono ] -DL-homoalanine or 2-amino-4- [ hydroxy (methyl) phosphono ] ammonium butyrate (2-amino-4- (hydroxymethyl) phosphinyl) butyric acid ammonium salt). Glufosinate was white crystalline with a slight smell. The melting point was 210℃and the boiling point was 519.1℃at 760 mmHg. Is easy to dissolve in water, has the solubility of 1370 g/L in water at 22 ℃ and has low solubility in common organic solvents. Glufosinate has chirality, and racemates of L type and D type are generally produced, and subsequent researches find that only L-glufosinate has weeding effect, while D type is almost inactive. If the product with only the pure optical isomer of L-glufosinate is prepared for use, the dosage of glufosinate can be reduced by half, the economy is improved, the use cost is reduced, the environmental pressure is lightened, N-phosphonomethylglycine and the salt thereof are reduced, and the treatment with the glufosinate herbicide refers to the treatment with any herbicide preparation containing glufosinate. The choice of the rate of use of a certain glufosinate formulation in order to achieve an effective biological dose is not beyond the skills of the average agronomic technician. Treatment of a field containing plant material derived from transgenic corn event p2DBEN-CP-BZ-12 with any herbicide formulation containing glufosinate will control weed growth in the field and will not affect the growth or yield of plant material derived from transgenic corn event p2 DBEN-CP-BZ-12.

The DNA construct is introduced into a plant using transformation methods including, but not limited to, agrobacterium-mediated transformation, gene gun transformation, and pollen tube channel transformation.

The agrobacterium-mediated transformation method is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border consensus sequences of the vector, i.e., the T-DNA region. The vector is transformed into an agrobacterium cell, which is subsequently used to infect plant tissue, and the T-DNA region of the vector comprising exogenous DNA is inserted into the plant genome.

The gene gun transformation method is to bombard plant cells (particle-mediated biolistic transformation) with a vector containing exogenous DNA.

The pollen tube channel transformation method utilizes a natural pollen tube channel (also called pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into embryo sacs through a bead core channel.

After transformation, the transgenic plants must be regenerated from the transformed plant tissue and offspring with the exogenous DNA selected using appropriate markers.

A DNA construct is a combination of DNA molecules that are linked to one another to provide one or more expression cassettes. The DNA construct is in particular a plasmid capable of self-replication in bacterial cells and containing various restriction enzyme sites for the introduction of DNA molecules providing functional genetic elements, i.e. promoters, introns, leader sequences, coding sequences, 3' terminator regions and other sequences. The expression cassette contained in the DNA construct includes the genetic elements necessary to provide for transcription of messenger RNA, and can be designed for expression in prokaryotic or eukaryotic cells. The expression cassette of the invention is designed to be most specifically expressed in plant cells.

A transgenic "event" is obtained by transforming a plant cell with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, inserting into the plant genome by transgenic means to produce a plant population, regenerating the plant population, and selecting a particular plant having the characteristics of being inserted into a particular genomic locus. The term "event" refers to both the original transformant comprising the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny of a sexual cross between a transformant and other species of individuals containing heterologous DNA, even after repeated backcrosses with a backcross parent, the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the hybrid progeny. The term "event" also refers to a DNA sequence from an original transformant that comprises an inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which DNA sequence is expected to be transferred into progeny resulting from sexual crossing of a parental line containing the inserted DNA (e.g., the original transformant and progeny resulting from its selfing) with a parental line not containing the inserted DNA, and which progeny received the inserted DNA comprising the gene of interest.

"recombinant" in the context of the present invention refers to forms of DNA and/or proteins and/or organisms that are not normally found in nature and are therefore produced by manual intervention. Such manual intervention may result in recombinant DNA molecules and/or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two otherwise isolated sequence segments, for example by chemical synthesis or by manipulation of isolated nucleic acid segments by genetic engineering techniques. Techniques for performing nucleic acid manipulations are well known.

The term "transgene" includes any cell, cell line, callus, tissue, plant part or plant, the genotype of which is altered by the presence of a heterologous nucleic acid, and includes the transgene originally so altered as well as progeny individuals produced from the original transgene by sexual crosses or asexual propagation. In the present invention, the term "transgene" does not include genomic (chromosomal or extrachromosomal) alterations by conventional plant breeding methods or naturally occurring events such as random allofertilisation, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

By "heterologous" in the present invention is meant that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule may originate from a first species and be inserted into the genome of a second species. Such molecules are thus heterologous to the host and are artificially introduced into the genome of the host cell.

Culturing a transgenic corn event p2DBEN-CP-BZ-12 capable of producing astaxanthin-rich and glufosinate herbicide tolerant, can be accomplished by the steps of: first sexually crossing a first parent corn plant consisting of a corn plant grown from a transgenic corn event p2DBEN-CP-BZ-12 and progeny thereof obtained by using the red seed of the invention and capable of determining an expression cassette enriched in astaxanthin and tolerant to glufosinate herbicide, with a second parent corn plant lacking an astaxanthin synthesis pathway gene and/or lacking tolerance to glufosinate herbicide, thereby producing a plurality of first generation progeny plants; these steps may further include backcrossing the astaxanthin-rich (red seed) and/or glufosinate-tolerant progeny plant with a second or third parent corn plant and then selecting progeny by identifying the astaxanthin-rich (red seed), glufosinate herbicide application or by identification of a trait-related molecular marker (such as a DNA molecule comprising the junction site identified at the 5 'and 3' ends of the insertion sequence in transgenic corn event p2 DBEN-CP-BZ-12) to produce a maize plant that is astaxanthin-rich and glufosinate-tolerant.

It will also be appreciated that two different transgenic plants can also be crossed to produce offspring containing two independent, separately added exogenous genes. Selfing of appropriate offspring can result in offspring plants that are homozygous for both added exogenous genes. Backcrossing of parent plants and outcrossing with non-transgenic plants as previously described are also contemplated, as are asexual propagation.

The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, e.g., a radioisotope, ligand, chemiluminescent agent, or enzyme, can be attached. Such a probe is complementary to one strand of the target nucleic acid, and in the present invention, the probe is complementary to one strand of DNA from the genome of transgenic maize event p2DBEN-CP-BZ-12, whether the genomic DNA is from the transgenic maize event p2DBEN-CP-BZ-12 or seed or from a plant or seed or extract of transgenic maize event p2 DBEN-CP-BZ-12. Probes of the present invention include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

The term "primer" is an isolated nucleic acid molecule that binds to a complementary target DNA strand by nucleic acid hybridization, anneals to form a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of the invention relate to their use in the amplification of a target nucleic acid sequence, for example, by the Polymerase Chain Reaction (PCR) or other conventional nucleic acid amplification methods.

Methods of designing and using primers and probes are well known in the art. The DNA molecules comprising the full length or fragments of SEQ ID NOS: 1-7 can be used as primers and probes for detecting maize event p2DBEN-CP-BZ-12 and can be readily designed by one skilled in the art using the sequences provided herein.

The length of the probes and primers is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers hybridize specifically to the target sequence under highly stringent hybridization conditions. Although probes other than the target DNA sequence and maintaining hybridization ability to the target DNA sequence can be designed by conventional methods, it is preferred that the probes and primers of the present invention have complete DNA sequence identity to a contiguous nucleic acid of the target sequence.

Primers and probes based on flanking genomic DNA and insert sequences of the invention may be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from transgenic maize event p2DBEN-CP-BZ-12 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises a transgene insert and maize genomic flanking regions, and fragments of the DNA molecule may be used as primers or probes.

The nucleic acid probes and primers of the invention hybridize to a target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic maize event p2DBEN-CP-BZ-12 in a sample. The nucleic acid molecule or fragment thereof is capable of specifically hybridizing to other nucleic acid molecules under certain conditions. As used herein, two nucleic acid molecules can be said to specifically hybridize to each other if they are capable of forming antiparallel double-stranded nucleic acid structures. Two nucleic acid molecules are said to be "complements" of one nucleic acid molecule if they exhibit complete complementarity. As used herein, a nucleic acid molecule is said to exhibit "complete complementarity" when each nucleotide of the two molecules is complementary to a corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under conventional "highly stringent" conditions. Deviations from complete complementarity are permissible provided that such deviations do not completely prevent the formation of double-stranded structures by the two molecules. In order to enable a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in sequence to allow the formation of a stable double-stranded structure at the particular solvent and salt concentration employed.

As used herein, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing under highly stringent conditions to the complementary strand of a matching other nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45℃followed by washing with 2.0 XSSC at 50℃are well known to those skilled in the art. For example, the salt concentration in the washing step may be selected from about 2.0 XSSC at low stringency conditions, about 0.2 XSSC at 50℃to high stringency conditions, about 50 ℃. In addition, the temperature conditions in the washing step may be raised from about 22 ℃ at room temperature under low stringency conditions to about 65 ℃ under high stringency conditions. The temperature conditions and salt concentration may both be varied, or one may remain unchanged while the other variable is varied. In particular, a nucleic acid molecule of the invention may specifically hybridize under moderately stringent conditions, e.g., at about 2.0 XSSC and about 65℃to one or more of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7, or to a complement thereof, or to any fragment of the foregoing. More specifically, a nucleic acid molecule of the invention hybridizes specifically under highly stringent conditions to one or more of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7, or to the complement thereof, or to any fragment of the above sequences. In the present invention, preferred marker nucleic acid molecules have SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 or SEQ ID NO. 7 or a sequence complementary thereto, or a fragment of any of the above sequences. Another preferred marker nucleic acid molecule of the invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 or SEQ ID NO. 7 or the complement thereof, or any fragment of the above sequences. SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 and SEQ ID NO. 7 can be used as markers in plant breeding methods to identify offspring of genetic crosses. Hybridization of the probe to the target DNA molecule may be detected by any method known to those skilled in the art, including, but not limited to, fluorescent labels, radiolabels, antibody-based labels, and chemiluminescent labels.

With respect to amplification (e.g., by PCR) of a target nucleic acid sequence using specific amplification primers, "stringent conditions" refer to conditions that allow hybridization of only the primer pair to the target nucleic acid sequence in a DNA thermal amplification reaction, and primers having a wild-type sequence (or its complement) corresponding to the target nucleic acid sequence are capable of binding to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

The term "specific binding (target sequence)" means that under stringent hybridization conditions, the probe or primer hybridizes only to the target sequence in a sample containing the target sequence.

As used herein, "amplified DNA," "amplification product," or "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a maize plant is produced by sexual hybridization with the transgenic maize event p2DBEN-CP-BZ-12 of the invention, or whether a maize sample collected from a field contains the transgenic maize event p2DBEN-CP-BZ-12, or whether a maize extract, e.g., meal, flour, or oil, contains the transgenic maize event p2DBEN-CP-BZ-12, DNA extracted from a maize plant tissue sample or extract can be amplified by a nucleic acid amplification method using a primer pair to produce an amplicon diagnostic for the presence of DNA of the transgenic maize event p2 DBEN-CP-BZ-12. The primer pair includes a first primer derived from a flanking sequence in the genome of the plant adjacent to the insertion site of the inserted foreign DNA, and a second primer derived from the inserted foreign DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic maize event p2 DBEN-CP-BZ-12. The length of the amplicon may range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred fifty nucleotide base pairs, and most preferably plus about four hundred fifty nucleotide base pairs or more.

Alternatively, the primer pair may be derived from flanking genomic sequences flanking the inserted DNA to produce an amplicon comprising the entire inserted nucleic acid sequence. One of the primer pairs derived from the plant genomic sequence may be located at a distance from the inserted DNA sequence that may range from one nucleotide base pair to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in the DNA thermal amplification reaction.

The nucleic acid amplification reaction may be accomplished by any nucleic acid amplification reaction method known in the art, including the Polymerase Chain Reaction (PCR). Various methods of nucleic acid amplification are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22kb genomic DNA and 42kb phage DNA. These methods, as well as other DNA amplification methods in the art, may be used in the present invention. The inserted exogenous DNA sequence and flanking DNA sequences from transgenic maize event p2DBEN-CP-BZ-12 can be obtained by amplifying the genome of transgenic maize event p2DBEN-CP-BZ-12 using the provided primer sequences, and standard DNA sequencing of the PCR amplicon or cloned DNA after amplification.

DNA detection kits based on DNA amplification methods may contain DNA primer molecules that specifically hybridize to target DNA and amplify diagnostic amplicons under appropriate reaction conditions. The kit may provide agarose gel-based detection methods or a number of methods known in the art for detecting diagnostic amplicons. Kits comprising DNA primers homologous or complementary to any portion of the maize genomic region of SEQ ID NO. 3 or SEQ ID NO. 4 and homologous or complementary to any portion of the transgene insertion region of SEQ ID NO. 5 are provided by the invention. In particular, primer pairs identified as useful in DNA amplification methods are SEQ ID NO. 8 and SEQ ID NO. 9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene/genomic region of transgenic maize event p2DBEN-CP-BZ-12, wherein the amplicon comprises SEQ ID NO. 1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO. 5.

Amplicons produced by these methods can be detected by a variety of techniques. One of the methods is Genetic Bit Analysis, which designs a DNA oligonucleotide strand that spans the insert DNA sequence and adjacent flanking genomic DNA sequences. The oligonucleotide strand is immobilized in a microwell of a microwell plate, and after PCR amplification of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product can hybridize to the immobilized oligonucleotide strand and serve as a template for a single base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next desired base. The results may be obtained by fluorescence or ELISA-like methods. The signal represents the presence of an insertion/flanking sequence, which indicates that the amplification, hybridization and single base extension reactions were successful.

Another method is Pyrosequencing technology. The method contemplates an oligonucleotide strand spanning the insertion DNA sequence and adjacent genomic DNA binding sites. The oligonucleotide strand and the single stranded PCR product of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences) are hybridized and then incubated with DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine-5' -phosphosulfate and luciferin. dNTPs are added separately and the resulting optical signal is measured. The optical signal represents the presence of an insertion/flanking sequence, which indicates that amplification, hybridization, and single base or multiple base extension reactions were successful.

Fluorescence polarization as described by Chen et al (Genome Res.) 9:492-498, 1999) is also one method that may be used to detect the amplicons of the present invention. The use of this method requires the design of an oligonucleotide strand spanning the insertion DNA sequence and adjacent genomic DNA binding sites. The oligonucleotide strand is hybridized to a single stranded PCR product of the target region (using one primer in each of the insert sequence and adjacent flanking genomic sequences) and then incubated with DNA polymerase and a fluorescent-labeled ddNTPs. Single base extension results in insertion of ddNTPs. Such an insertion can measure the change in its polarization using a fluorometer. The change in polarization represents the presence of an insertion/flanking sequence, which indicates that amplification, hybridization, and single base extension reactions were successful.

Taqman is described as a method for detecting and quantifying the presence of a DNA sequence, which is described in detail in the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe is designed that spans the intervening DNA sequence and adjacent genomic flanking binding sites, as described below. The FRET probe and PCR primers (one primer in each of the insert sequence and adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage of the fluorescent moiety and the quencher moiety on the FRET probe and release of the fluorescent moiety. The generation of a fluorescent signal is representative of the presence of the insertion/flanking sequences, which indicates that amplification and hybridization were successful.

Suitable techniques for detecting plant material derived from transgenic maize event p2DBEN-CP-BZ-12 based on hybridization principles may also include Southern blot hybridization, northern blot hybridization, and in situ hybridization. In particular, the suitable technique includes incubating the probe and sample, washing to remove unbound probe and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe, for example, radiolabeled probes can be detected by X-ray exposure and development, or enzymatically labeled probes can be detected by substrate conversion to effect a color change.

Tyangi et al (Nat. Biotech.) 14:303-308, 1996) describe the use of molecular markers in sequence detection. Briefly described, a FRET oligonucleotide probe is designed that spans the intervening DNA sequence and adjacent genomic flanking binding sites. The unique structure of the FRET probe results in it containing a secondary structure that is capable of retaining both the fluorescent moiety and the quenching moiety in close proximity. The FRET probe and PCR primers (one primer in each of the insert sequence and adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe to the target sequence results in a loss of secondary structure of the probe, thereby spatially separating the fluorescent moiety from the quenching moiety, producing a fluorescent signal. The generation of a fluorescent signal is representative of the presence of the insertion/flanking sequences, which indicates that amplification and hybridization were successful.

Other described methods, such as microfluidics (microfluidics), provide methods and apparatus for isolating and amplifying DNA samples. The photodyes are used to detect and determine specific DNA molecules. A nano tube (nano tube) device comprising an electronic sensor for detecting DNA molecules or a nano bead binding to a specific DNA molecule and thus being detectable is useful for detecting the DNA molecules of the invention.

DNA detection kits may be developed using the compositions of the present invention and methods described in or known to the DNA detection arts. The kit facilitates the identification of the presence or absence of the DNA of the transgenic corn event p2DBEN-CP-BZ-12 in a sample, and can also be used to cultivate corn plants containing the DNA of the transgenic corn event p2 DBEN-CP-BZ-12. The kit may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO. 1, 2, 3, 4 or 5, or other DNA primers or probes homologous to or complementary to DNA contained in the transgenic genetic element of DNA, which DNA sequences may be used in DNA amplification reactions or as probes in DNA hybridization methods.

The DNA structure of the transgene insert contained in the corn genome and the binding site to the corn genome illustrated in fig. 1 and table 1 comprises: a maize p2DBEN-CP-BZ-12 flanking genomic region at the 5' end of the transgene insert, a portion of the insert from the right border Region (RB) of agrobacterium, wherein the first and second expression cassettes are operably linked to a signal peptide ssu1 from the small strand of maize genomic ribulose-bisphosphate carboxylase by the side of the bi-directional promoter p2R5SGPA specifically expressed in maize seed, and then operably linked to the maize codon optimized β -carotene 4-ketolase gene CrBKT from chlamydomonas reinhardtii, and then operably linked to the transcription terminator (Nos) of nopaline synthase to form a first expression cassette; the other side is operably linked to a maize codon optimized beta-carotene hydroxylase gene HpCrtZ from Haematococcus pluvialis after operably linking to a signal peptide ssu1 from the maize genomic ribulose-bisphosphate carboxylase small chain, and then operably linked to a cauliflower mosaic virus 35S terminator (35S) constitutes a second expression cassette; wherein the third and fourth expression cassettes consist of a bi-directional promoter p2R5SGPA specifically expressed in maize seed operably linked to a signal peptide ssu1 from the maize genomic ribulose-bisphosphate carboxylase small chain operably linked to a phytoene dehydrogenase gene PaCrtI from Erwinia, which is then operably linked to a nopaline synthase transcription terminator (Nos); and operably linking the phytoene synthase gene ZmPSY1 from the maize genome followed by operably linking to the cauliflower mosaic virus 35S terminator (35S) constitutes a fourth expression cassette; a fifth expression cassette consisted of a cauliflower mosaic virus 35S promoter (pCaMv 35S), operably linked to a maize codon-optimized phosphomeflavone acetyl transferase gene Bar from Streptomyces hygroscopicus, and operably linked to a cauliflower mosaic virus 35S terminator (35S), a portion of the insert sequence from the left border region (LB) of Agrobacterium, and the maize plant p2DBEN-CP-BZ-12 flanking genomic region (SEQ ID NO: 5) at the 3' end of the transgenic insert sequence. In the DNA amplification method, the DNA molecule used as a primer may be any part of the transgene insert sequence derived from the transgenic maize event p2DBEN-CP-BZ-12, or any part of the DNA region derived from the flanking maize genome in the transgenic maize event p2 DBEN-CP-BZ-12.

The transgenic corn event p2DBEN-CP-BZ-12 can be combined with other transgenic corn varieties, such as herbicide (e.g., glufosinate, dicamba, etc.) tolerant corn, or transgenic corn varieties carrying an insect-resistant gene (e.g., chafer, grub, diabrotica, etc.). All of these various combinations of different transgenic events, when bred with the transgenic maize event p2DBEN-CP-BZ-12 of the invention, can provide improved hybrid transgenic maize varieties that are resistant to multiple pests, are astaxanthin-rich, and are tolerant to multiple herbicides. These varieties may exhibit superior characteristics such as yield enhancement compared to non-transgenic varieties and transgenic varieties of single trait.

The present invention provides transgenic maize event p2DBEN-CP-BZ-12, which is an astaxanthin-rich maize and is resistant to the phytotoxic effects of glufosinate-containing agricultural herbicides, for detecting nucleic acid sequences of maize plants comprising the event and methods of detecting the same. The dual trait maize plants express CrBKT, hpCrtZ, paCrtI and ZmPSY1 proteins, which provide pathway proteins for lycopene synthesis (precursor materials) and astaxanthin synthesis; and which expresses glufosinate-resistant 4- [ hydroxy (methyl) phosphono ] -DL-homoalanine or 2-amino-4- [ hydroxy (methyl) phosphono ] ammonium butyrate (2-amino-4- (hydro phosphinyl) butyric acid ammonium salt) of a strain of streptomyces hygroscopicus, which confers tolerance to glufosinate on plants.

Drawings

FIG. 1 is a schematic diagram showing the structure of the binding site between the transgene insert sequence and the corn genome of the nucleic acid sequence and the detection method thereof for detecting corn plant p2 DBEN-CP-BZ-12;

FIG. 2 is a schematic diagram showing the structure of a recombinant expression vector p2BDEN-CP-BZ for detecting the nucleic acid sequence of maize plant p2DBEN-CP-BZ-12 and the detection method thereof according to the invention;

FIG. 3 is a graph of the post-maturation effects of transgenic maize seeds comprising transgenic maize event p2DBEN-CP-BZ-12 of the invention;

FIG. 4 is a plot of the field effect of the recommended spray concentration of transgenic corn of the invention comprising transgenic corn event p2DBEN-CP-BZ-12 in a field sprayed with 4-fold doses of glufosinate herbicide;

FIG. 5 is a graph showing the results of the identification of astaxanthin biological activity in transgenic maize seeds containing transgenic maize event p2DBEN-CP-BZ-12 of the present invention.

Detailed Description

The following is a description of the nucleic acid sequence and detection method for detecting maize plant p2DBEN-CP-BZ-12 by specific examples.

EXAMPLE 1 cloning and transformation

%2, vector cloning

The recombinant expression vector p2DBEN-CP-BZ (shown in FIG. 2) was constructed using standard gene cloning techniques. The vector p2DBEN-CP-BZ comprises 5 transgene expression cassettes connected in series, wherein the first and the second expression cassettes are formed by operably connecting a signal peptide ssu1 from a small chain of a corn genome ribulose-bisphosphate carboxylase to one side of a bidirectional promoter p2R5SGPA specifically expressed in corn seeds, operably connecting the signal peptide to a corn codon optimized beta-carotene 4-ketolase gene CrBKT (the nucleic acid sequence of which is shown as 1306-2289 of SEQ ID NO: 5) from Chlamydomonas reinhardtii, and operably connecting the signal peptide to a transcription terminator (Nos) of nopaline synthase; the other side is operably linked to a maize codon optimized beta-carotene hydroxylase gene HpCrtZ (the nucleic acid sequence of which is shown in positions 3486-4376 of SEQ ID NO: 5) from Haematococcus pluvialis after operably linking to the signal peptide ssu1 from the maize genomic ribulose-bisphosphate carboxylase small chain, and then operably linked to a cauliflower mosaic virus 35S terminator (35S) constitutes a second expression cassette; wherein the third and fourth expression cassettes consist of a bidirectional promoter p2R5SGPA specifically expressed in maize seed operably linked to a signal peptide ssu1 from the maize genome ribulose-bisphosphate carboxylase small chain, operably linked to a phytoene dehydrogenase gene PaPaPaPaCrtI (the nucleic acid sequence of which is shown in positions 4863-6338 of SEQ ID NO: 5) from Erwinia, operably linked to a nopaline synthase transcription terminator (Nos); and operably linked to a phytoene synthase gene ZmPSY1 (the nucleic acid sequence of which is shown at positions 7394-8626 of SEQ ID NO: 5) from the maize genome followed by operably linked to a cauliflower mosaic virus 35S terminator (35S) constitutes a fourth expression cassette; the fifth expression cassette consists of the cauliflower mosaic virus 35S promoter (pCaMv 35S), operably linked to the maize codon-optimized phosphomeflavone acetyltransferase gene Bar from Streptomyces hygroscopicus (nucleic acid sequence shown in SEQ ID NO: 5 at positions 9892-10443), and operably linked to the cauliflower mosaic virus 35S terminator (35S).

The vector p2DBEN-CP-BZ was transformed into Agrobacterium LBA4404 (Invitrogen, chicago, USA; cat. No. 18313-015) by the liquid nitrogen method, and the transformed cells were screened using the phosphomeflavone acetyltransferase gene Bar as a selectable marker.

1.2 plant transformation

Transformation was performed using conventional agrobacterium infection, and aseptically cultured maize (maize variety Hi-II) young embryos were co-cultured with agrobacterium as described in this example 1.1 to transfer T-DNA in the constructed recombinant expression vector p2DBEN-CP-BZ into the maize chromosome set to generate transgenic maize events.

For Agrobacterium-mediated transformation of maize, briefly, immature chick embryos are isolated from maize, the chick embryos are contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the nucleic acid sequence of the CrBKT, hpCrtZ, paCrtI, zmPSY gene and the nucleic acid sequence of the Bar gene to at least one cell of one of the chick embryos (step 1: an infection step), in which step the chick embryos are specifically immersed in the Agrobacterium suspension (OD ₆₆₀ =0.4-0.6, in infection medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, ph 5.3) to initiate inoculation. The young embryo is co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culturing step). Specifically, the young embryo is cultured on a solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, agar 8g/L, pH 5.8) after the infection step. After this co-cultivation stage, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium was present in the recovery medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, plant gel 3g/L, pH 5.8) without addition of a selection agent for plant transformants (step 3: recovery step). Specifically, young embryos are cultured on solid medium with antibiotics but no selection agent to eliminate agrobacterium and provide a recovery period for the infected cells. The inoculated chick embryos are then cultured on a medium containing a selection agent (N- (phosphonomethyl) glycine) and the growing transformed calli are selected (step 4: selection step). Specifically, young embryo is screened in solid culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, N- (phosphonomethyl) glycerol) with selective agent Ammonia 0.25mol/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, plant gel 3g/L, pH 5.8) resulted in selective growth of transformed cells. Then, the callus is regenerated into plants (step 5: regeneration step), specifically, the callus grown on the medium containing the selection agent is cultured on solid medium (MS differentiation medium and MS rooting medium) to regenerate the plants.

The selected resistant calli were transferred to the MS differentiation medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyl adenine 2mg/L, N- (phosphonomethyl) glycine 0.125mol/L, plant gel 3g/L, pH=5.8) and cultured at 25 ℃. The differentiated plantlets were transferred to the MS rooting medium (MS salt 2.15 g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH=5.8), cultured to about 10cm high at 25℃and transferred to a greenhouse for cultivation until set. In the greenhouse, the cells were cultured at 28℃for 16 hours and at 20℃for 8 hours each day.

1.3 identification and screening of transgenic events

A total of 500 independent transgenic T0 individuals were generated. The p2DBEN-CP-BZ-6 is obtained by molecular detection (including target gene copy number detection, insertion position analysis and the like), astaxanthin content measurement, glufosinate herbicide resistance and agronomic trait evaluation on the offspring of all T0 plants stably inherited.

Example 2 detection of transgenic maize event p2DBEN-CP-BZ-12 Using TaqMan

About 100mg of leaves of transgenic maize event p2DBEN-CP-BZ-12 was taken as a sample, genomic DNA was extracted with Qiagen DNeasy Plant Maxi Kit, and the copy numbers of CrBKT, hpCrtZ, paCrtI, zmPSY and Bar were detected by Taqman probe fluorescent quantitative PCR method. Meanwhile, wild-type maize (non-transgenic, transformed recipient) plants were used as controls for detection analysis as described above. Experiments were repeated 3 times and averaged.

The specific method comprises the following steps:

step 11, taking 100mg of leaves of transgenic corn event p2DBEN-CP-BZ-12, grinding into homogenate in a mortar by using liquid nitrogen, and taking 3 repeats of each sample;

step 12, extracting genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, wherein the specific method refers to the product instruction;

step 13, determining the concentration of the genomic DNA of the sample by using NanoDrop 2000 (Thermo Scientific);

step 14, adjusting the concentration of the genomic DNA of the sample to the same concentration value, wherein the concentration value ranges from 80 ng/mu l to 100 ng/mu l;

step 15, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with the identified known copy number as a standard substance, taking the sample of a wild type corn (non-transgene, transformation receptor) plant as a control, repeating 3 times for each sample, and taking the average value; the fluorescent quantitative PCR primer and the probe sequences are respectively as follows:

The following primers and probes were used to detect the CrBKT gene sequence:

primer 1: TGGAGGACGGAGTAATCAAACC, as shown in SEQ ID NO. 16 of the sequence Listing;

primer 2: GAGGAATAGGAGGCTTAACGACTTC, as shown in SEQ ID NO. 17 of the sequence Listing;

probe 1: TACAGGCTAATGGCAAGCTGCCCCA, as shown in SEQ ID NO. 18 of the sequence Listing;

the following primers and probes were used to detect the HpCrtZ gene sequence:

primer 3: GCGGAGGAAAAGAGAACAACTG, as shown in SEQ ID NO 19 of the sequence Listing;

primer 4: GCCGGACACGCCGATA, as shown in SEQ ID NO. 20 of the sequence Listing;

probe 2: CAAGCCGCCGCCATTGCC, as shown in SEQ ID NO. 21 of the sequence Listing;

the following primers and probes were used to detect the PaCrtI gene sequence:

primer 5: TGATCATGCCTTGCACAAGAG, as shown in SEQ ID NO. 22 of the sequence Listing;

primer 6: TCTACACCCTCATCCACGCTTT, as shown in SEQ ID NO. 23 of the sequence Listing;

probe 3: CTTGGAAACCAAACTCCCCACTCCCTTT, as shown in SEQ ID NO. 24 of the sequence Listing;

the following primers and probes were used to detect the ZmPSY1 gene sequence:

primer 7: CTCGTCCGAGCAGAAGGTCTA, as shown in SEQ ID NO. 25 of the sequence Listing;

primer 8: TGCGCAGCTGGCGTTT, as shown in SEQ ID NO. 26 of the sequence Listing;

probe 4: TCGTGCTCAAGCAGGCCGCATT, as shown in SEQ ID NO 27 of the sequence Listing;

The following primers and probes were used to detect the Bar gene sequence:

primer 9: TGGGCTCCACGCTCTACAC, as shown in SEQ ID NO. 28 of the sequence Listing;

primer 10: ATGACAGCGACCACGCTCTT, as shown in SEQ ID NO. 29 of the sequence Listing;

probe 5: ACCTGCTGAAGTCCCTGGAGGCACA, as shown in SEQ ID NO. 30 of the sequence Listing;

the PCR reaction system is that

The 50 Xprimer/probe mixture contained 45. Mu.L of each primer at a concentration of 1mM, 50. Mu.L of probe at a concentration of 100. Mu.M and 860. Mu.L of 1 XTE buffer, and was stored in amber tubes at 4 ℃.

The PCR reaction conditions were

The data were analyzed using SDS2.3 software (Applied Biosystems) to obtain a single copy of the transgenic maize event p2DBEN-CP-BZ-12.

Example 3 transgenic maize event p2DBEN-CP-BZ-12 detection

3.1 genomic DNA extraction

DNA extraction according to the conventionally employed CTAB (cetyltrimethylammonium bromide) method: 2 g of tender transgenic corn event p2DBEN-CP-BZ-12 leaves are ground into powder in liquid nitrogen, 0.5mL of DNA preheated at 65 ℃ is added to extract CTAB Buffer [20g/L CTAB,1.4M NaCl,100mM Tris-HCl,20mM EDTA (ethylenediamine tetraacetic acid) ], the pH is adjusted to 8.0 by NaOH, and the mixture is fully and uniformly mixed and extracted for 90min at 65 ℃; adding 0.5 volume of phenol and 0.5 volume of chloroform, and mixing the mixture upside down; centrifuging at 12000rpm for 10min; sucking the supernatant, adding 1-time volume of isopropanol, gently shaking the centrifuge tube, and standing at-20deg.C for 30min; further centrifuging at 12000rpm for 10min; collecting DNA to the bottom of the tube; discarding the supernatant, washing the precipitate with 0.5mL of 70% ethanol by volume; centrifuging at 12000rpm for 5min; vacuum pumping or blow-drying in an ultra clean bench; the DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl,1mM EDTA,pH 8.0), and stored at a temperature of-20 ℃.

3.2 analysis of flanking DNA sequences

And (3) carrying out concentration measurement on the extracted DNA sample, so that the concentration of the sample to be measured is between 80 and 100 ng/. Mu.L. Genomic DNA was digested with selected restriction enzymes SpeI, pstI, bssHII (5 'end assay) and SacI, kpnI, xmaI, nheI (3' end assay), respectively. 26.5. Mu.L of genomic DNA, 0.5. Mu.L of the above-selected restriction enzyme and 3. Mu.L of the cleavage buffer were added to each cleavage system, and the cleavage was performed at an appropriate temperature for 1 hour. After the enzyme digestion is finished, 70 mu L of absolute ethyl alcohol is added into an enzyme digestion system, ice bath is carried out for 30min, centrifugal separation is carried out for 7min at the rotating speed of 12000rpm, supernatant is discarded, drying is carried out, and then 8.5 mu L of double distilled water (ddH) is added ₂ O), 1. Mu.L of 10 XT 4 Buffer and 0.5. Mu. L T4 ligase were ligated overnight at 4 ℃. PCR amplification was performed with a series of nested primers to isolate 5 'and 3' transgenes/genomic DNA. Specifically, the isolated 5' transgene/genomic DNA primer combination includes SEQ ID NO. 13, SEQ ID NO. 38 as a first primer, SEQ ID NO. 39, SEQ ID NO. 40 as a second primer, and SEQ ID NO. 13 as a sequencing primer. The isolated 3' transgene/genomic DNA primer combination included SEQ ID NO. 15, SEQ ID NO. 41 as the first primer, SEQ ID NO. 42, SEQ ID NO. 43 as the second primer, SEQ ID NO. 15 as the sequencing primer, and the PCR reaction conditions are shown in Table 3.

The resulting amplicons were electrophoresed on a 2.0% agarose Gel to isolate the PCR reaction, followed by isolation of the fragment of interest from the agarose matrix using the QIAquick Gel extraction kit (catalogue # 28704, qiagen Inc., valencia, CA). The purified PCR product is then sequenced (e.g., ABI prism 377, PE Biosystems, foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR inc., madison, WI).

The 5 'and 3' flanking sequences and the junction sequences were confirmed using standard PCR methods. The 5' flanking sequences and the junction sequences can be confirmed using SEQ ID NO. 8 or SEQ ID NO. 12, in combination with SEQ ID NO. 9, SEQ ID NO. 13 or SEQ ID NO. 38. The 3' flanking sequences and the junction sequences can be confirmed using SEQ ID NO. 11 or SEQ ID NO. 14 in combination with SEQ ID NO. 10, SEQ ID NO. 15 or SEQ ID NO. 41. The PCR reaction system and the amplification conditions are shown in tables 3 and 4. Those skilled in the art will appreciate that other primer sequences may be used to confirm flanking and junction sequences.

DNA sequencing of PCR products provides DNA that can be used to design other DNA molecules as primers and probes for identification of maize plants or seeds derived from transgenic maize event p2 DBEN-CP-BZ-12.

It was found that nucleotide 1-725 of SEQ ID NO. 5 shows the maize genomic sequence flanking the right border (5 'flanking sequence) of the transgenic maize event p2DBEN-CP-BZ-12 insert sequence and nucleotide 10715-11127 of SEQ ID NO. 5 shows the maize genomic sequence flanking the left border (3' flanking sequence) of the transgenic maize event p2DBEN-CP-BZ-12 insert sequence. The 5 'junction sequence is set forth in SEQ ID NO. 1 and the 3' junction sequence is set forth in SEQ ID NO. 2.

3.3 PCR zygosity assay

The junction sequence is a relatively short polynucleotide molecule that is a novel DNA sequence that is diagnostic for the DNA of transgenic maize event p2DBEN-CP-BZ-12 when detected in a polynucleic acid detection assay. The binding sequence of SEQ ID NO. 1 comprises 11bp each on one side of the T-DNARB region insertion site and the corn genomic DNA insertion site of the transgenic corn event p2DBEN-CP-BZ-12, and the binding sequence of SEQ ID NO. 2 consists of 11bp each on the other side of the T-DNALB region insertion site and the corn genomic DNA insertion site of the transgenic corn event p2 DBEN-CP-BZ-12. Longer or shorter polynucleotide binding sequences may be selected from SEQ ID NO. 3 or SEQ ID NO. 4. The junction sequences (5 'junction region SEQ ID NO:1, and 3' junction region SEQ ID NO: 2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The junction sequences SEQ ID NO. 6 and SEQ ID NO. 7 are also novel DNA sequences in the transgenic maize event p2DBEN-CP-BZ-12, which can also be used as DNA probes or as DNA primer molecules to detect the presence of the transgenic maize event p2DBEN-CP-BZ-12 DNA. The sequence of SEQ ID NO. 6 (nucleotide 735-1012 of SEQ ID NO. 3) spans the p2DBEN-CP-BZ construct DNA sequence and the Nos transcription termination sequence, and the sequence of SEQ ID NO. 7 (nucleotide 1-410 of SEQ ID NO. 4) spans the phosphomeflavone acetyl transferase gene Bar sequence and the p2DBEN-CP-BZ construct DNA sequence.

Furthermore, the amplicon is generated by using primers from at least one of SEQ ID NO. 3 or SEQ ID NO. 4, which primers when used in a PCR method generate a diagnostic amplicon for the transgenic maize event p2 DBEN-CP-BZ-12.

Specifically, a PCR product is generated from the 5 'end of the transgenic insert that is a portion of genomic DNA flanking the 5' end of the T-DNA insert in the genome comprising plant material derived from the transgenic maize event p2 DBEN-CP-BZ-12. This PCR product contains SEQ ID NO 3. For PCR amplification, primers 11 (SEQ ID NO: 8) hybridizing to the genomic DNA sequence flanking the 5' -end of the transgene insert and primers 12 (SEQ ID NO: 9) located in the transcription termination sequence of the transgene Nos were designed to pair with them.

A PCR product is generated from the 3 'end of the transgenic insert comprising a portion of genomic DNA flanking the 3' end of the T-DNA insert in the genome of plant material derived from transgenic maize event p2 DBEN-CP-BZ-12. This PCR product contains SEQ ID NO. 4. For PCR amplification, primers 14 (SEQ ID NO: 11) hybridizing to the genomic DNA sequence flanking the 3 '-end of the transgene insert and primers 13 (SEQ ID NO: 10) of the 35s transcription termination sequence at the 3' -end of the insert were designed to pair with.

The DNA amplification conditions described in tables 3 and 4 can be used in the PCR zygosity assay described above to generate the diagnostic amplicon of transgenic maize event p2 DBEN-CP-BZ-12. Detection of the amplicon may be performed by using a Stratagene Robotcycle, MJ Engine, perkin-Elmer 9700 or Eppendorf MastercyclerGradien thermocycler, or the like, or by methods and apparatus known to those skilled in the art.

TABLE 3 PCR step and reaction mixture conditions for identification of 5' transgenic insert/genome combination region of transgenic maize event p2DBEN-CP-BZ-12

Step (a)	Reagent(s)	Quantity of	Remarks
				1	Water without nucleotidase	Added to the final volume 20 [ mu ] L
2	Reaction buffer (and MgCl ₂ ）	2.0µL	1.5mM final buffer concentration MgCl ₂ Final concentration
				3	dATP, dCTP, dGTP and dTTP 10mM solution of (2)	0.4µL	200 mu M final concentration of each dNTP
4	Event primer 11 (SEQ ID NO: 8 suspended in 1×TE buffer or no Nucleotide enzyme in water to 10 mu M Concentration of (C)	0.2µL	Final concentration of 0.1 [ mu ] M
				5	Event primer 12 (SEQ ID NO: 9 suspended in 1×TE buffer or no Nucleotide enzyme in water to 10 mu M Concentration of (C)	0.2µL	Final concentration of 0.1 [ mu ] M
6	RNase, DNase-free (500 ng +. mL)	0.1µL	50 ng/reaction
				7	RED Taq DNA polymerase (1 sheet Bit/1 [ mu ] L	1.0 [ mu ] L (suggesting the next step) Front conversion straw	1 unit/reaction
8	Extracted DNA (template): to be separated into Blade for analyzing sample	200ng of genomic DNA
					Negative control	50ng non-transgenic maize genes Group DNA
	Negative control	Template-free DNA (DNA resuspended in Wherein the solution is
					Positive control	50ng of the composition comprising p2DBEN-CP-BZ- 12, maize genomic DNA

Table 4, perkin-Elmer9700 thermal cycler conditions

Cycle number	Setting up
		1	94 ℃ for 3 minutes
34	94 ℃ for 30 seconds
			64 ℃ for 30 seconds
	72 ℃ for 1 minute
		1	72 ℃ for 10 minutes

Mix gently, if there is no thermal cap on the thermocycler, 1-2 drops of mineral oil can be added above each reaction solution. PCR was performed on a Stratagene Robotcycler (Stratagene, la Jolla, calif.), MJ Engine (MJ R-Biorad, hercules, calif.), perkin-Elmer9700 (Perkin Elmer, boston, mass.) or Eppendorf Mastercycler Gradient (Eppendorf, hamburg, germany) thermocycler using the cycling parameters of Table 4. The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a calculated mode. The Perkin-Elmer9700 thermocycler is operated with a ramp rate (ramp speed) set to a maximum value.

The experimental results show that: primers 11 and 12 (SEQ ID NOS: 8 and 9), which when used in a PCR reaction of transgenic maize event p2DBEN-CP-BZ-12 genomic DNA, produce amplified products of 1012bp fragments, and when used in a PCR reaction of untransformed maize genomic DNA and non p2DBEN-CP-BZ-12 maize genomic DNA, NO fragments are amplified; primers 13 and 14 (SEQ ID NOS: 10 and 11), when used in the PCR reaction of the transgenic maize event p2DBEN-CP-BZ-12 genomic DNA, produced amplified products of 834bp fragments, when used in the PCR reaction of the untransformed maize genomic DNA and the non p2DBEN-CP-BZ-12 maize genomic DNA, NO fragments were amplified.

The PCR zygosity assay can also be used to identify whether the material derived from the transgenic maize event p2DBEN-CP-BZ-12 is homozygous or heterozygous. Primer 15 (SEQ ID NO: 12), primer 16 (SEQ ID NO: 13) and primer 17 (SEQ ID NO: 14), or primer 16 (SEQ ID NO: 13), primer 17 (SEQ ID NO: 14) and primer 18 (SEQ ID NO: 15) are used in an amplification reaction to generate a diagnostic amplicon of transgenic maize event p2 DBEN-CP-BZ-12. The DNA amplification conditions described in tables 5 and 6 can be used in the zygosity assay described above to generate a diagnostic amplicon for transgenic maize event p2 DBEN-CP-BZ-12.

TABLE 5 reaction solution for measuring the bondability

Step (a)	Reagent(s)	Quantity of	Remarks
				1	Nuclease-free water	Added to the final volume 5 [ mu ] L
2	2*Universal Master Mix (Applied Biosystems mesh) Number 4304437	5µL	Final concentration of 1
				3	Primer 15 (SEQ ID NO: 12) And primer 16 (SEQ ID NO: 13 And primer 17 (SEQ ID NO: 14 (resuspended in non-nucleic acid water) To a concentration of 10 μm	0.3µL	Final concentration of 0.1 [ mu ] M
4	REDTaq DNA polymerase (1 sheet Bit/[ mu ] L	1.0 [ mu ] L (suggest before the next step) Conversion straw	1 unit/reaction
				5	Extracted DNA (template): to be analyzed Blade of sample	200ng of genomic DNA
	Negative control	50ng of non-transgenic maize genome DNA
					Negative control	Template-free DNA (DNA resuspended in In which the solution
	Positive control	50ng of the composition comprising p2DBEN-CP-BZ- 12, maize genomic DNA

TABLE 6 determination of the bondability Perkin-Elmer9700 thermal cycler conditions

Cycle number	Setting up
		1	95 ℃ for 10 minutes
10	95 ℃ for 15 seconds
			64 ℃ for 1 minute (-1 ℃/cycle)
25	95 ℃ for 15 seconds
			54 ℃ for 1 minute
1	Immersion at 10 ℃

PCR was performed on a Stratagene Robotcycler (Stratagene, la Jolla, calif.), MJ Engine (MJ R-Biorad, hercules, calif.), perkin-Elmer9700 (Perkin Elmer, boston, mass.) or Eppendorf Mastercycler Gradient (Eppendorf, hamburg, germany) thermocycler using the cycling parameters of Table 6. The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a calculated mode. The Perkin-Elmer9700 thermocycler is operated with a ramp rate (ramp speed) set to a maximum value.

In the amplification reaction, the biological sample containing the template DNA contains DNA diagnostic for the presence of transgenic maize event p2DBEN-CP-BZ-12 in the sample. Or the reaction will produce two different DNA amplicons from a biological sample containing DNA derived from the corn genome that is heterozygous for the allele corresponding to the insert DNA present in the transgenic corn event p2 DBEN-CP-BZ-12. These two different amplicons will correspond to a first amplicon derived from the wild-type maize genomic locus and a second amplicon that diagnoses the presence of the transgenic maize event p2DBEN-CP-BZ-12 DNA. Only a corn DNA sample corresponding to a single amplicon of the second amplicon described for the heterozygous genome is generated, the presence of transgenic corn event p2DBEN-CP-BZ-12 can be determined diagnostically in the sample, and the sample is generated from a corn seed that is homozygous for the allele corresponding to the insert DNA present in the transgenic corn plant p2 DBEN-CP-BZ-12.

It should be noted that the primer pair of transgenic maize event p2DBEN-CP-BZ-12 was used to generate an amplicon diagnostic for the transgenic maize event p2DBEN-CP-BZ-12 genomic DNA. These primer pairs include, but are not limited to, primers 11 and 12 (SEQ ID NOS: 8 and 9), and primers 13 and 14 (SEQ ID NOS: 10 and 11) for use in the DNA amplification method. In addition, a control primer 19 and 20 (SEQ ID NO:31 and SEQ ID NO: 32) for amplifying the maize endogenous gene was included as an intrinsic criterion for the reaction conditions. Analysis of the transgenic maize event p2DBEN-CP-BZ-12 DNA extract samples should include a positive tissue DNA extract control for the transgenic maize event p2DBEN-CP-BZ-12, a negative DNA extract control derived from the non-transgenic maize event p2DBEN-CP-BZ-12 and a negative control that does not contain the template maize DNA extract. In addition to these primer pairs, any primer pair from SEQ ID NO. 3 or SEQ ID NO. 4, or the complement thereof, which when used in a DNA amplification reaction, produces an amplicon comprising SEQ ID NO. 1 or SEQ ID NO. 2 that is diagnostic for tissue derived from transgenic event maize plant p2DBEN-CP-BZ-12, respectively, may be used. The DNA amplification conditions set forth in tables 3-46 can be used to generate diagnostic amplicons of transgenic maize event p2DBEN-CP-BZ-12 using appropriate primer pairs. Extracts that are presumed to contain corn plant or seed DNA comprising transgenic corn event p2DBEN-CP-BZ-12, or products derived from transgenic corn event p2DBEN-CP-BZ-12, that when tested in a DNA amplification method produce an amplicon diagnostic for transgenic corn event p2DBEN-CP-BZ-12, can be used as templates for amplification to determine the presence or absence of transgenic corn event p2DBEN-CP-BZ-12.

Example 4 detection of transgenic maize event p2DBEN-CP-BZ-12 by Southern blot hybridization

4.1 DNA extraction for Southern blot hybridization

Southern blot analysis was performed using T4, T5 generation homozygous transformation events. Approximately 5 to 10g of plant tissue was ground in liquid nitrogen using a mortar and pestle. Plant tissue was resuspended in 12.5mL extraction buffer a (0.2M Tris ph=8.0, 50mM EDTA,0.25M NaCl,0.1%v/v β -mercaptoethanol, 2.5% w/v polyvinylpyrrolidone) and centrifuged at 4000rpm for 10 min (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5mL of extraction buffer B (0.2M Tris ph=8.0, 50mM EDTA,0.5M NaCl,1%v/v β -mercaptoethanol, 2.5% w/v polyvinylpyrrolidone, 3% myo-aminoacyl, 20% ethanol) and incubated for 30 min at 37 ℃. During the incubation period, the samples were mixed once with a sterile loop. After incubation, an equal volume of chloroform/isoamyl alcohol (24:1) was added, gently mixed by inversion and centrifuged at 4000rpm for 20 minutes. The aqueous layer was collected and centrifuged at 4000rpm for 5 minutes after the addition of 0.54 volume of isopropanol to precipitate the DNA. The supernatant was discarded and the DNA pellet was resuspended in 500. Mu.L TE. To degrade any RNA present, the DNA was incubated with 1. Mu.L of 30mg/mL RNAaseA for 30 min at 37℃and centrifuged at 4000rpm for 5 min, and the DNA was precipitated by centrifugation at 14000rpm for 10 min in the presence of 0.5 volumes of 7.5M ammonium acetate and 0.54 volumes of isopropanol. After discarding the supernatant, the pellet was washed with 500. Mu.L of 70% ethanol and dried and resuspended in 100. Mu.L TE.

4.2 restriction enzyme digestion

DNA concentrations were quantitatively detected using a spectrophotometer or fluorometer (using 1 xTAE and GelRED dyes). In a 100. Mu.L reaction system, 5. Mu.g of DNA was digested each time. Genomic DNA was digested with restriction enzymes SpeI and KpnI, respectively, and the partial sequences of CrBKT, hpCrtZ, paCrtI, zmPSY and Bar on T-DNA were used as probes. For each enzyme, the digestate was incubated at the appropriate temperature overnight. The samples were spun down to a volume of 30 μl using a vacuum centrifugal evaporative concentrator (speed vacuum).

4.3 gel electrophoresis

Bromophenol blue loading dye was added to each sample from this example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide, electrophoretically separated in TBE electrophoresis buffer, and the gel was electrophoresed overnight at 20 volts.

The gel was washed in 0.25M HCl for 15 minutes to depurinate the DNA, then washed with water. Southern blot hybridization was set as follows: in the tray 20 thick dry blotting papers were placed, and 4 thin dry blotting papers were placed thereon. In 0.4M NaOH, 1 sheet of Bao Yinji paper was pre-moistened and placed on the paper stack, followed by 1 sheet of Hybond-N+ transfer film pre-moistened in 0.4M NaOH (Amersham Pharmacia Biotech, # RPN 303B). The gel is placed on top, ensuring that there are no bubbles between the gel and the membrane. 3 additional pre-soaked blotters were placed on top of the gel and the buffer tray was filled with 0.4M NaOH. The gel stack and the buffer disc were connected with a wick pre-immersed in 0.4M NaOH, and the DNA was transferred to the membrane. DNA transfer was performed at room temperature for about 4 hours. After transfer, the Hybond membranes were rinsed in 2 XSSC for 10 seconds and the DNA was bound to the membrane by UV cross-linking.

4.4 hybridization

PCR was used to amplify the appropriate DNA sequences for probe preparation. The DNA probe is SEQ ID NO. 33,SEQIDNO:34,SEQIDNO:35SEQ ID NO:36, SEQ ID NO. 37 or homologous or complementary to the sequence part. 25ng of probe DNA was boiled in 45. Mu.L TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5. Mu.l of 32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37℃for 15 minutes. The probe was purified by centrifugation through a microcentrifuge G-50 column (Amersham Pharmacia Biotech, # 27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. Probe activity was measured using a scintillation counter. Pre-hybridization by Church pre-warmed with 20mL at 65 ℃Traffic liquid (500 mM Na) ₃ P0 ₄ 1mM EDTA,7%SDS,1%BSA) wet the Hybond membrane for 30 minutes, prehybridized the Hybond membrane. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. To the pre-hybridization buffer, an appropriate amount of probe (1 million counts per 1mL of pre-hybridization buffer) was added and hybridization was performed overnight at 65 ℃. The next day, hybridization buffer was discarded and 20mL Church rinse solution 1 (40 mM Na ₃ P0 ₄ 1mM EDTA,5% SDS,0.5% BSA) was washed in 150mL Church rinse solution 1 at 65℃for 20 minutes. Washing with Church rinse solution 2 (40 mM Na ₃ P0 ₄ 1mM EDTA,1% SDS) was repeated 2 times. The membrane is exposed to a phosphor screen or X-ray film to detect the location of probe binding.

Two control samples were included on each Southern: (1) DNA from negative (untransformed) isolates that are used to identify any endogenous maize sequences that can hybridize to the element-specific probe; (2) DNA from positive segregants into which HindIII digested p2DBEN-CP-BZ was introduced in an amount equivalent to one copy number based on probe length to demonstrate the sensitivity of the experiment when detecting single gene copies within the maize genome.

Hybridization data provided corroborated evidence to support TaqMan ^TM PCR analysis, i.e., maize plant p2DBEN-CP-BZ-12 contained a single copy of CrBKT, hpCrtZ, paCrtI, zmPSY and Bar genes. Using the CrBKT probe, speI and KpnI enzymatic hydrolysis produced single bands of about 32.2kb and 12.6kb in size, respectively; using the HpCrtZ probe, speI and KpnI enzymatic hydrolysis produced single bands of about 32.2kb and 12.6kb in size, respectively; using the PaCrtI probe, speI and KpnI enzymatic hydrolysis produced single bands of about 32.2kb and 12.6kb in size, respectively; using the ZmPSY1 probe, speI and KpnI enzymatic hydrolysis produced single bands of about 32.2kb and 12.6kb in size, respectively; using the Bar probe, speI and KpnI enzymatic hydrolysis resulted in sizes of about 32.2kb and 12.6kb, respectively. This suggests that one copy of each of CrBKT, hpCrtZ, paCrtI, zmPSY and Bar is present in maize transformation event p2 DBEN-CP-BZ-12.

Example 5 herbicide tolerance detection of maize transformation event

The test selects the herbicide (41% glufosinate-isopropyl ammonium)Brine agent) is sprayed. A random block design was used, 3 replicates. The cell area is 15m ² (5 m is multiplied by 3 m), the row spacing is 60cm, the plant spacing is 25cm, the conventional cultivation management is carried out, and a 1m wide isolation belt is arranged between the cells. The transgenic corn event p2DBEN-CP-BZ-12 and wild corn plants (non-transgenic, transformed recipient control (CK-) were treated by 1) spraying clear water; 2) The safener herbicide was sprayed at 1600g a i/ha (4 times the recommended field dose) during the V3 leaf phase and then again at the same dose during the V8 phase. It should be noted that the conversion of the glufosinate herbicide of different content and dosage form into the equivalent glufosinate form is applicable to the following conclusion. The phytotoxicity symptoms were investigated at 1 and 2 weeks after dosing, respectively, and the yield of the cells was determined at harvest. The phytotoxicity symptoms were ranked as shown in table 7. The herbicide damage rate is used as an evaluation index to evaluate an index of herbicide tolerance of a transformation event, specifically, the herbicide damage rate (%) Σ (peer damage number×number of ranks)/(total number×highest rank); the herbicide damage rate refers to the glufosinate damage rate, and the glufosinate damage rate is determined according to the phytotoxicity investigation result of 2 weeks after glufosinate treatment. The corn yield per cell is measured as the total yield (weight) of corn kernels in the middle 3 rows of each cell, and the yield difference between the different treatments is measured as a yield percentage (% yield = glufosinate yield sprayed/clear water yield sprayed). The results of transgenic maize event p2DBEN-CP-BZ-12 for herbicide tolerance and maize yield are shown in FIG. 4 and Table 8.

TABLE 7 grading Standard for the extent of phytotoxicity of glufosinate-ammonium on corn

Grade of phytotoxicity	Description of symptoms
		Level 0	Has no chemical injury and is matched with clear waterControl growth was consistent;
level 1	Slight phytotoxicity symptoms, local color changes, and phytotoxicity spots accounting for less than 10% of the leaf area;
		level 2	Slightly inhibiting growth or losing green, wherein the phytotoxicity spots occupy less than 1/4 of the leaf area;
3 grade	Has great influence on growth and development, and leaf malformation or plant dwarfing or phytotoxicity spots occupy less than 1/2 of the leaf area
		Grade 4	The influence on the growth and development is large, the serious malformation of the leaves or obvious dwarfing of the plants or less than 3/4 of the leaf spot;
grade 5	The phytotoxicity is extremely serious, and the dead plants or phytotoxicity spots occupy more than 3/4 of the leaf area.

Table 8 results of transgenic maize event p2DBEN-CP-BZ-12 on tolerance to glufosinate herbicide and maize yield results

Project/plant	p2DBEN-CP-BZ-12	CK-
			The rate of damage (%) (spray clear)Water	0	0
Glufosinate-ammonium rate (%) (Baoteda 1600g a. I./ha)	0	100
			Yield percentage (guard reaching 1600g a. I./ha)	102	0

The results show that in terms of herbicide (glufosinate) damage rate: 1) The rate of damage to transgenic maize event p2DBEN-CP-BZ-12 under glufosinate herbicide (1600 g a.i./ha) treatment was substantially 0, whereby transgenic maize event p2DBEN-CP-BZ-12 had good glufosinate herbicide tolerance.

In terms of yield: the yield of the transgenic corn event p2DBEN-CP-BZ-12 was not significantly different under the 2 treatments of spraying clear water and spraying 1600g a.i./ha glufosinate, and after the glufosinate herbicide was sprayed, the yield of the transgenic corn event p2DBEN-CP-BZ-12 was slightly improved over the clearly sprayed treatment group, thereby further indicating that the transgenic corn event p2DBEN-CP-BZ-12 had good glufosinate herbicide tolerance.

Example 6 comparison of astaxanthin content in maize

The method for extracting astaxanthin of transgenic corn event p2DBEN-CP-BZ-12 and wild corn plants (non-transgenic, transformed receptor control (CK-) by adopting a methanol-ethyl acetate extraction method comprises the following specific steps:

1) Weighing a certain amount of sample to be measured (dried corn is crushed and then weighed)

2) Adding the extract (methanol: tetrahydrofuran=1: 1, volume ratio), vortex oscillation for 1min

3) Heating in water bath at 60deg.C for 20min, taking out, and oscillating for 1min

4) Adding ethyl acetate, oscillating for 1min

5) Centrifuging at 4000r/min for 5min, collecting supernatant

6) Centrifuging at 10000r/min for 10min, collecting supernatant

7) The mixture was filtered through a 0.45 μm filter and detected by a UV-5100 ultraviolet spectrophotometer (Shanghai Yuan-Xuezhi instrument).

As shown in FIG. 3, from the color of the corn kernel, the transgenic corn event p2DBEN-CP-BZ-12 of the present invention was redder in color, orange red in color, compared to wild-type corn plants (CK-), indicating a higher astaxanthin content. And the astaxanthin content results of the transgenic corn event p2BDEN-CP-BZ-6 and the wild-type corn plant (CK-) by a methanol-ethyl acetate extraction method show that the astaxanthin content of the transgenic corn event p2BDEN-CP-BZ-6 is 72.50 mug/g, and the astaxanthin content of the wild-type corn plant (CK-) is only 13.35 mug/g.

Example 7 identification of the biological Activity of zeaastaxanthin

(1) Determining the optimal addition amount of astaxanthin in feed

The haematococcus pluvialis powder containing 2.84% of astaxanthin is added into the feed to obtain feeds (0, 5, 10, 15, 30 and 150 mg/kg) with different astaxanthin contents. With increasing astaxanthin content in the feed, the yolk color changed from yellow to red. The addition cost of the astaxanthin and the redness degree of the yolk are comprehensively considered, and 30mg astaxanthin is added to each kg of feed to be used as the optimal addition concentration of the astaxanthin.

(2) Three experiments were set up based on the optimal additive concentration determined in step (1)

The first set of experiments was a negative control, i.e., non-transgenic corn without astaxanthin; the second group of experiments is positive control, namely astaxanthin algae powder with the astaxanthin content equal to that of the astaxanthin corn; the third group of experiments was the experimental group, transgenic astaxanthin corn. The chicken can absorb astaxanthin from the feed and accumulate it in the yolk at week 4, 8 weeks on a daily feed of 30mg/kg astaxanthin.

As shown in fig. 5, the hen feeding test showed that the hen egg yolk fed with astaxanthin-rich corn (experimental group) and algae meal-enriched feed (positive control) was red, while the hen egg yolk of the negative control was yellow.

Taken together, regenerated transgenic maize plants were examined for the presence of ZmPSY1, paPaCrtI, crBKT, hpCrtZ and Bar genes by taqman analysis (see example 2) and characterized for copy numbers of astaxanthin-and glufosinate-herbicide-tolerant lines. Based on the copy number of the gene of interest, astaxanthin-rich, glufosinate herbicide tolerance and agronomic performance (see examples 4-6), the selection of event p2DBEN-CP-BZ-12 was superior with single copy transgenes, higher astaxanthin content, glufosinate herbicide tolerance and superior agronomic performance.

Claims

1. A nucleic acid sequence comprising one or more selected from the group consisting of sequences SEQ ID nos. 1-7 or complements thereof, said nucleic acid sequence being derived from transgenic maize event P2DBEN-CP-BZ-12, a representative sample of seed comprising said transgenic maize event P2DBEN-CP-BZ-12 having been deposited with the chinese collection under accession number cctccc No. P202331.

2. A DNA primer pair comprising a first primer and a second primer, wherein each of said first primer and said second primer comprises a partial sequence of SEQ ID No. 5 or a complement thereof and when used in an amplification reaction with DNA comprising the corn event P2DBEN-CP-BZ-12, produces an amplicon of the corn event P2DBEN-CP-BZ-12 in a test sample, a representative sample of seeds comprising said event having been deposited under deposit number cctccc No. P202331.

3. The pair of DNA primers according to claim 2, wherein the first primer is selected from the group consisting of SEQ ID No. 1 or its complement, SEQ ID No. 8 or SEQ ID No. 12; the second primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14.

4. The pair of DNA primers according to claim 2, wherein the first primer is selected from the group consisting of SEQ ID No. 1 or its complement, SEQ ID No. 8 or SEQ ID No. 12, and the second primer is selected from the group consisting of SEQ ID No. 9 or SEQ ID No. 13; or the first primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 10 or SEQ ID NO. 15, and the second primer is selected from SEQ ID NO. 11 or SEQ ID NO. 14.

5. A DNA probe comprising a partial sequence of SEQ ID No. 5 or a complement thereof, said DNA probe hybridizing under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID nos. 1 to 7 or a complement thereof and not hybridizing under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID nos. 1 to 7 or a complement thereof.

6. The DNA probe of claim 5, wherein the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO. 3 or a sequence complementary thereto, and SEQ ID NO. 4 or a sequence complementary thereto.

7. The DNA probe of claim 5, wherein the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO. 1 or a sequence complementary thereto, SEQ ID NO. 2 or a sequence complementary thereto, SEQ ID NO. 6 or a sequence complementary thereto, and SEQ ID NO. 7 or a sequence complementary thereto.

8. A marker nucleic acid molecule comprising a partial sequence of SEQ ID No. 5 or a complement thereof, said marker nucleic acid molecule hybridizing under stringent hybridization conditions with a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID nos. 1 to 7 or a complement thereof and not hybridizing under stringent hybridization conditions with a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID nos. 1 to 7 or a complement thereof.

9. The marker nucleic acid molecule of claim 8, wherein the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID No. 3 or its complement, SEQ ID No. 4 or its complement.

10. The marker nucleic acid molecule of claim 8, wherein the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID No. 1 or its complement, SEQ ID No. 2 or its complement, SEQ ID No. 6 or its complement and SEQ ID No. 7 or its complement.

11. A method of detecting the presence of DNA comprising transgenic maize event p2DBEN-CP-BZ-12 in a sample comprising:

(1) Contacting a sample to be detected with the DNA primer pair of any one of claims 2 to 4 in a nucleic acid amplification reaction;

(2) Performing a nucleic acid amplification reaction;

(3) Detecting the presence of an amplification product;

the amplification product comprises a nucleic acid sequence selected from the group consisting of sequences SEQ ID NO. 1-7 or a complement thereof, i.e., a DNA representing the presence of the transgenic maize event p2DBEN-CP-BZ-12 in the test sample; representative samples of seeds containing the event have been preserved at a preservation number CCTCC NO: P202331.

12. A method of detecting the presence of DNA comprising transgenic maize event p2DBEN-CP-BZ-12 in a sample comprising:

(1) Contacting a sample to be detected with the DNA probe of any one of claims 5-7, and/or the marker nucleic acid molecule of any one of claims 8-10;

(3) Detecting hybridization of the sample to be detected with the probe and/or the marker nucleic acid molecule;

representative samples of seeds containing the event have been preserved at a preservation number CCTCC NO: P202331.

13. A DNA detection kit comprising: the DNA primer pair of any one of claims 2-4, the DNA probe of any one of claims 5-7, and/or the marker nucleic acid molecule of any one of claims 8-10.

14. A method for increasing astaxanthin content in corn seeds, comprising planting at least one transgenic corn plant, wherein the genome of the transgenic corn plant comprises, in sequence, the nucleic acid sequence of SEQ ID No. 1, SEQ ID No. 5, positions 746-10703, and SEQ ID No. 2, or wherein the genome of the transgenic corn plant comprises the sequence of SEQ ID No. 5.

15. A method for protecting a maize plant from injury caused by a herbicide, characterized in that at least one transgenic maize plant is grown, said transgenic maize plant comprising in sequence the nucleic acid sequence of SEQ ID No. 1, SEQ ID No. 5, positions 746-10703 and SEQ ID No. 2 in the genome of said transgenic maize plant, or said transgenic maize plant comprising the sequence of SEQ ID No. 5 in the genome of said transgenic maize plant.

16. A method of controlling weeds in a field in which corn plants are grown, comprising applying an effective dose of glufosinate herbicide to the field in which at least one transgenic corn plant is grown, said transgenic corn plant comprising in its genome the nucleic acid sequences of SEQ ID No. 1, SEQ ID No. 5, positions 746-10703 and SEQ ID No. 2, in that order, or said transgenic corn plant comprising in its genome the sequence of SEQ ID No. 5.

17. A processed product that produces a transgenic corn event p2DBEN-CP-BZ-12, wherein the processed product is corn flour, corn oil, corn silk, or corn starch; representative samples of seeds containing the event have been preserved at a preservation number CCTCC NO: P202331.