CN114805508B - Rice heading stage gene DHD3 function and application - Google Patents

Abstract

The application discloses a gene for the heading stage of riceDHD3And applications thereof. The related protein DHD3 in the heading stage and the coding gene thereof can regulate and control the ear length, the grain number per ear, the primary branch number and the secondary branch number of plants; the plant spike length, the grain number per spike, the primary branch number and the secondary branch number can be increased by introducing the coding genes of the plant spike period gene related proteins into plants, and the breeding purpose can be realized by hybridization and transgenosis. The plant heading stage related protein DHD3 and the coding gene thereof have practical significance in cultivating transgenic plants with heading stage changed.

Description

Rice heading stage geneDHD3Function and application

Technical Field

The application relates to the biotechnology field and the plant breeding field, in particular to a gene in the heading stage of riceDHD3Functions and applications.

Background

Rice is one of the most important food crops in the world. The yield of rice is closely related to the grain safety of China. With the continuous increase of population, the gradual decrease of cultivation area, and the increase of the yield per unit area of rice are always an important task for breeding workers. The yield of rice is affected by various genetic factors, environmental factors and interactions thereof. The flowering period (also called heading period) of rice is one of important agronomic characters affecting the yield of rice, and the heading period of different rice varieties can adapt to the illumination air temperature conditions of different areas, so that the optimal yield is obtained. The rice plants can be accumulated in a nutritional growth way for a long time after the rice plants are later in heading, and more rice ears and more single-ear seeds can be developed in a growth stage to obtain more sufficient nutrients, so that the yield per unit area of the rice is improved. Therefore, the gene delaying the heading time of the rice is mined, the action mechanism and the interaction relation with environmental factors are explored, corresponding biotechnology such as transgenosis, molecular marker assisted breeding or gene editing is developed, the rice variety is improved, a new rice variety with a proper heading period is obtained, the rice yield in unit area is improved, and the method has important significance for rice breeding and improvement work.

Rice is a short-day plant whose flowering time is mainly affected by the length of sunlight, i.e., photoperiod. Genes reported in the prior art for regulating the heading date of rice are mostly related to photoperiod. Except photoperiod, nutrition, temperature, drought, salt, hormone and the like have influence on the heading date of rice. In the short-day condition of sunlight, the sunlight,Hd1activating the florigen geneHd3aIs used for promoting the flowering of rice. Transcription factor specific to rice under long sunlightEhd1PromotingRFT1So that the rice can also bloom at a later time. Environmental factors such as low temperature and drought can also be inhibited by ABF1, bZIP40 and Ghd7Ehd1Thereby inhibiting flowering in rice.

Searching more functional genes in the heading stage related to environmental influence, analyzing the molecular mechanism and the interrelation with other heading stage genes, perfecting the regulation network in the heading stage, and having important significance for optimizing the variety cultivation in the heading stage of rice.DHD3A heat shock protein transcription factor (Heat shock transcription factor, HSF) is encoded. Heat shock proteins (Heat shock proteins, HSPs) are molecular chaperones that are widely found in organisms and maintain or restore protein homeostasis under stress conditions. Heat shock transcription factors (Heat shock transcription factors, HSFs) are a class of genesTranscription factors that control expression of HSPs are over promoter-bound heat shock elements (Heat shock element, HSEs). There have been many reports on the role of HSFs in plants, most of which are associated with abiotic stresses such as heat stress, drought, salt stress, cold, etc. There are few reports on the time of flowering of HSFs, and only a few reports on the time of flowering of HSFs in arabidopsis.

Disclosure of Invention

The inventor selects the heading stage related protein (DHD 3) selected from heading stage phenotypes through screening of a large-scale rice transcription factor overexpression library, and shows that the protein is over-expressed through subsequent experimental researchesDHD3When the method is used, the heading period of the rice can be delayed, and the size of the rice spike and the number of seeds per spike can be obviously increased, so that the method is proved to be capable of regulating and controlling the length of the rice spike, the number of seeds per spike, the number of primary branches and the number of secondary branches, and finally the method is completed. So far, there is no report about the relation between HSFs and the heading date of rice.

The present application first provides the use of DHD3 protein or a gene encoding it in plant breeding in any one, two, three, four or five of the following:

p1, regulating and controlling the heading stage of plants;

p2, regulating and controlling the plant spike length;

p3, regulating and controlling the grain number of the plant spike;

p4, regulating and controlling the primary branch number of the plant;

p5, regulating and controlling the secondary branch number of the plant;

the DHD3 protein is any one of the following:

(A1) A protein with an amino acid sequence of SEQ ID No. 1;

(A2) The amino acid sequence shown in SEQ ID No.1 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues and is derived from rice protein with the same function;

(A3) A protein which has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and is derived from rice and has the same function;

(A4) A fusion protein obtained by ligating the N-terminal and/or C-terminal of the protein defined in any one of (A1) to (A3) with a protein tag;

in a preferred mode, the protein tag is a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and/or a SUMO tag.

Wherein identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity. In the above protein, the homology of 95% or more may be at least 96%, 97% or 98% identical. The 90% or more homology may be at least 91%, 92%, 93%, 94% identical. The 85% or more homology may be at least 86%, 87%, 88%, 89% identical. The 80% or more homology may be at least 81%, 82%, 83%, 84% identical.

In a specific embodiment, the expression level and/or activity of said DHD3 protein is increased in said plant, the heading time of said plant is increased and/or the ear length is increased and/or the number of grains per ear is increased and/or the number of primary shoots is increased and/or the number of secondary shoots is increased.

In particular, the plant is a monocot or dicot; further, the monocotyledonous plant is a plant of the Gramineae family; still further, the gramineous plant is a oryza plant; more specifically, the rice plant is rice; preferably, the plant is a gramineous plant, more preferably rice, wheat.

The application also provides a method for cultivating plants with increased heading time and/or increased ear length and/or increased grain per ear and/or increased primary and/or secondary branch numbers, comprising the step of increasing the expression and/or activity of DHD3 protein in a recipient plant;

the DHD3 protein is any one of the following:

(A1) A protein with an amino acid sequence of SEQ ID No. 1;

(A2) The amino acid sequence shown in SEQ ID No.1 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues and is derived from rice protein with the same function;

(A3) A protein which has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and is derived from rice and has the same function;

(A4) A fusion protein obtained by ligating the N-terminal and/or C-terminal of the protein defined in any one of (A1) to (A3) with a protein tag;

in a preferred mode, the protein tag is a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and/or a SUMO tag.

In specific embodiments, a nucleic acid molecule capable of overexpressing a DHD3 protein is introduced into a recipient plant to obtain a transgenic plant; or by crossing plant material containing said nucleic acid molecule expressing DHD3 protein as male parent or female parent into a recipient plant.

Preferably, the nucleic acid molecule of the DHD3 protein is any one of the following:

(B1) A DNA molecule shown in SEQ ID No.2 or SEQ ID No. 3;

(B2) A DNA molecule that hybridizes under stringent conditions to the DNA molecule defined in (B1) and encodes said DHD3 protein;

(B3) A DNA molecule having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the DNA sequence defined in any one of (B1) to (B2) and encoding the DHD3 protein.

The stringent conditions may be as follows: 50℃in 7% Sodium Dodecyl Sulfate (SDS), 0.5M Na ₃ PO ₄ Hybridization with 1mM EDTA, rinsing in2 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50 ℃, at 7% SDS、0.5M Na ₃ PO ₄ Hybridization with 1mM EDTA, rinsing in 1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M Na ₃ PO ₄ Hybridization with 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M Na ₃ PO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M Na ₃ PO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; the method can also be as follows: hybridization was performed in a solution of 6 XSSC, 0.5% SDS at 65℃and then washed once with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

In the above nucleic acid molecules, homology refers to the identity of nucleotide sequences. The identity of nucleotide sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, by using blastp as a program, the Expect value is set to 10, all filters are set to OFF, BLOSUM62 is used as Matrix, gap existence cost, per residue gap cost and Lambda ratio are set to 11,1 and 0.85 (default values), respectively, and identity of a pair of nucleotide sequences is searched for and calculated, and then the value (%) of identity can be obtained.

In the nucleic acid molecule, the homology of 95% or more may be at least 96%, 97% or 98% identical. The 90% or more homology may be at least 91%, 92%, 93%, 94% identical. The 85% or more homology may be at least 86%, 87%, 88%, 89% identical. The 80% or more homology may be at least 81%, 82%, 83%, 84% identical.

In the manner achieved by transgenesis, the introduction of the nucleic acid molecule capable of overexpressing the DHD3 protein is achieved by a recombinant expression vector, wherein the expression cassette contained therein refers to DNA capable of expressing DHD3 in a host cell, which DNA may include not only the initiation ofDHD3Promoters for gene transcription, and may also include terminationDHD3A terminator of transcription. Further, the expression cassetteEnhancer sequences may also be included. Promoters useful in the present application include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: ubiquitin gene Ubiqutin promoter (pUbi); a constitutive promoter of cauliflower mosaic virus 35S; wound-inducible promoters from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiol 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5, 057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN 101063139B (China patent 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolin, napin, oleosin, and soybean beta-glycin (Beachy et al (1985) EMBO J. 4:3047-3053)). They may be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g., odell et al (I) ⁹⁸⁵ ) Nature 313:810; rosenberg et al (1987) Gene, 56:125; guerineau et al (1991) mol. Gen. Genet, 262:141; proudfoot (1991) Cell, 64:671; sanfacon et al Genes Dev., 5:141; mogen et al (1990) Plant Cell, 2:1261; munroe et al (1990) Gene, 91:151; ballad et al (1989) Nucleic Acids Res.17:7891; joshi et al (1987) Nucleic Acid Res., 15:9627).

Construction of a kit comprising the aboveDHD3Recombinant expression vectors for gene expression cassettes. The plant expression vector can be binary agrobacterium vector or Gateway system vector, such as pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301. pCAMBIA1300, pBI121, pGWB411, pGWB412, pGWB405, pCAMBIA1391-Xa or pCAMBIA1391-Xb. UsingDHD3When constructing the recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiqutin promoter (pUbi) and the like can be added before transcription initiation nucleotide thereof, and can be used alone or in combination with other plant promoters; in addition, when the gene of the present application is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants.

The recombinant expression vector may be a plasmid, cosmid, phage, or viral vector. In a specific embodiment of the present application, the recombinant expression vector is specifically pCAMBIA1390, the structure of which is shown in fig. 1. The recombinant vector of the application is expressed in pCAMBIA1390-DHD3Carrier bodyPst IInserting DNA fragment shown in SEQ ID No.2 between enzyme cutting sitesDHD3Genes). Specifically, the over-expression vector containing the DNA fragment is introduced into the recipient plant, specifically: plant cells or tissues are transformed by conventional biological methods using Ti plasmids, ri plasmids, plant viral vectors, direct DNA transformation, microinjection, conductance, agrobacterium-mediated, etc., and the transformed plant tissues are grown into plants.

In particular, the plant is a monocot or dicot; further, the monocotyledonous plant is a plant of the Gramineae family; still further, the gramineous plant is a oryza plant; more specifically, the rice plant is rice; preferably, the plant is a gramineous plant, more preferably rice, wheat.

Further, the method comprises the step of breeding and obtaining the offspring of the recipient plant on the basis of the first generation of the recipient plant.

The application finds the related protein gene in heading stage through screeningDHD3Experiments prove that the related protein DHD3 in the heading stage and the coding gene thereof can regulate the heading stage, the ear length, the number of grains per ear, the number of primary branches and the number of secondary branches of plants. The expression of the over-expression heading stage related protein DHD3 coding gene can obviously increase the ear length, the grain number per ear, the primary branch number and the secondary branch number by increasing the heading stage of plants, and proves that the heading stage related protein DHD3 and the gene thereof play an important role in regulating and controlling the heading stage, the ear length, the grain number per ear, the primary branch number and the secondary branch number. The application not only provides a basis for further elucidating the molecular mechanism of the heading period of plants, but also provides new gene resources and breeding resources for plant breeding. The related protein DHD3 in the heading stage, the encoding gene and the nucleic acid molecule expressed by the over-expressed gene can be used for cultivating high-yield plants; obtained by the applicationDHD3The transgenic plant with increased gene expression can be used as a new plant germplasm material for researching the molecular mechanism of the plant in the heading stage and finding more developmental genes relevant to the regulation of the plant in the heading stage. The application has important application value for effectively regulating the heading date of plants by utilizing the gene resources through genetic breeding and genetic engineering methods.

Drawings

FIG. 1 shows a pCAMBIA1390 vector map.

FIG. 2A shows the Kitaake and wild riceDHD3Phenotype of the gene over-expression strains OE1, OE3, OE 8;

FIG. 2B shows wild rice Kitaake andDHD3phenotype of the snapping of the gene over-expression strains OE1, OE3, OE 8;

FIG. 2C shows wild rice Kitaake andDHD3gene-overexpressing strains OE1, OE3, OE8DHD3Relative expression amount of the gene;

FIG. 2D shows wild rice Kitaake andDHD3the heading period of the gene over-expression strains OE1, OE3 and OE 8;

FIG. 2E shows the Kitaake and wild riceDHD3Spike length comparison of gene overexpression strains OE1, OE3 and OE 8;

f in FIG. 2 is the wild type rice Kitaake andDHD3comparing the grain number of each spike of the gene overexpression strains OE1, OE3 and OE 8;

g in FIG. 2 is the wild type rice Kitaake andDHD3comparing primary branch numbers of gene overexpression strains OE1, OE3 and OE 8;

in FIG. 2, H is the wild type rice Kitaake andDHD3secondary stem number comparison of gene overexpression lines OE1, OE3, OE 8.

* Represented inP <The difference at the level of 0.01 is very significant.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The quantitative tests in the following examples were all set up in triplicate and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

Rice kitak (also referred to as wild type rice, abbreviated as WT) in the following examples: described in, for exampleGaoH, zhengXM, wanJM., et al, in the following literature.Ehd4 encodes a Novel and OryzaGenomic-specific regulator of photo periodic flowering in rice PLOS GENET 2013, 9 (2): e1003281. In this document "Kita-ake". The biological material is available to the public from the national academy of agricultural sciences for crop science research, and is used only for repeated experiments related to the present application, and is not used for other purposes.

The pCAMBIA1390 vector is a commercial vector, which is available to the public through commercial channels or related institutions, and also available from the national academy of agricultural sciences.

The Agrobacterium used in the examples below was Agrobacterium tumefaciens EHA105 [. Sup.105 ]Agrobacterium tumefaciensEHA 105), described in the following documentAgrobacteriumhelper plasmids for gene transfer to plants, hood, elizabeth E, gelvin, stanton B, melchers, leo S, hoekema, andre Transgenic research, 2 (4): p.208-218 (1993), which is available to the public from national academy of agricultural sciences crop science research, is used only for repeated experiments related to the application, and is not used for other purposes.

Example 1, the heading date-related protein DHD3 can regulate the grain size per spike of rice, the number of primary shoots and the number of secondary shoots

The inventor screens related proteins in heading stage selected from heading stage phenotypes through screening large-scale rice transcription factor overexpression libraries, and particularly the related proteins are derived from rice Kitaake @ in heading stage phenotypesOryza sativavar, kitaake) heading date related protein, which is named DHD3. The amino acid sequence of DHD3 in the rice Kitaake is SEQ ID No.1,DHD3the coding sequence (CDS sequence) of the gene is SEQ ID No.2,DHD3the genomic sequence of the gene was SEQ ID No.3 (LOC_Os 03g 12370). Subsequent experimental researches show that the grain length, the grain number per spike and the primary branch number and the secondary branch number of the rice can be regulated.

1. Overexpression vector pCAMBIA1390-DHD3Construction of (3)

1、DHD3Gene acquisition

Extraction fieldThe total RNA of the raw Kitaake is reversely transcribed into cDNA, and the cDNA is taken as a template, andDHD3-cds-FDHD3PCR amplification with-cds-R as primer to yield 1233 bpDHD3And (3) a gene.

DHD3The genome sequence of the gene is shown as SEQ ID No.3,DHD3the cDNA of the gene is SEQ ID No.2, which codes protein DHD3, and the amino acid sequence of the protein DHD3 is SEQ ID No.1.

The primers were as follows:

DHD3-cds-F: 5’- TCTGCACTAGGTACCTGCAGATGGGCTCTAAGAAGCGGT-3' (underlined sequence is the vector linker sequence)

DHD3-cds-R: 5’-ATGGATCCGTCGACCTGCAGTCAAGCTTCGGTAATGACAT-3' (underlined sequence is the vector linker sequence)

2、DHD3Construction of the overexpression vector

The pCAMBIA1390 vector was digested singly with restriction enzyme PstI, and the linear plasmid of about 10820bp was recovered to obtain a large vector fragment, and the circular vector map of the pCAMBIA1390 vector is shown in FIG. 1. A10820 bp linear plasmid was obtained by the above step 1 using an In-Fusion enzyme (www.clontech.com, cat# ST 0344) from ClontechDHD3The gene In-Fusion is connected to obtain recombinant plasmid named pCAMBIA1390-DHD3。

Sequencing shows that the recombinant plasmid pCAMBIA1390-DHD3For insertion between the Pst I cleavage sites of the pCAMBIA1390 vectorDHD3The vector thus obtained.

2. ConstructionDHD3Transgenic plants with over-expressed genes and identification of transgenic plants

1. Construction of transgenic plants

Recombinant plasmid pCAMBIA1390-DHD3Introducing Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens EHA105/pCAMBIA1390-DHD3。

2、DHD3Obtaining of Gene-overexpressed Rice

EHA105/pCAMBIA1390-DHD3Transferring into rice Kitaake @Oryza sativa) (hereinafter abbreviated as recipient rice) mature embryo callus, the specific steps are as follows:

(1) Suspension culture of recombinant Agrobacterium EHA105/pCAMBIA1390 with liquid LB Medium containing 50. Mu. Mol/L kanamycin-DHD3Bacterial suspension with OD600nm approximately equal to 0.5 is obtained.

(2) Mixing mature embryo embryogenic callus of rice Kitaake cultured for one month with the diluted bacterial liquid in the step (1), infecting for 30min, sucking dry bacterial liquid on the surface of the callus by adopting filter paper, and transferring into N6 solid co-culture medium (N6 mixed medium formula comprises potassium nitrate (2800 mg/L), ammonium sulfate (463 mg/L), monopotassium phosphate (400 mg/L), magnesium sulfate (MgSO) ₄ •7H ₂ O) (185 mg/L), calcium chloride (CaCl) ₂ •2H ₂ O) (165 mg/L), disodium ethylenediamine tetraacetate (37.3 mg/L), ferrous sulfate (FeSO) ₄ •7H ₂ O) (27.8 mg/L), manganese sulfate (MnSO ₄ •H ₂ O) (4.4. 4.4 mg/L), zinc sulfate (ZnSO) ₄ •7H ₂ O) (1.5 mg/L), boric acid (1.6 mg/L), potassium iodide (0.8 mg/L), vitamin B1 (thiamine hydrochloride) (1.0 mg/L), vitamin B6 (pyridoxine hydrochloride) (0.5 mg/L), niacin (0.5 mg/L), glycine (2.0 mg/L), sucrose (20000 mg/L). Weighing 24.1g of N6 mixed culture medium, heating, stirring, dissolving in 1000ml of distilled water, regulating pH to 5.8 by sodium hydroxide, sterilizing at 115 ℃ under high pressure for 20 minutes to obtain an N6 solid co-culture medium), and co-culturing for 3d at 24 ℃ to obtain the co-cultured callus.

(3) Inoculating the callus subjected to the co-culture treatment in the step (2) on an N6 solid screening medium (a medium obtained by adding hygromycin to the N6 solid screening medium, wherein the mass concentration of hygromycin in the N6 solid screening medium is 150 mg/L) with the hygromycin at the mass concentration of 150mg/L, and culturing for the first screening.

(4) Healthy callus is picked on the 16 th day from the beginning of the first screening, transferred into an N6 solid screening culture medium containing hygromycin with the mass concentration of 200mg/L (the culture medium obtained by adding hygromycin into the N6 solid screening culture medium, wherein the mass concentration of hygromycin in the N6 solid screening culture medium is 200 mg/L) for culturing and carrying out the second screening, and the healthy callus is obtained as the resistant callus after the first sub-1 every 15 days.

(5) Transferring the resistant callus obtained in the step (4) into a differentiation medium (differentiation medium: 6-BA2mg, NAA0.2mg, N6 mixed medium 4g, hydrolyzed casein 1g, inositol 0.1g, sucrose 25g, sorbitol 2.4g, agar powder 7g, deionized water added to 1L) containing hygromycin with a mass concentration of 150mg/L, performing differentiation culture at 24deg.C for 45d (at this time, the aerial part height of the plant is about 15 cm), opening the bottle mouth, hardening off the seedling for 3 days, and transplanting to a greenhouse for cultivation to obtain the transgenic pCAMBIA1390- DHD3Plants (T0 generation).

3. RotationDHD3PCR identification of rice

Extracting T0 generation and T1 generation respectivelyDHD3The genome DNA of rice plant is used as template and 1390-F and DHD3-R are used as primer for PCR amplification.

The primers were as follows:

1390-F：5'-TGCCTTCATACGCTATTTATTTGC-3'；

DHD3-R：5'- CTTGACCTGATGTTTCTGGG-3'。

1390-F corresponds to 10707-10730 bp on the carrier of figure 1,DHD3the R primer corresponds to 864-883 bp of SEQ ID No. 2. If a transgenic plant can be amplified by PCR with the primers described above to obtain a DNA fragment of 927 bp, the plant is proved to be a positive transgenic plant.

For a certain T0 generation plant, if the plant and the T1 generation plant thereof are positive in PCR identification, the plant is proved to be homozygousDHD3The plant with over-expressed gene has one selfing progenyDHD3Gene overexpression lines comprising 20T 1-generation transgenesDHD3A single plant.

4. Detection of mRNA expression level of plants

For detection of transgenic offspringDHD3Gene expression level, and detection of receptor rice and T0 generation transfer by real-time quantitative PCRDHD3In vivo of paddy riceDHD3Expression of the gene. Real-time quantitative PCR was performed on a quantitative PCR apparatus (7900 real-time, applied Biosystems) according to the procedure provided at Applied Biosystems, with the rice Ubiqutin gene as an internal reference. The primers were annealed at 60℃and reacted for 40 cycles, with 3 replicates per sample. Reaction bodyWas 25. Mu.l, which included 2. Mu.l of reverse transcription product, 0.25. Mu.M forward and reverse primer, and 12.5. Mu.l of SYBRGreen mixture (available from Takara).

The primers used for real-time quantitative PCR identification were as follows:

DHD3-RT-F：5'- CATACGCCAGCTCAACACCTATGG-3'；

DHD3-RT-R：5' -AACCTTCATTGGCCCACTCCCATC-3'。

the partial detection results are shown in fig. 2C. Compared with wild rice, the rice is transformedDHD3Rice T0 generation strains OE-1, OE-3 and OE8DHD3The expression level of the gene is remarkably improved.

3. RotationDHD3Phenotype and agronomic trait investigation of rice

1. Heading date investigation

Will turn toDHD3 T ₂ The generation rice and the receptor rice are planted in Beijing cis (long sunshine area (NLD), the sunshine length is more than 15 h), the heading period of the material is investigated, and the material is photographed, wherein the heading period refers to the number of days required from sowing to 3cm length of the first spike of the plant extracted from leaf sheath. The results of the observations are shown in FIGS. 2A and D, wherein the wild type rice Kitaake; OE-1, OE-3 and OE8 represent T2-transferred DHD3 rice. FIG. 2D shows statistics of the heading date of rice material in Beijing, compared with wild riceDHD3Gene T ₂ The heading period of the generation of rice is about 13 days in advance in Beijing.

2. Spike shape investigation

And taking plants to be detected (20 plants per plant line), and counting the spike length, the grain number per spike, the primary branch number and the secondary branch number after planting and harvesting. The results are shown in FIG. 2 as B, E-H. The results showed that, compared with the wild type,DHD3the spike length, the grain number per spike, the primary branch number and the secondary branch number of the gene over-expression plant are all obviously increased. In the mature period of rice, the average heading period of the rice Kitaake (wild type), OE-1, OE-3 and OE8 plants is 61.72+/-0.65 days, 74.70 +/-0.56 days, 75.85 +/-0.54 days and 74.00 +/-0.88 days respectively, and the average heading length of the rice Kitaake (wild type), OE-1, OE-3 and OE8 plants is 13.44+/-0.12 cm, 15.35+/-0.12 cm, 15.67+/-0.17 cm and 15.51+/-0.15 cm respectively; water and its preparation methodThe average grain number per ear of rice Kitaake (wild type), OE-1, OE-3 and OE8 plants is 59.70+ -1.84, 103.96 + -2.44, 105.35 + -2.50, 108.45 + -2.27, respectively; the average primary branch numbers of rice Kitaake (wild type), OE-1, OE-3 and OE8 plants are 7.00+/-0.18, 11.26+/-0.22, 11.35+/-0.23 and 12.20+/-0.22 respectively; the average secondary stem numbers of rice Kitaake (wild type), OE-1, OE-3 and OE8 plants were 7.90+ -0.36, 13.65+ -0.54, 14.65+ -0.75 and 14.60+ -0.58, respectively. There was no significant difference in empty vector control plants and rice Kitaake plant height.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

<110> institute of crop science at national academy of agricultural sciences

<120> Rice heading date Gene DHD3 function and application

<160> 3

<210> 1

<211> 410

<212> PRT

<213> Rice

<400> 1

MGSKKRSPQHPAAAAPPPAVGGGGGGEVSGDGGASTANGPVVPKPSEVAPFLTKVYDMVSDPATDNVISWAEGGGSFVIWDSHAFERDLHRHFKHSNFTSFIRQLNTYGFRKVHPDRWEWANEGFIMGQKHLLKTIKRRKKSSQESPSEIQKAPVKTAPGTENIEIGKYGGLEKEVETLKRDKALLMQQLVDLRHYQQTSNLEVQNLIERLQVMEQNQQQMMALLAIVVQNPSFLNQLVQQQQQQRRSNWWSPDGSKKRRFHALEQGPVTDQETSGRGAHIVEYLPPVPETSGQVNPVEGAICSANSQPVPSPAVATPMDMQTSNVADTLGSSEEPFADNSTLHEWDDNDMQLLFDDNLDPILPPFENDGQMGPPLSVQDYDFPQLEQDCLMEAQYNSNNPQYADVITEA

<210> 2

<211> 1233

<212> DNA

<213> Rice

<400> 2

ATGGGCTCTAAGAAGCGGTCGCCTCAGCATCCGGCCGCCGCGGCGCCCCCTCCCGCCGTCGGCGGCGGCGGCGGCGGCGAGGTCTCCGGCGATGGTGGCGCCTCGACGGCGAACGGGCCGGTGGTGCCGAAGCCGTCGGAGGTGGCGCCGTTCCTGACGAAGGTGTACGACATGGTCTCGGACCCCGCGACCGACAACGTTATCTCGTGGGCCGAGGGCGGCGGCAGCTTCGTGATCTGGGACTCGCACGCCTTCGAGCGCGACCTCCACAGGCACTTCAAGCACAGCAATTTCACCAGCTTCATACGCCAGCTCAACACCTATGGATTTCGTAAAGTTCACCCTGATAGATGGGAGTGGGCCAATGAAGGTTTTATTATGGGCCAAAAACATCTTCTGAAGACCATTAAGAGGAGGAAGAAGTCTTCTCAGGAATCACCTAGCGAGATACAGAAGGCGCCTGTCAAAACTGCACCTGGTACTGAAAATATTGAGATAGGAAAATATGGTGGCCTTGAAAAGGAGGTTGAAACCCTTAAGAGGGATAAAGCTCTTCTCATGCAGCAGCTTGTAGATCTCAGGCACTACCAGCAAACATCTAACCTTGAAGTGCAGAATTTAATTGAACGGCTTCAAGTAATGGAACAGAACCAGCAGCAGATGATGGCACTTCTAGCAATCGTTGTCCAGAATCCTAGTTTTCTCAACCAGCTTGTGCAGCAACAGCAGCAGCAGCGCAGATCCAACTGGTGGAGTCCTGATGGAAGCAAGAAAAGGAGATTTCATGCTCTTGAGCAGGGCCCTGTAACTGATCAGGAGACCTCTGGCCGTGGGGCACATATTGTTGAATATCTCCCACCTGTCCCAGAAACATCAGGTCAAGTAAATCCAGTGGAAGGAGCCATTTGTTCGGCCAACTCACAACCAGTTCCAAGTCCTGCAGTTGCCACACCCATGGACATGCAAACGTCTAACGTTGCTGATACTCTCGGTTCATCTGAGGAGCCTTTCGCTGATAACTCTACTCTACATGAATGGGATGATAACGACATGCAGCTTCTGTTTGATGATAACCTAGACCCAATACTTCCACCATTTGAGAATGATGGTCAAATGGGCCCTCCTTTGAGTGTTCAAGATTATGATTTTCCGCAGTTAGAGCAGGATTGTCTGATGGAAGCACAATATAACTCCAACAATCCTCAATATGCTGATGTCATTACCGAAGCTTGA

<210> 3

<211> 3832

<212> DNA

<213> Rice

<400> 3

ACTACTAGTACACCAGACGACAACACACACACAAAAAAAAAAAAGAAGAGAAAAACCGAACGAAAATCCCCTCGCGCAGACGACTACTACATCCTTCTCGTCTCATCCCGTCGACCCGCCGCCGCCTCAATCTCGAAGCCTCGGCGAGGCTAGGGTTTCTGCGTCTCCATGGGCTCTAAGAAGCGGTCGCCTCAGCATCCGGCCGCCGCGGCGCCCCCTCCCGCCGTCGGCGGCGGCGGCGGCGGCGAGGTCTCCGGCGATGGTGGCGCCTCGACGGCGAACGGGCCGGTGGTGCCGAAGCCGTCGGAGGTGGCGCCGTTCCTGACGAAGGTGTACGACATGGTCTCGGACCCCGCGACCGACAACGTTATCTCGTGGGCCGAGGGCGGCGGCAGCTTCGTGATCTGGGACTCGCACGCCTTCGAGCGCGACCTCCACAGGCACTTCAAGCACAGCAATTTCACCAGCTTCATACGCCAGCTCAACACCTATGTGAGATTCCCTTGATCCCTGTGTTCGTTTGTTTCTGATGCGCGAATTCGGTGCCATTTCCAGTTGGTTGGACGAAATCGGTAGTGAAATCTGAGTTTCTGTTCCCAATTTGTTGTTTATTATCACGGCTAGACAGCAAATCTTGCTTGCAATTATAAATTGGGCAGTAGCTTCCGATGCACTGCATATGAATTTGTTTGAATCGTGACTGCGTGTTATATGATGTTACTTTCTTCTATTTTGTGCCTTTTAAGTTGATTGCGTGTATTAGGGATTATCTGCCATTTTGGAGTTAATCACTTATTAAATTTTAACTACGTTGGAAGCTGTTGGCGATATAGTTGGATGCCTTTCTTCTTCTAGTCGAAAGACACAATAGAACTAGTTTCTGCGGTGGCTTTCTATTCAACAACAACTTCTAGAGTTCTAGTACATAAAACACGTCATTGGGGGTGGGGACTAATATTGTTAATTTTGAGACCAGTTTCTGTTCTCTTAATGTTTTGTGAATTTGATCGTATGAAAGCTGGCTGTAGAAACTATGCCAAACTCTTGGCTTTAAATTACAGGGGAATGATATGTGTTGCCTATCACTACTTCTAAAAGTCTATTTCCCCCATATTTGTATTTAGTGAACTTCAGAACTAGAGAAAGCATGATGTTATAACCTACCATCATGCTGTATAAGAAGAATATGTTCCCTCTTGTTTGGCTGAAAGAAATGCATGTTTGGTTGTGCTGATATTGTACTGCTATTATCTTCTTCTGTGTCATTTGCCTCAATACATTGTTTTATTTGAATTTGAACTTCCTTTTCACAATCGAATTTGTCTGATGAAATATAAGATTATGAATTTGCTCTTTTATTGAACTATATGGACACTTAATTTTGTGCTTTTGGCAAATCCATGTCCTCATTTTGATTTCTGGATAAATCACTGGACTCTTGCACCCAGGATTTCTTCTGATGTCTAATTACTTAAATGCGAAAATCACCTGACTTTTGCTCACTGGGTTGCTTTCCTGTAGTTAGGAGTAGTTCTATTTAACCATCTATTAGTTGTTCTTGGCTTCATATACTCAGTAAAACTTAAAAACAAAGCCTGAAAAGTGAAATCTCCAATGGGATCAGTAGAAACATTACTTTATCTGCTTTCATTGATGTTCTCTATTCTTTTGGAGCATATGTTTTATATTAGCTGAAGTTACTCAAGTTTCCTTTCATAATCAGGGATTTCGTAAAGTTCACCCTGATAGATGGGAGTGGGCCAATGAAGGTTTTATTATGGGCCAAAAACATCTTCTGAAGACCATTAAGAGGAGGAAGAAGTCTTCTCAGGAATCACCTAGCGAGATACAGAAGGCGCCTGTCAAAACTGCACCTGGTACTGAAAATATTGAGATAGGAAAATATGGTGGCCTTGAAAAGGAGGTTGAAACCCTTAAGAGGGATAAAGCTCTTCTCATGCAGCAGCTTGTAGATCTCAGGCACTACCAGCAAACATCTAACCTTGAAGTGCAGAATTTAATTGAACGGCTTCAAGTAATGGAACAGAACCAGCAGCAGATGATGGCACTTCTAGCAATCGTTGTCCAGAATCCTAGTTTTCTCAACCAGCTTGTGCAGCAACAGCAGCAGCAGCGCAGATCCAACTGGTGGAGTCCTGATGGAAGCAAGAAAAGGAGATTTCATGCTCTTGAGCAGGGCCCTGTAACTGATCAGGAGACCTCTGGCCGTGGGGCACATATTGTTGAATATCTCCCACCTGTCCCAGAAACATCAGGTCAAGTAAATCCAGTGGAAGGAGCCATTTGTTCGGCCAACTCACAACCAGTTCCAAGTCCTGCAGTTGCCACACCCATGGACATGCAAACGTCTAACGTTGCTGATACTCTCGGTTCATCTGAGGAGCCTTTCGCTGATAACTCTACTCTACATGAATGGGATGATAACGACATGCAGCTTCTGTTTGATGATAACCTAGACCCAATACTTCCACCATTTGAGAATGATGGTCAAATGGGCCCTCCTTTGAGTGTTCAAGATTATGATTTTCCGCAGTTAGAGCAGGATTGTCTGATGGAAGCACAATATAACTCCAACAATCCTCAATATGGTAATGACTAATTACTGTATACCCTATGTTTTTGTTCATCATTTTGTGGAAAACAAGCGTGATGTCATTTTAGTTAACTGTGGAGTTTCTATGTGCATGTTTCATGCCAAATGCCAAACAATGGATGTTTACAGACCACCCTTTTAGTCTGTTGTGCTAGGATTTGGCAAAGATGACATGGAGCCTTATTCAAAGTTCAATACTTGCTTCTCAAATGGCTTTGATATTTCCTTCTGTTATTTCACGAAAGTAGTGTTTGACAACTAGAGTGATATTTTTTTTTATATCTGGTTAATTGGACAATTTTGATCACAGCCAAACCTCTTGATTTAGTTTCCTCAACCAAAACAGATCTAAGCTGTGCCTGCGTCACATTGATTATTTTCCCAATCAGCCTATTCTTTGTTTGATCATATCGGTTTCAATTCACTCTGCAGTACTTCTATACATGCCTGACATCTTCCCTTTTTCATCAGCTGATGTCATTACCGAAGCTTGATTGGTGGTCCAGGAGCATACTTGCAGTAACATTAGGTGGGTACAGTCCATTTTTAACATGAAAAAGGAATTATTCCTTAATGTGCTTTGTTAATGGAATGCTTACTTTGCGTTGCAATACCAAAGTACCAAACTGAAAGACATACCATCCTTGTTTAATTCCTCTAGCCGTTGTTTCTTACAGAACTTTAGGCTAGTATTTCGTGTCAGGCTAGGACTATATGGTCAACTAACCCTGCAACCGCCTCCAAATTGAAATTCAATCGAAAAAATATTGAACTTAATGGCTTGAACTGAATGCTTACTAAATAAACATGATTGGTCGTTAAAAAAATGCCATCAGCCATTTCTTGTAAATAAATACACGAAGCTATATTTTTTTTATTTGTATGACCAATGTTTGTTCCAGTACTGATCCAGTTTCAACATCTGCAGTTCTTCGGTGACCAACCTCCGGGCGCATCTGCACCATTGGCATCCCGAAATGGCGTCCTCAGGGTGTACCGATGAATTATGCTAACACAGAAGAAGATATAACTCTAATCTGGTTGACCATACAGAACTACCTTTCTTGTTCAAGGCACTTTTTGGGGACAGGGGACGCCTTTTCGCAGTTCTCGTCGTCTTACACTAGCGATGGTTGCTACCATCGAATTCATTTGGTGTATATACTGTTGTTCGTCTTATAAAACATGAGCAGTTTTGTACATTTACCTTGCGTATCA

Claims (13)

1. Use of a DHD3 protein or a gene encoding the same in plant breeding, wherein in said plant the expression level and/or activity of said DHD3 protein is increased and said plant breeding is an increase in plant heading date;

   the DHD3 protein is any one of the following:

   (A1) A protein with an amino acid sequence of SEQ ID No. 1;

   (A2) A fusion protein obtained by ligating the N-terminal and/or C-terminal of the protein defined in (A1) with a protein tag.
2. 2. The use according to claim 1, characterized in that: the protein tag is Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag and/or SUMO tag.
3. 3. The use according to claim 1, characterized in that: the plant is Gramineae plant.
4. 4. A use according to claim 3, characterized in that: the Gramineae plant is a Oryza plant.
5. 5. A use according to claim 3, characterized in that: the Gramineae plant is rice or wheat.
6. 6. A method of growing plants having increased heading time comprising the step of increasing the expression and/or activity of DHD3 protein in a recipient plant;

   the DHD3 protein is any one of the following:

   (A1) A protein with an amino acid sequence of SEQ ID No. 1;

   (A2) A fusion protein obtained by ligating the N-terminal and/or C-terminal of the protein defined in (A1) with a protein tag.
7. 7. The method according to claim 6, wherein: the protein tag is Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag and/or SUMO tag.
8. 8. The method of claim 7, comprising the steps of: introducing a nucleic acid molecule capable of overexpressing a DHD3 protein into a recipient plant to obtain a transgenic plant; or by crossing plant material containing said nucleic acid molecule expressing DHD3 protein as male parent or female parent into a recipient plant.
9. 9. The method according to claim 8, wherein: the nucleic acid molecule of the DHD3 protein is a DNA molecule shown as SEQ ID No.2 or SEQ ID No. 3.
10. 10. The method according to any one of claims 6 to 9, characterized in that: the plant is Gramineae plant.
11. 11. The method according to claim 10, wherein: the Gramineae plant is a Oryza plant.
12. 12. The method according to claim 10, wherein: the Gramineae plant is rice or wheat.
13. 13. The method according to claim 10, wherein: further comprising breeding to obtain progeny thereof based on the first generation of the recipient plant.