CN108018286B - Creation, detection and application of corn transformation event ZM8-143 - Google Patents

Abstract

The present application belongs to the field of plant biotechnology and provides a corn transgenic event named ZM8-143 and its detection and application. Primer pairs, primer pair combinations and methods for detecting the transgenic event are provided. Also provided are methods for obtaining various new transgenic materials using plants comprising the transgenic events as donors, and the progeny produced and products thereof.

Description

Creation, detection and application of corn transformation event ZM8-143

Technical Field

The application relates to the technical field of plant biology, in particular to a method for developing and detecting a transgenic corn transformation event with resistance to borers and herbicide-tolerant glufosinate-ammonium.

Background

The corn borer is commonly called corn borer, the harm of which is one of important biological disasters causing perennial yield reduction of corn, and the corn borer seriously affects the yield and quality of the corn, including Asian corn borer (Ostrinia furnacalis) and European corn borer (Ostrinia nubilalis). China is the multiple and repeat region of the asian corn borer (Ostrinia furnacalis) and occurs on a large scale almost every two years. The yield of the corn damaged by the corn borers is reduced by 10-15% in the common year, the yield of the corn in the growing year can be reduced by more than 30%, and even the corn is harvested absolutely. The annual loss of corn is 600-. The corn borers not only directly cause the loss of the corn yield, but also induce and aggravate the occurrence of the corn ear rot, so that the quality of the corn is reduced.

At present, the main mode for preventing and controlling the corn borers is mainly pesticide prevention and control. The use of a large amount of pesticides not only increases the planting cost, but also destroys the ecological environment. The insecticidal crystal protein of Bacillus thuringiensis (Bt for short) has specific poisoning effect on different insects (such as Lepidoptera, Coleoptera, Diptera, etc.) including corn borer and invertebrates. By cultivating the transgenic Bt insect-resistant corn, the corn insect damage can be effectively prevented and controlled, the use of pesticide is reduced, the yield loss is saved, the agricultural income is increased, and the environmental hazard is reduced.

The weeds in the field compete with crops for water, fertilizer, light energy and growth space, are intermediate hosts for damaging crop germs and pests, and are one of important biological limiting factors for increasing the yield of crops. The area of crops seriously damaged by weeds all year round in China is up to 12 hundred million acres, wherein 1.9 hundred million acres of corn are obtained. With the increasing migration speed of rural population to cities, the scale and mechanization of corn planting is a foreseeable trend, which makes the traditional artificial weeding method unrealistic. At present, the widely adopted selective herbicide has large application amount and long residual period, and is easy to influence the normal growth of the next-stubble crops. The biocidal herbicides such as glufosinate-ammonium and the like have the characteristics of high efficiency, low toxicity, easy degradation, no residue and the like, but have no selectivity in weeding and cannot be directly used in the growth period of crops. The problem that all weeds can be solved by spraying 1-2 times in the growth period of the corn can be solved by cultivating the corn with the biocidal herbicide resistance through a transgenic technology, and the dosage and the investment cost of the herbicide are reduced. M. ndez et al (2011) found that herbicide tolerant transgenic maize could save weeding costs $ 102 per hectare, while the yield increased by 22% (insect and herbicide tolerant bivalent transgene). The transgenic technology can not only improve the resistance of the corn to some insect pests and the tolerance of certain herbicide, but also recover the yield loss, increase the yield per unit of the corn and reduce the production cost.

The plant transgenic breeding technology has the advantages of strong purposiveness, short period, high efficiency, capability of realizing the transfer of excellent genes among different species and the like. Since the first commercialization of transgenic crops in 1996, this technology has brought about tremendous changes to global agriculture. The planting area of the global transgenic crops reaches 1.815 hundred million hectares in 2014, which is more than 100 times of the planting area in 1996. In the aspect of transformation technology, a gene gun and agrobacterium-mediated method is a main transformation method for developing and applying transgenic insect-resistant corn. The agrobacterium-mediated method has simple operation, high transformation rate and low cost, and is the most widely applied transformation method at present. In the aspect of gene selection, Cry1Ac, Cry1F and other genes for preventing and treating lepidoptera corn borers are still used as main genes, but a plurality of lines with coleoptera resistance such as MON88017 and the like are already put into commercial production, and a Cry3 gene is used for obtaining corn root nematode resistant lines such as MON863 and the like. This suggests that selection of insect-resistant genes gradually broadens the range of target insects and increases the selection of the insect-resistant spectrum of genes. With the application of genetic engineering technology, transgenic Bt insect-resistant maize optimized by codon is also commercially produced, such as MON810, MON89034 of Monsanto, USA. Worldwide, more than 40 kinds of transgenic Bt insect-resistant corns are approved by 26 countries to be put into commercial production or feed and food processing in 1996 to date.

It is well known to those skilled in the art that expression of a foreign gene in a plant has a positional effect, i.e., is influenced by the location of the inserted chromosome, which may be due to the influence of transcriptional regulatory elements near the chromosomal structure or integration site. Therefore, it is usually necessary to produce hundreds of different transformation events and to screen out excellent transformation events with desired exogenous gene expression levels and patterns for commercial production applications. Excellent transformation events transfer foreign genes into germplasm in other genetic backgrounds by means of conventional breeding methods, i.e. sexual crosses, whose progeny retain the transgene expression characteristics of the original transformants. This strategy has been widely applied to elite varieties with certain ecological adaptability to achieve the goal of increasing elite traits.

Disclosure of Invention

The application transfers a Bacillus Thuringiensis (BT) anti-corn borer gene (cry1Ab/cry1AcZM) and a herbicide glufosinate-ammonium tolerance gene (bar) into the genome of a corn excellent inbred line by an agrobacterium-mediated method to obtain an insect-resistant herbicide-resistant corn transformation event ZM 8-143.

Furthermore, it is important to establish a method for specifically detecting this transformation event. In one aspect, detecting the presence of a particular transformation event is an effective means of determining whether progeny of a sexual cross contain a gene of interest; on the other hand, the method for determining a specific event will help to comply with transgenic safety management regulations such as licensing and identification regulations requiring the origin of commercial planting of transgenic crops, sale of processed products, and the like. It is possible to detect the presence of a transgene by nucleic acid detection methods well known in the art, including but not limited to PCR amplification using polynucleotide primers or DNA hybridization using nucleic acid probes. In general, DNA primer sequences and methods for detecting transgenic plants are simple and consistent, and detection of target sequences often focuses on frequently used gene expression elements such as promoters, terminators, and marker genes. Therefore, sequence information for obtaining unique "flanking DNA" is required to distinguish between different transformation events produced by the same transformation vector. The specificity detection is carried out on the corn transformation event, so that products of the transgenic corn event, parents and filial generations can be better supervised and managed.

In one aspect, the present application provides a nucleic acid molecule of maize transformation event ZM8-143 selected from the group consisting of: a nucleic acid molecule comprising the nucleotide sequence shown in SEQ id No. 2or a fragment or variant thereof or the complement thereof.

In another aspect, the present application provides a primer pair, or a combination of primer pairs, of a nucleic acid molecule for detecting a maize transformation event ZM8-143 selected from the group consisting of a primer pair comprising one primer specifically recognizing the sequence comprising nucleotides 1-438 of the sequence indicated by SEQ ID NO. 2 and another primer specifically recognizing the sequence comprising nucleotides 7181-8073 of the sequence indicated by SEQ ID NO. 2or the complement thereof;

in one embodiment, the primer pair is selected from the group consisting of:

primer combination (1)

SEQ ID NO:3(FW-csp2211):5’-CTGTCACACGGATTCTGTAT-3’，

SEQ ID NO:4(RV-csp2526):5’-ACTTAGACATGCAATGCTCA-3’；

Primer combination (2)

SEQ ID NO:3(FW-csp2211):5’-CTGTCACACGGATTCTGTAT-3’，

SEQ ID NO:14(RV-csp2344):5’-TATAGGGTTTCGCTCATGTG-3’；

Primer combination (3)

SEQ ID NO:15(FW-csp2648):5’-CCGAGAATTATGCAGCATTT-3’，

10(RV-csp2649) 5'-TTTGGGATGCTTATGTTTGC-3'; and

primer combination (4)

SEQ ID NO:9(FW-csp2423):5’-GGCTAGTATCTACGACACAC-3’，

SEQ ID NO:10(RV-csp2649):5’-TTTGGGATGCTTATGTTTGC-3’。

In another aspect, the present application provides a method for identifying a transformation event ZM8-143 in a biological sample comprising using a primer pair, or a combination of primer pairs, as described above.

In another aspect, the present application provides a kit or microarray for detecting a maize transformation event ZM8-143, comprising a primer pair, or a combination of primer pairs, as described above.

In another aspect, the present application provides the use of a primer pair, or a combination of primer pairs, as described above, or a kit or microarray, as described above, for detecting a maize transformation event ZM 8-143.

In another aspect, the present application provides a method of detecting the presence of a transformation event ZM8-143, or progeny thereof, in a biological sample, comprising:

providing a biological sample and extracting DNA from the biological sample;

providing a primer pair, or a combination of primer pairs, as described above;

carrying out DNA amplification reaction by using the primer pair; and

detecting the DNA amplicon molecule produced by said DNA amplification reaction, wherein the presence of said DNA amplicon molecule indicates the presence of a transformation event ZM8-143,

wherein the transformation event ZM8-143 is DNA which introduces foreign DNA into a plant thereby producing the sequence of SEQ ID NO. 2 in the plant.

In another aspect, the present application provides an isolated DNA molecule comprising any one of the amplicons produced by the methods described above.

In another aspect, the use of a transgenic maize comprising SEQ ID NO. 2 in breeding, optionally comprising obtaining a progeny plant by pollen culture, haploid embryo culture, doubling culture, cell culture, tissue culture, selfing, or crossing, or a combination thereof. In another aspect, the present application provides an article made from the plant produced by the above-described use, optionally the article is a food, feed or industrial material.

In another aspect, the present application provides a transgenic plant comprising transformation event ZM 8-143.

In another aspect, the present application provides progeny plants obtained by pollen culture, haploid embryo culture, doubling culture, cell culture, tissue culture, selfing, or crossing, or a combination thereof, with a transgenic corn plant containing transformation event ZM 8-143.

Transformation event ZM8-143 described herein is DNA that has been introduced into a plant with exogenous DNA to produce the sequence of SEQ ID NO. 2 in the plant. In the sequence of SEQ ID NO. 2, the 1st to 438 th nucleotides and the 7181 st and 8073 th nucleotides are inherent sequences in the maize genome sequence, and the 439 th and 7181 th nucleotides are exogenous insert sequences.

In addition, methods of pest control and weed control using the above-described corn transformation events are provided.

Drawings

FIG. 1A is a schematic diagram of a carrier pZZ 01194; fig. 1B is a schematic structural diagram of vector pZZ 01206; FIG. 1C is a schematic diagram of the structure of carrier pZZ 00015; FIG. 1D is a schematic structural view of vector pZHZHZH 25018; wherein

Ubi promoter: ubiquitin promoter

omega: omega sequence

cry1Ab/cry1 AcZM: optimized Bt gene sequences

poly A: polyadenosine sequence

T-NOS: nopaline synthase terminator

T-OCS: octopine synthase terminator

pMB1 rep: pMB1 replicon

Amp (R): ampicillin resistance

EGFP: green fluorescent protein

T-Border (right): T-DNA right border sequence

CaMV35S promoter: cauliflower mosaic virus 35S promoter

bar: glufosinate-ammonium-resistant gene sequence

CaMV35S polyA: cauliflower mosaic virus 35S polyadenylation sequence

T-Border (left): T-DNA left border sequence

bp: base pairing

Kanamycin (R): kanamycin resistance sequence

pBR322 ori: pBR322 initiation region sequence

pBR322 born: pBR322 framework region sequence

pVS1 rep: pVS1 replicon

pVS1 sta: pVS1 transcriptional initiation region

FIG. 2, tolerance (T) and sensitivity (S) maize leaf expression after glufosinate application;

FIG. 3A, identification of Asian corn borer resistance of transformed plant leaves. R is insect-resistant; s is insect-susceptible;

FIG. 3B, identification of Asian corn borer resistance of transformed plant stems. R is insect-resistant; s is insect-susceptible;

FIG. 4A, Southern hybridization analysis cry1Ab/cry1AcZM gene insert copy number; lanes 1 and 5 are the negative control 249; lane 9 is a positive control; 2, 3 and 4 are the result of DNA hybridization with HindIII enzyme digestion; lanes 6, 7 and 8 show the results of hybridization with NcoI-digested DNA; m is the molecular weight marker lane, indicated by the base number (kb). 333bp probes from cry1Ab/cry1AcZM partial sequence, positive bands of 8.8kb (HindIII) and 10.3kb (NcoI), respectively, indicate single copy insertion of single site of foreign gene;

FIG. 4B, Southern hybridization analysis of the bar gene insert copy number; lanes 1 and 5 are the negative control 249 DNA; lane 9 is a positive control; lanes 2, 3 and 4 show the results of hybridization of the transforming event maize DNA digested with HindIII; lanes 6, 7 and 8 show the hybridization results of the transformation event, corn DNA, digested with NcoI; lane 7, M: a molecular weight standard; the probe 408bp comes from the partial sequence of the carrier bar gene; positive bands were 6.3kb (HindIII) and 7.8kb (NcoI), respectively, indicating single copy insertion of the foreign gene;

FIG. 5 is a schematic diagram of insertion of T-DNA of pZHZHZH 25018 vector into maize genome. The left insertion point is located on chromosome 8, 134500794 bp; the right insertion point is located on chromosome 8, 134513477 bp; the corresponding region of the left flanking primer, the region of the insert sequence and the corresponding region of the right flanking primer were verified by 4 pairs of primer amplification, cloning of DNA fragments and sequencing.

FIG. 6A, left flank primer PCR positive reaction specificity; lanes 1-4 are sterile water, 249DNA, ZM8-143DNA, and other identical vector transformation event DNA, respectively, with only the amplified bands in lane 3 of the event maize ZM8-143 genomic DNA template;

FIG. 6B shows the amount of template DNA added in the left wing primer PCR reaction, lanes 1-6 are 0.01,0.05, 0.1, 0.5, 1.0, 5.0ng, respectively; lane 2 is clearly visible with 0.05ng template;

FIG. 7A, PCR positive reaction specificity of right flank primer; lanes 1-4 are sterile water, 249DNA, ZM8-143DNA, and other identical vector transformation event DNA, respectively, with only the amplified bands in lane 3 of the event maize ZM8-143 genomic DNA template;

FIG. 7B, right flank primer PCR reaction, lanes 1-6 are 0.05, 0.1, 0.5, 1.0, 5.0, 10.0ng, respectively; lane 2 is clearly visible with 0.1ng template.

Detailed Description

The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be understood in accordance with their ordinary usage by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards and other publications, etc., cited herein are incorporated by reference in their entirety.

As used herein, "maize" is any maize plant and includes all plant varieties that can be bred with maize, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, and plant cells intact in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like.

Transformation event ZM8-143 as referred to herein refers to the transgenic introduction of maize inbred line 249 into maize plants having foreign gene inserts (T-DNA inserts) inserted between specific genomic sequences. In a specific example, the expression vector used for the transgene has the sequence shown in SEQ ID NO. 1, and the T-DNA insert obtained after the transgene has the sequence shown in nucleotide 439 and 7180 of SEQ ID NO. 2. Transformation event ZM8-143 can refer to this transgenic process, can also refer to a T-DNA insert within the genome resulting from this process, or a combination of a T-DNA insert and flanking sequences, or can refer to a maize plant resulting from this transgenic process. In a specific example, the event is also applicable to plants obtained by transforming other recipient varieties with the same expression vector (SEQ ID NO:1) and inserting the T-DNA insert into the same genomic position. Transformation event ZM8-143 can also refer to progeny plants resulting from vegetative propagation, sexual propagation, doubling or doubling of the above plants, or a combination thereof.

In the present application, the applicants obtained a T-DNA insert flanking nucleotides 1-438 and 7181-8073 of SEQ ID NO:2 (nucleotides 439-7180 of SEQ ID NO: 2). The flanking sequences are not limited to nucleotides 1-438 and 7181-8073 of SEQ ID NO 2, since the flanking sequences are listed only to indicate the position of the T-DNA insert in the genome, i.e.the left insertion point is located on chromosome 8, 134500794 bp; the right insertion point is located on chromosome 8 at 134513477 bp. Thus the flanking sequences of the present application may be flanked by genomic sequences.

Since transformation event ZM8-143 produces a T-DNA insert that is inserted into a specific site in the genome, its insertion site is specific and can be used to detect whether a biological sample contains transformation event ZM 8-143. Thus, primer pairs, probes, and combinations of primer pairs and probes that are capable of specifically detecting the site of engagement of the T-DNA insert of a transformation event ZM8-143 with flanking sequences can be used to detect the transformation event ZM8-143 of the present application.

As used herein, "nucleotide sequence" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, nucleotide sequences are written from left to right in the 5 'to 3' direction.

In some embodiments, the nucleic acid fragments of the present application may be altered to make conservative amino acid substitutions. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made according to monocot codon preferences, e.g., codons encoding the same amino acid sequence can be substituted with monocot preferred codons without altering the amino acid sequence encoded by the nucleotide sequence.

In some embodiments, the present application also relates to variants of the nucleic acid fragments. Generally, variants of a particular nucleic acid fragment will have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more sequence identity, or the complement thereof, to the particular nucleotide sequence. Such variant sequences include additions, deletions or substitutions of one or more nucleic acid residues, which may result in the addition, removal or substitution of the corresponding amino acid residue. Sequence identity is determined by sequence alignment programs known in the art, including hybridization techniques. Nucleotide sequence variants of the embodiments may differ from the sequences of the present application by as little as 1-15 nucleotides, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2, or even 1 nucleotide.

As used herein, a "probe" is an isolated polynucleotide, complementary to a strand of a target polynucleotide, to which is attached a conventional detectable label or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent or enzyme.

As used herein, a "primer" is an isolated polynucleotide that anneals to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then stretches along the target DNA strand by means of, for example, a DNA polymerase. Primer pairs are directed to their target polynucleotide amplification use, for example, by Polymerase Chain Reaction (PCR) or other conventional nucleic acid amplification methods.

As used herein, "kit" or "microarray" refers to a set of reagents or chips for the purpose of identification and/or detection of corn transformation event ZM8-143 in a biological sample. For the purpose of quality control (e.g. purity of seed lot), detection of event ZM8-143 in or comprising plant material or material derived from plant material, such as but not limited to food or feed products, a kit or chip may be used and its components may be specifically adapted.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, steps or conditions of the present invention may be made without departing from the spirit and substance of the invention and are intended to be included within the scope of the present application. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular cloning Manual of Sambrook et al (Sambrook J & Russell DW, Molecular cloning: a laboratory Manual,2001), or following the conditions suggested by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1 acquisition and characterization of transgenic maize ZM8-143

The acquisition and identification of transgenic event ZM8-143 comprises the steps of:

(1) artificially synthesizing a DNA sequence cry1Ab/cry1AcZM of a lepidoptera-resistant corn borer gene, and constructing a transformation vector pZHZH25018 containing a pest-resistant gene and a glufosinate-resistant screening gene bar;

(2) introducing the transformation vector in the step (1) into a maize inbred line 249 through an agrobacterium-mediated genetic transformation method to obtain a transformed seedling, and cultivating the transformed seedling in a greenhouse;

(3) carrying out molecular identification on the transformed seedlings in the step (2), selecting T0 generation plants with low copy number (1-2) and containing no or less vector DNA for selfing or test cross, and harvesting seeds (T1 generation);

(4) carrying out resistance identification on the transformed seedlings selected in the step (3) by using a local leaf smearing method, and verifying the herbicide tolerance level;

(5) identifying the maize borer resistant in-vitro leaves of the transformed seedling in the step (4) by using partial leaves, and evaluating resistance performance and agronomic performance;

(6) germinating the seeds of the T1 generation in the step (3), spraying herbicide after 20 days of emergence to select resistant plants for sampling for PCR analysis, obtaining a homozygous single-copy inserted transgenic corn strain, and selfing to obtain seeds (T2 generation);

(7) germinating the T2 generation seeds in the step (6), identifying herbicide-tolerant glufosinate ammonium again in the seedling stage, systematically identifying in-vitro leaves, in-vitro filaments and in-vivo bodies of greenhouse and evaluating agronomic characters;

(8) extracting genomic DNA of leaves of T2 seedlings selected in the step (7) to perform southern hybridization analysis on copy number of inserted genes;

(9) and (3) analyzing the flanking sequences of the inserted gene by using the DNA of the leaves of the T2 generation seedling selected in the step (8), obtaining the data of the flanking sequences of the left boundary and the right boundary of the inserted gene, designing a synthetic primer, amplifying the inserted sequence and the flanking boundary sequence, and determining the chromosome position where the transformation event occurs.

The steps will be described in detail below.

1-1. design and Synthesis of insect-resistant Gene

The gene of the application is based on the 608 amino acid sequences at the end of Cry1Ab and Cry1AcN which are fused and modified, and the coding sequence is replaced by plant-preferred codons. Eliminating AT-rich sequences which cause unstable plant transcription and common restriction enzyme cutting sites in DNA sequences, and then correcting and eliminating the AT-rich sequences by a method of replacing codons; adding a termination codon TAA at the 3' end to obtain a modified DNA sequence; the Bt gene is determined and chemically synthesized and modified as shown in the sequence SEQID NO. 1. The protein encoded by the modified DNA sequence contains 3 functional segments, wherein two functional regions at the N end are highly homologous to corresponding parts of Cry1Ab, and a functional region at the C end is highly homologous to Cry1Ac, so that the gene is named Cry1Ab/Cry1 AcZM. This sequence was subjected to homology alignment with the sequence of Guo Sandou et al (CN1037913C, 1996) and Cry1Ab of Mon810, the Mensanto transgenic maize event (results are shown in Table 1), and the GC content was calculated (results are shown in Table 2).

TABLE 1 comparison of DNA sequence homology of Bt genes

Sequence name	Homology to cry1Ab/cry1AcZM
		CN1037913C	74.9％
Mon810	71.4％

TABLE 2% GC content of cry1Ab/cry1AcZM and kindred sequences

Sequence name	GC proportion%
		cry1Ab/cry1AcZM	58
CN1037913C	48
		Mon810	61

1-2 vector construction

According to the requirement of expressing gene function in plants, the expression optimization design is further carried out on the upstream and downstream of the coding region of the cry1Ab/cry1AcZM gene so as to improve the strength of the gene on the transcription level and the protein translation efficiency, and the expression optimization design comprises that a 67-nucleotide omega sequence and a 3-nucleotide (acc) Kozak sequence are added at the 5 'end to enhance the translation efficiency of eukaryotic genes, and a 3' end eukaryotic mRNA poly (A) tail sequence is added to enhance the transport from nucleus to cytoplasm and the stability and translation efficiency of mRNA.

The 5 'end of the synthesized cry1Ab/cry1AcZM was added with HindIII and PstI cleavage sites and the 3' end was added with PmeI cleavage sites, and the synthesized sequence was cloned into Puc57simple vector, named pZZ01194 (FIG. 1A).

Construction of pZHZHZH 25018:

ubi promoter fragment obtained by treating vector pzz00002 containing Ubi promoter with restriction endonuclease HindIII + BamHI, and treating with T₄The ends are filled in by DNA polymerase. pZZ01194 treatment with restriction enzyme PstI with T₄The ends were filled with DNA polymerase and the Ubi promoter was ligated by blunt end ligation to obtain a vector containing the Ubi-cry1Ab/cry1AcZM fragment designated pZZ 01201.

A vector containing a Tocs terminator (EcoRI cleavage site at 5 'end, PmeI at 3' end, EcoRI site) was named pZZ01131, and the Tocs terminator sequence was obtained by EcoRI single cleavage of pZZ 01131.

EcoRI treatment pZZ01131 to obtain the fragments of the Tocs terminator, followed by T₄DNA polymerase fills in the resulting sticky ends.

The vector containing the Ubi-cry1Ab/cry1AcZM-Tocs fragment was obtained by PmeI treatment pZZ01201 and joining the Tocs terminator by blunt end ligation, and was named pZZ01206 (see FIG. 1B).

Using vector pCambia3300 (with 35s-BAR-T35spolyA element) as backbone, the Ubi-EGFP-T35spolyA element was added by HindIII + PmeI double digestion to obtain vector pZZ00015 (FIG. 1C).

The pZZ01206 vector was treated with HindIII + PmeI to obtain Ubi-cry1Ab/cry1AcZM-Tocs fragment.

pZZ00015 vector was treated with HindIII + PmeI, and Ubi-Cry1Ab/Cry1AcZM-Tocs was ligated into the incision to obtain an expression vector containing two expression elements of Ubi-Cry1Ab/Cry1AcZM-Tocs and 35s-BAR-T35spolyA, which was designated pZHZHZH 25018 (FIG. 1D) and has the sequence shown in SEQ ID NO: 1.

1-3 genetic transformation of maize

Transforming plasmid DNA of a vector pZHZH25018 into agrobacterium EHA105 by an electric shock method, identifying and reserving for later use, selfing a corn selfing line 249, taking young embryos with the length of about 1.5mm for transformation, collecting young embryos of about 200 clusters into a batch, putting the batch into an EP tube, sucking a suspension, adding an agrobacterium liquid containing 200 mu M acetosyringone, carrying out co-culture for 5 minutes, transferring the young embryos onto a co-culture medium, carrying out dark culture for three days, putting the young embryos after dark culture on a selfing induction culture medium, putting the young embryos on a screening culture medium containing 5 mg/L bialaphos after callus grows out, carrying out screening culture, carrying out subculture once every two weeks, selecting good embryogenic callus in a good state when resistant callus grows out, transferring the embryonic callus to a differentiation culture medium, carrying out culture conditions of 26 ℃, carrying out L ux light intensity every day, irradiating for 16 hours, carrying out regeneration after two weeks, transferring regenerated plantlets into a rooting culture medium, obtaining a second-generation seedling after the growth, carrying out a vermiculite-grade plant culture pot, carrying out PCR (T2) extraction, carrying out a T2-strain hybridization test on a T2 plant, and transplanting a plant to obtain a transgenic plant.

1-4. analysis and characterization of T0 and progeny

And sowing seeds of the T1 generation in a greenhouse to obtain plants of the T1 generation. And carrying out insect resistance identification, herbicide tolerance analysis and agronomic trait analysis on the seeds, and carrying out selfing and pollination to obtain T2 generation seeds. And sowing seeds of the T2 generation in a greenhouse to obtain plants of the T2 generation. And carrying out insect resistance identification, herbicide tolerance analysis, agronomic trait analysis and molecular characteristic analysis on the hybrid seeds, and obtaining T3 generation seeds after selfing and pollination. And sowing seeds of the T3 generation in a greenhouse to obtain plants of the T3 generation. And carrying out insect resistance identification, herbicide tolerance analysis, agronomic trait analysis and molecular characteristic analysis on the hybrid seeds, and obtaining T4 generation seeds after selfing and pollination.

The transformation events are upgraded from T1 to T3 according to the excellent insect-resistant and herbicide-resistant characteristics and the agronomic characters of the transformation events, and then the transformation events enter an intermediate test.

(A) Herbicide tolerance character identification

Herbicide tolerance identification: seeds obtained by selfing or test crossing the T0 positive plants are sown in a greenhouse, herbicide resistance identification is carried out on the T1 plants at the 6-8 leaf stage, and plants without resistance genes are removed. Since the cry1Ab/cry1AcZM gene is within the T-DNA left and right border sequence with the glufosinate-resistant gene, it is transformed into recipient maize at the same time. Under the condition of T0 generation and T1 generation selfing, the separation proportion of herbicide resistance of T2 generation strain plant group is one of the bases for judging gene homozygosity.

The herbicide for spraying is produced by Bayer crop science (China) and has the effective component of glufosinate-ammonium soluble agent with concentration of 18%. Determination of glufosinate tolerance identification concentration: the recommended dosage of the herbicide is 150-300 ml/mu (30-40 kg of water is added), namely, the herbicide is diluted by 267 times, so that the 100-time diluted preservative solution is adopted to coat inverted two leaves (the leaf tips are cut off to serve as investigation marks) in the heart-leaf period (6-8 fully-unfolded leaves) of the corn with the transformation event. Herbicide tolerance performance was observed and recorded after 4-5 days (figure 2). The result shows that a batch of T0 generation corns with leaves highly resistant to glufosinate and descendants thereof are obtained in the experiment.

(B) Transgenic corn plant anti-borer bioassay

The stem borer resistance of T1, T2 and T3 plants is tested in the field by adopting a heart-leaf stage living body inoculation method and utilizing Asian corn borer (Ostrinia furnacalis).

Inoculating 10-20 insects in each corn plant when the corn plant grows to the middle heart-leaf stage (7 leaf stage). Approximately 60 eggs from the black head stage were placed in a centrifuge tube and the tube mouth was closed with a cotton wool plug. Placing the centrifuge tube into an incubator with 28 deg.C and 80% humidity, or placing at room temperature, covering with a wet towel, incubating, removing absorbent cotton, and placing into the cardiac plexus. Investigating the damage degree of the heart and leaves of the plants one by one after 2-3 weeks of insect inoculation, and dividing damage grades according to the size and the number of insect holes on damaged leaves, wherein the damage grades are called leaf eating grades. Currently, the 9-grade grading standard established by the international corn borer cooperative group is mostly adopted internationally (table 3). Leaf feeding grade was investigated on a plant-by-plant basis, the average value of each plant was taken as the leaf feeding grade of the line for identification, the wormholes were investigated before harvest, and the borer resistance grade was determined according to the evaluation criteria of table 3.

TABLE 3 evaluation criteria for corn borer resistance field identification

Note: the sum of the number of stem-boring tunnels with a diameter of more than 2.5cm and the number of visible holes on the stem was counted per plant.

HR: high resistance; r: resisting; MR: resisting; s: feeling; HS: feeling of height

The mean leaf feeding grade of the selected transformation events in the application to Asian corn borer leaves reaches 1.1-1.8, and the transformation events are high-resistance grades, and are shown in a figure 3A, a figure 3B and a table 4.

TABLE 4 determination of the leaf feeding level of the transformed borer in different generations

Conversion event number	Generation of generation	Average leaf eating grade	Standard deviation of
				ZM8-143	T1	1.8*	0.4
ZM8-143	T2	1.6*	0.7
				ZM8-143	T3	1.1*	0.2
Cry1Ab-11	Positive control	1.2*	0.15
				Xiang 249	Negative control	6.1	1.1

Remarking: 1. investigating the number n of strains as 10; "+" indicates significant difference compared to negative control.

2. The present event transformant system number (T3: M1433T 300128; T2: M1423T 200143; T0: M00929B004 a).

1-5 DNA molecular characterization of transgenic events

(A) PCR detection

The T0 generation transgenic corn genome DNA was extracted using DNA extraction kit from Tiangen Biochemical technology.

The following reagents were thawed from a-20 ℃ freezer: 10-fold PCR buffer (Takara), deoxynucleotide mix (10mM, Sigma), wherein the forward primer SEQ ID NO:12(CSP 759): 5'-CACGCAGATTCCAGCGGTCAA-3', respectively; reverse primer SEQ ID NO:13(CSP 760): 5'-GACGAGGTGAAGGCGTTAGCA-3') and maize leaf DNA templates. After thawing all reagents, centrifuge briefly for several seconds and place on ice until ready for use. And preparing mixed solution of a PCR reaction system, uniformly mixing, and centrifuging for a few seconds in short. PCR reaction (20. mu.l): mu.l 10-fold PCR buffer (Takara), 0.5. mu.l deoxynucleotide mix (10mM, Sigma), 0.8. mu.l Forward and reverse primer mix (5. mu.M), 0.2. mu. l r-Taq (5U, Takara), 1. mu.l maize leaf DNA template, and the remainder dd H₂And O. The mixture was dispensed into 200. mu.l PCR tubes, and 1. mu.l template DNA was added and labeled separately for each sample. And (3) putting the PCR reaction tube into a Thermo 9700 type PCR amplification instrument, selecting a preset PCR amplification program, and starting to operate the reaction. The PCR reaction program is: pre-denaturation at 94 ℃ for 2 min; 30 cycles: denaturation at 94 ℃ for 30 seconds, annealing at 58 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds; final extension at 72 ℃ for 5 min.

After the PCR was completed, 5. mu.l of the PCR product was subjected to agarose gel electrophoresis. A1.5% agarose gel was prepared, stained in Ethidium Bromide (EB) for 10 minutes after electrophoresis at 150V for 25 minutes, and photographed in an ultraviolet gel imaging system. The cry1Ab/cry1AcZM gene is specific to a transformation vector, so that a transgenic plant which can amplify a specific strip of the gene is a positive plant, and otherwise, the transgenic plant is a negative material.

(B) Southern blot identification

Probes for cry1Ab/cry1AcZM were synthesized using the PCR digoxin probe synthesis kit (cat # 11636090910) from Roche using primers SEQ ID NO 12(CSP 759): CACGCAGATTCCAGCGGTCAA and SEQ ID NO 13(CSP 760): GACGAGGTGAAGGCGTTAGCA as primers, with a probe size of 333bp (SEQ ID NO: 11). the amplification system comprised a DNA template of 5. mu. L (50pg), a CSP759 primer of 0.5. mu. L760, a primer of 0.5. mu. L DIG mix of 5. mu. L polymerase 0.75. mu. L buffer (10 fold) of 5. mu. L, ddH 5. mu. Ab, and ddH 25018 plasmid DNA as a template₂O33.25 mu L PCR reaction program, including pre-denaturation at 94 ℃ for 5min, 35 cycles of denaturation at 94 ℃ for 30sec, annealing at 55 ℃ for 30sec, extension at 72 ℃ for 45 sec, and extension at 72 ℃ for 7min, after PCR amplification, the product is stored at 12 ℃ and the labeling effect is detected by 1% gel, and the amplified product is the probe with the sequence listed above.

Extracting total DNA of leaf genome of transgenic corn T1, T2 or T3 generation material, drying the obtained DNA precipitate, dissolving in deionized water, and measuring the concentration for later use.

The sample was digested and the digested fragments were recovered, and 200. mu. L containing 20. mu.g of corn genomic DNA, 20. mu.l of restriction enzyme (HindIII or NcoI), 20. mu.l of 10-fold buffer solution, and ddH₂The volume of O is filled up to 200. mu.l. After enzyme digestion for 16h, 20 mul of the mixture is taken for electrophoresis detection, and whether the enzyme digestion effect is thorough or not is detected. Enzyme digestion product plus ddH₂Make up to 400. mu.l of O, add 1/10 volumes of 3M sodium acetate solution (pH5.2), add 4. mu.l of Dr.GenT L E Precipitation Carrier, add 2.5 volumes of absolute ethanol, mix well, centrifuge at 12,000rpm for 15 minutes at 4 ℃ and apply 50. mu.l of ddH to the precipitate₂O dissolved, and 5. mu.l of 6-fold loading buffer was added.

The DNA was run through a 0.8% gel at 20V for 16 h. Excess lanes and wells were cut off and the remaining gel was treated with denaturing solution 2 times for 15 min each time and gently shaken on a shaker. The cells were then treated with the neutralization buffer 2 times for 15 minutes each, and gently shaken on a shaker. And cleaning once by using ultrapure water. 20 times SSC treatment for 10 minutes and biofilm transfer for 4 hours or more using the whatman system.

After the transfer of the membrane was complete, the membrane was placed on Whatman 3MM filter paper soaked with 10 times SSC and cross-linked for 3-5 minutes using a UV cross-linker. By ddH₂And O, simply washing the membrane and drying in the air. The hybridization and development were carried out according to the manual of Roche digoxin assay kit I (cat # 11745832910) or Roche digoxin assay kit II (cat # 11585614910).

This experiment detects the copy number of the exogenous gene integrated into the maize genome and the similarities and differences of the transformation events. The genomic DNA was cleaved by HindIII and NcoI endonucleases, respectively, to obtain the result of integration into the maize genomic copy number (see FIG. 4A). FIG. 4A shows the results of hybridization of the genomic DNA of maize of the T2 generation strain of this transformation event with cry1Ab/cry1AcZM specific probe molecules digested with HindIII and NcoI, respectively, with a probe length of 333 bp. Lanes 1 and 5 are the negative control 249; lane 9 is a positive control; 2. 3 and 4 are the hybridization result of enzyme cutting DNA with HindIII; 6. lanes 7 and 8 show the results of hybridization with NcoI-digested DNA; m is the molecular weight marker lane, indicated by the base number (kb). A positive band, 8.8kb (HindIII) and 10.3kb (NcoI), is shown under each of the two digestion conditions, indicating that the foreign gene is inserted in a single copy, which is a single copy transformation event.

Southern hybridization analysis of the bar gene, the gene of interest, was performed in the same manner as described above. A specific probe (SEQ ID NO:18) for the bar gene was prepared using a primer pair (SEQ ID NO:16(FW-CSP74), SEQ ID NO:17(RV-CSP73)), and its length was 408 bp. FIG. 4B shows the results of the identification of copy number by hybridization of the HindIII and NcoI cleavage of the genomic DNA of strain maize of the present transformation event T2 generation with the bar gene, respectively; lanes 1 and 5 are the negative control 249 DNA; lane 9 is a positive control; lanes 2, 3 and 4 show the results of hybridization of the transforming event maize DNA digested with HindIII; lanes 6, 7 and 8 show the hybridization results of the transformation event, corn DNA, digested with NcoI; lane 7, M: a molecular weight standard; the 408bp probe comes from a partial sequence of a carrier bar gene; positive bands were 6.3kb (HindIII) and 7.8kb (NcoI), respectively. According to the vector sequence, the band obtained by HindIII enzyme digestion hybridization is larger than 1.9kb, the actually obtained band is about 6.3kb, and the expected band size is met; the band obtained by the NcoI cleavage hybridization should be larger than 3.0kb, and the size of the band actually obtained is about 7.8kb, as expected (FIG. 4B). Indicating that the transformation event contained a single-site single copy of the bar gene insertion.

(C) Size and Structure of the insertion sequence

The vector size of the exogenous gene single copy insertion sequence including the left and right border sequences is 6812 bp. The practical size of the transformation event insertion sequence is determined to be 6742bp, the left end of the T-DNA lacks 16bp, and the right end lacks 54bp by a segmented PCR amplification exogenous DNA sequencing method. The 70bp nucleotide is located in the border sequence of the non-coding region. Its deletion did not affect the integrity of the insect-resistant gene cry1Ab/cry1AcZM and the bar gene as a selection marker. The segmented clone is inserted into DNA, and sequence analysis and comparison show that the 6742bp nucleotide sequence is completely consistent with a theoretical sequence.

Example 2 DNA molecular detection of maize transformation events

2-1 left flank sequence analysis

And (3) extracting total DNA (strong transgenic plants grown in T2 generation or T3 generation) from plant leaves of the transformation event to be detected, and amplifying, cloning and sequencing the flanking sequence of the exogenous gene inserted into the corn genome by using a tail-PCR method to obtain a sequence result.

(1) The Tail-PCR primer sequences are shown in Table 5.

TABLE 5 primer sequences

(2) Preparing high-quality corn genome DNA, and diluting for later use;

(3) and (3) taking the genomic DNA in the step (2) as a template for the first round of PCR reaction, wherein the reaction system is shown in the following table. The reaction procedure is as follows: 94 ℃ for 5 min; 5 cycles: 94 deg.C for 30sec, 62 deg.C for 2min, and 72 deg.C for 2.5 min; 94 ℃, 30 sec; at 25 ℃ for 3 min; 72 deg.C (32% ramp), 3 min; 15 cycles: 94 ℃, 30 sec; at 62 ℃ for 1 min; 72 ℃ for 2.5 min; 94 ℃, 30 sec; at 62 ℃ for 1 min; 72 ℃ for 2.5 min; 94 ℃, 30 sec; at 45 ℃ for 1 min; 72 ℃ for 2.5 min; 72 ℃ for 7 min; 20 ℃ for 10 min.

TABLE 6 first round PCR reaction System

Components	Volume μ L
		10×PCR Buffer	2
dNTP(10mmol/L)	0.3
		Bar-86(10μM)	0.2
AP3(10μM)	1.2
		rTaq(5U/μl)	0.12
Genomic DNA	1
		ddH2O	To a final volume of 20 μ L

(4) And (3) carrying out second round PCR amplification by using the first round PCR product (mixed liquor mother liquor) as a template.

TABLE 7 second round PCR reaction System

Components	Volume μ L
		10×PCR Buffer	2
dNTP(10mmol/L)	0.3
		Bar-22(10μM)	0.2
AP3(10μM)	1.2
		rTaq(5U/μl)	0.12
PCR product (mother liquor) on the upper round	1
		ddH2O	To a final volume of 20 μ L

The reaction program is that × 20 cycles at 94 ℃, 5min, (94 ℃, 30sec, 65 ℃, 1min, 72 ℃, 2.5min, 94 ℃, 30sec, 45 ℃, 1min, 72 ℃, 2.5min), 72 ℃, 7min and 20 ℃, 10 min.

(5) And performing third round PCR amplification by using the second round PCR product (diluted by 10 times in the mixed solution) as a template.

TABLE 8 third round PCR reaction System

Components	Volume μ L
		10×PCR Buffer	2
dNTP(10mmol/L)	0.3
		35003Left-254-anti(10μM)	0.2
AP3(10μM)	1.2
		rTaq(5U/μl)	0.12
PCR product on round (10 times dilution)	1
		ddH2O	To a final volume of 20 μ L

The reaction program is that × 20 cycles at 94 ℃, 5min, (94 ℃, 30sec, 65 ℃, 1min, 72 ℃, 2.5min, 94 ℃, 30sec, 45 ℃, 1min, 72 ℃, 2.5min), 72 ℃, 7min and 20 ℃, 10 min.

(6) Taking the product of the third round of PCR to carry out electrophoresis detection in 1% (w/v)1 × TAE agarose gel, and recovering a DNA fragment between 300bp and 2 kb;

(7) the recovered fragments were ligated to T-vector and ligated overnight at 16 ℃;

(8) converting the ligation product of (7);

(9) amplifying the transformation product in the step (8) by using M13F and M13R primers, selecting a positive clone shake culture liquid, and extracting Plasmid DNA by using a TIAnprep Rapid Mini Plasmid Kit (centrifugal column type);

(10) sequencing the plasmid DNA of (9) with a sequencing primer using

Plasmid DNA was sequenced by PCR using the terminator 3.1cycle Sequencing Kit. Sequencing primers are M13F and M13R primers; M13-F: 5'-TGTAAAACGACGGCCAGT-3', M13-R: 5'-CAGGAAACAGCTATGACC-3', respectively;

(11) purification of PCR products from formamide denaturation by NaAc and absolute ethanol (10)

(12) And (3) starting sequencing the purified and denatured PCR product in the step (11) by using an ABI DNA sequencer 3730 and reading out a sequencing result.

(13) Sequencing results a homology search was performed with maize genomic sequences in the plantagdb database using the B L ASTN tool, with the best match results being the chromosome number and base pair position number of the insertion site, typically with a sequence identity of 90-100%.

The experiment detects that the left flank sequence of the inserted T-DNA is 438bp, which is shown as nucleotide 1-438 of sequence SEQ ID NO. 2. Using the maize B73 whole genome sequence as a reference (http:// www.plantgdb.org/ZmGDB/cgi-bin/blastGDB. pl), analysis and comparison confirmed that the insertion point was located on chromosome 8, 134500794bp, on the left of the transformation event in the present application, see FIG. 5.

2-2 Right flank sequence analysis

And (3) extracting total DNA (strong transgenic plants grown in T2 generation or T3 generation) from plant leaves of the transformation event to be detected, and amplifying, cloning and sequencing the flanking sequence of the exogenous gene inserted into the corn genome by using a tail-PCR method to obtain a sequence result.

(1) The Tail-PCR primer sequences are shown in Table 9.

TABLE 9 primer sequences

(2) Preparing high-quality corn genome DNA for later use, and diluting the high-quality corn genome DNA for later use;

(3) and (3) taking the genomic DNA in the step (2) as a template for the first round of PCR reaction, wherein the reaction system is shown in the following table. The reaction procedure is as follows: 94 ℃ for 5 min; 5 cycles: 94 deg.C for 30sec, 62 deg.C for 2min, and 72 deg.C for 2.5 min; 94 ℃, 30 sec; at 25 ℃ for 3 min; 72 deg.C (32% ramp), 3 min; 15 cycles: 94 ℃, 30 sec; at 62 ℃ for 1 min; 72 ℃ for 2.5 min; 94 ℃, 30 sec; at 62 ℃ for 1 min; 72 ℃ for 2.5 min; 94 ℃, 30 sec; at 45 ℃ for 1 min; 72 ℃ for 2.5 min; 72 ℃ for 7 min; 20 ℃ for 10 min.

TABLE 10 first round PCR reaction System

Components	Volume μ L
		10×PCR Buffer	2
dNTP(10mmol/L)	0.3
		Cry1ab right-37sense(10μM)	0.2
AP1(10μM)	1.2
		rTaq(5U/μl)	0.12
Genomic DNA	1
		ddH2O	To a final volume of 20 μ L

(4) And (3) carrying out second round PCR amplification by using the first round PCR product (mixed liquor mother liquor) as a template.

TABLE 11 second round PCR reaction System

Components	Volume μ L
		10×PCR Buffer	2
dNTP(10mmol/L)	0.3
		RTB1-392(10μM)	0.2
AP1(10μM)	1.2
		rTaq(5U/μl)	0.12
PCR product (mother liquor) on the upper round	1
		ddH2O	To a final volume of 20 μ L

The reaction sequence is that × 20 cycles of 94 ℃, 5min, (94 ℃, 30sec, 65 ℃, 1min, 72 ℃, 2.5min, 94 ℃, 30sec, 45 ℃, 1min, 72 ℃, 2.5min, 72 ℃, 7min and 20 ℃, 10 min.

(5) And performing third round PCR amplification by using the second round PCR product (diluted by 10 times in the mixed solution) as a template.

TABLE 12 third round PCR reaction System

Components	Volume μ L
		10×PCR Buffer	2
dNTP(10mmol/L)	0.3
		RTB2-169(10μM)	0.2
AP1(10μM)	1.2
		rTaq(5U/μl)	0.12
PCR product on round (10 times dilution)	1
		ddH2O	To a final volume of 20 μ L

The reaction program is that × 20 cycles at 94 ℃, 5min, (94 ℃, 30sec, 65 ℃, 1min, 72 ℃, 2.5min, 94 ℃, 30sec, 45 ℃, 1min, 72 ℃, 2.5min), 72 ℃, 7min and 20 ℃, 10 min.

(6) Taking the product of the third round of PCR to carry out electrophoresis detection in 1% (w/v)1 × TAE agarose gel, and recovering a DNA fragment between 300bp and 2 kb;

(7) the recovered fragments were ligated to T-vector and ligated overnight at 16 ℃;

(8) converting the ligation product of (7);

(9) amplifying the transformation product in the step (8) by using M13F and M13R primers, selecting a positive clone shake culture liquid, and extracting Plasmid DNA by using a TIAnprep Rapid Mini Plasmid Kit (centrifugal column type);

(10) sequencing the plasmid DNA of (9) with a sequencing primer using

Plasmid DNA was sequenced by PCR using the terminator 3.1cycle Sequencing Kit. Sequencing primers are M13F and M13R primers; M13-F: 5'-TGTAAAACGACGGCCAGT-3', M13-R: 5'-CAGGAAACAGCTATGACC-3', respectively;

(11) purification of PCR products from formamide denaturation by NaAc and absolute ethanol (10)

(12) And (3) starting sequencing the purified and denatured PCR product in the step (11) by using an ABI DNA sequencer 3730 and reading out a sequencing result.

(13) Sequencing results a homology search was performed with maize genomic sequences in the plantagdb database using the B L ASTN tool, with the best match results being the chromosome number and base pair position number of the insertion site, typically with a sequence identity of 90-100%.

The 893bp right flank sequence of the inserted T-DNA is detected by the experiment and is shown in the nucleotide 7181-8073 of the sequence SEQ ID NO. 2.

The right insertion point of the transformation event of the present application was determined to be located on chromosome 8, 134513477bp, by analysis and comparison with the whole genome sequence of maize B73 as reference, see FIG. 5.

Sequence analysis shows that after the exogenous T-DNA is inserted into the receptor genome, 16bp and 54bp deletions occur at the left and right boundaries of the exogenous T-DNA respectively, i.e., the T-DNA insert (nucleotide 439-7180) in SEQ ID NO. 2 lacks 16bp and 54bp at the left and right ends of the T-DNA insert compared with SEQ ID NO. 1. Further analysis showed that deletion of this DNA fragment did not affect the integrity of the insect-resistant gene cry1Ab/cry1AcZM and the bar selection marker gene.

Furthermore, deletion of the maize genome at the insertion site (i.e., Chr8: 134500794-Chr 8:134513477) did not disrupt any known maize endogenous functional genes.

Example 3 detection of flanking DNA sequences in transgenic maize ZM8-143

3-1 left flank DNA sequence detection, a pair of primers (FW-csp2211 and RV-csp2344) are designed by utilizing the left flank genome sequence of a corn transformation event and the sequence of a 35S polyA terminator in an exogenous fragment, and a qualitative PCR identification method of a transformation event product is established, wherein the primers designed according to the 5' end of a ZM8-143 transformation event exogenous DNA fragment integration site L BT-DNA are as follows:

SEQ ID NO:3(FW-csp2211):5’-CTGTCACACGGATTCTGTAT-3’，

SEQ ID NO:14(RV-csp2344):5’-TATAGGGTTTCGCTCATGTG-3’；

the specific primer utilizes temperature gradient PCR amplification DNA fragment to determine the optimal annealing temperature under the condition of 55-65 ℃, the result proves that the optimal amplification temperature is 61 ℃, the PCR reaction program is 95 ℃ for 5min, (94 ℃ for 30s, 55-65 ℃ for 30s, 72 ℃ for 1min) × 35 cycles, and the temperature is 72 ℃ for 7 min.

To test the specificity of the above primers (FW-csp 2211; RV-csp2344) for amplification of the transformation event, maize DNA from various sources was used for PCR amplification. The PCR reaction conditions and procedure were 95 ℃ for 5min, 35 cycles: 30s at 94 ℃, 30s at 61 ℃ and 1min at 72 ℃; 7min at 72 ℃. The results indicated that only the present transformation event DNA gave a positive result, and that all other transformation events or negative control maize varieties gave negative results (see FIG. 6A). The size of the DNA fragment is 648bp, and the result obtained by cloning and sequencing the DNA fragment is consistent with the expectation.

In order to test the minimum dosage of the total DNA of the corn of the transformation event, the specific primers amplify target fragments by using different template DNA sample loading quantities at the optimal amplification temperature of 61 ℃. The PCR reaction condition and procedure are 95 ℃ for 5 min; 35 cycles: 30s at 94 ℃, 30s at 61 ℃ and 1min at 72 ℃; 7min at 72 ℃. The results indicated that the minimum amount of maize genomic template DNA was 0.05ng (see FIG. 6B). The amplified DNA fragment size is consistent with the expectation, and the result obtained by DNA fragment clone sequencing is also consistent with the expectation.

The T-DNA left flank corn genome sequence and the vector sequence of the exogenous DNA fragment integration site of the transformation event can also be amplified by using primers SEQ ID NO:3(FW-csp2211) and SEQ ID NO:4(RV-csp 2526). The PCR reaction condition and procedure are 95 ℃ for 5 min; 35 cycles: 30s at 95 ℃, 30s at 58 ℃ and 3min at 72 ℃; 7min at 72 ℃. The amplified DNA fragment size 2426bp is consistent with the expectation, and the result obtained by cloning and sequencing the DNA fragment is also consistent with the expectation. Can be used to confirm the present transformation event.

3-2 right flank DNA sequence detection: a pair of primers (SEQ ID NO:15 and SEQ ID NO:10) was designed using the sequence of the T-ocs terminator and the right flanking genomic sequence in the exogenous fragment of the maize transformation event to establish a qualitative PCR identification method for the transformation event. Primers designed according to the integration site RBT-DNA 5' end of the exogenous DNA fragment of the ZM8-143 transformation event are as follows:

SEQ ID NO:15(FW-csp2648):5’-CCGAGAATTATGCAGCATTT-3’，

SEQ ID NO:10(RV-csp2649):5’-TTTGGGATGCTTATGTTTGC-3’；

the optimal annealing temperature is determined by amplifying DNA fragments of the specific primers at the temperature of 55-65 ℃ by using temperature gradient PCR. Results confirmed that the optimal amplification temperature was 55 ℃ (see figure); the PCR reaction program is 95 ℃ for 5 min; 35 cycles: 30s at 94 ℃, 30s at 55-65 ℃ and 1min at 72 ℃; 7min at 72 ℃.

To test the specificity of the above primers (FW-csp 2648; RV-csp2649) for amplification of the transformation event, different sources of maize DNA were used for PCR amplification. The PCR reaction conditions and procedures were 95 ℃ for 5 min; 35 cycles: 30s at 94 ℃, 30s at 55 ℃ and 1min at 72 ℃; 7min at 72 ℃. The results indicated that only the present transformation event DNA gave a positive result, and that all other transformation events or negative control maize varieties gave negative results (see FIG. 7A). The size of the DNA fragment 1043bp is consistent with the expectation, and the result obtained by cloning and sequencing the DNA fragment is also consistent with the expectation.

In order to test the minimum use amount of the total DNA of the corn of the transformation event, the specific primer is subjected to PCR reaction for 5min at the optimal amplification temperature of 55 ℃ and the PCR reaction condition and program are 95 ℃; 35 cycles: 30s at 94 ℃, 30s at 55 ℃ and 1min at 72 ℃; 7min at 72 ℃. The lowest dose of maize genomic template DNA from which the desired fragment was amplified was 0.1ng (see FIG. 7B). The amplified DNA fragment size is consistent with the expectation, and the result obtained by DNA fragment clone sequencing is also consistent with the expectation.

The T-DNA right flank corn genome sequence and the vector sequence of the exogenous DNA fragment integration site of the transformation event can also be amplified by using primers SEQ ID NO. 9(FW-csp2423) and SEQ ID NO. 10(RV-csp 2649). The PCR reaction condition and procedure are 95 ℃ for 5 min; 35 cycles: 30s at 95 ℃, 30s at 55 ℃ and 3min at 72 ℃; 7min at 72 ℃. The amplified DNA fragment size of 1225bp is consistent with the expectation, and the result obtained by DNA fragment clone sequencing is also consistent with the expectation. Can be used to confirm the present transformation event.

The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the technical principle of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Sequence listing

<110> China seed group Co., Ltd

<120> creation, detection and application of maize transformation event ZM8-143

<130>15C11924CN

<160>18

<170>PatentIn version 3.5

<210>1

<211>6812

<212>DNA

<213> pZHZHZH 25018 vector sequence

<400>1

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 120

ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 180

atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 240

cttatctggg aactactcac acattattat ggagaaactc gagtcaaatc tcggtgacgg 300

gcaggaccgg acggggcggt accggcaggc tgaagtccag ctgccagaaa cccacgtcat 360

gccagttccc gtgcttgaag ccggccgccc gcagcatgcc gcggggggca tatccgagcg 420

cctcgtgcat gcgcacgctc gggtcgttgg gcagcccgat gacagcgacc acgctcttga 480

agccctgtgc ctccagggac ttcagcaggt gggtgtagag cgtggagccc agtcccgtcc 540

gctggtggcg gggggagacg tacacggtcg actcggccgt ccagtcgtag gcgttgcgtg 600

ccttccaggg gcccgcgtag gcgatgccgg cgacctcgcc gtccacctcg gcgacgagcc 660

agggatagcg ctcccgcaga cggacgaggt cgtccgtcca ctcctgcggt tcctgcggct 720

cggtacggaa gttgaccgtg cttgtctcga tgtagtggtt gacgatggtg cagaccgccg 780

gcatgtccgc ctcggtggca cggcggatgt cggccgggcg tcgttctggg ctcatggtag 840

actcgagaga gatagatttg tagagagaga ctggtgattt cagcgtgtcc tctccaaatg 900

aaatgaactt ccttatatag aggaagggtc ttgcgaagga tagtgggatt gtgcgtcatc 960

ccttacgtca gtggagatat cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc 1020

ttctttttcc acgatgctcc tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga 1080

ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtagg tgccaccttc 1140

cttttctact gtccttttga tgaagtgaca gatagctggg caatggaatc cgaggaggtt 1200

tcccgatatt accctttgtt gaaaagtctc aatagccctt tggtcttctg agactgtatc 1260

tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttcacat caatccactt 1320

gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg ggtgggggtc 1380

catctttggg accactgtcg gcagaggcat cttgaacgat agcctttcct ttatcgcaat 1440

gatggcattt gtaggtgcca ccttcctttt ctactgtcct tttgatgaag tgacagatag 1500

ctgggcaatg gaatccgagg aggtttcccg atattaccct ttgttgaaaa gtctcaatag 1560

ccctttggtc ttctgagact gtatctttga tattcttgga gtagacgaga gtgtcgtgct 1620

ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg cctctccccg cgcgttggcc 1680

gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa 1740

cgcaattaat gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc 1800

ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga 1860

catgattacg aattcgagct cggtacccgg ggatcctcta gagtcgacct gcaggcatgc 1920

aagcttatcc agcttgcatg cctgcagtgc agcgtgaccc ggtcgtgccc ctctctagag 1980

ataatgagca ttgcatgtct aagttataaa aaattaccac atattttttt tgtcacactt 2040

gtttgaagtg cagtttatct atctttatac atatatttaa actttactct acgaataata 2100

taatctatag tactacaata atatcagtgt tttagagaat catataaatg aacagttaga 2160

catggtctaa aggacaattg agtattttga caacaggact ctacagtttt atctttttag 2220

tgtgcatgtg ttctcctttt tttttgcaaa tagcttcacc tatataatac ttcatccatt 2280

ttattagtac atccatttag ggtttagggt taatggtttt tatagactaa tttttttagt 2340

acatctattt tattctattt tagcctctaa attaagaaaa ctaaaactct attttagttt 2400

ttttatttaa taatttagat ataaaataga ataaaataaa gtgactaaaa attaaacaaa 2460

taccctttaa gaaattaaaa aaactaagga aacatttttc ttgtttcgag tagataatgc 2520

cagcctgtta aacgccgtcg acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg 2580

cgtcgggcca agcgaagcag acggcacggc atctctgtcg ctgcctctgg acccctctcg 2640

agagttccgc tccaccgttg gacttgctcc gctgtcggca tccagaaatt gcgtggcgga 2700

gcggcagacg tgagccggca cggcaggcgg cctcctcctc ctctcacggc accggcagct 2760

acgggggatt cctttcccac cgctccttcg ctttcccttc ctcgcccgcc gtaataaata 2820

gacaccccct ccacaccctc tttccccaac ctcgtgttgt tcggagcgca cacacacaca 2880

accagatctc ccccaaatcc acccgtcggc acctccgctt caaggtacgc cgctcgtcct 2940

cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta gggcccggta 3000

gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg tgctgctagc 3060

gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact tgccagtgtt 3120

tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg atttcatgat 3180

tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca atatatgccg 3240

tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt gatgatgtgg 3300

tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac ctggtggatt 3360

tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa ttgaagatga 3420

tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta ctgatgcata 3480

tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg cggtcgttca 3540

ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta ttaattttgg 3600

aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat ggaaatatcg 3660

atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat gatggcatat 3720

gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa acaagtatgt 3780

tttataatta ttttgatcttgatatacttg gatgatggca tatgcagcag ctatatgtgg 3840

atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc ttttgtcgat 3900

gctcaccctg ttgtttggtg ttacttctgc aggtcgactc tagaggatcg tatttttaca 3960

acaattacca acaacaacaa acaacaaaca acattacaat tactatttac aattacaacc 4020

atggattgcc ggccctacaa ctgcctgtcg aaccctgagg tggaggtcct gggcggcgag 4080

cggattgaga ctggctacac accgattgac atctcactct ccctgaccca gttcctcctg 4140

tcggagttcg tgccaggcgc tgggttcgtt ctcggcctgg tggatatcat ttggggcatc 4200

ttcgggccaa gccagtggga cgctttcctg gtccagatcg agcagctcat taatcagagg 4260

atcgaggagt tcgcgcggaa ccaggctatt agccgcctcg agggcctgtc gaacctctac 4320

cagatctacg ccgagagctt cagggagtgg gaggctgatc cgacgaaccc cgccctgagg 4380

gaggagatgc ggattcagtt caatgacatg aactccgctc tgaccacggc tatcccactc 4440

ttcgcggtgc agaattacca ggtcccactc ctgagcgtct acgtgcaggc tgcgaacctc 4500

cacctgtctg tgctgcgcga tgtttcagtg ttcggccaga cctgggggtt cgacgctgct 4560

acgattaatt ccaggtacaa cgatctgaca cggctcatcg gcaattacac tgaccatgcc 4620

gttcggtggt acaacaccgg cctcgagagg gtgtgggggc cagactccag ggattggatt 4680

aggtacaacc agttccgcag ggagctcaca ctgactgtcc tggacatcgt ttccctcttc 4740

ccaaactacg atagccggac ctaccctatt cgcacggtgt cccagctgac aagggagatc 4800

tacactaatc cagtcctcga gaacttcgac ggctctttcc gcgggtcagc tcagggcatt 4860

gaggggtcca tcaggagccc tcacctgatg gatatcctca actcaatcac catctacacg 4920

gacgctcacc gcggcgagta ctactggtcc gggcatcaga tcatggcttc cccagtcggc 4980

ttcagcgggc cagagttcac cttcccactg tacggcacga tggggaacgc tgctccacag 5040

cagaggatcg ttgctcagct cggccagggg gtgtaccgca cactgtccag cactctctac 5100

cggcgcccgt tcaacatcgg cattaacaat cagcagctga gcgtgctcga cggcacagag 5160

ttcgcctacg ggacttcgtc taacctgccc tcggcggtct acaggaagtc gggcaccgtt 5220

gactctctcg atgagatccc gccccagaac aataacgtcc cacctcgcca gggcttctcg 5280

cacaggctgt cgcatgtttc tatgttccgg tcaggcttct ccaactcatc cgtctccatc 5340

attagggccc cgatgttctc atggatccac cggtccgcgg agttcaataa catcattgct 5400

agcgattcga tcacgcagat tccagcggtc aagggcaatt tcctcttcaa cgggagcgtt 5460

atctcgggcc ctgggttcac aggcggggac ctggtgaggc tcaatagctc gggcaataac 5520

atccagaaca ggcggtacat tgaggtccca atccacttcc cttctacctc aacgcgctac 5580

agggtccggg ttcgctacgc gtccgtgaca ccaattcatc tgaatgtcaa ctggggcaat 5640

tcttcaatct tctcgaacac tgtgcctgcc acagcgactt ctctggacaa tctccagtcc 5700

agcgatttcg gctacttcga gtctgctaac gccttcacct cgtctctcgg caatatcgtg 5760

ggggtccgca acttcagcgg cacggctggc gttattattg ataggttcga gttcatccct 5820

gttactgcta ccctggaggc tgagtaagta ggtgaggaat tctttgagta ttatggcatt 5880

ggaaaagcca ttgttctgct tgtaatttac tgtgttcttt cagtttttgt tttcggacat 5940

caaaaaaaaa aaaaaaaaaa aaaaaaaatt taacaaaaaa aaaaaaaaaa aaaaaaaagt 6000

ttaattcgat tatcctcgag ccctagtgtc ctgctttaat gagatatgcg agacgcctat 6060

gatcgcatga tatttgcttt caattctgtt gtgcacgttg taaaaaacct gagcatgtgt 6120

agctcagatc cttaccgccg gtttcggttc attctaatga atatatcacc cgttactatc 6180

gtatttttat gaataatatt ctccgttcaa tttactgatt gtaccctact acttatatgt 6240

acaatattaa aatgaaaaca atatattgtg ctgaataggt ttatagcgac atctatgata 6300

gagcgccaca ataacaaaca attgcgtttt attattacaa atccaatttt aaaaaaagcg 6360

gcagaaccgg tcaaacctaa aagactgatt acataaatct tattcaaatt tcaaaagtgc 6420

cccaggggct agtatctacg acacaccgag cggcgaacta ataacgctca ctgaagggaa 6480

ctccggttcc ccgccggcgc gcatgggtga gattccttga agttgagtat tggccgtccg 6540

ctctaccgaa agttacgggc accattcaac ccggtccagc acggcggccg ggtaaccgac 6600

ttgctgcccc gagaattatg cagcattttt ttggtgtatg tgggccccaa atgaagtgca 6660

ggtcaaacct tgacagtgac gacaaatcgt tgggcgggtc cagggcgaat tttgcgacaa 6720

catgtcgagg ctcagcagga cctgcaggcg tttaaactat cagtgtttga caggatatat 6780

tggcgggtaa acctaagaga aaagagcgtt ta 6812

<210>2

<211>8073

<212>DNA

<213> ZM8-143 event sequence

<400>2

ctgtcacacg gattctgtat accatagtga attgatggtt gagagactat gcacgaggca 60

tgcaaattaa caagactcat acaagcgtcg aacagtgtgc tgatgatgat cagagacaca 120

agggcagcac atgatcagat cttaacatgt ttcgaataag cttttctcta gatctccaag 180

gaagaagatc cagtcagata tgtgtcgatg ctcatcccca acgtacataa gttatcaatg 240

gtattatatg ttcccgttgc aacgcacgag cacacaccta gtaatctcta aaaaggatta 300

aaggctagtt tgaaaactta atttttcttc gagatctttg agatcgaagc gaaaattaag 360

atattttttc actcattttg agaattacga aggaaattta agctcgtaac aggagaaaga 420

ggaggaggaa agtgggaagg tgtaaacaaa ttgacgctta gacaacttaa taacacattg 480

cggacgtttt taatgtactg aattaacgcc gaattaattc gggggatctg gattttagta 540

ctggattttg gttttaggaa ttagaaattt tattgataga agtattttac aaatacaaat 600

acatactaag ggtttcttat atgctcaaca catgagcgaa accctatagg aaccctaatt 660

cccttatctg ggaactactc acacattatt atggagaaac tcgagtcaaa tctcggtgac 720

gggcaggacc ggacggggcg gtaccggcag gctgaagtcc agctgccaga aacccacgtc 780

atgccagttc ccgtgcttga agccggccgc ccgcagcatg ccgcgggggg catatccgag 840

cgcctcgtgc atgcgcacgc tcgggtcgtt gggcagcccg atgacagcga ccacgctctt 900

gaagccctgt gcctccaggg acttcagcag gtgggtgtag agcgtggagc ccagtcccgt 960

ccgctggtgg cggggggaga cgtacacggt cgactcggcc gtccagtcgt aggcgttgcg 1020

tgccttccag gggcccgcgt aggcgatgcc ggcgacctcg ccgtccacct cggcgacgag 1080

ccagggatag cgctcccgca gacggacgag gtcgtccgtc cactcctgcg gttcctgcgg 1140

ctcggtacgg aagttgaccg tgcttgtctc gatgtagtgg ttgacgatgg tgcagaccgc 1200

cggcatgtcc gcctcggtgg cacggcggat gtcggccggg cgtcgttctg ggctcatggt 1260

agactcgaga gagatagatt tgtagagaga gactggtgat ttcagcgtgt cctctccaaa 1320

tgaaatgaac ttccttatat agaggaaggg tcttgcgaag gatagtggga ttgtgcgtca 1380

tcccttacgt cagtggagat atcacatcaa tccacttgct ttgaagacgt ggttggaacg 1440

tcttcttttt ccacgatgct cctcgtgggt gggggtccat ctttgggacc actgtcggca 1500

gaggcatctt gaacgatagc ctttccttta tcgcaatgat ggcatttgta ggtgccacct 1560

tccttttcta ctgtcctttt gatgaagtga cagatagctg ggcaatggaa tccgaggagg 1620

tttcccgata ttaccctttg ttgaaaagtc tcaatagccc tttggtcttc tgagactgta 1680

tctttgatat tcttggagta gacgagagtg tcgtgctcca ccatgttcac atcaatccac 1740

ttgctttgaa gacgtggttg gaacgtcttc tttttccacg atgctcctcg tgggtggggg 1800

tccatctttg ggaccactgt cggcagaggc atcttgaacg atagcctttc ctttatcgca 1860

atgatggcat ttgtaggtgc caccttcctt ttctactgtc cttttgatga agtgacagat 1920

agctgggcaa tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat 1980

agccctttgg tcttctgaga ctgtatcttt gatattcttg gagtagacga gagtgtcgtg 2040

ctccaccatg ttggcaagct gctctagcca atacgcaaac cgcctctccc cgcgcgttgg 2100

ccgattcatt aatgcagctg gcacgacagg tttcccgact ggaaagcggg cagtgagcgc 2160

aacgcaatta atgtgagtta gctcactcat taggcacccc aggctttaca ctttatgctt 2220

ccggctcgta tgttgtgtgg aattgtgagc ggataacaat ttcacacagg aaacagctat 2280

gacatgatta cgaattcgag ctcggtaccc ggggatcctc tagagtcgac ctgcaggcat 2340

gcaagcttat ccagcttgca tgcctgcagt gcagcgtgac ccggtcgtgc ccctctctag 2400

agataatgag cattgcatgt ctaagttata aaaaattacc acatattttt tttgtcacac 2460

ttgtttgaag tgcagtttat ctatctttat acatatattt aaactttact ctacgaataa 2520

tataatctat agtactacaa taatatcagt gttttagaga atcatataaa tgaacagtta 2580

gacatggtct aaaggacaat tgagtatttt gacaacagga ctctacagtt ttatcttttt 2640

agtgtgcatg tgttctcctt tttttttgca aatagcttca cctatataat acttcatcca 2700

ttttattagt acatccattt agggtttagg gttaatggtt tttatagact aattttttta 2760

gtacatctat tttattctat tttagcctct aaattaagaa aactaaaact ctattttagt 2820

ttttttattt aataatttag atataaaata gaataaaata aagtgactaa aaattaaaca 2880

aatacccttt aagaaattaa aaaaactaag gaaacatttt tcttgtttcg agtagataat 2940

gccagcctgt taaacgccgt cgacgagtct aacggacacc aaccagcgaa ccagcagcgt 3000

cgcgtcgggc caagcgaagc agacggcacg gcatctctgt cgctgcctct ggacccctct 3060

cgagagttcc gctccaccgt tggacttgct ccgctgtcgg catccagaaa ttgcgtggcg 3120

gagcggcaga cgtgagccgg cacggcaggc ggcctcctcc tcctctcacg gcaccggcag 3180

ctacggggga ttcctttccc accgctcctt cgctttccct tcctcgcccg ccgtaataaa 3240

tagacacccc ctccacaccc tctttcccca acctcgtgtt gttcggagcg cacacacaca 3300

caaccagatc tcccccaaat ccacccgtcg gcacctccgc ttcaaggtac gccgctcgtc 3360

ctcccccccc ccctctctac cttctctaga tcggcgttcc ggtccatggt tagggcccgg 3420

tagttctact tctgttcatg tttgtgttag atccgtgttt gtgttagatc cgtgctgcta 3480

gcgttcgtac acggatgcga cctgtacgtc agacacgttc tgattgctaa cttgccagtg 3540

tttctctttg gggaatcctg ggatggctct agccgttccg cagacgggat cgatttcatg 3600

attttttttg tttcgttgca tagggtttgg tttgcccttt tcctttattt caatatatgc 3660

cgtgcacttg tttgtcgggt catcttttca tgcttttttt tgtcttggtt gtgatgatgt 3720

ggtctggttg ggcggtcgtt ctagatcgga gtagaattct gtttcaaact acctggtgga 3780

tttattaatt ttggatctgt atgtgtgtgc catacatatt catagttacg aattgaagat 3840

gatggatgga aatatcgatc taggataggt atacatgttg atgcgggttt tactgatgca 3900

tatacagaga tgctttttgt tcgcttggtt gtgatgatgt ggtgtggttg ggcggtcgtt 3960

cattcgttct agatcggagt agaatactgt ttcaaactac ctggtgtatt tattaatttt 4020

ggaactgtat gtgtgtgtca tacatcttca tagttacgag tttaagatgg atggaaatat 4080

cgatctagga taggtataca tgttgatgtg ggttttactg atgcatatac atgatggcat 4140

atgcagcatc tattcatatg ctctaacctt gagtacctat ctattataat aaacaagtat 4200

gttttataat tattttgatc ttgatatact tggatgatgg catatgcagc agctatatgt 4260

ggattttttt agccctgcct tcatacgcta tttatttgct tggtactgtt tcttttgtcg 4320

atgctcaccc tgttgtttgg tgttacttct gcaggtcgac tctagaggat cgtattttta 4380

caacaattac caacaacaac aaacaacaaa caacattaca attactattt acaattacaa 4440

ccatggattg ccggccctac aactgcctgt cgaaccctga ggtggaggtc ctgggcggcg 4500

agcggattga gactggctac acaccgattg acatctcact ctccctgacc cagttcctcc 4560

tgtcggagtt cgtgccaggc gctgggttcg ttctcggcct ggtggatatc atttggggca 4620

tcttcgggcc aagccagtgg gacgctttcc tggtccagat cgagcagctc attaatcaga 4680

ggatcgagga gttcgcgcgg aaccaggcta ttagccgcct cgagggcctg tcgaacctct 4740

accagatcta cgccgagagc ttcagggagt gggaggctga tccgacgaac cccgccctga 4800

gggaggagat gcggattcag ttcaatgaca tgaactccgc tctgaccacg gctatcccac 4860

tcttcgcggt gcagaattac caggtcccac tcctgagcgt ctacgtgcag gctgcgaacc 4920

tccacctgtc tgtgctgcgc gatgtttcag tgttcggcca gacctggggg ttcgacgctg 4980

ctacgattaa ttccaggtac aacgatctga cacggctcat cggcaattac actgaccatg 5040

ccgttcggtg gtacaacacc ggcctcgaga gggtgtgggg gccagactcc agggattgga 5100

ttaggtacaa ccagttccgc agggagctca cactgactgt cctggacatc gtttccctct 5160

tcccaaacta cgatagccgg acctacccta ttcgcacggt gtcccagctg acaagggaga 5220

tctacactaa tccagtcctc gagaacttcg acggctcttt ccgcgggtca gctcagggca 5280

ttgaggggtc catcaggagc cctcacctga tggatatcct caactcaatc accatctaca 5340

cggacgctca ccgcggcgag tactactggt ccgggcatca gatcatggct tccccagtcg 5400

gcttcagcgg gccagagttc accttcccac tgtacggcac gatggggaac gctgctccac 5460

agcagaggat cgttgctcag ctcggccagg gggtgtaccg cacactgtcc agcactctct 5520

accggcgccc gttcaacatc ggcattaaca atcagcagct gagcgtgctc gacggcacag 5580

agttcgccta cgggacttcg tctaacctgc cctcggcggt ctacaggaag tcgggcaccg 5640

ttgactctct cgatgagatc ccgccccaga acaataacgt cccacctcgc cagggcttct 5700

cgcacaggct gtcgcatgtt tctatgttcc ggtcaggctt ctccaactca tccgtctcca 5760

tcattagggc cccgatgttc tcatggatcc accggtccgc ggagttcaat aacatcattg 5820

ctagcgattc gatcacgcag attccagcgg tcaagggcaa tttcctcttc aacgggagcg 5880

ttatctcggg ccctgggttc acaggcgggg acctggtgag gctcaatagc tcgggcaata 5940

acatccagaa caggcggtac attgaggtcc caatccactt cccttctacc tcaacgcgct 6000

acagggtccg ggttcgctac gcgtccgtga caccaattca tctgaatgtc aactggggca 6060

attcttcaat cttctcgaac actgtgcctg ccacagcgac ttctctggac aatctccagt 6120

ccagcgattt cggctacttc gagtctgcta acgccttcac ctcgtctctc ggcaatatcg 6180

tgggggtccg caacttcagc ggcacggctg gcgttattat tgataggttc gagttcatcc 6240

ctgttactgc taccctggag gctgagtaag taggtgagga attctttgag tattatggca 6300

ttggaaaagc cattgttctg cttgtaattt actgtgttct ttcagttttt gttttcggac 6360

atcaaaaaaa aaaaaaaaaa aaaaaaaaaa tttaacaaaa aaaaaaaaaa aaaaaaaaaa 6420

gtttaattcg attatcctcg agccctagtg tcctgcttta atgagatatg cgagacgcct 6480

atgatcgcat gatatttgct ttcaattctg ttgtgcacgt tgtaaaaaac ctgagcatgt 6540

gtagctcaga tccttaccgc cggtttcggt tcattctaat gaatatatca cccgttacta 6600

tcgtattttt atgaataata ttctccgttc aatttactga ttgtacccta ctacttatat 6660

gtacaatatt aaaatgaaaa caatatattg tgctgaatag gtttatagcg acatctatga 6720

tagagcgcca caataacaaa caattgcgtt ttattattac aaatccaatt ttaaaaaaag 6780

cggcagaacc ggtcaaacct aaaagactga ttacataaat cttattcaaa tttcaaaagt 6840

gccccagggg ctagtatcta cgacacaccg agcggcgaac taataacgct cactgaaggg 6900

aactccggtt ccccgccggc gcgcatgggt gagattcctt gaagttgagt attggccgtc 6960

cgctctaccg aaagttacgg gcaccattca acccggtcca gcacggcggc cgggtaaccg 7020

acttgctgcc ccgagaatta tgcagcattt ttttggtgta tgtgggcccc aaatgaagtg 7080

caggtcaaac cttgacagtg acgacaaatc gttgggcggg tccagggcga attttgcgac 7140

aacatgtcga ggctcagcag gacctgcagg cgtttaaact tgatctgtgt cctgtgaagg 7200

ttcgaacaac tgcacattat gcaaattgtc aatagaaact gagattattg caagacatag 7260

ttgcagttca tgttttcaat gcactgactg ttgagtacca acactgggta atacctttcg 7320

cctcctcaat attccatatt tttatcgttc cacttgctgc accagcacct atcgtaactt 7380

cagaagagtc aggtcgtact gactcaactg gacttataaa gcctgataga ctctgcaatg 7440

tacaatgaaa tacacctgaa gtagatgttg ccaaaaaaga gagcaagaat gacatattga 7500

tattacacat aaaccgttgg gataggacat taccaggagg gcaccgggtt tccctatagc 7560

ccaaagattg accttcaaat cctccccacc agtgatgagg atccttgatg ctcgcctccc 7620

aaacttggca caattgacat tcaaagtgtg cgcgacaaac tcctctggtc attgtcaatt 7680

gagtgtcaaa tactttgacc caacttcaaa attgcagcag taataaatat gctcaaaacc 7740

ttcttaaata ctctagcata aaaaatatca cttggtgctc caccatttca agcaataaga 7800

ctctctccaa caaggtcatg taaaaggtca tgttcgatat atttaactca ccgagctcgc 7860

ccctacacct ccagcaaagt cttctatcac atcctttaaa atttggcggc ctcttctcat 7920

cctctaaacg tagcggctcc ttctacaatt gtacaattaa ttatcttgca atttggcaat 7980

ggttttgttt gttcaatatt caatgccatt tcaatggtag tttacaattg tgccttagct 8040

gcaaaaacag atggcaaaca taagcatccc aaa 8073

<210>3

<211>20

<212>DNA

<213>FW-csp2211

<400>3

ctgtcacacg gattctgtat 20

<210>4

<211>20

<212>DNA

<213>RV-csp2526

<400>4

acttagacat gcaatgctca 20

<210>5

<211>20

<212>DNA

<213>FW-csp2527

<400>5

gcggataaca atttcacaca 20

<210>6

<211>20

<212>DNA

<213>RV-csp2528

<400>6

ctgcagaagt aacaccaaac 20

<210>7

<211>20

<212>DNA

<213>FW-csp2529

<400>7

actgtttctt ttgtcgatgc 20

<210>8

<211>20

<212>DNA

<213>RV-csp2530

<400>8

tttgacctgc acttcatttg 20

<210>9

<211>20

<212>DNA

<213>FW-csp2423

<400>9

ggctagtatc tacgacacac 20

<210>10

<211>20

<212>DNA

<213>RV-csp2649

<400>10

tttgggatgc ttatgtttgc 20

<210>11

<211>333

<212>DNA

<213> Probe

<400>11

cacgcagatt ccagcggtca agggcaattt cctcttcaac gggagcgtta tctcgggccc 60

tgggttcaca ggcggggacc tggtgaggct caatagctcg ggcaataaca tccagaacag 120

gcggtacatt gaggtcccaa tccacttccc ttctacctca acgcgctaca gggtccgggt 180

tcgctacgcg tccgtgacac caattcatct gaatgtcaac tggggcaatt cttcaatctt 240

ctcgaacact gtgcctgcca cagcgacttc tctggacaat ctccagtcca gcgatttcgg 300

ctacttcgag tctgctaacg ccttcacctc gtc 333

<210>12

<211>21

<212>DNA

<213>CSP759

<400>12

cacgcagatt ccagcggtca a 21

<210>13

<211>21

<212>DNA

<213>CSP760

<400>13

gacgaggtga aggcgttagc a 21

<210>14

<211>20

<212>DNA

<213>RV-csp2344

<400>14

tatagggttt cgctcatgtg 20

<210>15

<211>20

<212>DNA

<213>FW-csp2648

<400>15

ccgagaatta tgcagcattt 20

<210>16

<211>19

<212>DNA

<213>FW-CSP74

<400>16

caccatcgtc aaccactac 19

<210>17

<211>18

<212>DNA

<213>RV-CSP73

<400>17

cagttcccgt gcttgaag 18

<210>18

<211>408

<212>DNA

<213> Probe

<400>18

caccatcgtc aaccactaca tcgagacaag cacggtcaac ttccgtaccg agccgcagga 60

accgcaggag tggacggacg acctcgtccg tctgcgggag cgctatccct ggctcgtcgc 120

cgaggtggac ggcgaggtcg ccggcatcgc ctacgcgggc ccctggaagg cacgcaacgc 180

ctacgactgg acggccgagt cgaccgtgta cgtctccccc cgccaccagc ggacgggact 240

gggctccacg ctctacaccc acctgctgaa gtccctggag gcacagggct tcaagagcgt 300

ggtcgctgtc atcgggctgc ccaacgaccc gagcgtgcgc atgcacgagg cgctcggata 360

tgccccccgc ggcatgctgc gggcggccgg cttcaagcac gggaactg 408

Claims (10)

1. A nucleic acid molecule consisting of SEQ ID NO: 2or the complementary sequence thereof.

2. A primer pair for detecting the nucleic acid molecule of claim 1, selected from the group consisting of:

(1) SEQ ID NO:3 and SEQ ID NO: 4;

(2) SEQ ID NO:3 and SEQ ID NO: 14;

(3) SEQ ID NO:15 and SEQ ID NO: 10; and

(4) SEQ ID NO:9 and SEQ ID NO: 10.

3. a method for identifying a transformation event ZM8-143 in a biological sample comprising using the primer pair of claim 2.

4. A kit or microarray for detecting the maize transformation event ZM8-143 comprising the primer pair of claim 2.

5. Use of the primer pair of claim 2or the kit or microarray of claim 4 for the detection of maize transformation events ZM 8-143.

6. A method for detecting the presence of transformation event ZM8-143 or a progeny thereof in a biological sample comprising

Providing a biological sample and extracting DNA from the biological sample;

providing a primer pair of claim 2;

carrying out DNA amplification reaction by using the primer pair; and

detecting a DNA amplicon molecule produced by said DNA amplification reaction, wherein the presence of said DNA amplicon molecule indicates the presence of a transformation event ZM8-143, wherein said transformation event ZM8-143 is the introduction of exogenous DNA into a plant to produce in the plant the nucleic acid sequence of SEQ ID NO:2, or a DNA having a sequence of 2.

7. Comprises the amino acid sequence shown in SEQ ID NO:2 in breeding.

8. The use of claim 7, wherein said breeding comprises obtaining a progeny plant by pollen culture, haploid embryo culture, doubling culture, cell culture, tissue culture, selfing, or crossing, or a combination thereof.

9. An article made from the plant produced by the use of claim 7 or 8.

10. The article of claim 9, wherein the article is a food, feed or industrial material.

Images