CN107739403B - A protein related to plant flowering period and its encoding gene and application - Google Patents

Abstract

The present invention discloses a protein related to plant flowering period, its encoding gene and application. In the present invention, the gene GmFT1a is cloned from the late-maturing soybean variety treated with long-day irradiation, and it is overexpressed in soybean to obtain a transgenic plant. The flowering stage of the transgenic plant is later than that of the non-transgenic wild type. The GmFT1a protein has a flowering inhibitory effect.

Description

A protein related to plant flowering period and its encoding gene and application

technical field

The invention belongs to the field of biotechnology, and in particular relates to a protein related to the flowering period of plants and its encoding gene and application.

Background technique

Soybean is an important oil and food crop, widely distributed around the world. As a typical short-day crop, the flowering process of soybean is strictly regulated by photoperiod. However, there are differences in the sensitivity of different soybean varieties to photoperiod, resulting in a relatively narrow planting range of individual varieties (generally between 1-1.5 latitudes). When plants are introduced between different latitudes, changes in the length of sunshine often lead to earlier or later flowering and maturity, resulting in decreased yield or even no harvest. Therefore, it has always been an important goal of soybean breeding to develop widely adaptable soybean varieties that are relatively insensitive to photoperiod.

The flowering period and maturity period are important indicators of soybean photoperiod response, and are also the main ecological traits affecting the distribution of varieties. In breeding and production practice, soybean varieties can be divided into different maturity groups (also known as growth groups) (Maturity groups, MG) according to the early and late maturity stages. At present, North American soybean varieties have been divided into 13 mature stage groups from north to south: 000, 00, 0, I, II, III, IV, V, VI, VII, VIII, IX, and X. my country's soybean breeding experts put forward the division plan of mature stage group in line with China's national conditions in combination with China's breeding practice and planting system. Recently, in the study, it was found that there are soybean varieties that mature earlier than the MG000 group in alpine regions such as Northeast China and the Russian Far East, which belong to the MG0000 group, indicating that soybeans in my country have a richer maturity diversity, which is a useful tool for studying soybean photoperiod response and maturity. important genetic resources for the differences in traits over time.

Previous studies have shown that short days are a necessary condition for inducing flowering and fruiting in photoperiod-sensitive soybean varieties. When short-day-induced photoperiod-sensitive soybean varieties are subjected to long-day treatment, the short-day effect can be relieved, the apical meristem shifts from vegetative organ differentiation to reproductive organ differentiation, and flowering reversal occurs; when short-day treatment is performed again, reflowering can occur. solid. Grafting experiments found that the leaves of late-maturing scions could produce flowering-inhibiting substances under long-day light, and their effects had dose effects. These phenomena indicate that, like short-day treatment, long-day exposure also has its unique physiological effects; the reproductive development of soybean is controlled by both short-day promotion and long-day inhibition, and the two coordinate vegetative growth and reproductive growth through quantitative interactions. Relationship.

Based on the above background, mining long-day-specific expression genes and clarifying their functions and their expression differences between photoperiod-sensitive and insensitive varieties are not only important for in-depth understanding of the relationship between vegetative growth and reproductive growth, and for clarifying the molecular mechanism of soybean photoperiod response It can also provide molecular means for cultivating excellent soybean varieties suitable for planting in certain regions.

SUMMARY OF THE INVENTION

An object of the present invention is to provide a protein.

The protein provided by the present invention is the protein of the following a) or b) or c):

a) the amino acid sequence is the protein shown in sequence 2;

b) a fusion protein obtained by linking a tag to the N-terminal and/or C-terminal of the protein shown in SEQ ID NO: 2;

c) A protein with the same function obtained by substituting and/or deleting and/or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID NO: 2.

Among them, sequence 2 consists of 176 amino acid residues.

In order to facilitate purification of the protein in a), a tag as shown in Table 1 can be attached to the amino terminus or carboxyl terminus of the protein shown in SEQ ID NO: 2 in the sequence listing.

Table 1. Sequence of tags

Label Residues sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

For the protein in the above c), the substitution and/or deletion and/or addition of one or several amino acid residues are substitutions and/or deletions and/or additions of no more than 10 amino acid residues.

The protein in the above c) can be obtained by artificial synthesis, or by first synthesizing its encoding gene and then biologically expressing it.

The coding gene of the protein in the above c) can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID NO: 1, and/or carrying out missense mutation of one or several base pairs, and/or The coding sequence of the tag shown in Table 1 is attached to its 5' end and/or 3' end.

Another object of the present invention is to provide biomaterials related to the above-mentioned proteins.

The biological material related to the above-mentioned protein provided by the present invention is any one of the following A1) to A12):

A1) a nucleic acid molecule encoding the above-mentioned protein;

A2) an expression cassette containing the nucleic acid molecule of A1);

A3) a recombinant vector containing the nucleic acid molecule of A1);

A4) a recombinant vector containing the expression cassette described in A2);

A5) a recombinant microorganism containing the nucleic acid molecule of A1);

A6) a recombinant microorganism containing the expression cassette described in A2);

A7) a recombinant microorganism containing the recombinant vector described in A3);

A8) a recombinant microorganism containing the recombinant vector described in A4);

A9) a transgenic plant cell line containing the nucleic acid molecule of A1);

A10) a transgenic plant cell line containing the expression cassette of A2);

A11) a transgenic plant cell line containing the recombinant vector described in A3);

A12) A transgenic plant cell line containing the recombinant vector described in A4).

In the above materials, the nucleic acid molecule of A1) is the gene shown in the following 1) or 2) or 3):

1) its coding sequence is the cDNA molecule shown in sequence 1;

2) A cDNA molecule or a genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the above-mentioned protein;

3) A cDNA molecule or a genomic DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined in 1) or 2) and encodes the above-mentioned protein.

Wherein, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

Among them, sequence 1 consists of 531 nucleotides, encoding the amino acid sequence shown in sequence 2.

Those of ordinary skill in the art can easily mutate the nucleotide sequences encoding the above-mentioned proteins of the present invention by known methods, such as directed evolution and point mutation. Those artificially modified nucleotides with 75% or higher identity to the nucleotide sequence encoding the above-mentioned protein, as long as they encode the above-mentioned protein and have the same function, are derived from the nucleotide sequence of the present invention and are equivalent to Sequences of the present invention.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "Identity" includes 75% or higher, or 85% or higher, or 90% or higher, or 95% or Nucleotide sequences of higher identity. Identity can be assessed with the naked eye or with computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned 75% or more identity may be 80%, 85%, 90% or more than 95% identity.

In the above biological materials, the stringent conditions are hybridization in a solution of 2×SSC, 0.1% SDS at 68° C. and washing the membrane twice for 5 min each time, and then in a solution of 0.5×SSC, 0.1% SDS, Hybridize and wash the membrane twice at 68°C for 15 min each; or hybridize and wash the membrane in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS at 65°C.

In the above biological materials, the expression cassette containing the nucleic acid molecule encoding the protein described in A2) refers to the DNA capable of expressing the protein in the host cell, and the DNA may not only include a promoter that initiates the transcription of the nucleic acid molecule encoding the protein , and may also include a terminator that terminates the transcription of the nucleic acid molecule encoding the above-mentioned protein. Further, the expression cassette may also include enhancer sequences. Promoters useful in the present invention include, but are not limited to: constitutive promoters; tissue, organ and development specific promoters and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter of cauliflower mosaic virus 35S: a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120: 979-992); chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiol acid S-methyl ester)); tomato Protease inhibitor II promoter (PIN2) or LAP promoter (both inducible with methyl jasmonate); heat shock promoter (US Pat. No. 5,187,267); tetracycline-inducible promoter (US Pat. No. 5,057,422) seed-specific promoters, such as foxtail millet seed-specific promoter pF128 (CN101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (for example, promoters of phaseolin, napin, oleosin and soybean beta conglycin (Beachy et al (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine Synthase terminators (see, eg: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; ^Guerineau et al. (1991) Mol. Gen. Genet, 262:141; 1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acids Res., 15:9627).

Recombinant vectors containing expression cassettes of nucleic acid molecules encoding the above proteins can be constructed using existing expression vectors. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company) and so on. The plant expression vector may also contain the 3' untranslated region of the foreign gene, ie, containing the polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The poly(A) signal can guide the addition of poly(A) to the 3' end of the mRNA precursor, such as Agrobacterium crown gall-inducing (Ti) plasmid genes (such as nopaline synthase gene Nos), plant genes (such as soybean The untranslated regions transcribed from the 3' end of the storage protein gene) have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG initiation codons or adjacent region initiation codons, etc., but must be associated with the coding. The reading frames of the sequences are identical to ensure correct translation of the entire sequence. The translation control signals and initiation codons can be derived from a wide variety of sources, either natural or synthetic. The translation initiation region can be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a gene (GUS gene, luciferase gene, luciferase gene) that can be expressed in plants encoding an enzyme that can produce color change or a luminescent compound. Gene, etc.), marker genes for antibiotics (such as the nptII gene that confers resistance to kanamycin and related antibiotics, the bar gene that confers resistance to the herbicide phosphinothricin, the hph gene that confers resistance to the antibiotic hygromycin , and the dhfr gene conferring resistance to methotrexate, the EPSPS gene conferring resistance to glyphosate) or marker genes for chemical resistance (such as herbicide resistance genes), mannose-6- which provides the ability to metabolize mannose Phosphoisomerase gene. Considering the safety of transgenic plants, the transformed plants can be directly screened under stress without adding any selectable marker gene.

In the above biological material, the vector may be plasmid, cosmid, phage or viral vector.

In the above biological materials, the microorganisms can be yeast, bacteria, algae or fungi, such as Agrobacterium.

In the above biological materials, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs do not include propagation materials.

Another object of the present invention is to provide new uses of the above-mentioned protein or the above-mentioned material.

The present invention provides the application of the above-mentioned protein or the above-mentioned material in regulating the flowering period and/or the maturity period of plants.

In the above application, the regulation is advanced or delayed.

The application of the above-mentioned protein or the above-mentioned related biological material in the following (1) or (2) also belongs to the protection scope of the present invention:

(1) Cultivate transgenic plants whose flowering period is advanced or delayed;

(2) Breeding transgenic plants with early or late maturation.

In the above application, the method of cultivation can be through gene editing or gene knockout.

A final object of the present invention is to provide a method of growing transgenic plants with delayed flowering.

The method provided by the present invention comprises the step of overexpressing the above-mentioned protein in a recipient plant to obtain a transgenic plant; the flowering stage of the transgenic plant is later than that of the recipient plant.

In the above method, the method of overexpression is to introduce the gene encoding the protein into the recipient plant; the nucleotide sequence of the gene encoding the protein is SEQ ID NO: 1.

In the embodiment of the present invention, the gene encoding the protein (ie, the DNA molecule shown in SEQ ID NO: 1 in the sequence listing) is introduced into the recipient plant through a recombinant vector containing an expression cassette for the nucleic acid molecule encoding the protein. The recombinant vector is specifically the recombinant expression vector pTF101.1-GmFT1a; the recombinant expression vector pTF101.1-GmFT1a is to replace the DNA molecule shown in sequence 1 with the DNA between the XbaI and AscI restriction sites of the pTF101.1 vector fragment, and keep the other sequences of the pTF101.1 vector unchanged, the obtained vector.

In the above method, the transgenic plant is understood to include not only the first-generation transgenic plant obtained by transforming the above-mentioned protein-encoding gene into the target plant, but also its progeny. For transgenic plants, the gene can be propagated in that species, and conventional breeding techniques can be used to transfer the gene into other varieties of the same species, including in particular commercial varieties. The transgenic plants include seeds, callus, whole plants and cells.

In the above method, the recipient plant is a monocotyledonous plant or a dicotyledonous plant, the dicotyledonous plant is specifically soybean, and the variety of the soybean is specifically Jack.

In the above method, the flowering period is the number of days after the emergence of the plant into the initial flowering period (R1), and the R1 period is the period when the first flower appears at any node on the main stem.

In the above method, the maturity period refers to the period when 95% of the pods of the plant show inherent mature color.

In the present invention, the gene GmFT1a is cloned from the late-maturing soybean variety treated with long-day irradiation, and it is overexpressed in soybean to obtain a transgenic plant. The flowering stage of the transgenic plant is later than that of the non-transgenic wild type. The GmFT1a protein has a flowering inhibitory effect.

Description of drawings

Figure 1 shows the relative expression of GmFT1a gene in single leaves under different light treatments. Among them, Figure 1A is the detection of the relative expression of GmFT1a gene in single leaves of Zigong Dongdou under different light treatments; Figure 1B is the detection of relative expression of GmFT1a gene in single leaves of Heihe 27 under different light treatments.

Figure 2 shows the expression analysis of GmFT1a in soybean varieties at different maturity stages under different light treatments.

Figure 3 shows the DNA level bar gene detection and RNA level GmFT1a detection of GmFT1a soybean. Among them, Figure 3A is the DNA level bar gene detection of GmFT1a soybean; Figure 3B is the RNA level GmFT1a detection of GmFT1a soybean.

Figure 4 shows the growth of GmFT1a soybean #9 and #10 after 39 days of emergence.

Detailed ways

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

Quantitative experiments in the following examples are all set up to repeat the experiments three times, and the results are averaged.

The late-ripening soybean variety Zigong Dongdou in the following examples has been disclosed in the document "Han Tianfu, Wang Jinling. Research on the photoperiodic response of soybean after flowering. Acta Botany, 1995, 37:863-869", the public can obtain it from the Chinese Academy of Agricultural Sciences Acquired by the Crop Science Institute.

The soybean variety Heihe 27 in the following examples is described in the document "Jia Zhen, Wu Cunxiang, Wang Miao, et al. Influence of the number of leaves on the rootstock or scion in the soybean grafting system on the growth and development of the scion [J]. Journal of Crops, 2011, 37 ( 4): 650-660.”, which is publicly available from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

The pTF101.1 carrier in the following examples is in the document "Paz M M, Shou H, Guo Z, etal.Assessment of conditions affecting Agrobacterium-mediated soybeantransformation using the cotyledonary node explant[J].Euphytica, 2004,136(2): 167-179.” and publicly available from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

Agrobacterium tumefaciens EHA101 in the following examples is encoded in a region of pTiBo542 outside of T-DNA [J]. Journal of Bacteriology, 1986 , 168(3): 1291-1301.”, which is publicly available from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

The soybean variety Jack in the following examples is described in the document "Zhou Yang, Liu Wei, Sun Shi, et al. Cloning and expression analysis of soybean regeneration-related gene GmWUS [J]. Chinese Journal of Oil Crops, 2014, 36(6): 707. It has been published in ”, and the public can obtain it from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

The flowering period in the following examples refers to the period when the first flower appears at any node on the main stem of the plant; the mature period refers to the period when 95% of the pods of the plant show inherent mature color.

Example 1. Cloning and expression analysis of GmFT1a gene

1. Cloning of GmFT1a gene

1, the material selected in the present embodiment is a late-ripening variety Zigong Dongdou that is extremely sensitive to photoperiod, and after its emergence, carries out a long-day treatment, takes its single leaf and extracts RNA after 9 days, and the RNA obtained is a template, reversed. cDNA was recorded.

2. Using the cDNA obtained in step 1 as a template, the primers GmFT1a-F: ATGCCTAGATCAACGGACCCTCT and GmFT1a-R: TTATCTTCTTCTTCCACTGCTT are used for PCR amplification to obtain PCR amplification products. and sequence it.

The sequencing results showed that the nucleotide sequence of the PCR amplification product was sequence 1, and the gene shown in sequence 1 was named GmFT1a, in which the 1-531st ORF from the 5' end was ORF, which encoded a 176-amino acid residue. The protein is named GmFT1a, and the amino acid sequence of GmFT1a protein is sequence 2.

2. Expression of GmFT1a gene in different developmental stages of soybean

1. Taking Zigong Dongdou (photoperiod-sensitive variety) and Heihe 27 (photoperiod-insensitive variety) as experimental materials, light treatment was performed after the cotyledons were unfolded. LD, 16h light/8h dark), short day treatment (SD, 12h light/12h dark), and short day 13 days to long day treatment (SD13-LD).

2. In different light treatment days (3d, 7d, 11d, 15d, 19d, 23d, 27d), the total RNA of Zigong Dongdou and Heihe 27 leaves after different light treatments were extracted, reverse transcribed into cDNA, and the Real-time RT-PCR method, with GmActin as the internal standard gene, to detect the relative expression of GmFT1a gene. The primer sequences for detecting GmFT1a and the internal reference gene are as follows:

qGmFT1a-F:AAAAAGGTGCCTAGGGCATC;

qGmFT1a-R:GCAGATTACCTTGCTGGGAA;

qGmActin-F: CGGTGGTTCTATCTTGGCATC;

qGmActin-R: GTCTTTCGCTTCAATAACCCTA.

The results are shown in Figure 1. The detection results showed that: in the late-ripening variety Zigong Dongdou, the GmFT1a gene had a high expression level under the long-day treatment, and was basically not expressed under the short-day treatment. The expression level of GmFT1a increased sharply; in the early-maturing cultivar Heihe 27, the expression level of GmFT1a gene was extremely low under both long-day and short-day treatments. expression in beans. The above results indicated that the expression of GmFT1a gene was related to the flowering and maturity stages of soybean.

3. Expression of GmFT1a gene in soybean varieties of different maturity groups

1. Soybean varieties of different maturity groups are used as experimental materials. The soybean varieties are in the order of maturity group and maturity as follows: Maple Presto (MG000), OAC Vision (MG 00), Traill (MG0) , Heihe 27(MG 0), OAC Talbot(MG II), Zhonghuang30(MG III), Jack(MG III), TN4-94(MGIV), Nathan(MG V), Dillon(MG VI), Stonewall(MG VII) ), Dowling (MG VIII), Zigong Dongdou (MGX), Jupiter (X). Light treatment was performed after the cotyledons were unfolded. According to the different light treatment methods, it was divided into the following two types: long-day treatment (LD, 16h light/8h dark) and short-day treatment (SD, 12h light/12h dark).

2. After 9 days of light treatment, the single-leaf leaves after light treatment were taken for RNA extraction, reverse transcribed into cDNA, and the Real-time RT-PCR method was used to detect the relative expression of GmFT1a gene with GmActin as the internal standard gene. . The primer sequences are as in 2 in the above step 2.

The results are shown in Figure 2. Under the short-day treatment, the expression level of GmFT1a gene in each variety was very low; while under the long-day treatment, the expression of GmFT1a gene was low in early-maturing varieties and higher in late-maturing varieties. With the delay of maturity, there is a gradually increasing trend. It also indicated that the GmFT1a gene was associated with flowering and maturity.

Example 2. Obtaining and functional verification of GmFT1a soybean

First, the acquisition of GmFT1a soybean

1. Construction of recombinant expression vector pTF101.1-GmFT1a

(1) Using pMD18-T-simple connected with GmFT1a as a template, using GmFT1a-F-XbaI: TCTAGAATGCCTAGATCAACGGACCCTCT and GmFT1a-R-AscI: GGCGCGCC TTATCTTCTTCTTCCACTGCTT as primers for PCR amplification to obtain a PCR product, that is, both ends contain XbaI and the GmFT1a fragment of AscI (545 bp in size).

(2) Double-enzyme digestion of the GmFT1a fragment containing XbaI and AscI at both ends obtained in the above step (1) with restriction endonucleases XbaI and AscI to recover the GmFT1a fragment; 1. The vector was double-enzyme digested, and the backbone vector was recovered; T4 ligase was used to connect the GmFT1a fragment and the backbone vector, and the ligation reaction was carried out at 16°C to obtain the ligated product.

(3) The ligation product obtained in the above step (2) was transformed into Escherichia coli DH5α (purchased from Tiangen Biochemical Technology Co., Ltd.), coated on a LB solid plate containing Kan, cultured at 37°C for 12-16h, and single colonies were picked for bacterial growth. Liquid PCR verification (verification primers are GmFT1a-F-XbaI: TCTAGAATGCCTAGATCAACGGACCCTCT and GmFT1a-R-AscI: GGCGCGCCTTATCTTCTTCTTCCACTGCTT), the positive transformant with a size of 545bp obtained by PCR amplification is named as the recombinant expression vector pTF101.1-GmFT1a , and handed it over to BGI for sequencing.

The sequencing results show that the recombinant expression vector pTF101.1-GmFT1a is a DNA fragment that replaces the DNA molecule shown in sequence 1 between the XbaI and AscI restriction sites of the pTF101.1 vector, and keeps other sequences of the pTF101.1 vector unchanged. , the resulting vector.

2. Recombinant Agrobacterium acquisition

Take 1 μg of the recombinant expression vector pTF101.1-GmFT1a prepared in the above step 1 to transform the competent cells of Agrobacterium tumefaciens EHA101, and culture them on YEP medium (containing kanamycin 50 mg/L) for two days at 28°C. Positive clones were identified by PCR using primers GmFT1a-F-XbaI:TCTAGAATGCCTAGATCAACGGACCCTCT and GmFT1a-R-AscI:GGCGCGCCTTTATCTTCTTCTTCCACTGCTT (product size was 545bp). The positive bacterial solution identified by PCR was named recombinant Agrobacterium EHA101.1::pTF101.1-GmFT1a.

3. Acquisition and identification of GmFT1a soybean

(1) Obtaining GmFT1a soybean

The recombinant Agrobacterium EHA101.1::pTF101.1-GmFT1a obtained in the above step 2 was transformed into the soybean variety Jack in the third maturity group (MGIII). The soybean genetic transformation process mainly refers to "Zhang Z, Xing A, Staswick P. , et al.The use of glufosinate as a selective agent in Agrobacterium-mediated transformation of soybean[J].Plant Cell, Tissue and Organ Culture, 1999,56(1):37-46.", respectively obtain 10 strains of T ₀ generation transfer GmFT1a soybean plants.

(2) Identification of GmFT1a-transformed soybean

GmFT1a soybean seeds of T ₀ generation (T ₁ generation) were planted in the greenhouse of the Institute of Crop Science, Chinese Academy of Agricultural Sciences (25°C, humidity 60%-80%). L glufosinate smearing and screening treatment, 5-7 days later, the phenotype was observed and statistically screened, the leaves of the glufosinate-resistant plants were sampled, and PCR identification was performed to obtain the positive T ₁ generation transgenic GmFT1a soybean plants. The specific steps of PCR identification are as follows: extract the DNA of the taken leaves and perform bar gene detection (bar gene detection primers: Bar-F: GCACCATCGTCAACCACTACATC and Bar-R: CAGAAACCCACGTCATGCCAGTT, the product size is 430bp, Figure 3A); extract the RNA of the taken leaves , and detected GmFT1a (GmFT1a gene detection primers: RTGmFT1a-F: GGAGCCTTTCACAAGTAGCGTTTCTA and RTGmFT1a-R: AATTCCAGCAAAGTCTCTGGTGTT, product size is 397bp, Figure 3B).

The PCR identification results of some T ₁ -generation GmFT1a soybeans are shown in Figure 3: As can be seen from the figure, the Bar-F/Bar-R primers were PCR amplified in T ₁ -generation GmFT1a soybeans to obtain a band with a size of 430 bp , RTGmFT1a-F/RTGmFT1a-R primers were PCR amplified in T ₁ generation transgenic GmFT1a soybean to obtain a band with a size of 397bp. The positive T ₁ generation transgenic GmFT1a soybean lines #2, #3, #4, #9, #10 were selected for the following experiments.

2. Flowering situation of GmFT1a soybean

The flowering period of the positive T ₁ generation transgenic GmFT1a soybean lines #2, #3, #4, #9, #10 and wild-type soybean plants (WT) was counted. The statistical method of flowering period was that the plants entered R1 after emergence. The number of days in which the first flower appears at any node on the main stem. The number of plants selected for each line is shown in Table 1. The experiment was repeated 3 times, and the results were averaged.

The statistical results are shown in Table 1. The results showed that the average flowering period of T ₁ generation transgenic GmFT1a soybean lines #2, #3, #4, #9 and #10 were 35.4 days, 30.6 days, 37.8 days, 36.4 days and 38.3 days, respectively. Flower phenotype; while the flowering period of wild-type soybean varieties was 29.4 days, and the flowering period of T ₁ generation transgenic GmFT1a soybean was significantly later than that of wild-type soybean varieties. When the T ₁ generation transgenic GmFT1a soybean lines #2, #3, #4, #9 and #10 flowered, the wild type had set pods, and the pods reached 2-3 cm in length (Figure 4). It can be seen from the above results that the GmFT1a gene has the function of delaying the flowering period of soybean.

Table 1. Flowering period of GmFT1a soybeans of T ₁ generation

Claims (8)

1. The application of a protein whose amino acid sequence is shown in Sequence 2 or its related biological material in regulating soybean flowering and/or maturity; The relevant biological material is any one of the following A1) to A12): A1) A nucleic acid molecule encoding the protein; A2) an expression cassette containing the nucleic acid molecule of A1); A3) a recombinant vector containing the nucleic acid molecule of A1); A4) a recombinant vector containing the expression cassette of A2); A5) a recombinant microorganism containing the nucleic acid molecule of A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic soybean cell line containing the nucleic acid molecule of A1); A10) A transgenic soybean cell line containing the expression cassette of A2); A11) A transgenic soybean cell line containing the recombinant vector described in A3); A12) A transgenic soybean cell line containing the recombinant vector described in A4). 2 . The application according to claim 1 , wherein the regulation is advanced or delayed. 3 . 3. Application of the protein whose amino acid sequence is shown in SEQ ID NO: 2 or its related biological material in the following (1) or (2): (1) Cultivate transgenic soybeans with earlier or later flowering period; (2) Cultivate transgenic soybeans with earlier or later maturity; The relevant biological material is any one of the following A1) to A12): A1) A nucleic acid molecule encoding the protein; A2) an expression cassette containing the nucleic acid molecule of A1); A3) a recombinant vector containing the nucleic acid molecule of A1); A4) a recombinant vector containing the expression cassette of A2); A5) a recombinant microorganism containing the nucleic acid molecule of A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic soybean cell line containing the nucleic acid molecule of A1); A10) A transgenic soybean cell line containing the expression cassette of A2); A11) A transgenic soybean cell line containing the recombinant vector described in A3); A12) A transgenic soybean cell line containing the recombinant vector described in A4). 4 . The application according to claim 1 , wherein: A1) the nucleic acid molecule is a cDNA molecule whose coding sequence is shown in SEQ ID NO: 1. 5 . 5. The application according to any one of claims 1-3, wherein the flowering period is the number of days that the plant enters the R1 stage after emergence. 6. A method for cultivating a transgenic soybean with delayed flowering period, comprising the step of overexpressing a protein with an amino acid sequence as shown in sequence 2 in the recipient soybean to obtain a transgenic soybean; the flowering period of the transgenic soybean is later than the Receptor soybean. 7. The method according to claim 6, wherein the overexpression method is to introduce the gene encoding the protein whose amino acid sequence is as shown in SEQ ID NO: 2 into the recipient soybean; The nucleotide sequence of the gene encoding the protein is SEQ ID NO:1. 8. The method according to claim 6 or 7, wherein the flowering period is the number of days that the plant enters the R1 stage after emergence.

Images