CN107739403B

CN107739403B - Protein related to plant flowering phase and coding gene and application thereof

Info

Publication number: CN107739403B
Application number: CN201610656899.1A
Authority: CN
Inventors: 韩天富; 刘薇; 蒋炳军; 马立明; 侯文胜; 吴存祥; 孙�石; 陈莉; 武婷婷
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2016-08-11
Filing date: 2016-08-11
Publication date: 2020-12-22
Anticipated expiration: 2036-08-11
Also published as: CN107739403A

Abstract

The invention discloses a protein related to plant flowering phase and a coding gene and application thereof. The gene GmFT1a is cloned from a late-maturing soybean variety treated by long-day sunlight and is overexpressed in soybeans to obtain a transgenic plant, and the flowering period of the transgenic plant is later than that of a non-transgenic wild type, so that the GmFT1a gene or the GmFT1a protein expressed by the gene has a flowering inhibiting effect.

Description

Protein related to plant flowering phase and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a protein related to a plant flowering phase, and a coding gene and application thereof.

Background

Soybeans are important oil and food crops and are widely distributed around the world. As a typical short-day crop, the flowering process of soybeans is tightly regulated by the photoperiod. However, differences in the sensitivity of different soybean varieties to photoperiod exist, resulting in a relatively narrow range of planting for individual varieties (typically between 1-1.5 latitudes). When the seeds are introduced in different latitude regions, the flowering phase and the mature phase are advanced or delayed due to the change of the length of sunlight, so that the yield is reduced and even the grains are not harvested. Therefore, the cultivation of a widely adapted soybean variety with relatively insensitive photoperiod has been an important goal in soybean breeding.

The flowering period and the mature period are important indexes of the photoperiod reaction of the soybeans and are main ecological traits influencing variety distribution. In breeding and production practice, soybean varieties can be divided into different Maturity Groups (MG) according to the Maturity stage. Currently, north american soybean varieties have been divided into 13 maturity groups of 000, 00, 0, I, II, III, IV, V, VI, VII, VIII, IX, X from north to south. Chinese soybean breeding experts combine Chinese breeding practice and planting systems to provide a scheme for dividing maturity groups according with Chinese situations. Recently, in research, soybean varieties which are older than MG000 groups exist in high-cold areas such as northeast China and far east Russia in China, and the soybean varieties belong to MG0000 groups, which shows that soybeans in China have richer maturity diversity and are important genetic resources for researching photoperiod reaction and maturity character differences of the soybeans.

Previous studies have shown that short day is a necessary condition for inducing photoperiod sensitive soybean varieties to flower and seed. When the photoperiod sensitive soybean variety induced by short days is treated for a long day, the short day effect can be relieved, the apical meristem is changed from vegetative organ differentiation to reproductive organ differentiation, and flowering reversion occurs; when the short-day treatment is carried out again, the flowers and the fruits can be bloomed again. Grafting experiments show that the leaves of the late-maturing scions can produce flowering inhibiting substances under long-day sunlight, and the effects of the flowering inhibiting substances have a dosage effect. These phenomena suggest that, as with short-day treatment, long-day exposure has its unique physiological effects; the reproductive development of the soybean is controlled by the short-day promoting effect and the long-day inhibiting effect, and the two effects coordinate the relationship between vegetative growth and reproductive growth through quantitative interaction.

Based on the background, the long-day specific expression gene is excavated, the function and the expression difference between photoperiod sensitive varieties and insensitive varieties are determined, the molecular method not only plays an important role in deeply understanding the relationship between vegetative growth and reproductive growth and determining the photoperiod reaction molecular mechanism of soybeans, but also can provide a molecular means for cultivating good soybean varieties suitable for being planted in certain areas.

Disclosure of Invention

It is an object of the present invention to provide a protein.

The protein provided by the invention is the protein of a) or b) or c) as follows:

a) the amino acid sequence is a protein shown in a sequence 2;

b) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in the sequence 2;

c) and (b) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2.

Wherein, the sequence 2 consists of 176 amino acid residues.

In order to facilitate the purification of the protein in a), the amino terminal or the carboxyl terminal of the protein shown in the sequence 2 in the sequence table can be connected with a label shown in the table 1.

TABLE 1 sequence of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The protein of c) above, wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The protein in the c) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The gene encoding the protein of c) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in sequence No. 1, and/or performing missense mutation of one or several base pairs, and/or connecting the coding sequence of the tag shown in Table 1 to the 5 'end and/or 3' end thereof.

It is another object of the present invention to provide a biomaterial related to the above protein.

The biological material related to the protein provided by the invention is any one of the following A1) to A12):

A1) nucleic acid molecules encoding the above proteins;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising a4) said recombinant vector;

A9) a transgenic plant cell line comprising the nucleic acid molecule of a 1);

A10) a transgenic plant cell line comprising the expression cassette of a 2);

A11) a transgenic plant cell line comprising the recombinant vector of a 3);

A12) a transgenic plant cell line comprising the recombinant vector of a 4).

In the above material, the nucleic acid molecule according to A1) is a gene represented by the following 1) or 2) or 3):

1) the coding sequence is a cDNA molecule shown in sequence 1;

2) a cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in 1) and encoding the protein;

3) a cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence limited by 1) or 2) under strict conditions and codes the protein.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

Wherein, the sequence 1 consists of 531 nucleotides, and the coding sequence 2 shows the amino acid sequence.

The nucleotide sequence of the present invention encoding the above-mentioned protein can be easily mutated by a person of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence encoding the above-mentioned protein are derived from and identical to the nucleotide sequence of the present invention as long as they encode the above-mentioned protein and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 2 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In the above biological material, the stringent conditions are hybridization and membrane washing at 68 ℃ for 2 times, 5min each, in a solution of 2 XSSC, 0.1% SDS, and hybridization and membrane washing at 68 ℃ for 2 times, 15min each, in a solution of 0.5 XSSC, 0.1% SDS; or in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃ and washing the membrane.

In the above-mentioned biological materials, the expression cassette containing a nucleic acid molecule encoding the above-mentioned protein according to A2) means a DNA capable of expressing the above-mentioned protein in a host cell, and the DNA may contain not only a promoter which initiates transcription of the nucleic acid molecule encoding the above-mentioned protein but also a terminator which terminates transcription of the nucleic acid molecule encoding the above-mentioned protein. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: a constitutive promoter; tissue, organ and development specific promoters and inducible promoters. Examples of promoters include, but are not limited to: group of cauliflower mosaic virusesConstitutive promoter 35S: the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al (1999) Plant Physiol 120: 979-992); chemically inducible promoter from tobacco, pathogenesis-related 1(PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible with methyl jasmonate); heat shock promoters (U.S. patent 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128(CN101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators (see, e.g., Odell et al (I)⁹⁸⁵) Nature313: 810; rosenberg et al (1987) Gene,56: 125; guerineau et al (1991) mol.gen.genet,262: 141; proudfoot (1991) Cell,64: 671; sanfacon et al Genes Dev.,5: 141; mogen et al (1990) Plant Cell,2: 1261; munroe et al (1990) Gene,91: 151; ballad et al (1989) Nucleic Acids Res.17: 7891; joshi et al (1987) Nucleic Acid Res, 15: 9627).

The recombinant vector containing the expression cassette of the nucleic acid molecule encoding the above-mentioned protein can be constructed using an existing expression vector. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Co., Ltd.), etc. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The poly A signal can lead poly A to be added to the 3 'end of mRNA precursor, and the untranslated regions transcribed at the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (such as nopaline synthase gene Nos) and plant genes (such as soybean storage protein gene) have similar functions. When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound capable of producing a color change (GUS gene, luciferase gene, etc.), a marker gene for antibiotics (e.g., nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to phosphinothricin as an herbicide, hph gene conferring resistance to hygromycin as an antibiotic, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or a marker gene for chemical resistance (e.g., herbicide resistance), a mannose-6-phosphate isomerase gene providing the ability to metabolize mannose, which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector.

In the above biological material, the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium.

In the above biological material, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not comprise propagation material.

It is also an object of the present invention to provide a novel use of the above protein or the above material.

The invention provides the application of the protein or the material in regulating and controlling the flowering period and/or the mature period of plants.

In the above application, the regulation is advanced or delayed.

The application of the protein or the related biological material in the following (1) or (2) also belongs to the protection scope of the invention:

(1) cultivating transgenic plants with early or late flowering period;

(2) and (5) cultivating the transgenic plant with the mature period advanced or delayed.

In the above application, the breeding method may be a gene editing method or a gene knockout method.

It is a final object of the present invention to provide a method for breeding transgenic plants with a prolonged flowering phase.

The method provided by the invention comprises the steps of over-expressing the protein in a receptor plant to obtain a transgenic plant; the transgenic plant has a flowering stage later than that of the recipient plant.

In the above method, the overexpression is carried out by introducing a gene encoding the above protein into a recipient plant; the nucleotide sequence of the gene encoding the protein is sequence 1.

In an embodiment of the present invention, the gene encoding the protein (i.e., the DNA molecule represented by sequence 1 in the sequence listing) is introduced into the recipient plant via a recombinant vector containing an expression cassette for a nucleic acid molecule encoding the protein. The recombinant vector is specifically a recombinant expression vector pTF101.1-GmFT1 a; the recombinant expression vector pTF101.1-GmFT1a is a vector obtained by replacing a DNA molecule shown in a sequence 1 with a DNA fragment between XbaI and AscI enzyme cutting sites of a pTF101.1 vector and keeping other sequences of the pTF101.1 vector unchanged.

In the above method, the transgenic plant is understood to include not only the first generation transgenic plant obtained by transforming a plant of interest with the gene encoding the above protein, but also its progeny. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.

In the method, the recipient plant is a monocotyledon or a dicotyledon, the dicotyledon is specifically soybean, and the variety of the soybean is specifically Jack.

In the method, the flowering stage is the days after emergence when the plant enters the initial flowering stage (R1), and the R1 stage is the stage when the first flower at any node of the main stem appears.

In the above method, the mature period refers to a period in which 95% of the pods of the plant exhibit an inherent mature color.

The gene GmFT1a is cloned from a late-maturing soybean variety treated by long-day sunlight and is overexpressed in soybeans to obtain a transgenic plant, and the flowering period of the transgenic plant is later than that of a non-transgenic wild type, so that the GmFT1a gene or the GmFT1a protein expressed by the gene has a flowering inhibiting effect.

Drawings

FIG. 1 shows the detection of the relative expression level of GmFT1a gene in single leaves under different light irradiation treatments. Wherein, FIG. 1A is the detection of relative expression level of GmFT1A gene in single leaf of Yugongdong bean under different light treatment; FIG. 1B shows the detection of the relative expression level of the GmFT1a gene in a single leaf of the black river 27 under different light treatments.

FIG. 2 is an analysis of the expression of GmFT1a in soybean varieties at different maturity stages under different light treatments.

FIG. 3 shows the bar gene detection at DNA level and the GmFT1a detection at RNA level of soybean transformed with GmFT1 a. Wherein, FIG. 3A is the DNA level bar gene detection of soybean transformed with GmFT1 a; FIG. 3B is a detection of RNA levels of GmFT1a in GmFT1a transferred soybeans.

FIG. 4 shows the growth of soybeans #9 and #10 transformed with GmFT1a after 39 days of emergence.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results averaged.

The late maturing varieties of soybean in the following examples are disclosed in the literature "Korea Tianfu, Wang jin Ling, study of the photoperiod reaction of soybean after flowering-plant bulletin, 1995,37: 863-.

The soybean variety Heihe 27 in the following examples was disclosed in the literature "Jiazhen, Wu bankxiang, Miaomi, etc.. influence of the number of leaves retained by the rootstock or the scion on the growth and development of the scion in the soybean grafting system [ J ]. the Proc for crops, 2011,37(4): 650-.

The pTF101.1 vector in the following examples is disclosed in the document "Paz M, Shou H, Guo Z, et al. assessment of conditioning of agricultural-mediated straw transformation using the collectible node extension [ J ]. Euphytoica, 2004,136(2): 167-179", publicly available from the institute of crop science of the national academy of agricultural sciences.

Agrobacterium tumefaciens EHA101 in the following examples is disclosed in the document "Hood E E, Helmer G L, Fraley R T, et al, the hyperbirus of Agrobacterium tumefaciens A281is encoded in a region of pTiBo542outside of T-DNA [ J ]. Journal of Bacteriology,1986,168(3): 1291-.

The soybean variety Jack in the following examples is disclosed in "Zhouyang, Liuwei, Sunwai, etc.." cloning and expression analysis of soybean regeneration-related gene GmWUS [ J ]. proceedings of Chinese oil crops, 2014,36(6):707 ", and publicly available from the institute of crop science, academy of agricultural sciences.

The flowering period in the following examples refers to the period when the first flower appears at any node of the main stem of the plant; the mature period refers to the period of time when 95% of the pods of the plant exhibit an inherent mature color.

Example 1 cloning of GmFT1a Gene and analysis of expression thereof

Cloning of GmFT1a Gene

1. The material selected in this example is late-maturing variety of Gongdong bean which is very sensitive to photoperiod, long-day treatment is carried out after the seedling emergence, single leaf is taken after 9 days, RNA is extracted, and the obtained RNA is used as a template to obtain cDNA through reverse transcription.

2. Taking the cDNA obtained in the step 1 as a template, and adopting a primer GmFT1 a-F: ATGCCTAGATCAACGGACCCTCT and GmFT1 a-R: TTATCTTCTTCTTCCACTGCTT PCR amplification is carried out to obtain PCR amplification product. And sequenced.

The sequencing result shows that: the nucleotide sequence of the PCR amplification product is sequence 1, the gene shown in sequence 1is named as GmFT1a, wherein, the 1 st to 531 th from the 5' end is ORF, protein composed of 176 amino acid residues is coded, the protein is named as GmFT1a, and the amino acid sequence of the GmFT1a protein is sequence 2.

Second, the expression condition of GmFT1a gene in different development stages of soybean

1. The method comprises the following steps of taking the self-tribute winter beans (photoperiod sensitive varieties) and the black river 27 (photoperiod insensitive varieties) as experimental materials, carrying out light treatment after cotyledons are unfolded, and dividing the materials into three types according to different light treatment modes: long day treatment (LD, 16h light/8 h dark), short day treatment (SD, 12h light/12 h dark), and short day 13-to-long day treatment (SD 13-LD).

2. And extracting total RNA of the leaves of the gongyou winter beans and the black river 27 after the illumination treatment in different modes on different illumination treatment days (3d, 7d, 11d, 15d, 19d, 23d and 27d), carrying out reverse transcription to obtain cDNA, and detecting the relative expression quantity of the GmFT1a gene by adopting a Real-time RT-PCR method and using GmActin as an internal standard gene. Primer sequences for detecting GmFT1a and an internal reference gene are as follows:

qGmFT1a-F：AAAAAGGTGCCTAGGGCATC；

qGmFT1a-R：GCAGATTACCTTGCTGGGAA；

qGmActin-F：CGGTGGTTCTATCTTGGCATC；

qGmActin-R：GTCTTTCGCTTCAATAACCCTA。

the results are shown in FIG. 1. The detection result shows that: in the late-maturing variety of self-tribute winter beans, the GmFT1a gene has high expression level under long-day treatment and is not expressed basically under short-day treatment, and the expression level of the GmFT1a gene is increased sharply when the short-day treatment is changed into the long-day treatment within 13 days; in the early maturing variety black river 27, the GmFT1a gene had an extremely low expression level under both long-day and short-day treatments, and although a significant increase was observed at 23 days, it was far from its expression in the self-winter bean. The above results indicate that the expression of the GmFT1a gene is related to the flowering and maturation stages of soybean.

Expression conditions of GmFT1a genes in soybean varieties of different maturity groups

1. Taking soybean varieties of different maturity groups as experimental materials, wherein the soybean varieties are sequentially as follows according to the maturity group and the maturity period from early to late: maple Presto (MG000), OAC Vision (MG 00), Traill (MG0), Heihe 27(MG 0), OAC Talbot (MG II), Zhonghuang30(MG III), Jack (MG III), TN4-94(MG IV), Nathan (MG V), Dillon (MG VI), Stonewwall (MG VII), Dowling (MG VIII), Gongdong winter beans (MG X), Jupiter (X). Performing light treatment after the cotyledon is unfolded, and classifying the cotyledon into the following two types according to different light treatment modes: long-day treatment (LD, 16h light/8 h dark), short-day treatment (SD, 12h light/12 h dark).

2. And after 9 days of illumination treatment, respectively taking the single leaf leaves after illumination treatment to extract RNA, carrying out reverse transcription to obtain cDNA, and detecting the relative expression quantity of the GmFT1a gene by adopting a Real-time RT-PCR method and taking GmActin as an internal standard gene. The primer sequence was as described above in step two, 2.

As a result, as shown in FIG. 2, the expression level of the GmFT1a gene was very low in each variety under the short-day treatment; under long-day treatment, the expression of the GmFT1a gene is low in early-maturing varieties, the expression level is high in late-maturing varieties, and the GmFT1a gene tends to gradually increase along with the postponing of the maturation stage. The GmFT1a gene was also shown to be associated with flowering and maturation phases.

Example 2 acquisition of transgenic soybeans GmFT1a and functional verification thereof

First, transfer of GmFT1a Soybean

1. Construction of recombinant expression vector pTF101.1-GmFT1a

(1) PCR amplification is carried out by taking pMD18-T-simple connected with GmFT1a as a template and GmFT1a-F-XbaI: TCTAGAATGCCTAGATCAACGGACCCTCT and GmFT1a-R-AscI: GGCGCGCC TTATCTTCTTCTTCCACTGCTT as primers to obtain a PCR product, namely a GmFT1a fragment (with the size of 545bp) containing XbaI and AscI at two ends.

(2) Carrying out double digestion on the GmFT1a fragment containing the XbaI and the AscI at two ends obtained in the step (1) by using restriction endonucleases XbaI and AscI, and recovering to obtain a GmFT1a fragment; carrying out double enzyme digestion on the pTF101.1 vector by using restriction enzymes XbaI and AscI, and recovering to obtain a skeleton vector; and (3) connecting the GmFT1a fragment and the skeleton vector by using T4 ligase, and carrying out a connection reaction at 16 ℃ to obtain a connection product.

(3) And (3) transforming the ligation product obtained in the step (2) into escherichia coli DH5 alpha (purchased from Tiangen Biochemical technology Co., Ltd.), coating the escherichia coli DH5 alpha on an LB solid plate containing Kan, culturing at 37 ℃ for 12-16h, selecting a single colony to perform bacteria liquid PCR verification (verification primers are GmFT1a-F-XbaI: TCTAGAATGCCTAGATCAACGGACCCTCT and GmFT1a-R-AscI: GGCGCGCC TTATCTTCTTCTTCCACTGCTT), performing PCR amplification to obtain a positive transformant with the size of 545bp, and naming the positive transformant as a recombinant expression vector pTF101.1-GmFT1a, and handing the positive transformant to Huada gene corporation for sequencing.

The sequencing result shows that: the recombinant expression vector pTF101.1-GmFT1a is a vector obtained by replacing a DNA molecule shown in sequence 1 with a DNA fragment between XbaI and AscI enzyme cutting sites of the pTF101.1 vector, and keeping other sequences of the pTF101.1 vector unchanged.

2. Obtaining of recombinant Agrobacterium

Mu.g of competent cells of Agrobacterium tumefaciens EHA101 transformed with the recombinant expression vector pTF101.1-GmFT1a prepared in step 1 above were cultured at 28 ℃ for two days on YEP medium (containing 50mg/L kanamycin) to select positive clones, which were then cloned using primers GmFT1a-F-XbaI: TCTAGAATGCCTAGATCAACGGACCCTCT and GmFT1a-R-AscI: GGCGCGCCTTTATCTTCTTCTTCCACTGCTT PCR was performed (product size 545 bp). The positive bacterial liquid obtained by PCR identification is named as recombinant agrobacterium EHA101.1: (pTF101.1-GmFT 1 a).

3. Obtaining and identifying transgenic GmFT1a soybeans

(1) Obtaining of soybeans transformed with GmFT1a

Transforming the recombinant agrobacterium EHA101.1 obtained in the step 2 into a soybean variety Jack in a third maturation stage group (MGIII) by pTF101.1-GmFT1a, and carrying out a soybean genetic transformation processThe main references "Zhang Z, Xing A, Staswick P, et al. the use of a selective agent in Agrobacterium-mediated transformation of sobean [ J]Plant Cell, Tissue and Organ Culture,1999,56(1):37-46. ", gave 10 strains of T, respectively₀Transfer GmFT1a soybean plant.

(2) Identification of transgenic GmFT1a soybeans

Will T₀Transfer GmFT1a soybean seeds (T)₁Generation) is planted in a greenhouse (25 ℃, humidity is 60-80%) of the institute of crop science of Chinese academy of agricultural sciences, 160mg/L glufosinate smearing and screening treatment is carried out on soybean leaves when the soybean material grows to the V2 stage, observation and statistics of screening phenotype are carried out after 5-7 days, leaf sampling is carried out on glufosinate resistant plants, PCR identification is carried out, and positive T is obtained₁Transfer GmFT1a soybean plant. The PCR identification comprises the following specific steps: extracting DNA from the leaf and performing Bar gene detection (Bar gene detection primers: Bar-F: GCACCATCGTCAACCACTACATC and Bar-R: CAGAAACCCACGTCATGCCAGTT, product size 430bp, FIG. 3A); RNA of the taken leaf was extracted and subjected to detection of GmFT1a (GmFT1a gene detection primers: RTGmFT1 a-F: GGAGCCTTTCACAAGTAGCGTTTCTA and RTGmFT1 a-R: AATCTCAGCAAAGTCTCTGGTGTT, product size: 397bp, FIG. 3B).

Part T₁The PCR identification results of the GmFT1 a-transferred soybean are shown in FIG. 3: as can be seen from the figure, the Bar-F/Bar-R primer is at T₁Transferring the soybean to GmFT1a for generation, obtaining a strip with the size of 430bp through PCR amplification, and carrying out RT GmFT1a-F/RTGmFT1a-R primer at T₁PCR amplification in GmFT1a transferred soybean yielded a band with a size of 397 bp. Selection of Positive T₁ Transfer lines #2, #3, #4, #9, #10 of GmFT1a soybeans were used for the following experimental studies.

Second, flowering of soybean transformed with GmFT1a

For positive T₁The flowering stages of GmFT1a soybean lines #2, #3, #4, #9, #10 and wild soybean plants (WT) were counted, and the statistical method of the flowering stage was the number of days for the plants to enter the R1 stage (the first flower on any node of the main stem) after emergence. The number of plants selected per line is shown in Table 1. The experiment was repeated 3 times and the results averaged.

The statistical results are shown in table 1. The results show that: t is₁The average flowering phases of GmFT1a soybean lines #2, #3, #4, #9 and #10 are 35.4 days, 30.6 days, 37.8 days, 36.4 days and 38.3 days respectively, and late flowering phenotype is generated; whereas the flowering phase of wild type soybean varieties is 29.4 days, T₁The flowering period of the soybean transformed with GmFT1a is obviously later than that of the wild type. At T₁When transgenic soybean lines #2, #3, #4, #9 and #10 of GmFT1a were flowering, the wild type had already pod and the length of the pod reached 2-3cm (FIG. 4). From the above results, it was found that the GmFT1a gene had a function of delaying the flowering of soybean.

TABLE 1, T₁Flowering period of soybean with GmFT1a

Claims

1. The application of the protein with the amino acid sequence shown as the sequence 2 or the related biological material thereof in regulating and controlling the flowering phase and/or the maturation phase of the soybean;

the related biomaterial is any one of the following a1) to a 12):

A1) nucleic acid molecules encoding said proteins;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising a4) said recombinant vector;

A9) a transgenic soybean cell line comprising the nucleic acid molecule of a 1);

A10) a transgenic soybean cell line comprising the expression cassette of a 2);

A11) a transgenic soybean cell line comprising the recombinant vector of a 3);

A12) a transgenic soybean cell line comprising the recombinant vector of a 4).

2. Use according to claim 1, characterized in that: the regulation is early or late.

3. The application of the protein with the amino acid sequence shown as the sequence 2 or the related biological material thereof in the following (1) or (2):

(1) cultivating transgenic soybean with early or late flowering period;

(2) cultivating transgenic soybean with advanced or delayed mature period;

the related biomaterial is any one of the following a1) to a 12):

A1) nucleic acid molecules encoding said proteins;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising a4) said recombinant vector;

A10) a transgenic soybean cell line comprising the expression cassette of a 2);

A11) a transgenic soybean cell line comprising the recombinant vector of a 3);

A12) a transgenic soybean cell line comprising the recombinant vector of a 4).

4. Use according to any one of claims 1 to 3, characterized in that: A1) the nucleic acid molecule is a cDNA molecule with a coding sequence shown as a sequence 1.

5. Use according to any one of claims 1 to 3, characterized in that: the flowering stage is the days after emergence when the plants enter the R1 stage.

6. A method for breeding transgenic soybean with prolonged flowering phase comprises the steps of over-expressing protein with amino acid sequence shown as sequence 2 in receptor soybean to obtain transgenic soybean; the transgenic soybean has a flowering time later than that of the recipient soybean.

7. The method of claim 6, wherein: the overexpression method is to introduce a coding gene of a protein with an amino acid sequence shown as a sequence 2 into receptor soybean;

the nucleotide sequence of the gene encoding the protein is sequence 1.

8. The method according to claim 6 or 7, characterized in that: the flowering stage is the days after emergence when the plants enter the R1 stage.