CN106119245B - For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 - Google Patents

For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 Download PDF

Info

Publication number
CN106119245B
CN106119245B CN201610440595.1A CN201610440595A CN106119245B CN 106119245 B CN106119245 B CN 106119245B CN 201610440595 A CN201610440595 A CN 201610440595A CN 106119245 B CN106119245 B CN 106119245B
Authority
CN
China
Prior art keywords
seq
dbn9001
dna
nucleic acid
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610440595.1A
Other languages
Chinese (zh)
Other versions
CN106119245A (en
Inventor
王登元
于彩虹
张成伟
韩超
李晓娇
姜自芹
张良君
吴竹筠
田康乐
鲍晓明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Dabeinong Biotechnology Co Ltd
Original Assignee
Beijing Dabeinong Technology Group Co Ltd
Beijing Dabeinong Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Dabeinong Technology Group Co Ltd, Beijing Dabeinong Biotechnology Co Ltd filed Critical Beijing Dabeinong Technology Group Co Ltd
Priority to CN201610440595.1A priority Critical patent/CN106119245B/en
Publication of CN106119245A publication Critical patent/CN106119245A/en
Application granted granted Critical
Publication of CN106119245B publication Critical patent/CN106119245B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N25/00—Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of application, e.g. seed treatment or sequential application; Substances for reducing the noxious effect of the active ingredients to organisms other than pests
    • A01N25/32—Ingredients for reducing the noxious effect of the active substances to organisms other than pests, e.g. toxicity reducing compositions, self-destructing compositions
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/18—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds
    • A01N57/20—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds containing acyclic or cycloaliphatic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275—Glyphosate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8277—Phosphinotricin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C12N9/1092—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01183—Phosphinothricin acetyltransferase (2.3.1.183)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01019—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Abstract

The present invention relates to a kind of for detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001, and the nucleic acid sequence of the bean plant includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series.Transgenic soybean event DBN9001 of the present invention has preferable tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, on yield without influence, and detection method can quickly and accurately identify in biological sample whether include transgenic soybean event DBN9001 DNA molecular.

Description

For detecting the nucleic acid sequence and its inspection of herbicide-tolerant soybean plant DBN9001 Survey method
Technical field
The nucleic acid sequence and its detection side that the present invention relates to a kind of for detecting herbicide-tolerant soybean plant DBN9001 Method, more particularly to it is a kind of tolerance glyphosate and glufosinate-ammonium bean plant DBN9001 and detection biological sample in whether include The method of the DNA molecular of specific transgenic soybean event DBN9001.
Background technique
N- phosphonomethylglycine, also referred to as glyphosate are a kind of chronic wide spectrum steriland herbicides of inner sucting conduction type.Grass Sweet phosphine is the competing of the synthesis substrate phosphoenolpyruvate (PEP) of 5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) Striving property inhibitor can inhibit both substrates of PEP and 3- phosphoric acid shikimic acid under EPSPS catalysis to 5- enolpyruvyl acyl thick grass The conversion of acid -3- phosphoric acid shikimic acid makes protein so that aromatic amino acid be blocked to synthesize precursor-shikimic acid route of synthesis Synthesis be interfered and lead to plant and bacterial death.
Glyphosate tolerant can be realized by the EPSPS of expression modification.The EPSPS of modification has glyphosate lower Compatibility, thus in the presence of glyphosate, EPSPS maintains their catalytic activity, that is, it is resistance to obtain glyphosate By property.
Soybean (Glycine max) is one of big main cultivation crop in the world five.Herbicide tolerant is one in Soybean production The important economical character of item, especially to the tolerance of glyphosate herbicidal.Soybean can be with to the tolerance of glyphosate herbicidal It expresses that glyphosate herbicide tolerant type gene (EPSPS, CP4) in bean plant by transgene method and obtains, example Such as soybean event GTS40-3-2, soybean event MON89788.
The increasingly increase that generally use and the glyphosate of glyphosate tolerant tillage systems use already leads to careless in recent years The prevalence of sweet phosphine resistant weed.In grower in face of glyphosate-resistant weeds or the ground changed to the weed species being more difficult to control Area, grower can be by mixing or being used interchangeably to the weak of compensation glyphosate with other herbicides that can control omission weeds Point.
Glufosinate-ammonium is one of phosphinothricin class herbicide non-systemic, nonselective herbicide.It is mainly used for 1 year It is raw or perennial broadleaf weed be unearthed after control, be by L-phosphinothricin (active constituent in glufosinate-ammonium) to glutamine Synthase (a kind of the ammonolysis poison in plant necessary to enzyme) can not retroactive inhibition control weeds.Root is killed not with glyphosate Together, glufosinate-ammonium first kills leaf, can be conducted in plant xylem by plant transpiration effect, between quick-acting in paraquat and Between glyphosate.
The phosphinothricin N-acetyl transferase (PAT) separated from streptomycete is catalyzed L-phosphinothricin conversion by acetylation For its inactive form.The gene of plant optimization form of PAT is expressed in soybean using to assign soybean to glufosinate-ammonium The tolerance of herbicide, such as soybean event A5547-127.Therefore glufosinate-ammonium weeding is applied in combination with glufosinate tolerant character Agent can be used as a kind of non-selective means of effectively management glyphosate-resistant weeds.
In future, as the popularization of transgenic pest-resistant soybean and large area are planted, the insect/pest survived on a small quantity After several generations is bred, it is possible to create resistance.Transgenic herbicide-tolerant soybean and turns base as non-pest-resistant genetically engineered soybean Because pest-resistant soybean is planted together with certain proportion, insect/pest can be delayed to generate resistance.
Known foreign gene is influenced in the intracorporal expression of plant by their chromosome location, it may be possible to due to dyeing Matter structure (such as heterochromatin) or transcription regulatory element (such as enhancer) are close to integration site.Thus, it usually needs screening is a large amount of Event be possible to identify can be with commercialized event (event that the target gene imported obtains optimal expression).Example Such as, have been observed that the expression quantity of quiding gene there may be very big difference between event in plant and other organisms；In table On the space reached or time mode may there is also differences, such as between different plant tissues transgenosis relative expression exist it is poor Different, this species diversity shows that actual expression pattern may be pre- with the transcription regulatory element institute in the gene construct according to importing The expression pattern of phase is inconsistent.It is thus typically necessary to generate hundreds and thousands of different events and filter out from these events Single incident with transgene expression amount and expression pattern desired for the purpose of being commercialized.With expected transgenosis table Event up to amount and expression pattern can be used for that transgenosis is penetrated into other by sexual cutcross using conventional breeding methods In genetic background.The transgenic expression characteristics of original transformant are maintained by the offspring that this Crossing system generates.Using this Kind strategy pattern may insure there is reliable gene expression in many kinds, and these kinds can well adapt to locality Growth conditions.
It will be beneficial that the presence of particular event, which is able to detect, so that whether the offspring for determining sexual hybridization includes target gene. In addition, the method for detection particular event also will be helpful to abide by relevant laws and regulations, such as thrown from the food of recombination crops It needs to obtain official approval before entering market and is marked.Transgenosis is detected by any well known polynucleotides detection method Presence be all it is possible, such as polymerase chain reaction (PCR) or using polynucleotide probes DNA hybridization.These detections Method is usually focused on common genetic elements, such as promoter, terminator, marker gene etc..Therefore, unless with insertion turn The sequence of the adjacent chromosomal DNA of gene DNA (" flanking DNA ") be it is known, above-mentioned this method cannot be used to distinguish Different events, especially those events generated with identical DNA construct.Insertion is spanned so often utilizing at present The pair of primers of the junction of transgenosis and flanking DNA identifies transgenosis particular event by PCR, specifically includes The first primer of flanking sequence and the second primer comprising insetion sequence.
Summary of the invention
The nucleic acid sequence that the object of the present invention is to provide a kind of for detecting herbicide-tolerant soybean plant DBN9001 and Its detection method, transgenic soybean event DBN9001 have preferable tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide, And detection method can quickly and accurately identify in biological sample whether include specific transgenic soybean event DBN9001 DNA Molecule.
To achieve the above object, the present invention provides a kind of nucleic acid molecules with following nucleic acid sequence, the nucleic acid sequences Column include at least 11 continuous nucleotide, and/or SEQ ID NO:4 or its complementation in SEQ ID NO:3 or its complementary series At least 11 continuous nucleotide in sequence.
Preferably, the nucleic acid sequence includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or it is mutual Complementary series.
Further, the nucleic acid sequence include SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its Complementary series.
Further, the nucleic acid sequence includes SEQ ID NO:5 or its complementary series.
The SEQ ID NO:1 or its complementary series are 5 ' ends in transgenic soybean event DBN9001 in insetion sequence End is located at the sequence that a length near insertion junction is 22 nucleotide, the SEQ ID NO:1 or its complementary sequence Column span the DNA sequence dna of the flanking genomic DNA sequence of soybean insertion point and 5 ' ends of insetion sequence, comprising described SEQ ID NO:1 or its complementary series can be accredited as the presence of transgenic soybean event DBN9001.The SEQ ID NO:2 Or its complementary series is to be located near insertion junction in transgenic soybean event DBN9001 in 3 ' ends of insetion sequence One length is the sequence of 22 nucleotide, and the SEQ ID NO:2 or its complementary series span 3 ' ends of insetion sequence DNA sequence dna and soybean insertion point flanking genomic DNA sequence, be comprising the SEQ ID NO:2 or its complementary series The presence of transgenic soybean event DBN9001 can be accredited as.
In the present invention, the nucleic acid sequence can be inserted into sequence for the SEQ ID NO:3 or its complementary series transgenic Any portion of at least 11 or more continuous polynucleotides (the first nucleic acid sequence) of column, or be the SEQ ID NO: 3 or its complementary series in 5 ' flank Soybean genomic DNA regions any portion of at least 11 or more continuous multicore glycosides Sour (second nucleotide sequence).The nucleic acid sequence may further be derived from or be complementary to comprising the complete SEQ ID to be same A part of the SEQ ID NO:3 of NO:1.When the first nucleic acid sequence is used together with second nucleotide sequence, these nucleic acid Sequence can be used as DNA primer in the DNA cloning method for generating amplified production.Using DNA primer in DNA cloning method The amplified production of middle generation be when including the amplified production of SEQ ID NO:1 can diagnose transgenic soybean event DBN9001 or The presence of its offspring.Well known to those skilled in the art, the first and second nucleic acid sequences need not be only made of DNA, can also be wrapped Include RNA, DNA and RNA mixture or DNA, RNA or other not as one or more polymerase templates nucleotide or The combination of its analog.In addition, heretofore described probe or primer should be at least about 11,12,13,14,15,16,17, 18, the length of 19,20,21 or 22 continuous nucleotides can be selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID Nucleotide described in NO:3, SEQ ID NO:4 and SEQ ID NO:5.When selected from SEQ ID NO:3, SEQ ID NO:4 and When nucleotide shown in SEQ ID NO:5, the probe and primer can be for length at least about 21 to about 50 or More continuous nucleotides.The SEQ ID NO:3 or its complementary series are in transgenic soybean event DBN9001 in insertion sequence Column 5 ' ends be located at insertion junction near a length be 780 nucleotide sequence, the SEQ ID NO:3 or Its complementary series by 476 nucleotide soybean flanking genomic DNA sequence (the nucleotide 1-476 of SEQ ID NO:3), 39 The prGm17gTsf1 of the engagement region sequence (the nucleotide 477-515 of SEQ ID NO:3) of nucleotide and 265 nucleotide starting 3 ' the end DNA sequences (the nucleotide 516-780 of SEQ ID NO:3) of subsequence form, comprising the SEQ ID NO:3 or its Complementary series can be accredited as the presence of transgenic soybean event DBN9001.
The nucleic acid sequence can be any portion of the SEQ ID NO:4 or its complementary series transgenic insetion sequence At least 11 or more the continuous polynucleotides (third nucleic acid sequence) divided, or be the SEQ ID NO:4 or its complementation Any portion of at least 11 or more continuous polynucleotides (the 4th cores in 3 ' flank Soybean genomic DNA regions in sequence Acid sequence).The nucleic acid sequence may further be derived from or be complementary to comprising the described of the complete SEQ ID NO:2 to be same A part of SEQ ID NO:4.When third nucleic acid sequence is used together with the 4th nucleic acid sequence, these nucleic acid sequences be can be used as DNA primer is in the DNA cloning method for generating amplified production.Expansion using DNA primer to being generated in DNA cloning method Volume increase object is that can diagnose depositing for transgenic soybean event DBN9001 or its offspring when including the amplified production of SEQ ID NO:2 ?.The SEQ ID NO:4 or its complementary series are to be located in transgenic soybean event DBN9001 in 3 ' ends of insetion sequence A length being inserted near junction is the sequence of 877 nucleotide, the SEQ ID NO:4 or its complementary series by The phosphinothricin N-acetyl transferase cPAT sequence (the nucleotide 1-183 of SEQ ID NO:4) of 183 nucleotide, 21 cores The t35S terminator sequence of the carrier intervening sequence (the nucleotide 184-204 of SEQ ID NO:4) of thuja acid, 195 nucleotide Nucleotide (SEQ ID NO:4 in (the nucleotide 205-399 of SEQ ID NO:4), 10 pDBN4003 construct DNA sequence dnas Nucleotide 400-409) and 468 nucleotide soybean integration site flanking genomic DNA sequence (SEQ ID NO:4's It 410-879) forms, can be accredited as transgenic soybean event DBN9001's comprising the SEQ ID NO:4 or its complementary series In the presence of.
The SEQ ID NO:5 or its complementary series are that the length of characterization transgenic soybean event DBN9001 is 6644 The sequence of nucleotide, the genome and genetic elements for specifically including are as shown in table 1.Comprising the SEQ ID NO:5 or its mutually Complementary series can be accredited as the presence of transgenic soybean event DBN9001.
The genome and genetic elements that table 1, SEQ ID NO:5 include
The nucleic acid sequence or its complementary series can be used in DNA cloning method to generate amplicon, the inspection of the amplicon Survey diagnosis biological sample transgenic soybean event DBN9001 or the presence of its offspring；The nucleic acid sequence or its complementary series It can be used in nucleotide detection method, to detect the presence of biological sample transgenic soybean event DBN9001 or its offspring.
To achieve the above object, the present invention also provides the DNA of test sample transgenic soybean event DBN9001 a kind of Existing method, comprising:
Contact sample to be tested in nucleic acid amplification reaction at least two primers for expanding target amplification product；
Carry out nucleic acid amplification reaction；With
Detect the presence of the target amplification product；
The target amplification product include in SEQ ID NO:3 or its complementary series at least 11 continuous nucleotide and/ Or at least 11 continuous nucleotide in SEQ ID NO:4 or its complementary series.
Further, the target amplification product includes 1-11 or 12- in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleotides in 22 continuous nucleotides, and/or SEQ ID NO:2 or its complementary series.
Further, the target amplification product includes at least one selected from the following: SEQ ID NO:1 or its complementation Sequence, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series and SEQ ID NO:7 or its complementary sequence Column.
In the above-mentioned technical solutions, at least one primer includes the nucleic acid sequence or its segment or complementation therewith Sequence.
Specifically, the primer includes the first primer and the second primer, the first primer be selected from SEQ ID NO:8 and SEQ ID NO:10；Second primer is selected from SEQ ID NO:9 and SEQ ID NO:11.
To achieve the above object, the present invention also provides the DNA of test sample transgenic soybean event DBN9001 a kind of Existing method, comprising:
Contact sample to be tested with probe, the probe includes at least 11 in SEQ ID NO:3 or its complementary series At least 11 continuous nucleotide in continuous nucleotide, and/or SEQ ID NO:4 or its complementary series；
Hybridize the sample to be tested and the probe under stringent hybridization conditions；With
Detect the hybridisation events of the sample to be tested and the probe.
The stringent condition can in 6 × SSC (sodium citrate), 0.5%SDS (lauryl sodium sulfate) solution, Hybridize at 65 DEG C, is then respectively washed film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.
Further, the probe include in SEQ ID NO:1 or its complementary series 1-11 or 12-22 it is continuous 1-11 or 12-22 continuous nucleotides in nucleotide, and/or SEQ ID NO:2 or its complementary series.
Further, the probe includes at least one selected from the following: SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series and SEQ ID NO:7 or its complementary series.
Selectively, at least one fluorophor label of at least one described probe.
To achieve the above object, the present invention also provides the DNA of test sample transgenic soybean event DBN9001 a kind of Existing method, comprising:
Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:3 or In its complementary series at least 11 continuous nucleotide, and/or SEQ ID NO:4 or its complementary series at least 11 it is continuous Nucleotide；
Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions；With
The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then are educated by marker auxiliary Kind analysis is to determine that glyphosate tolerant and/or glufosinate tolerant and marker nucleic acid molecules are chain on science of heredity.
Further, the marker nucleic acid molecules include 1-11 or in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleosides in 12-22 continuous nucleotides, and/or SEQ ID NO:2 or its complementary series Acid.
Further, the marker nucleic acid molecules include at least one selected from the following: SEQ ID NO:1 or its mutually Complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series and SEQ ID NO:7 or its complementation Sequence.
To achieve the above object, the present invention also provides a kind of DNA detection kit, including at least one DNA molecular, institutes Stating DNA molecular includes at least 11 continuous nucleotide, and/or SEQ in the homologous sequence or its complementary series of SEQ ID NO:3 At least 11 continuous nucleotide, can be used as genetically engineered soybean in the homologous sequence of ID NO:4 or its complementary series Event DBN9001 or its offspring have the DNA primer or probe of specificity.
Further, the DNA molecular includes 1-11 or 12-22 in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleotides in continuous nucleotide, and/or SEQ ID NO:2 or its complementary series.
Further, the DNA molecular includes at least one selected from the following: the homologous sequence of SEQ ID NO:1 or Its complementary series, the homologous sequence of SEQ ID NO:2 or its complementary series, the homologous sequence of SEQ ID NO:6 or its complementary sequence The homologous sequence or its complementary series of column and SEQ ID NO:7.
To achieve the above object, the present invention also provides a kind of plant cell or parts, include coding glyphosate tolerant The nucleic acid sequence of the nucleic acid sequence of EPSPS albumen, the nucleic acid sequence for encoding glufosinate tolerant PAT albumen and specific region, institute The nucleic acid sequence for stating specific region includes at least one selected from the following: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO: Sequence shown in 6 and SEQ ID NO:7.
To achieve the above object, the present invention also provides a kind of generations to glyphosate herbicidal and/or glufosinate-ammonium herbicide The method of soybean plant strain with tolerance, including introducing coding glyphosate tolerant into the genome of the soybean plant strain The nucleic acid of the nucleic acid sequence of EPSPS albumen and/or the nucleic acid sequence of coding glufosinate tolerant PAT albumen and specific region The nucleic acid sequence of sequence, the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO: 4, at least one of sequence shown in SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.
Specifically, the soybean plant strain that there is tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide of generating Method includes:
By the transgenic soybean event DBN9001 to glyphosate herbicidal and/or glufosinate-ammonium herbicide with tolerance the One parental soybean plant and the second parental soybean plant sexual hybridization for lacking glyphosate and/or glufosinate tolerant, to produce Raw a large amount of progeny plants；
The progeny plant described in glyphosate herbicidal and/or glufosinate-ammonium herbicide treatment；With
The progeny plant of selection tolerance glyphosate and/or glufosinate-ammonium.
To achieve the above object, the present invention also provides a kind of cultures to glyphosate herbicidal and/or glufosinate-ammonium herbicide The method of bean plant with tolerance, comprising:
An at least soya seeds are planted, include coding glyphosate tolerant EPSPS in the genome of the soya seeds The nucleic acid sequence of albumen and/or the nucleic acid sequence of coding glufosinate tolerant PAT albumen and the nucleic acid sequence of specific region；
The soya seeds are made to grow up to soybean plant strain；With
The soybean plant strain described in effective dose glyphosate herbicidal and/or glufosinate-ammonium herbicide spray is harvested with other not The plant of nucleic acid sequence with specific region compares the plant with the plant injury weakened；
The nucleic acid sequence of the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.
To achieve the above object, the present invention also provides a kind of sides for protecting the plants from the damage as caused by herbicide Method is planted including the herbicide containing effective dose glyphosate and/or glufosinate-ammonium is applied at least one genetically engineered soybean of plantation The big Tanaka of object, the transgenic soy bean plant include selected from SEQ ID NO:1, SEQ ID NO:2, SEQ in its genome At least one of ID NO:3, SEQ ID NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 core Acid sequence, the transgenic soy bean plant have the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.
To achieve the above object, the present invention also provides a kind of methods for controlling weeds in field, including will contain effective agent Amount glyphosate and/or the herbicide of glufosinate-ammonium are applied to the big Tanaka for planting at least one transgenic soy bean plant, described to turn base Because bean plant includes selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO in its genome: 4, at least one of sequence shown in SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence, transgenosis is big Beans plant has the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.
To achieve the above object, the present invention also provides a kind of crop field glyphosate for controlling glyphosate-tolerant plant is anti- Property weeds method, including the herbicide containing effective dose glufosinate-ammonium is applied at least one glyphosate tolerant of plantation The big Tanaka of transgenic soy bean plant, the transgenic soy bean plant of the glyphosate tolerant include to be selected from its genome SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ At least one of sequence shown in ID NO:7 nucleic acid sequence, the transgenic soy bean plant of the glyphosate tolerant have pair simultaneously The tolerance of glufosinate-ammonium herbicide.
To achieve the above object, the present invention also provides a kind of methods for delaying insect-resistant, and it is pest-resistant big to be included in plantation The big Tanaka of beans plant plants at least one transgenic soy bean plant with glyphosate and/or glufosinate tolerant, the tool Having the transgenic soy bean plant of glyphosate and/or glufosinate tolerant in its genome includes selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 At least one of nucleic acid sequence.
To achieve the above object, the present invention also provides a kind of multicore glycosides comprising SEQ ID NO:1 or SEQ ID NO:2 The agricultural product or commodity of acid, the agricultural product or commodity are lecithin, fatty acid, glycerol, sterol, soybean piece, soy meal, soybean Albumen or its concentrate, soybean oil, soybean fiber, soya-bean milk grumeleuse or bean curd.
In nucleic acid sequence and its detection method of the present invention for detecting herbicide-tolerant soybean plant DBN9001, Defined below and method can preferably define the present invention and those skilled in the art is instructed to implement the present invention, unless separately It explains, term is understood according to the conventional usage of those of ordinary skill in the art.
" soybean " refers to soya bean (Glycine max), and all plant varieties including that can mate with soybean, Including wild soybean kind.
Term "comprising", " comprising " refer to " including but not limited to ".
Term " plant " includes that whole plant, plant cell, plant organ, plant protoplast, plant can therefrom again It is complete in raw plant cell tissue cultures, plant callus, vegetation bed (plant clumps) and plant or plant part Whole plant cell, the plant part such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stalk, root, the tip of a root, flower Medicine etc..The part for the genetically modified plants being interpreted as in the scope of the invention includes but is not limited to plant cell, protoplast, group It knits, callus, embryo and flower, stem, fruit, Ye Hegen, the above plant part are originated from advance with DNA molecular conversion of the invention And the genetically modified plants being therefore at least partly made of transgenic cell or its filial generation.
Term " gene " refers to the nucleic acid fragment of expression specific protein, including adjusting sequence (5 ' the non-volumes before coded sequence Code sequence) and coded sequence after adjusting sequence (3 ' non-coding sequence)." natural gene ", which refers to, is naturally found to have its own Adjust the gene of sequence." mosaic gene " refer to be not natural gene any gene, it includes non-natural discovery adjusting and Coded sequence." endogenous gene " refers to natural gene, and the natural gene is located in organism genome its natural place. " foreign gene " is the alien gene being not present in the existing genome for being biology and originally, also refers to and imports through Transgenic procedures The gene of recipient cell.Foreign gene may include the natural gene or mosaic gene of insertion non-native organism." transgenosis " It is the gene that genome is had been incorporated by Transformation Program.The site that recombinant DNA has been inserted into Plant Genome can claim For " insertion point " or " target site ".
" flanking DNA " may include the genome being naturally present in the organism of such as plant or be drawn by conversion process External source (heterologous) DNA entered, such as segment relevant to transformation event.Therefore, flanking DNA may include natural and exogenous DNA Combination.In the present invention, " flanking region " or " flanking sequence " or " genome frontier district " or " genome border sequence " refer to The base-pair of at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 is longer Sequence, be located at initial external source insertion DNA molecular immediately upstream or downstream and with initial external source be inserted into DNA molecular phase It is adjacent.When the flanking region is located at downstream, it is referred to as " left margin flank " or " 3 ' flank " or " 3 ' genome frontier district " Or " 3 ' border sequence of genome " etc..When the flanking region is located at upstream, it is referred to as " right margin flank " or " 5 ' sides The wing " or " 5 ' genome frontier district " or " 5 ' border sequence of genome " etc..
The Transformation Program of the random integration of exogenous DNA is caused to will lead to the transformant containing different flanking regions, the difference Flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, flanking region is logical Chang Buhui changes.Transformant also can be containing between heterologous insertion DNA and the section of genomic DNA or between two sections of genomic DNAs Or the unique engagement between two sections of allogeneic dna sequence DNAs." engagement " is the point of two specific DNA fragmentation connections.For example, engagement exists In the position of insert DNA connection flanking DNA.Junction is also present in the organism of conversion, and two of them DNA fragmentation is to repair Adorn linking together for the mode found from native organism." engagement DNA ", " engaging zones " refer to comprising junction DNA。
The present invention provides the referred to as transgenic soybean event of DBN9001 and its offspring, the transgenic soybean events DBN9001 is bean plant DBN9001 comprising the Plants and Seeds of transgenic soybean event DBN9001 and its plant are thin Born of the same parents or its renewable part, the plant part of the transgenic soybean event DBN9001, including but not limited to cell, pollen, embryo Pearl, flower, bud, root, stem, leaf, pod and the product from bean plant DBN9001, such as soybean cake, powder and oil, are specifically as follows Lecithin, fatty acid, glycerol, sterol, edible oil, defatted soybean piece, including degreasing and the soy meal of baking, soya-bean milk grumeleuse, Bean curd, soybean protein concentrate, the soybean protein of separation, hydrolyzed vegetable protein, textured soybean protein and soybean fiber.
Transgenic soybean event DBN9001 of the present invention contains a DNA construct, when it is expressed in plant cell When, the transgenic soybean event DBN9001 obtains the tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide.The DNA Construct includes two concatenated expression cassettes, and first expression cassette is comprising the suitable promoter for expressing in plant and fits The polyadenylation signal sequence of conjunction, the promoter, which is operably connected, encodes 5- enol pyruvylshikimate -3- phosphoric acid The gene of synthase (EPSPS), the EPSPS have tolerance to glyphosate herbicidal.Second expression cassette includes for planting The suitable promoter expressed in object and suitable polyadenylation signal sequence, the promoter are operably connected coding The nucleic acid sequence of the gene of phosphinothricin N-acetyl transferase (PAT), the PAT albumen has tolerance to glufosinate-ammonium herbicide Property.Further, the promoter can be the suitable promoter separated from plant, including composing type, induction type and/or tissue Specificity promoter, the suitable promoter include but is not limited to cauliflower mosaic virus (CaMV) 35S promoter, radix scrophulariae flower Mosaic virus (FMV) 35S promoter, Tsf1 promoter, ubiquitin protein (Ubiquitin) promoter, actin (Actin) starting Son, soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum (Cestrum) yellow leaf curl virus promoter, patatin (Patatin) open Mover, ribulose-1,5-bisphosphate, 5- diphosphonic acid carboxylase/oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) starting Son, E9 promoter, GOS promoter, alcA/alcR promoter, Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promoter and Arabidopsis (Arabidopsis) Suc2 promoter.The polyadenylation signal sequence can for The suitable polyadenylation signal sequence to work in plant, the suitable polyadenylation signal sequence include but unlimited In from the polyadenosine of soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Polyadenylation signal sequence derives from cauliflower mosaic virus (CaMV) 35S terminator, derives from pea ribulose -1,5- diphosphonic acid Carboxylase/oxygenase E9 terminator, from protease-inhibitor Ⅱ (PIN II) gene polyadenylation signal sequence and From the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.
In addition, the expression cassette can also include other genetic elements, the genetic elements include but is not limited to enhance Son and signal peptide/transit peptides.The expression of gene can be enhanced in the enhancer, and the enhancer includes but is not limited to cigarette Careless etch virus (TEV) translation activity factor, CaMV35S enhancer and FMV35S enhancer.Signal peptide/the transit peptides can be with Guide EPSPS albumen and/or PAT Protein transport to extracellular or intracellular specific organelle or compartment, for example, using compiling Code chloroplast transit peptide sequence targets chloroplaset, or utilizes ' KDEL ' to retain sequence and target endoplasmic reticulum.
5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) gene can be from soil Agrobacterium It is isolated in (Agrobacterium tumefaciens sp.) CP4 bacterial strain, and can by optimization codon or with Other modes change the polynucleotides of coding EPSPS, to reach the stability and utilizability that increase transcript in transformed cells Purpose.5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) gene can also be used as selected marker.
" glyphosate " refers to the salt of N- phosphonomethylglycine and it, is handled with " glyphosate herbicidal " and refers to use Any one is handled containing the herbicide formulations of glyphosate.In order to reach ebd and to certain glyphosate system The selection of agent utilization rate is no more than the technical ability of common agronomic technique personnel.Herbicide formulations using any one containing glyphosate Processing contains the field of the vegetable material from herbicide-tolerant soybean plant DBN9001, will control in the field Weed growth, and do not influence from herbicide-tolerant soybean plant DBN9001 vegetable material growth or yield.
The phosphinothricin N-acetyl transferase separated from streptomycete (Streptomyces viridochromogenes) (phosphinothricin N-acetyltransferase, PAT) gene is catalyzed L-phosphinothricin by acetylation and is converted into Its inactive form, to assign plant to the tolerance of glufosinate-ammonium herbicide.Phosphinothricin (PTC, 2- amino -4- Methylphosphine-butyric acid) be glutamine synthelase inhibitor.PTC is antibiotic 2- amino -4- methylphosphine acyl-alanyl-alanine Structural units, this tripeptides (PTT) has resisting gram-positive and gramnegative bacterium and antimycotic Botrytis cinerea The activity of (Botrytis cinerea).Phosphinothricin N-acetyl transferase (PAT) gene can also be used as selected marker Gene.
" glufosinate-ammonium " also known as glufosinate refer to 2- amino -4- [hydroxyl (methyl) phosphono] butyric acid ammonium, with " careless ammonium Phosphine herbicide " processing, which refers to, to be handled using any one containing the herbicide formulations of glufosinate-ammonium.In order to reach effective biology Learn dosage and to certain glufosinate-ammonium preparation utilization rate selection be no more than common agronomic technique personnel technical ability.Use any one Herbicide formulations processing containing glufosinate-ammonium contains the vegetable material from herbicide-tolerant soybean plant DBN9001 Field will control the weed growth in the field, and not influence from herbicide-tolerant soybean plant DBN9001's The growth or yield of vegetable material.
The DNA construct is introduced in plant using method for transformation, and the method for transformation includes but is not limited to agriculture bar Bacterium (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.
The Agrobacterium_mediated method is the common method of Plant Transformation.The exogenous DNA gram that will be introduced into plant Between the grand left and right boundary consensus sequence to carrier, i.e. the area T-DNA.The carrier is transformed into agrobatcerium cell, then, The agrobatcerium cell is organized for infection plant, and the area T-DNA of the carrier comprising exogenous DNA is inserted into plant gene In group.
The Gene Knock-out Mice is with carrier bombardment plant cell (the biological bullet that particle mediates comprising exogenous DNA Hit conversion).
The pollen tube channel conversion method is that natural pollen tube channel (also known as pollen is formed by after pollinating using plant Pipe guides tissue), through megarchidium channel, exogenous DNA is carried into blastular.
After conversion, it is necessary to have from the plant tissue regenerating plants of conversion, and using suitable label selection The offspring of exogenous DNA.
DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassettes.DNA Construct preferably can the self-replacation in bacterial cell, and contain different restriction endonuclease sites plasmid, Contained restriction endonuclease sites provide functioning gene element, i.e. promoter, introne, leader sequence, volume for importing The DNA molecular of code sequence, 3 ' terminator regions and other sequences.Expression cassette contained in DNA construct includes providing courier Genetic elements necessary to the transcription of RNA, the expression cassette can be designed as expressing in prokaryotic cell or eukaryocyte.This hair Bright expression cassette is designed to most preferably express in plant cell.
Transgenosis " event " is to include one as obtained from converting plant cell with heterologous DNA construct and contain The expression of nucleic acid box of target gene is inserted into the plant population in Plant Genome with generation by transgene method, regeneration The plant population, and selection have the specific plant of insertion specific gene group site feature.Term " event " includes allogeneic dna sequence DNA Original transformant and the transformant offspring.Term " event " further includes transformant and other kinds containing allogeneic dna sequence DNA Offspring obtained from sexual hybridization is carried out between body, even if after be returned repeatedly with backcross parent, from transformant parent This insertion DNA and flanking genomic dna exists in the same chromosome location in filial generation.Term " event ", which also refers to, to be come From the DNA sequence dna of original transformant, the DNA sequence dna include insertion DNA and with the close adjacent flanking genomes sequence of insertion DNA Column, which, which is expected, is transferred in filial generation, the filial generation by containing insertion DNA parental department (such as original transformant and its It is selfed the filial generation generated) sexual hybridization is carried out with the parental department without containing insertion DNA and is generated, and the filial generation is received comprising mesh Mark the insertion DNA of gene.
" recombination " refers to the DNA that generally can not be found and therefore generate by manual intervention in nature in the present invention And/or the form of albumen and/or organism.This manual intervention can produce recombinant DNA molecules and/or recombinant plant." the weight It is that isolated sequence section obtains, such as passes through chemistry in other cases that group DNA molecular ", which is by two kinds of artificial combination, Synthesis operates isolated nucleic acid segment by genetic engineering technology.The technology for carrying out nucleic-acid manipulation is well-known.
Term " transgenosis " includes any cell, cell line, callus, tissue, plant part or plant, above base Because type due to heterologous nucleic acids there are due to change, " transgenosis " includes Transgenics initially changed in this way and by most The offspring individual that first Transgenics are generated by sexual hybridization or vegetative propagation.In the present invention, term " transgenosis " does not wrap (chromosome the or extrachromosomal) change by conventional plant breeding method or the natural genome that event occurs is included, it is described It is natural that for example random allogamy of event, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base or spontaneous prominent occurs Become.
" heterologous " refers to that the first molecule is not found usually and the second molecular combinations in nature in the present invention.For example, Molecule can be originated from the first species and be inserted into the genome of the second species.Therefore this molecule for host be it is heterologous and It is artificially introduced in the genome of host cell.
The transgenic soybean event DBN9001 that there is tolerance to glyphosate herbicidal and glufosinate-ammonium herbicide is cultivated, is led to It crosses following steps: making the first parent soybean plant and the second parent soybean plant sexual hybridization first, to produce multiplicity First generation progeny plant, first parent soybean plant are big by cultivation transgenic soybean event DBN9001 and its offspring's Beans plant composition, transgenic soybean event DBN9001 and its offspring be by using it is of the invention to glyphosate herbicidal and Obtained from there is glufosinate-ammonium herbicide the expression cassette of tolerance to be converted, the second parent soybean plant shortage removes glyphosate The tolerance of careless agent and/or glufosinate-ammonium herbicide；Then the application to glyphosate herbicidal and/or glufosinate-ammonium herbicide is selected to have There is the progeny plant of tolerance, can cultivate there is the soybean of tolerance to plant glyphosate herbicidal and glufosinate-ammonium herbicide Object.These steps, which may further include, makes the application to glyphosate herbicidal and/or glufosinate-ammonium herbicide have tolerance Progeny plant is returned with the second parent soybean plant or third parent soybean plant, then passes through application Gyphosate herbicice Agent, glufosinate-ammonium herbicide or by molecular marked compound relevant to character (such as comprising being inserted into transgenic soybean event DBN9001 The DNA molecular of bond site that the 5 ' ends and 3 ' ends of sequence identify) identification select filial generation, glyphosate is removed to generate Careless agent and glufosinate-ammonium herbicide have the bean plant of tolerance.
It will also be appreciated that two different genetically modified plants can also hybridize to generate containing there are two independent, separation The offspring of the foreign gene of formula addition.It is all homozygous for the available foreign gene added to two of the selfing of appropriate offspring The Progeny plants of son.It is also as previously described to be expected to the backcrossing of parental plant and with the cutcross of non-transgenic plant , vegetative propagation is also same.
The soybean of trans Bt gene can kill insect/pest of such as Lepidoptera, but there is also the insect survived on a small quantity/ Pest, after several generations is bred, it is possible to create resistant insects/pest of anti-Bt albumen.Resistance is generated in order to solve insect/pest This problem, Environmental Protection Agency USA give following guidance for the use of genetically modified crops, need to provide a certain proportion of shelter (can be non-pest-resistant genetically engineered soybean, (such as herbicide tolerant genetically engineered soybean or anti-Non-target pests turn base to shield institute soybean Because of soybean or Non-transgenic soybean).After insect/pest of the overwhelming majority is killed on corresponding transgenic pest-resistant soybean, Some insect/pest is on sanctuary soybean without extremely, ensure that insect/pest population of not resistance accounts for governance number Amount.Accordingly even when having the resistant insects/pest to survive on a small quantity, with the non-resistance insect/pest post-coitum resistance for accounting for governance quantity Gene is also significantly diluted.
Term " probe " is the nucleic acid molecules of one section of separation, is combined with conventional detectable label or report point above Son, for example, radioactive isotope, ligand, chemiluminescent agent or enzyme.This probe is complementary with a chain of target nucleic acid , in the present invention, probe is complementary with a DNA chain from transgenic soybean event DBN9001 genome, no matter the gene Group DNA be also be derived from from transgenic soybean event DBN9001 or seed transgenic soybean event DBN9001 plant or Seed or extract.Probe of the invention not only includes DNA or ribonucleic acid, further include specifically with target DNA sequence dna combines and can be used for detecting the existing polyamide and other probe materials of the target dna sequence.
Term " primer " is the nucleic acid molecules of one section of separation, is hybridized by nucleic acid, annealed combination to complementary target dna On chain, heterozygote is formed between primer and target dna chain, then under the action of polymerase (such as archaeal dna polymerase), along mesh DNA chain is marked to extend.Primer pair of the invention is related to its application in target nucleic acid sequence amplification, for example, passing through polymerase chain Formula reacts (PCR) or other conventional nucleic acid amplification methods.
The length of probe and primer is usually 11 polynucleotides or more, preferably 18 polynucleotides or more, More preferably 24 polynucleotides or more, most preferably 30 polynucleotides or more.This probe and primer are in height Specifically hybridize under degree stringent hybridization condition with target sequence.Although being different from target dna sequence and being protected to target dna sequence The probe for holding hybridization ability can design by conventional method, however, it is preferred to, probe and primer in the present invention There is complete DNA sequence dna identity with the continuous nucleic acid of target sequence.
It can be determined by conventional method based on the primer and probe of flanking genomic dna and insetion sequence of the invention, For example, by separating corresponding DNA molecular from from the vegetable material of transgenic soybean event DBN9001, and determining should The nucleic acid sequence of DNA molecular.The DNA molecular includes transgene insert sequence and soybean genome flanking sequence, and the DNA divides The segment of son may be used as primer or probe.
Nucleic acid probe and primer of the invention hybridizes with target dna sequence under strict conditions.Any conventional nucleic acid is miscellaneous It hands over or amplification method may be used to identify in sample from the presence of the DNA of transgenic soybean event DBN9001.Nucleic acid point Son or its segment can carry out specific hybrid with other nucleic acid molecules in any case.As the present invention uses, if two A nucleic acid molecules can form antiparallel double-strandednucleic acid structure, so that it may say that the two nucleic acid molecules are able to carry out specifically to each other Property hybridization.If two nucleic acid molecules show complete complementarity, claiming one of nucleic acid molecules is another nucleic acid point " complement " of son.As the present invention uses, when each nucleotide and another nucleic acid molecules of a nucleic acid molecules The corresponding nucleotide mutual added time, then the two nucleic acid molecules is claimed to show " complete complementarity ".If two nucleic acid molecules can be with Enough stability phase mutual crosses then claim to make them anneal and be bonded to each other under the conditions of at least conventional " low stringent " The two nucleic acid molecules are " minimum level is complementary ".Similarly, if two nucleic acid molecules can be mutual with enough stability Hybridization then claims the two nucleic acid molecules to have to make them anneal and be bonded to each other under the conditions of conventional " height is stringent " " complementarity ".Deviateing from complete complementarity can permit, as long as not exclusively to prevent two molecules from being formed double for this deviation Chain structure.In order to enable a nucleic acid molecules as primer or probe, it is only necessary to it is adequately complementary to guarantee that it has in sequence Property, so that stable duplex structure can be formed under used specific solvent and salinity.
As the present invention uses, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules are in high stringency Specific hybrid can occur with the complementary strand of another section of nucleic acid molecules to match down.Promote the suitable stringent of DNA hybridization Condition is then used under the conditions of 50 DEG C for example, about being handled under the conditions of 45 DEG C with 6.0 × sodium chloride/sodium citrate (SSC) 2.0 × SSC washing, these conditions are well known to those skilled in the art.For example, the salinity in washing step can be selected About 2.0 × SSC, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C from Low stringency conditions.In addition, washing step In temperature condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of room temperature of Low stringency conditions.Temperature strip Part and salinity can all change, can also one of them remain unchanged and another variable changes.Preferably, originally Invention a nucleic acid molecules can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, in SEQ ID NO:6 and SEQ ID NO:7 Specific hybrid occurs for any segment of one or more nucleic acid molecules or its complementary series or above-mentioned sequence.It is highly preferred that A nucleic acid molecules of the invention under high stringency with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, one or more nucleic acid molecules or its complementary series in SEQ ID NO:6 and SEQ ID NO:7, Or specific hybrid occurs for any segment of above-mentioned sequence.In the present invention, preferred marker nucleic acid molecules have SEQ ID Any segment of NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned sequence. Another preferred marker nucleic acid molecules of the present invention and SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID Any segment of NO:7 or its complementary series or above-mentioned sequence is same with 80% to 100% or 90% to 100% sequence Property.SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 may be used as the mark in plant breeding method Object is remembered to identify the offspring of genetic cross.Probe can be art technology by any one with hybridizing for target dna molecule Method known to personnel detects, these methods include but is not limited to fluorescent marker, radioactive label, antibody class label And chemiluminescent labeling.
About the amplification (for example, passing through PCR) for using specific amplimer to carry out target nucleic acid sequence, " stringent item Part " refers to the condition for only allowing primer pair target nucleic acid sequence to hybridize in the hot amplified reaction of DNA, has and target core The primer of the corresponding wild-type sequence of acid sequence (or its complementary series), can be and excellent in conjunction with the target nucleic acid sequence Choosing generates unique amplified production, amplified production, that is, amplicon.
Term " specific binding (target sequence) " refers to probe under stringent hybridization conditions or primer only and comprising target Target sequence in the sample of sequence hybridizes.
As the present invention uses, " by the DNA of amplification " or " amplicon " refer to the target as nucleic acid-templated a part The nucleic acid amplification product of nucleic acid sequence.For example, in order to determine bean plant whether by containing transgenic soybean event of the present invention DBN9001 is generated by sexual hybridization mode, or whether the soybean sample acquired from field includes transgenic soybean event Whether DBN9001 or extract of soybean, such as coarse powder, powder or oil include transgenic soybean event DBN9001, from bean plant The DNA that tissue sample or extract extract can be by using the nucleic acid amplification method of primer pair to generate for genetically engineered soybean The presence of the DNA of event DBN9001 is diagnostic amplicon.The primer pair include one in the Plant Genome with The first primer of the adjacent flanking sequence of the exogenous DNA insertion point of insertion, and second draw from the exogenous DNA of insertion Object.Amplicon has certain length and sequence, and the sequence is also diagnostic to the transgenic soybean event DBN9001. The length range of amplicon can be the combination length of primer pair plus a nucleotide base pair, preferably add about 50 cores Thuja acid base-pair more preferably adds about 250 nucleotide bases pair, most preferably adds about 450 nucleosides soda acids Base to or more.
Optionally, primer pair can include entire insertion to generate from the flanking genomic sequence of the insertion two sides DNA The amplicon of nucleotide sequence.One in the primer pair of plant genome sequences can be located at away from insertion DNA sequence dna At a certain distance from, which may range from a nucleotide base to about 20,000 nucleotide bases pair.Term " amplification The use of son " has been particularly intended to exclude the primer dimer formed in the hot amplified reaction of DNA.
Nucleic acid amplification reaction can be realized by any nucleic acid amplification reaction method known in the art, including polymerization Enzyme chain reaction (PCR).Various nucleic acid amplification methods have been well-known to those skilled in the art.PCR amplification method has been sent out Open up the phage DNA of the amplifiable up to genomic DNA of 22kb and up to 42kb.Other of these methods and this field DNA cloning method can be used for the present invention.The exogenous DNA array of insertion and flank from transgenic soybean event DBN9001 DNA sequence dna can be expanded by being expanded using genome of the provided primer sequence to transgenic soybean event DBN9001 The DNA sequencing of standard is carried out after increasing to the DNA of PCR amplification or clone.
DNA detection kit based on DNA cloning method contains DNA primer molecule, they are under reaction condition appropriate On specific hybrid to target dna and expand diagnostic amplicon.Kit can provide the detection method based on Ago-Gel Or many methods of checkout and diagnosis amplicon known in the art.Containing with SEQ ID NO:3 or SEQ ID NO:4's Any part in soybean genome area is homologous or complementary and any part with the transgenosis insert district of SEQ ID NO:5 The kit of homologous or complementary DNA primer is provided by the present invention.Particularly identify useful in DNA cloning method draw Object expands 5 ' transgenosis/genome with transgenic soybean event DBN9001 to being SEQ ID NO:8 and SEQ ID NO:9 A part of homologous diagnostic amplicon in area, wherein amplicon includes SEQ ID NO:1.Other DNA as DNA primer points Son can be selected from SEQ ID NO:5.
Amplicon caused by these methods can be detected by multiple technologies.One of method is hereditary position point It analyses (Genetic Bit Analysis), this method devises one across insertion DNA sequence dna and adjacent flanking genomic dna The DNA oligonucleotide chain of sequence.The oligonucleotide chain is fixed in the micropore of a microwell plate, is carried out to target area (primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) after PCR amplification, single stranded PCR products can be with Fixed oligonucleotide chain is hybridized, and the template as single base extension, which has used DNA polymerization Enzyme and ddNTPs for next expected base specific markers.Result can be obtained by fluorescence or ELISA class method.Signal The presence of insertion/flanking sequence is represented, illustrates that amplification, hybridization and single base extension are successful.
Another method is pyrosequencing (Pyrosequencing) technology.This method devises one across insertion The oligonucleotide chain of DNA sequence dna and adjacent genomic DNA binding site.By the single-stranded of the oligonucleotide chain and target area Then and DNA PCR product (primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) is hybridized, Polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine -5 '-phosphorus sulfate and luciferin are together It is incubated.It is separately added into dNTPs, measures the optical signal of generation.Optical signal represents the presence of insertion/flanking sequence, says Bright amplification, hybridization and single base or polybase base extension are successful.
The Fluorescence polarization of Chen etc. (genome research (Genome Res.) 9:492-498,1999) description is also can In a kind of method for detecting amplicon of the present invention.Need to design one in this way across insertion DNA sequence dna and phase The oligonucleotide chain of adjacent genomic DNA binding site.The single stranded PCR products of the oligonucleotide chain and target area (are being inserted Enter in sequence and respectively use in adjacent flanking genomic sequence a primer) hybridized, then with archaeal dna polymerase and one The ddNTP of kind fluorescent marker is incubated together.Single base extension will lead to insertion ddNTP.This insertion can use fluorescence Instrument measures the change of its polarization.The change of polarization represents the presence of insertion/flanking sequence, illustrates amplification, hybridization and single alkali Base extension is successful.
Taqman is described as a kind of detect and is mentioned with method existing for quantitative analysis DNA sequence dna, this method in manufacturer It is discussed in detail in the operation instruction of confession.It is now briefly illustrated below, designs one across insertion DNA sequence dna and adjacent base Because of the FRET oligonucleotide probe of group flank binding site.The FRET probe and PCR primer are (in insetion sequence and adjacent side A primer is respectively used in wing genome sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.FRET probe Hybridization lead to the division of fluorescence part and quencher moieties and the release of fluorescence part on FRET probe.The generation of fluorescence signal The presence of insertion/flanking sequence is represented, illustrates amplification and hybridization is successful.
Based on Hybridization principle, for detecting the plant material for deriving from herbicide tolerant transgenic soybean event DBN9001 The suitable technology of material can also include Southern blot hybridization, Northern blot hybridization and in situ hybridization.Particularly, described The technology of being suitble to includes incubating probe and sample, is washed to remove whether unbonded probe and detection probe have hybridized.It is described Detection method depend on the appended type marked of probe, for example, can detecte radioactive label by X-ray exposure and imaging Probe, or by substrate convert realize color change can detecte enzyme label probe.
Tyangi etc. (Nature Biotechnol (Nat.Biotech.) 14:303-308,1996) describes molecular labeling in sequence Application in column detection.It is briefly described as follows, designs one across insertion DNA sequence dna and adjacent flanking genomic binding site FRET oligonucleotide probe.The unique texture of the FRET probe causes it to contain secondary structure, which can be close Apart from interior holding fluorescence part and quencher moieties.The FRET probe and PCR primer are (in insetion sequence and adjacent flanking gene A primer is respectively used in group sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.By successful PCR Amplification, the hybridization of FRET probe and target sequence leads to the forfeiture of probe secondary structure, to make fluorescence part and quencher moieties It spatially separates, generates fluorescence signal.The generation of fluorescence signal represents the presence of insertion/flanking sequence, explanation Amplification and hybridization are successful.
The method of other descriptions, such as the method that microfluid (microfluidics) provides separation and DNA amplification sample And equipment.Photoinitiator dye is for detecting and measuring specific DNA molecular.Include the electronic sensor or knot for detecting DNA molecular Close specific DNA molecular receive pearl and thus can be detected receive test tube (nanotube) equipment for detecting DNA of the invention points Son is useful.
Method that composition and DNA detection field of the present invention describes or known can be used to develop DNA inspection Test agent box.The kit is conducive to identify the DNA that whether there is transgenic soybean event DBN9001 in sample, can be with For cultivating the bean plant of the DNA containing transgenic soybean event DBN9001.The kit can containing DNA primer or Probe at least part for being derived from or being complementary to SEQ ID NO:1,2,3,4 or 5, or contains other DNA primers or spy Needle, with being derived from or being complementary to DNA contained in the genetically modified element of DNA, these DNA sequence dnas can be used for DNA cloning Reaction, or as the probe in DNA hybridization method.It is containing in soybean genome and what is illustrated in Fig. 1 and table 1 turns base Because the DNA structure of insetion sequence and soybean genome binding site includes: the soybean for being located at 5 ' end of transgene insert sequence is planted Object DBN9001 flanking genomes region, first expression cassette is by soybean Tsf1 gene (code extension factor EF-1 α) promoter (prGm17gTsf1), it is operably connected on the coded sequence (spAtCTP2) of arabidopsis EPSPS chloroplast transit peptides, can grasp It is connected to the 5- enol-pyrovyl shikimic acid -3- phosphate synthase of the glyphosate tolerant of Agrobacterium CP4 bacterial strain (cEPSPS) it on, is operably connected on the 3 ' non-translated sequences (tPse9) from pea ribulose -1,5- diphosphonic acid carboxylase And form, second expression cassette by the tandem sequence repeats containing enhancer region cauliflower mosaic virus 35 S promoter (pr35S), it is operably connected on the phosphinothricin N-acetyl transferase (cPAT) of the glufosinate tolerant of streptomycete, and It is operably connected on cauliflower mosaic virus 35S terminator (t35S) and forms, the left boundary area from Agrobacterium (LB) a part of insetion sequence, and it is located at the bean plant DBN9001 flanking genomes of 3 ' end of transgene insert sequence Region (SEQ ID NO:5).In DNA cloning method, the DNA molecular as primer be can be from bean plant Any part of DBN9001 transgenic insetion sequence is also possible to big from flank in transgenic soybean event DBN9001 Any part in the region of DNA domain of beans genome.
Transgenic soybean event DBN9001 can be with other genetically engineered soybean breed combinations, such as herbicide tolerant is (such as 2,4-D, dicamba etc.) soybean, or carry the genetically engineered soybean kind of other anti insect genes (such as Cry1Ac, Cry2Ab). The various combinations of all these difference transgenic events, the breeding together with transgenic soybean event DBN9001 of the invention can be with The improvement hybrid transgenic soybean varieties for resisting a variety of insect pests and being resistant to a variety of herbicides are provided.These kinds are compared to non-transgenic The transformed variety of kind and unisexuality shape can show the superior features such as yield promotion.
The present invention provides a kind of for detecting the nucleic acid sequence and its detection of herbicide-tolerant soybean plant DBN9001 Method, transgenic soybean event DBN9001 are resistant to the phytotoxic effects of the agriculture herbicide containing glyphosate and/or glufosinate-ammonium. 5- enol pyruvylshikimate-the 3- of the glyphosate resistance of the soybean plant strain expression Agrobacterium strains CP4 of the dual character Phosphate synthase (EPSPS) albumen assigns plant to the tolerance of glyphosate, and expresses the phosphine silk of the glufosinate resistance of streptomycete Rhzomorph N- acetyltransferase (PAT) albumen assigns plant to the tolerance of glufosinate-ammonium.Dual character soybean has following excellent Point: 1) apply agriculture herbicide containing glyphosate and be used for the ability that broad-spectrum weeding controls to soybean crops；2) glufosinate tolerant Glufosinate-ammonium herbicide (mix or be used alternatingly with glyphosate herbicidal), which is applied in combination, in character can be used as a kind of effectively management grass The non-selective means of sweet phosphine resistant weed；3) herbicide tolerant genetically engineered soybean is as non-pest-resistant genetically engineered soybean, and turns Gene pest-resistant soybean is planted together with certain proportion, and insect/pest can be delayed to generate resistance；4) soybean yields does not reduce. In addition, coding glyphosate tolerant and glufosinate tolerant character gene linkage in same DNA section, and be present in turn On the term single gene seat of transgenic soybean event DBN9001 genome, this point provides the breeding efficiency of enhancing and makes it possible to The transgenic insert in reproductive population and its filial generation is tracked with molecular labeling.SEQ ID in detection method simultaneously NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series can be used as DNA primer or probe to generate and be diagnosed as transgenic soybean event DBN9001 or thereafter The amplified production in generation, and the plant material identified from transgenic soybean event DBN9001 that can be quick, accurate, stable The presence of material.
BRIEF DESCRIPTION OF THE SEQUENCES
It is located at insertion junction in 5 ' ends of insetion sequence in SEQ ID NO:1 transgenic soybean event DBN9001 A neighbouring length is the sequence of 22 nucleotide, wherein 1-11 nucleotide and 12-22 nucleotide are located at The two sides of insertion point in soybean genome；
It is located at insertion junction in 3 ' ends of insetion sequence in SEQ ID NO:2 transgenic soybean event DBN9001 A neighbouring length is the sequence of 22 nucleotide, wherein 1-11 nucleotide and 12-22 nucleotide are located at The two sides of insertion point in soybean genome；
It is located at insertion junction in 5 ' ends of insetion sequence in SEQ ID NO:3 transgenic soybean event DBN9001 A neighbouring length is the sequence of 780 nucleotide；
It is located at insertion junction in 3 ' ends of insetion sequence in SEQ ID NO:4 transgenic soybean event DBN9001 A neighbouring length is the sequence of 877 nucleotide；
The flank soybean genomic sequence of the entire T-DNA sequence of SEQ ID NO:5,5 ' and 3 '；
SEQ ID NO:6 is located at the sequence inside SEQ ID NO:3, spans pDBN4003 construct and genome Engage the nucleotide sequence of region sequence and prGm17gTsf1 promoter；
SEQ ID NO:7 is located at the sequence inside SEQ ID NO:4, spans phosphinothricin N-acetyl transferase Nucleotide sequence in cPAT, t35S transcription terminator sequences and pDBN4003 construct DNA sequence dna；
The first primer of SEQ ID NO:8 amplification SEQ ID NO:3；
The second primer of SEQ ID NO:9 amplification SEQ ID NO:3；
The first primer of SEQ ID NO:10 amplification SEQ ID NO:4；
The second primer of SEQ ID NO:11 amplification SEQ ID NO:4；
Primer on 5 ' flanking genomic sequence of SEQ ID NO:12；
The primer of SEQ ID NO:13 and SEQ ID NO:12 pairing being located on T-DNA；
Primer on 3 ' flanking genomic sequence of SEQ ID NO:14 can detecte with SEQ ID NO:12 pairing and turn Gene is homozygote or heterozygote；
The primer of SEQ ID NO:15 and SEQ ID NO:14 pairing being located on T-DNA；
The primer 1 of SEQ ID NO:16 Taqman detection EPSPS；
The primer 2 of SEQ ID NO:17 Taqman detection EPSPS；
The probe 1 of SEQ ID NO:18 Taqman detection EPSPS；
The primer 3 of SEQ ID NO:19 Taqman detection PAT；
The primer 4 of SEQ ID NO:20 Taqman detection PAT；
The probe 2 of SEQ ID NO:21 Taqman detection PAT；
The first primer of SEQ ID NO:22 soybean endogenous gene ubiquitin protein (Ubiquitin)；
Second primer of SEQ ID NO:23 soybean endogenous gene ubiquitin protein (Ubiquitin)；
The probe of EPSPS in the detection of SEQ ID NO:24 Southern blot hybridization；
The probe of PAT in the detection of SEQ ID NO:25 Southern blot hybridization；
SEQ ID NO:26 is located at the primer on T-DNA, consistent with the direction ID NO:13 SEQ；
SEQ ID NO:27 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains flank sequence Column；
SEQ ID NO:28 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains flank sequence Column；
SEQ ID NO:29 is located at the primer on T-DNA, consistent with the direction ID NO:15 SEQ；
SEQ ID NO:30 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains flank sequence Column；
SEQ ID NO:31 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains flank sequence Column.
Below by drawings and examples, technical scheme of the present invention will be described in further detail.
Detailed description of the invention
Fig. 1 is the present invention for detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 Transgene insert sequence and soybean genome junction structural schematic diagram；
Fig. 2 is the present invention for detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 Recombinant expression carrier pDBN4003 structural schematic diagram.
Specific embodiment
Further illustrate the present invention for detecting herbicide-tolerant soybean plant DBN9001 below by specific embodiment Nucleic acid sequence and its detection method technical solution.
First embodiment, clone and conversion
1.1, carrier cloning
Recombinant expression carrier pDBN4003 (as shown in Figure 2) is constructed using the gene clone technology of standard.The carrier PDBN4003 includes two concatenated transgene expression cassettes, and first expression cassette is by soybean Tsf1 gene (code extension factor EF- 1 α) promoter (prGm17gTsf1), it is operably connected to the coded sequence of arabidopsis EPSPS chloroplast transit peptides (spAtCTP2) on, it is operably connected to the 5- enol-pyrovyl thick grass of the glyphosate tolerant of Agrobacterium CP4 bacterial strain On acid -3- phosphate synthase (cEPSPS), it is operably connected to the 3 ' untranslateds from pea ribulose -1,5- diphosphonic acid carboxylase It is formed in sequence (tPse9)；Second expression cassette by the tandem sequence repeats containing enhancer region cauliflower mosaic virus 35S Promoter (pr35S) is operably connected to the phosphinothricin N-acetyl transferase of the glufosinate tolerant of streptomycete (cPAT) it on, and is operably connected on cauliflower mosaic virus 35S terminator (t35S) and forms.
The carrier pDBN4003 is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA with liquid nitrogen method； Cat.No:18313-015 in), and with 5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) for selected marker pair Transformed cells are screened.
1.2, Plant Transformation
It is converted using conventional Agrobacterium infestation method, by the soybean cotyledon node tissue and the present embodiment of sterile culture Agrobacterium described in 1.1 co-cultures, and the T-DNA in the recombinant expression carrier pDBN4003 of building is transferred to soybean dyeing In body group, to generate transgenic soybean event DBN9001.
For the transformation of soybean of mediated by agriculture bacillus, briefly, by mature soya seeds in soybean germination culture medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6) in sprouted, seed is inoculated on germination medium, By the following conditions culture: 25 ± 1 DEG C of temperature；Photoperiod (light dark) is 16/8h.It is taken after sprouting 4-6 days swollen at bud green cotyledonary node Big soybean aseptic seedling, cuts hypocotyl under cotyledonary node at 3-4 millimeter, longitudinally slit cotyledon removes terminal bud, lateral bud and seed Root.Wound is carried out at cotyledonary node with the knife spine of scalpel, the cotyledonary node tissue crossed with agrobacterium suspension contact wound, wherein The nucleotide sequence of the nucleotide sequence of EPSPS gene and pat gene can be transferred to the cotyledonary node group that wound is crossed by Agrobacterium It knits (step 1: infecting step).In this step, cotyledonary node tissue preferably immerses agrobacterium suspension (OD660=0.5-0.8, Infect culture medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2- Morpholino b acid (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) in starting infect.Cotyledonary node tissue is trained altogether with Agrobacterium Support one period (3 days) (step 2: co-culturing step).Preferably, cotyledonary node group is woven in infect step after in solid medium (MS salt 4.3g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, 2-morpholine ethane sulfonic acid (MES) 4g/L, zeatin 2mg/L, Agar 8g/L, pH5.6) on cultivate.After the stage of co-cultivation herein, there is " recovery " step of a selectivity.In " recovery " step In, recovery media (B5 salt 3.1g/L, B5 vitamin, 2-morpholine ethane sulfonic acid (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 2mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) at least exist A kind of oneself knows the antibiotic (cephalosporin 150-250mg/L) for inhibiting Agrobacterium growth, does not add the selective agent of vegetable transformant (step 3: recovering step).Preferably, the tissue block of cotyledon node regeneration is having antibiotic but the not solid medium of selective agent Upper culture, to eliminate Agrobacterium and provide convalescence for infected cell.Then, the tissue block of cotyledon node regeneration is containing selective agent It is cultivated on the culture medium of (glyphosate) and selects the transformed calli (step 4: selection step) grown.Preferably, cotyledon Regenerated tissue block is saved in screening solid medium (B5 salt 3.1g/L, B5 vitamin, 2-morpholine ethane sulfonic acid for having selective agent (MES) 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glyphosate isopropyl amine salt 10mg/L, pH5.6) on cultivate, cause the cell of conversion can be with Continued growth.Then, the cytothesis of conversion is at plant (step 5: regeneration step), it is preferable that in the culture medium containing selective agent The tissue block of the cotyledon node regeneration of upper growth is cultivated on solid medium (B5 differential medium and B5 root media) with again Plant.
It screens obtained resistant tissues block and is transferred to the B5 differential medium (B5 salt 3.1g/L, B5 vitamin, 2- morpholine Ethanesulfonic acid (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellin 1mg/L, auxin 1mg/L, glyphosate isopropyl amine salt 10mg/L, pH5.6) on, Differentiation is cultivated at 25 DEG C.It differentiates the seedling come and is transferred to the B5 root media (B5 salt 3.1g/L, B5 vitamin, 2- Quinoline ethanesulfonic acid (MES) 1g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, indole -3-butyric acid (IBA) 1mg/L), In culture of rootage, culture moves to hot-house culture to solid to about 10cm high at 25 DEG C.In the greenhouse, it is trained at 26 DEG C daily It supports 16 hours, is cultivated 8 hours at 20 DEG C.
1.3, the identification and screening of transgenic event
288 separate transgenic T are produced altogether0Plant.
Pass through TaqManTMIt analyzes (referring to second embodiment) and detects regenerated Transgenic soybean plants with the presence or absence of EPSPS And pat gene, and characterize the copy number of tolerance glyphosate and glufosinate-ammonium strain.By screening, the event DBN9001 of having selected is excellent Different, there is single copy transgenosis, good glyphosate herbicide tolerance, glufosinate-ammonium herbicide tolerant and economical character Performance (referring to sixth embodiment).
Second embodiment carries out transgenic soybean event DBN9001 detection with TaqMan
It takes the blade about 100mg of transgenic soybean event DBN9001 as sample, uses plant DNA extraction kit (DNeasy Plant Maxi Kit, Qiagen) extracts its genomic DNA, is examined by Taqman fluorescence probe quantitative PCR method Survey the copy number of EPSPS gene and pat gene.Simultaneously using Wild-type soy plant as control, examined according to the method described above Survey analysis.Experiment sets 3 repetitions, is averaged.
The specific method is as follows:
Step 11, the blade 100mg for taking transgenic soybean event DBN9001, are ground into homogenate with liquid nitrogen in mortar, each Sample takes 3 repetitions；
Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；
Step 13, the genomic DNA concentration that above-mentioned sample is measured with NanoDrop 2000 (Thermo Scientific)；
Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the range of the concentration value is 80- 100ng/μl；
Step 15, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR method, by being copied known to identification The sample of shellfish number is as standard items, and using the sample of Wild-type soy plant as control, 3 repetitions of each sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively:
Following primer and probe is used to detect EPSPS gene order:
Primer 1:TTGGTGCTAACCTTACCGTTGAG is as shown in SEQ ID NO:16 in sequence table；
Primer 2: GCTTACCACGACCTTCAAGACG is as shown in SEQ ID NO:17 in sequence table；
Probe 1:CTGATGCTGACGGTGTGCGTACCATC is as shown in SEQ ID NO:18 in sequence table；
Following primer and probe is used to detect pat gene sequence:
Primer 3:CAGTTGAGATTAGGCCAGCTACAG is as shown in SEQ ID NO:19 in sequence table；
Primer 4:TTCACTGTAGACGTCTCAATGTAATGG is as shown in SEQ ID NO:20 in sequence table；
Probe 2:CAGCTGATATGGCCGCGGTTTGTG is as shown in SEQ ID NO:21 in sequence table；
PCR reaction system are as follows:
50 × the primer/probe mixture includes each 45 μ L of every kind of primer, 50 μ of probe of 100 μM of concentration of 1mM concentration L and 860 μ lL1 × TE buffers, and at 4 DEG C, it is housed in amber test tube.
PCR reaction condition are as follows:
Data are analyzed using SDS2.3 software (Applied Biosystems), obtain the transgenic soybean event singly copied DBN9001。
3rd embodiment, transgenic soybean event DBN9001 detection
3.1, extracting genome DNA
DNA is extracted according to CTAB (cetyl trimethylammonium bromide) method routinely used: taking 2 grams of tender transgenosis big After the blade of beans event DBN9001 is pulverized in liquid nitrogen, it is slow in 65 DEG C of the temperature DNA preheated extraction CTAB that 0.5mL is added Fliud flushing (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetra-acetic acid), extremely with NaOH tune pH 8.0) after, mixing well, 65 DEG C of Yu Wendu are extracted 90 minutes；0.5 times of volume of phenol is added, 0.5 times of volume of chloroform overturns mixed It is even；It is centrifuged 10 minutes under 12000rpm (revolutions per minute) revolving speed；2 times of volume dehydrated alcohols are added in Aspirate supernatant, soft to shake Dynamic centrifuge tube, 4 DEG C of Yu Wendu stand 30 minutes；It is centrifuged again under 12000rpm revolving speed 10 minutes；DNA is collected to tube bottom；Abandon supernatant Liquid, the ethyl alcohol for being 70% with 1mL mass concentration, washing precipitating；It is centrifuged 5 minutes under 12000rpm revolving speed；Vacuum is drained or super Net platform drying；DNA is precipitated and dissolved in suitable TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0), is stored in Under the conditions of -20 DEG C of temperature.
3.2, the analysis of flanking DNA sequence
Concentration mensuration is carried out to the DNA sample of said extracted, is located at the concentration of sample to be tested between 80-100ng/ μ L. With restriction enzyme PsiI, DraI and the TaqI (5 ' end analysis) and AflII, TaqI and PsiI (3 ' end analysis) point selected Other digestion genomic DNA.26.5 μ L genomic DNAs, the above-mentioned restriction enzyme selected of 0.5 μ L are added in each digestion system Enzyme and 3 μ L enzyme cutting buffering liquids, digestion 1 hour.After to digestion, 70 μ L dehydrated alcohols, ice bath are added into digestion system 30 minutes, revolving speed 12000rpm was centrifuged 7 minutes, abandoned supernatant, and 8.5 μ L distilled water (dd H are added in drying later2O)、1μL 10X T4DNA ligase buffer (NEB T4DNA Ligase Reaction Buffer, specific formula may have access to the website NEB or With reference to https: //www.neb.com/products/restriction-endonucleases, https: // ) and 0.5 μ L T www.neb.com/products/b0202-t4-dna-ligase-reaction-buffer4- DNA connection Enzyme is stayed overnight in 4 DEG C of temperature connections.PCR amplification separation 5 ' and 3 ' transgenosis/genomic DNA is carried out with a series of nested primers.Tool Body, separation 5 ' transgenosis/genomic DNA primer combination includes SEQ ID NO:13, SEQ ID NO:26 as the first primer, SEQ ID NO:27, SEQ ID NO:28 are as the second primer, and SEQ ID NO:13 is as sequencing primer.3 ' transgenosis of separation/ The combination of genomic DNA primer includes SEQ ID NO:15, SEQ ID NO:29 as the first primer, SEQ ID NO:30, SEQ ID NO:31 is as the second primer, and for SEQ ID NO:15 as sequencing primer, PCR reaction condition is as shown in table 3.
Electrophoresis is on 2.0% Ago-Gel to separate PCR reactant for amplicon obtained, then using glue recycling examination Agent box (QIAquick Gel Extraction Kit, catalogue #_28704, Qiagen Inc., Valencia, CA) is from agarose Matrix separates target fragment.Then to the sequencing of the PCR product of purifying (for example, ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyze (for example, DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).
5 ' and 3 ' flanking sequences and junction sequences are confirmed using standard pcr.5 ' flanking sequences and junction sequences can make Confirmed with SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:26. SEQ ID NO:11 or SEQ ID NO:14, combination S EQ ID NO:10, SEQ ID can be used in 3 ' flanking sequences and junction sequences NO:15 or SEQ ID NO:29 confirms.PCR reaction system and amplification condition are as shown in table 2 and table 3.Those skilled in the art It will be understood that other primer sequences can also be used for confirmation flanking sequence and junction sequences.
The DNA sequencing of PCR product provides the DNA that can be used for designing other DNA moleculars, other described DNA moleculars are made The identification of the bean plant or seed from transgenic soybean event DBN9001 is used for for primer and probe.
It was found that 1-859, the nucleotide displays in SEQ ID NO:5 are soybean genomic sequence in genetically engineered soybean thing The right margin flank (5 ' flanking sequence) of part DBN9001 insetion sequence, 5564-6644, nucleotide in SEQ ID NO:5 are aobvious Show the left margin flank (3 ' flanking sequence) for being soybean genomic sequence in transgenic soybean event DBN9001 insetion sequence. 5 ' junction sequences are listed in SEQ ID NO:1, and 3 ' junction sequences are listed in SEQ ID NO:2.
3.3, PCR zygosity determination
Junction sequence is relatively short polynucleotide molecule, is new DNA sequence dna, examines when in polynucleotide tests and analyzes It is diagnostic for the DNA of transgenic soybean event DBN9001 when measuring.Connecing in SEQ ID NO:1 and SEQ ID NO:2 Close every side of insertion point and Soybean genomic DNA that sequence is transgenic soybean event DBN9001 transgenic segment 11 polynucleotides.Longer or shorter polynucleotides junction sequence can be selected from SEQ ID NO:3 or SEQ ID NO:4 It selects.Junction sequence (5 ' the join domain SEQ ID join domain SEQ ID of NO:1 and 3 ' NO:2) is used as DNA probe or conduct DNA primer molecule is useful in DNA detection method.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 is also transgenosis New DNA sequence dna in soybean event DBN9001 can also be used as DNA probe or big as DNA primer Molecular Detection transgenosis The presence of beans event DBN9001DNA.The SEQ ID NO:6 (477-780, the nucleotide of SEQ ID NO:3) spans The nucleotide sequence of the bonding land and prGm17gTsf1 promoter of pDBN4003 construct and genome, the SEQ ID NO:7 (147-409, the nucleotide of SEQ ID NO:4) spans phosphinothricin N-acetyl transferase cPAT, t35S tanscription termination Subsequence and pDBN4003 construct DNA sequence dna.
In addition, amplicon is generated by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4, The diagnostic amplicon of transgenic soybean event DBN9001 is generated when the primer is in PCR method.
Specifically, PCR product is generated from 5 ' ends of transgene insert sequence, which is to turn base comprising deriving from Because in the genome of the vegetable material of soybean event DBN9001 flank in the genomic DNA of 5 ' ends of T-DNA insetion sequence A part.This PCR product includes SEQ ID NO:3.In order to carry out PCR amplification, design and flank are in transgene insert sequence 5 ' ends genomic dna sequence hybridization primer 5 (SEQ ID NO:8) and paired be located at transgenosis The primer 6 (SEQ ID NO:9) of prGm17gTsf1 promoter sequence.
PCR product is generated from 3 ' ends of transgene insert sequence, which includes to derive from transgenic soybean event Flank is in a part of the genomic DNA of 3 ' ends of T-DNA insetion sequence in the genome of the vegetable material of DBN9001.This A PCR product includes SEQ ID NO:4.In order to carry out PCR amplification, design and flank are in 3 ' ends of transgene insert sequence The phosphine silk bacterium of primer 8 (the SEQ ID NO:11) and the paired 3 ' ends positioned at insert of genomic dna sequence hybridization The primer 7 (SEQ IDNO:10) of plain N- acetyltransferase cPAT sequence.
The DNA cloning condition illustrated in table 2 and table 3 can be used for above-mentioned PCR zygosity test to generate genetically engineered soybean The diagnostic amplicon of event DBN9001.The detection of amplicon can be by using Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycler etc. are carried out, or are passed through Method known to those skilled in the art and equipment carry out.
Table 2,5 ' transgenic insertions/genome engaging zones identification PCR for transgenic soybean event DBN9001 Step and reaction mixture condition
Table 3, Perkin-Elmer9700 thermal cycler condition
It lightly mixes, if not having hot top on thermal cycler, 1-2 drop mineral can be added above each reaction solution Oil.Using the above loop parameter (table 3) in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or PCR is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run under the mode of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.
The results showed that primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in transgenic soybean event DBN9001 base When because in the PCR reaction of group DNA, the amplified production of 780bp segment is generated, when it is used in unconverted Soybean genomic DNA and non- When in the PCR reaction of DBN9001 Soybean genomic DNA, no segment is amplified；Primer 7 and 8 (SEQ ID NO:10 and 11), When it is used in the PCR reaction of transgenic soybean event DBN9001 genomic DNA, the amplified production of 877bp segment is generated, When in the PCR reaction that it is used in unconverted Soybean genomic DNA and non-DBN9001 Soybean genomic DNA, expanded without segment Increase.
PCR zygosity determination can also be used in identification from transgenic soybean event DBN9001 material be homozygote or It is heterozygote.Primer 9 (SEQ ID NO:12), primer 10 (SEQ ID NO:13) and primer 11 (SEQ ID NO:14) are used for Amplified reaction is to generate the diagnostic amplicon of transgenic soybean event DBN9001.The DNA cloning condition illustrated in table 4 and table 5 It can be used for above-mentioned zygosity test to generate the diagnostic amplicon of transgenic soybean event DBN9001.
Table 4, zygosity determination reaction solution
Table 5, zygosity determination Perkin-Elmer9700 thermal cycler condition
Using the above loop parameter (table 5) Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) Or it is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler PCR.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run under the mode of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.
In the amplified reaction, the biological sample containing template DNA, which contains, diagnoses the sample transgenic soybean event DBN9001 there are the DNA of situation.Or reaction will generate two by the biological sample containing the DNA from soybean genome A different DNA cloning, the DNA from soybean genome in transgenic soybean event DBN9001 relative to existing The corresponding allele of insertion DNA be heterozygosis.The two different amplicons, which will correspond to, derives from Wild-type soy base Because group locus the first amplicon and diagnosis transgenic soybean event DBN9001DNA there are the second amplicons of situation.Only Generate the soy bean DNA sample for corresponding to the single amplicon of the second amplicon for the description of heterozygous genes group, diagnosable determination The presence of sample transgenic soybean event DBN9001, and the sample in transgenic soy bean plant DBN9001 by relative to depositing The corresponding allele of insertion DNA be produced by homozygous soya seeds.
It should be noted that the primer pair of transgenic soybean event DBN9001 is used to transgenic soybean event DBN9001 genomic DNA is diagnostic amplicon.These primer pairs include but is not limited to (the SEQ ID NO:8 of primer 5 and 6 With 9) and primer 7 and 8 (SEQ ID NO:10 and 11), in the DNA cloning method.In addition, for expanding in soybean One control primer 12 and 13 (SEQ ID NO:22 and 23) of source gene is included, as in one of reaction condition Standard.DNA extracting sample analysis to transgenic soybean event DBN9001 should include a transgenic soybean event The assaypositive tissue DNA extract of DBN9001 compares, and a negative DNA from Non-transgenic soybean event DBN9001 is extracted Object control and a negative control without containing template soy bean DNA extract.Other than these primer pairs, it can also use and From any primer pair of SEQ ID NO:3 or SEQ ID NO:4 or its complementary series, when they are used for DNA amplification reaction Generate respectively for the tissue from transgenic event bean plant DBN9001 be it is diagnostic comprising SEQ ID NO:1 or The amplicon of SEQ ID NO:2.The DNA cloning condition illustrated in table 2- table 5 is used for suitable primer pair to generate The diagnostic amplicon of transgenic soybean event DBN9001.It generates when being tested in DNA cloning method to genetically engineered soybean thing Part DBN9001 be diagnostic amplicon, presumption contain bean plant or seed comprising transgenic soybean event DBN9001 The extract of DNA, or from the product of transgenic soybean event DBN9001, be used as the template of amplification, be to determine It is no that there are transgenic soybean event DBN9001.
Fourth embodiment carries out transgenic soybean event DBN9001 detection by Southern blot hybridization
4.1, it is extracted for the DNA of Southern blot hybridization
Southern engram analysis is carried out using T4, T5 and T6 generation homozygous transformation event.Using mortar and pestle, in liquid Plant tissue is ground in nitrogen.20mLCTAB lysis buffer (100mM Tris pH8.0,20mM EDTA pH8.0, 1.4M NaCl, 0.2%v/v β-dredges base ethyl alcohol, 2%w/v Polyvinyl-pyrrolidone) in the ground plant group of resuspension 4-5g It knits, and is incubated 60 minutes at 65 DEG C of temperature.During incubation, sample was mixed by inversion once in every 10 minutes.After incubation, addition Isometric chloroform/isoamyl alcohol (24:1) was gently mixed by being inverted, with revolving speed 4000rpm centrifugation 20 minutes.Water phase is collected, 1 hour is placed at -20 DEG C of temperature after adding isometric isopropanol to precipitate DNA, then with revolving speed 4000rpm centrifugation 5 minutes DNA precipitating is obtained, then resuspension DNA is precipitated in 1mL TE buffer.For any existing RNA that degrades, in temperature 37 At DEG C, DNA and the concentration 5 μ L RNAase A for being 30mg/mL are incubated 30 minutes, with revolving speed 4000rpm centrifugation 5 minutes, then In the presence of 0.1 volume 3M sodium acetate and 2 volume dehydrated alcohol, 10 minutes precipitating DNA are centrifuged with revolving speed 14000rpm. After discarding supernatant, is precipitated with the 1mL ethanol washing of 70% (v/v), re-dissolved in 1mL TE buffer after making it dry. The genomic DNA for measuring above-mentioned sample with ultramicrospectrophotometer (NanoDrop 2000, Thermo Scientific) is dense Degree.
4.2, enzymic digestion is limited
In 100 μ L reaction systems, 5 μ g DNA are digested every time.It is digested respectively with restriction enzyme EcoRI and EcoRV The partial sequence of genomic DNA, the EPSPS using on T-DNA and PAT are as probe.For every kind of enzyme, at a proper temperature overnight Incubate digest.Using SpeedVac (speed vacuum, Thermo Scientific) rotation sample to subtract Lack volume to 20 μ L.
4.3, gel electrophoresis
Bromophenol blue Loading Dye is added to each sample in the present embodiment 4.2, and by each sample pipetting volume Onto 0.7% Ago-Gel containing ethidium bromide, TAE electrophoretic buffer (40mM Tris- acetic acid, 2mM EDTA, PH8.0 electrophoretic separation in), running gel is stayed overnight under 20 volts.
Denaturing liquid (1.5M NaCl, 0.5M NaOH) and neutralizer (1.5M NaCl, 0.5M Tris, pH7.2) are used respectively Treatment gel each 30 minutes.5 × SSC is poured into porcelain dish, costs one piece of glass plate, then successively puts the filter paper bridge soaked, is coagulated Glue, positively charged nylon membrane (Roche, Cat.No.11417240001), three layers of filter paper, paper tower, weight.Transferring film mistake at room temperature After night, is rinsed nylon membrane 10 seconds in 2 × SSC, be crosslinked by UV and DNA is fixed on film.
4.4, hybridize
It is prepared with the DNA sequence dna that PCR amplification is suitble to for probe.The DNA probe is SEQ ID NO:24 and SEQ ID NO:25, or it is homologous or complementary with above-mentioned Sequence.With the efficient digoxigenin labeled of DNA and detection kit II (DIG High Prime DNA Labeling and Detection Starter Kit II kit, Roche, Cat.No.11585614910 the operations such as DIG label, Southern blot hybridization and the signal detection of probe) are carried out, specifically Method refers to its product description.
Include two kinds of control samples on each Southern: (1) DNA of the segregant from negative (unconverted), For identify it is any can be with element-specific probe hybridization endogenous soybean sequence；(2) one is equivalent to based on probe length to copy The pDBN4003 plasmid of the Hind III- digestion of shellfish number, the sensitivity as the positive control hybridized and for illustrating experiment.
The evidence that hybridization data provides confirmation supports TaqManTMPCR analysis, i.e. bean plant DBN9001 contain Single copy of EPSPS and pat gene.Using the EPSPS probe, EcoR I and EcoR V enzymatic hydrolysis generate respectively size about 8kb and The single band of 13kb；Using the PAT probe, EcoR I and EcoR V enzymatic hydrolysis generate the list of size about 7.5kb and 2.5kb respectively One band.This shows that each copy of EPSPS and PAT is present in transformation of soybean event DBN9001.
5th embodiment detects transgenic soybean event DBN9001 protein by ELISA
Expression range of the EPSPS and PAT protein in transgenic soybean event DBN9001, can be examined by ELISA It surveys.
It takes the fresh blade of 2mg transgenic soybean event DBN9001 as sample, is added described in 1mL and extracts after liquid nitrogen grinding Take buffer (8g/L NaCl, 0.27g/L KH2PO4, 1.42g/L Na2HPO4, 0.2g/L KCl, 5.5ml/L Tween-20, PH7.4), it is centrifuged 10 minutes under the revolving speed of 4000rpm, supernatant is taken to dilute 40 times with the extraction buffer, 80 μ l is taken to dilute Supernatant afterwards is detected for ELISA.
With ELISA (enzyme-linked immunosorbent assay) kit (ENVIRLOGIX company, EPSPS kit and PAT reagent Box) it the ratio of fresh weight is accounted for protein in sample (EPSPS albumen and PAT albumen) amount tests and analyzes, specific method With reference to its product description.Simultaneously with Wild-type soy plant leaf (non-transgenic, NGM) as compareing, according to the method described above It is tested and analyzed, every plant is repeated 6 times.
The experimental result such as table 6 of protein (EPSPS albumen and PAT albumen) content of transgenic soybean event DBN9001 It is shown.EPSPS albumen in transgenic soybean event DBN9001 and the fresh blade of Wild-type soy plant is measured respectively to be averaged table Accounting for the ratio (μ g/g) of fresh weight up to amount is respectively 170.1 and 0；Transgenic soybean event DBN9001 and Wild-type soy are planted It is respectively 260.2 and 0 that PAT albumen average expression amount, which accounts for the ratio (μ g/g) of fresh weight, in the fresh blade of strain.
Expressing quantity (μ g/g) the measurement average result of table 6, transgenic soybean event DBN9001
The herbicide tolerant detection of sixth embodiment, transgenic soybean event DBN9001
This test selects agriculture (to have up to herbicide (41% glyphosate-isopropylammonium aqua) and guarantor's examination up to (Basta) herbicide Imitate the glufosinate-ammonium of ingredient 18%) it is sprayed.Using RANDOMIZED BLOCK DESIGN, 3 repetitions.Plot area is 18m2(5m× 3.6m), line-spacing 60cm, spacing in the rows 8cm, conventional cultivation management have the wide isolation strip of 1m between cell.By transgenic soybean event DBN9001 carries out following 3 kinds of processing respectively: 1) not spraying, artificial control grass；2) by 1680g a.e./ha, (a.e./ha refers to " living Property ingredient angelic acid per hectare ") dosage in the V3 leaf phase sprays agriculture up to herbicide, then at R2 phase (full-bloom stage) by same dose again Secondary sprinkling agriculture reaches herbicide；3) it is sprayed by 800g a.i./ha (a.i./ha refers to " active ingredient per hectare ") dosage in the V3 leaf phase Guarantor's examination is spilt up to herbicide, then sprays guarantor's examination again by same dose in the V6 phase up to herbicide；4) 800g a.i./ha dosage is pressed Guarantor's examination is sprayed up to herbicide in the V3 leaf phase, then reaches herbicide by 1680g a.e./ha dose spray agriculture in the R2 phase.Use wild type Soybean plant strain (non-transgenic, NGM) does parallel control experiment.It should be noted that the Gyphosate herbicice of different content and dosage form Agent is converted into the form of equivalent glyphosate and the glufosinate-ammonium solution of various concentration is converted into above-mentioned equivalent effective component grass ammonium Phosphine is suitable for draw a conclusion.
The 1 week and 2 weeks investigation symptom of chemical damage after medication respectively, and harvest when measure cell soybean yields.Phytotoxicity disease Shape classification is as shown in table 7.The index for using the aggrieved rate of herbicide as the herbicide tolerant of evaluation transformation event is specifically removed The careless aggrieved rate of agent (%)=∑ (aggrieved strain number × number of levels at the same level)/(total strain number × highest level)；The wherein aggrieved rate of herbicide Including the aggrieved rate of glyphosate and the aggrieved rate of glufosinate-ammonium, the aggrieved rate of herbicide is the medicine according to 2 weeks after glyphosate or glufosinate-ammonium processing Evil investigation result and determination.The soybean yields of each cell is the big beans total output (weight) for weighing 3 rows among each cell, Volume variance between different disposal is measured in the form of yield percentage, and yield percentage (%)=spraying yield/does not spray Apply yield.The results are shown in Table 8 to the result of herbicide tolerant and soybean yields by transgenic soybean event DBN9001.
Table 7, herbicide are to the grade scale of soybean phytotoxicity degree
Phytotoxicity rank Symptom description
1 Growth is normal, without any damage symptoms
2 Slight phytotoxicity, phytotoxicity are less than 10%
3 Medium phytotoxicity can restore later, not influence yield
4 Phytotoxicity is heavier, it is difficult to restore, cause the underproduction
5 Phytotoxicity is serious, cannot restore, and causes the obvious underproduction or total crop failure
Table 8, transgenic soybean event DBN9001 are to the result and yield test result of herbicide tolerant
As a result illustrate, in terms of herbicide (glyphosate and glufosinate-ammonium) aggrieved rate: 1) transgenic soybean event DBN9001 exists Aggrieved rate is essentially 0 under glyphosate herbicidal (1680g a.e./ha) processing；2) transgenic soybean event DBN9001 is in careless ammonium Aggrieved rate is also essentially 0 under phosphine herbicide (800g a.i./ha) processing；3) transgenic soybean event DBN9001 is removed in glufosinate-ammonium Aggrieved rate is also essentially 0 under careless agent (800g a.i./ha) and glyphosate herbicidal (1680g a.e./ha) processing；Turn as a result, Transgenic soybean event DBN9001 has good herbicide (glyphosate and glufosinate-ammonium) tolerance.
In terms of yield: transgenic soybean event DBN9001 is spraying glyphosate herbicidal (1680g a.e./ha), grass Ammonium phosphine herbicide (800g a.i./ha) and glufosinate-ammonium herbicide (800g a.i./ha)+glyphosate herbicidal (1680g a.e./ Ha) the lower yield of 3 kinds of processing, which is compared, does not spray processing and is increased slightly, and further demonstrates that transgenic soybean event DBN9001 as a result, With good herbicide (glyphosate and glufosinate-ammonium) tolerance.
7th embodiment
Such as agricultural product or commodity can be produced by transgenic soybean event DBN9001.If in the agricultural product or commodity In detect enough expression quantity, the agricultural product or commodity are expected containing can diagnose transgenic soybean event DBN9001 material Expect the nucleotide sequence present in the agricultural product or commodity.The food or commodity include but is not limited to come from bean plant The product of DBN9001, such as soybean cake, powder and oil, are specifically as follows lecithin, fatty acid, glycerol, sterol, edible oil, degreasing Soybean piece, including degreasing and the soy meal of baking, soya-bean milk grumeleuse, bean curd, soybean protein concentrate, separation soybean protein, Hydrolyzed vegetable protein, textured soybean protein and soybean fiber etc..Nucleic acid detection method based on probe or primer pair and/ Or kit can be developed it is big to detect transgenosis shown in such as SEQ ID NO:1 or SEQ ID NO:2 in biological sample Beans event DBN9001 nucleotide sequence, wherein probe sequence or primer sequence be selected from as SEQ ID NO:1, SEQ ID NO:2, Sequence or its segment or sequence complementary to it shown in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, with Diagnose the presence of transgenic soybean event DBN9001.
In conclusion transgenic soybean event DBN9001 of the present invention has glyphosate herbicidal and glufosinate-ammonium herbicide Preferable tolerance, on yield without influence, and whether detection method can quickly and accurately be identified in biological sample comprising turning base Because of the DNA molecular of soybean event DBN9001.
Seed corresponding to transgenic soybean event DBN9001 is deposited in China Microbiological bacterium on November 27th, 2015 Kind preservation administration committee common micro-organisms center (abbreviation CGMCC, address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, in Institute of microbiology, the academy of sciences, state, postcode 100101), classification naming: soybean (Glycine max), deposit number CGMCC No.11043.Preserved material will be 30 years in depository's preservation.
It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, those skilled in the art should understand that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit and scope of the technical solution of the present invention.

Claims (23)

1. a kind of nucleic acid molecules with following nucleic acid sequence, which is characterized in that the nucleic acid sequence include SEQ ID NO:1 or Its complementary series, and/or SEQ ID NO:2 or its complementary series, the nucleic acid molecules are originated from transgenic soybean event DBN9001, the transgenic soybean event DBN9001 are preserved in the form of seed and with deposit number CGMCC No.11043 China Committee for Culture Collection of Microorganisms's common micro-organisms center.
2. nucleic acid molecules according to claim 1, which is characterized in that the nucleic acid sequence include SEQ ID NO:3 or its Complementary series, and/or SEQ ID NO:4 or its complementary series.
3. nucleic acid molecules according to claim 2, which is characterized in that the nucleic acid sequence include SEQ ID NO:5 or its Complementary series.
4. a kind of method existing for DNA of test sample transgenic soybean event DBN9001 characterized by comprising
Contact sample to be tested in nucleic acid amplification reaction at least two primers for expanding target amplification product；
Carry out nucleic acid amplification reaction；With
Detect the presence of the target amplification product；
The target amplification product includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its complementary series, The target amplification product is originated from transgenic soybean event DBN9001, and the transgenic soybean event DBN9001 is with the shape of seed Formula and China Committee for Culture Collection of Microorganisms's common micro-organisms center is preserved in deposit number CGMCC No.11043.
5. method existing for the DNA of test sample transgenic soybean event DBN9001 according to claim 4, feature It is, the target amplification product further includes at least one selected from the following: SEQ ID NO:6 or its complementary series and SEQ ID NO:7 or its complementary series.
6. method existing for the DNA of test sample transgenic soybean event DBN9001 according to claim 4 or 5, special Sign is that described two primers include SEQ ID NO:8 and SEQ ID NO:9 or SEQ ID NO:10 and SEQ ID NO: 11。
7. a kind of method existing for DNA of test sample transgenic soybean event DBN9001 characterized by comprising
Contact sample to be tested with probe, the probe includes SEQ ID NO:1 or its complementary series or SEQ ID NO: 2 or its complementary series, the source probe transgenic soybean event DBN9001, the transgenic soybean event DBN9001 is to plant Son form and China Committee for Culture Collection of Microorganisms's commonly micro- life is preserved in deposit number CGMCC No.11043 Object center；
Hybridize the sample to be tested and the probe under stringent hybridization conditions；With
Detect the hybridisation events of the sample to be tested and the probe.
8. method existing for the DNA of test sample transgenic soybean event DBN9001 according to claim 7, feature It is, the probe also includes at least one selected from the following: SEQ ID NO:6 or its complementary series and SEQ ID NO:7 Or its complementary series.
9. special according to method existing for the DNA of the test sample transgenic soybean event DBN9001 of claim 7 or 8 Sign is that at least one described probe is marked at least one fluorophor.
10. a kind of method existing for DNA of test sample transgenic soybean event DBN9001 characterized by comprising
Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:1 or it is mutual Complementary series or SEQ ID NO:2 or its complementary series, the marker nucleic acid molecules are originated from transgenic soybean event DBN9001, the transgenic soybean event DBN9001 are preserved in the form of seed and with deposit number CGMCC No.11043 China Committee for Culture Collection of Microorganisms's common micro-organisms center；
Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions；With
The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then pass through marker assistant breeding point Analysis is to determine that glyphosate tolerant and/or glufosinate tolerant and marker nucleic acid molecules are chain on science of heredity.
11. method existing for the DNA of test sample transgenic soybean event DBN9001 according to claim 10, special Sign is that the marker nucleic acid molecules further include at least one selected from the following: SEQ ID NO:6 or its complementary series and SEQ ID NO:7 or its complementary series.
12. a kind of DNA detection kit, which is characterized in that including at least one DNA molecular, the DNA molecular includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series, can be used as transgenic soybean event DBN9001 or its offspring have one of DNA primer of specificity or probe；The DNA molecular is originated from transgenic soybean event DBN9001, the transgenic soybean event DBN9001 are preserved in the form of seed and with deposit number CGMCC No.11043 China Committee for Culture Collection of Microorganisms's common micro-organisms center.
13. DNA detection kit according to claim 12, which is characterized in that further include when the DNA molecular is as probe At least one selected from the following: SEQ ID NO:6 or its complementary series and SEQ ID NO:7 or its complementary series.
14. a kind of method for generating the soybean plant strain for having tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide, special Sign is, including will successively include SEQ ID NO:1,899-5553 nucleic acid sequences of SEQ ID NO:5 and SEQ in genome The soybean plant strain of ID NO:2 hybridizes with another soybean plant strain, to generate a large amount of progeny plants；Selection genome successively wraps ID containing SEQ NO:1,899-5553 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2 or genome include SEQ The progeny plant of ID NO:5, and the progeny plant has glyphosate and/or glufosinate tolerant.
15. 4 soybean generated to glyphosate herbicidal and/or glufosinate-ammonium herbicide with tolerance according to claim 1 The method of plant characterized by comprising
To there is the first parent of transgenic soybean event DBN9001 of tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide This soybean plant strain and the second parental soybean plant sexual hybridization for lacking glyphosate and/or glufosinate tolerant, to generate big Measure progeny plant；
The progeny plant described in glyphosate herbicidal and/or glufosinate-ammonium herbicide treatment；With
The progeny plant of selection tolerance glyphosate and/or glufosinate-ammonium herbicide；
The transgenic soybean event DBN9001 is preserved in China in the form of seed and with deposit number CGMCC No.11043 Microbiological Culture Collection administration committee common micro-organisms center.
16. a kind of method that culture has the bean plant of tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide, special Sign is, comprising:
An at least soya seeds are planted, include the nucleic acid sequence of specific region, the spy in the genome of the soya seeds The nucleic acid sequence for determining region successively includes SEQ ID NO:1,899-5553 nucleic acid sequences of SEQ ID NO:5 and SEQ ID The nucleic acid sequence of NO:2 or the specific region includes SEQ ID NO:5；
The soya seeds are made to grow up to soybean plant strain；With
The soybean plant strain described in effective dose glyphosate herbicidal and/or glufosinate-ammonium herbicide spray, harvest do not have with other The plant of the nucleic acid sequence of specific region compares the plant with the plant injury weakened.
17. a kind of method for protecting the plants from the damage as caused by herbicide, which is characterized in that including effective dose will be contained Glyphosate and/or the herbicide of glufosinate-ammonium are applied to the big Tanaka for planting at least one transgenic soy bean plant, the transgenosis Bean plant successively includes SEQ ID NO:1,899-5553 nucleic acid sequences of SEQ ID NO:5 and SEQ in its genome It include SEQ ID NO:5 in the genome of ID NO:2 or the transgenic soy bean plant；The transgenic soy bean plant tool There is the tolerance to glyphosate herbicidal and/or glufosinate-ammonium herbicide.
18. a kind of method for controlling weeds in field, which is characterized in that including effective dose glyphosate and/or glufosinate-ammonium will be contained Herbicide be applied to the big Tanaka for planting at least one transgenic soy bean plant, the transgenic soy bean plant is in its genome In successively include SEQ ID NO:1,899-5553 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2 or described turn It include SEQ ID NO:5 in the genome of transgenic soybean plant；The transgenic soy bean plant have to glyphosate herbicidal and/ Or the tolerance of glufosinate-ammonium herbicide.
19. a kind of method for the crop field glyphosate resistance weeds for controlling glyphosate-tolerant plant, which is characterized in that including inciting somebody to action Herbicide containing effective dose glufosinate-ammonium is applied to the big of the transgenic soy bean plant for planting at least one glyphosate tolerant Tanaka, the transgenic soy bean plant of the glyphosate tolerant successively include SEQ ID NO:1, SEQ ID in its genome The transgenic soy bean plant of 899-5553 nucleic acid sequences of NO:5 and SEQ ID NO:2 or the glyphosate tolerant It include SEQ ID NO:5 in genome；The transgenic soy bean plant of the glyphosate tolerant has to glufosinate-ammonium weeding simultaneously The tolerance of agent.
20. a kind of method for delaying insect-resistant, which is characterized in that including planted in the big Tanaka for planting pest-resistant bean plant to A kind of few transgenic soy bean plant with glyphosate and/or glufosinate tolerant, it is described to have glyphosate and/or glufosinate-ammonium resistance to Transgenic soy bean plant by property successively includes 899-5553 SEQ ID NO:1, SEQ ID NO:5 cores in its genome The gene of acid sequence and SEQ ID NO:2 or the transgenic soy bean plant with glyphosate and/or glufosinate tolerant It include SEQ ID NO:5 in group.
21. a kind of agricultural product or commodity for being produced from transgenic soybean event DBN9001, which is characterized in that the agricultural product or Commodity are soybean piece, soy meal, soybean protein or its concentrate, soybean oil, soybean fiber, soya-bean milk grumeleuse；It is described to turn base Chinese microorganism strain guarantor is preserved in because of soybean event DBN9001 in the form of seed and with deposit number CGMCC No.11043 Hide administration committee's common micro-organisms center.
22. being produced from the agricultural product or commodity of transgenic soybean event DBN9001 according to claim 21, feature exists In the soya-bean milk grumeleuse is bean curd.
23. a kind of agricultural product or commodity for being produced from transgenic soybean event DBN9001, which is characterized in that the agricultural product or Commodity are lecithin, fatty acid, glycerol, sterol；The transgenic soybean event DBN9001 is compiled in the form of seed and with preservation Number CGMCC No.11043 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center.
CN201610440595.1A 2016-06-18 2016-06-18 For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 Active CN106119245B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610440595.1A CN106119245B (en) 2016-06-18 2016-06-18 For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610440595.1A CN106119245B (en) 2016-06-18 2016-06-18 For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001

Publications (2)

Publication Number Publication Date
CN106119245A CN106119245A (en) 2016-11-16
CN106119245B true CN106119245B (en) 2019-10-18

Family

ID=57470580

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610440595.1A Active CN106119245B (en) 2016-06-18 2016-06-18 For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001

Country Status (1)

Country Link
CN (1) CN106119245B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2019460919B2 (en) * 2019-08-09 2024-03-21 Beijing Dabeinong Biotechnology Co., Ltd. Nucleic acid sequence for detecting soybean plant DBN8002 and detection method therefor
CN111247255B (en) * 2019-08-09 2023-06-27 北京大北农生物技术有限公司 Nucleic acid sequence for detecting soybean plant DBN8007 and detection method thereof
CN114787389A (en) * 2022-02-21 2022-07-22 北京大北农生物技术有限公司 Nucleic acid sequence for detecting soybean plant DBN8205 and detection method thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101939437A (en) * 2008-02-15 2011-01-05 孟山都技术公司 Soybean plant and seed corresponding to transgenic event MON87769 and methods for detection thereof
CN103597077A (en) * 2010-12-15 2014-02-19 先正达参股股份有限公司 Soybean event SYHT0H2 and compositions and methods for detection thereof
CN103826443A (en) * 2011-07-13 2014-05-28 陶氏益农公司 Stacked herbicide tolerance event 8264.42.32.1, related transgenic soybean lines, and detection thereof
CN104718293A (en) * 2012-06-25 2015-06-17 美国陶氏益农公司 Soybean event pDAB9582.816.15.1 detection method
CN104830846A (en) * 2015-04-30 2015-08-12 北京大北农科技集团股份有限公司 Nucleic acid sequence used for detecting herbicide-tolerant corn plant DBN9898 and detection method thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101939437A (en) * 2008-02-15 2011-01-05 孟山都技术公司 Soybean plant and seed corresponding to transgenic event MON87769 and methods for detection thereof
CN103597077A (en) * 2010-12-15 2014-02-19 先正达参股股份有限公司 Soybean event SYHT0H2 and compositions and methods for detection thereof
CN103826443A (en) * 2011-07-13 2014-05-28 陶氏益农公司 Stacked herbicide tolerance event 8264.42.32.1, related transgenic soybean lines, and detection thereof
CN104718293A (en) * 2012-06-25 2015-06-17 美国陶氏益农公司 Soybean event pDAB9582.816.15.1 detection method
CN104830846A (en) * 2015-04-30 2015-08-12 北京大北农科技集团股份有限公司 Nucleic acid sequence used for detecting herbicide-tolerant corn plant DBN9898 and detection method thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AC235290.1;NCBI;《GenBank》;20090312;全文 *
GQ497217.1;NCBI;《GenBank》;20090828;全文 *
抗草甘膦转基因大豆的田间鉴定;高秀清 等;《山西农业大学学报（自然科学版）》;20151231;第35卷(第2期);143-147 *
转基因技术在大豆性状改良上的应用;杜艳丽，谢甫绨;《大豆科学》;20150430;第34卷(第2期);320-328 *

Also Published As

Publication number Publication date
CN106119245A (en) 2016-11-16

Similar Documents

Publication Publication Date Title
CN106086010B (en) For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9008
CN106086011B (en) For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9004
CN104427861B (en) Corn event mon 87411
CN104830845B (en) Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878
CN104878094B (en) For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888
CN104830847B (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9936
CN104878091B (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9978
CN104830846B (en) Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9898
MX2013011275A (en) Cotton transgenic event mon 88701 and methods of use thereof.
KR20080050548A (en) Soybean event mon89788 and methods for detection thereof
CN104878096B (en) For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868
CN111406117B (en) Nucleic acid sequence for detecting soybean plant DBN8002 and detection method thereof
CN104878092B (en) Nucleic acid sequence and its detection method for detecting corn plant DBN9953
WO2021026689A1 (en) Nucleic acid sequence used for detecting soybean plant dbn8007 and detection method therefor
CN104878095B (en) Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9858
CN109971880A (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9508
CN106119245B (en) For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001
CN104830983B (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9968
CN110881367A (en) Corn event Ttrans-4 and methods of use thereof
CN104846084B (en) For detecting the nucleic acid sequence and its detection method of corn plant DBN9927
CN104878097B (en) Nucleic acid sequence and its detection method for detecting corn plant DBN9981
CN104878090B (en) For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9877

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20200810

Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49

Patentee after: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd.

Address before: 100080, 14, Zhongguancun Avenue, 27, Beijing, Haidian District

Co-patentee before: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd.

Patentee before: BEIJING DABEINONG TECHNOLOGY GROUP Co.,Ltd.

TR01 Transfer of patent right