CN113980106B

CN113980106B - Small peptide for regulating and controlling sizes of plant seeds and organs, and coding gene and application thereof

Info

Publication number: CN113980106B
Application number: CN202111263865.3A
Authority: CN
Inventors: 张学琴; 曾月娟; 申思敏; 陈立群; 叶德
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2021-10-27
Filing date: 2021-10-27
Publication date: 2023-03-21
Anticipated expiration: 2041-10-27
Also published as: CN113980106A

Abstract

The invention discloses a small peptide for regulating and controlling sizes of plant seeds and organs, and a coding gene and application thereof. The invention specifically discloses a polypeptide AtZSP1 (AtZSP 1 small peptide) with an amino acid sequence of SEQ ID No.1 and application of a coding gene thereof in regulating and controlling sizes of plant seeds and organs. The invention successfully identifies a gene participating in regulating and controlling the sizes of arabidopsis seeds and organs by utilizing a T-DNA insertion mutant library and adopting a reverse genetics method and according to bioinformatics analysis for the first time, which is named as AtZSP1 gene, increases the sizes of the seeds and/or the organs of plants by a genetic engineering method, obtains AtZSP1 over-expression plants, enriches high-quality gene resources for the development and application fields of small peptides, can be well applied to the improvement of crop varieties, improves the crop yield and has important practical value for plant breeding work.

Description

Small peptide for regulating and controlling sizes of plant seeds and organs, and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to small peptides for regulating and controlling sizes of plant seeds and organs, and coding genes and application thereof.

Background

Seed size is one of the major factors affecting crop yield, and directly determines crop yield, and has long been an important goal for many crop breeding improvements. In addition, the size of plant organs is also an important trait in agriculture, horticulture, grass and other sciences. Therefore, the study of the regulatory mechanisms of seed and organ size has become an important research area in plant science. The size of plant organs is determined by cell proliferation, which increases cell number through cell division, and cell expansion, which increases cell size through cell growth. A number of genes have been identified which are involved in regulating cell proliferation and cell growth to affect plant organ size (Zhang X, guo W, du D, pu L, zhang C.Ove reppression of a main BR transcription factor ZmBZR1 in Arabidopsis enzymes and cut size of the transgenic plants. Plant Sci.2020;292 110378.). Among these genes, there are small peptides involved in this process, such as ROTUDIFOLIA 4 (ROT 4) which regulates Cell proliferation at the tip of Arabidopsis stem, and overexpression of ROT4 reduces the size of meristems, thereby reducing leaf size (Ikeuchi M, yamaguchi T, kazama T, ito T, horiguchi G, tsukaya H. ROTIFOLIA4 regulation cells promotion conversion on the body axis in Arabidopsis shot. Plant T Cell physiology.2011; 52 (1): 59-69.). Phytosulfokine-alpha (PSK-alpha) affects root growth by regulating cell expansion, and the PSK receptor gene Atpskr1-T mutant is primarily due to shortened root length due to reduced cell size (Kutschmar A, rzewuski G, stuhrwohldt N, beemster GT, inze D, saute r M.PSK-alpha proteins root growth in Arabidopsis. New Phytol.2009;181 (4): 820-31.). Although many genes have been identified that affect plant organ size, studies of the genetic and molecular biological mechanisms are still limited.

Small peptides (small peptides), broadly, refer to proteins less than 250 amino acids in length, but are also defined by 5-60 amino acids in length (Matsubayashi Y. Posttranslational modified small-peptide signals in plants. Annu Rev Plant biol.2014; 65. 385-413.). The small peptide participates in various processes such as cell proliferation, root development, pollen fertility, stomatal opening and closing, absorption and regulation of mineral elements, resistance to growth and development of diseases and insect pests and response of abiotic stress and the like. According to the characteristics of the existence of a signal peptide sequence at the N terminal, small peptides can be mainly divided into two main categories: secretory, i.e., small peptides (containing a signal peptide at the N-terminus) that are secreted to the outside of the cell to exert their effects; non-secretory, i.e., a small peptide that functions intracellularly (without a signal peptide at the N-terminus). Currently, a number of small peptides have been identified as being involved in the growth and development of plants, such as CLAVATA3 regulating the size of SAMs (Rojo E, sharma V K, kovaleva V, et al. CLV3 Is Localized to the excellular Space, where It Is desirable to activate the Arabidopsis CLAVATA Stem Cell signalling Pathway [ J ]. Plant Cell, 8978 zft 8978 (5): 969-977.); LURE directs the pollen tube to the blastocyst (Okuda S, tsutsui H, shiina K, sprunck S, takeuchi H, yui R, et al. Defensin-like polypeptide LUREs arm polen cells. Nature.2009;458 (7236): 357-61.); the RALFs family of proteins plays an important role in vegetative and reproductive growth of plants, among others (Bedinger PA, pearce G, covey PA. RALFs: peptide regulators of plant growth. Plant Signal Behav.2010;5 (11): 1342-6.; qu LJ, li L, lan Z, dresselhus T. Peptide signalling the polar tube j ourney and double fertilization. J Exp Box. 2015;66 (17): 5139-50.). However, a large amount of small peptides with unknown functions in plants are still unidentified, and the development and application of the small peptides are greatly limited due to the large amount of the small peptides in plants and the great difficulty in researching biological functions. Research shows that based on a set of comprehensive methods of bioinformatics prediction, mutant identification and gene function identification, the small peptide can be effectively identified and the biological function of the small peptide can be verified, so that the obstacles on small peptide identification caused by gene function redundancy and low abundance are successfully overcome, and the defects of complexity, time consumption and high technical requirements of the traditional biochemical analysis technology are also avoided.

The development and application of plant small peptides are a new and promising research field, and a large amount of small peptides in plants need to be mined, just as human beings know soil microorganisms, more blanks wait to be filled. Therefore, it is of great significance to identify unknown small peptides in plants and to mine their functions.

Disclosure of Invention

The technical problem to be solved by the invention is how to regulate the size of plant seeds and/or organs.

In order to solve the above technical problems, the present invention provides, in a first aspect, an application of a polypeptide that regulates a size of a seed and/or an organ of a plant or a substance that regulates an activity or a content of the polypeptide, wherein the application may be any one of the following:

d1 Use of a polypeptide or a substance modulating the activity or content of said polypeptide for modulating the size of a plant seed and/or organ;

d2 Use of) a polypeptide or a substance modulating the activity or content of said polypeptide for the preparation of a product modulating the size of a plant seed and/or organ;

d3 Use of) a polypeptide or a substance modulating the activity or content of said polypeptide for growing plants with increased or decreased seed and/or organ size;

d4 Use of) a polypeptide or a substance modulating the activity or content of said polypeptide for the preparation of a product for breeding plants having an increased or decreased size of seeds and/or organs;

d5 Use of) a polypeptide or a substance that modulates the activity or content of the polypeptide in plant breeding;

the polypeptide is named as AtZSP1 and can be any one of the following:

a1 Polypeptide of which the amino acid sequence is SEQ ID No. 1;

a2 A polypeptide which is obtained by substituting and/or deleting and/or adding more than one amino acid residue on the amino acid sequence shown in SEQ ID No.1, has more than 80 percent of identity with the polypeptide shown in A1) and has the function of regulating and controlling the size of plant seeds and/or organs;

a3 A fusion polypeptide obtained by connecting a tag to the N-terminal and/or C-terminal of A1) or A2).

A4 Polypeptide of which the amino acid sequence is SEQ ID No. 8;

a5 A polypeptide which is obtained by substituting and/or deleting and/or adding more than one amino acid residue on the amino acid sequence shown in SEQ ID No.8, has more than 80 percent of identity with the polypeptide shown in A4) and has the function of regulating and controlling the size of plant seeds and/or organs;

a6 A fusion polypeptide obtained by attaching a tag to the N-terminus and/or C-terminus of A4) or A5).

To facilitate purification of the polypeptide, a tag as shown in table 1 may be attached to the amino-terminus and/or the carboxy-terminus of the polypeptide.

Table 1: sequence of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The AtZSP1 polypeptide in A2) can be a polypeptide which has 75% or more than 75% of identity with the amino acid sequence of the polypeptide shown in SEQ ID No.1 and has the same function. The having 75% or greater than 75% identity is having 75%, having 80%, having 85%, having 90%, having 95%, having 96%, having 97%, having 98%, or having 99% identity.

The AtZSP1 polypeptide in A2) can be synthesized artificially, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The AtZSP1 polypeptide in A2) above may be a small peptide consisting of 57 amino acids. The small peptide is named as AtZSP1 small peptide.

The gene encoding the AtZSP1 polypeptide in A2) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in SEQ ID No.2, and/or performing missense mutation of one or several base pairs, and/or attaching the coding sequence of the tag shown in table 1 above to its 5 'end and/or 3' end.

Wherein, the DNA molecule shown in SEQ ID No.2 codes AtZSP1 polypeptide shown in SEQ ID No. 1.

The invention also provides an application of the biological material related to the AtZSP1 polypeptide, wherein the application can be any one of the following:

e1 Use of biological materials related to the AtZSP1 polypeptides for regulating the size of plant seeds and/or organs;

e2 Use of a biomaterial related to an AtZSP1 polypeptide for the preparation of a product for regulating the size of plant seeds and/or organs;

e3 Use of a biological material related to an AtZSP1 polypeptide for the cultivation of plants with increased or decreased seed and/or organ size;

e4 Use of a biological material related to an AtZSP1 polypeptide for the preparation of a product for the cultivation of plants with increased or decreased seed and/or organ size;

e5 Application of biological materials related to the AtZSP1 polypeptide in plant breeding;

the biomaterial may be any of the following:

b1 A nucleic acid molecule encoding an AtZSP1 polypeptide;

b2 An expression cassette comprising the nucleic acid molecule according to B1);

b3 A recombinant vector containing the nucleic acid molecule according to B1) or a recombinant vector containing the expression cassette according to B2);

b4 A recombinant microorganism containing the nucleic acid molecule according to B1), or a recombinant microorganism containing the expression cassette according to B2), or a recombinant microorganism containing the recombinant vector according to B3);

b5 A transgenic plant cell line containing the nucleic acid molecule according to B1) or a transgenic plant cell line containing the expression cassette according to B2);

b6 A transgenic plant tissue containing the nucleic acid molecule according to B1) or a transgenic plant tissue containing the expression cassette according to B2);

b7 A transgenic plant organ containing the nucleic acid molecule according to B1) or a transgenic plant organ containing the expression cassette according to B2);

d1 Nucleic acid molecules that inhibit or reduce expression of the gene encoding the AtZSP1 polypeptide;

d2 An expression cassette comprising a nucleic acid molecule according to D1);

d3 A recombinant vector containing the nucleic acid molecule according to D1) or a recombinant vector containing the expression cassette according to D2);

d4 A recombinant microorganism containing the nucleic acid molecule according to D1), or a recombinant microorganism containing the expression cassette according to D2), or a recombinant microorganism containing the recombinant vector according to D3);

d5 A transgenic plant cell line containing the nucleic acid molecule according to D1) or a transgenic plant cell line containing the expression cassette according to D2);

d6 A transgenic plant tissue containing the nucleic acid molecule according to D1) or a transgenic plant tissue containing the expression cassette according to D2);

d7 A transgenic plant organ containing the nucleic acid molecule according to D1) or a transgenic plant organ containing the expression cassette according to D2).

In the above application, the nucleic acid molecule of B1) can be a DNA molecule represented by B1) or B2) or B3) or B4) as follows:

b1 The coding sequence (CDS) is a DNA molecule or cDNA molecule as shown in SEQ ID No. 2;

b2 ) the nucleotide sequence is a DNA molecule or cDNA molecule shown in SEQ ID No. 2;

b3 A DNA molecule or cDNA molecule having 75% or more identity with the nucleotide sequence defined in b 1) or b 2) and encoding an AtZSP1 polypeptide;

b4 A DNA molecule or cDNA molecule which hybridizes with the nucleotide sequence defined by b 1) or b 2) under strict conditions and codes for AtZSP1 polypeptide.

The nucleotide sequence encoding the AtZSP1 polypeptide of the present invention can be easily mutated by one of ordinary skill in the art using known methods, such as directed evolution or point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence of the AtZSP1 polypeptide isolated in the present invention are derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode the AtZSP1 polypeptide and have the function of the AtZSP1 polypeptide.

In the above application, the stringent conditions may be as follows: hybridizing at 50 ℃ in a mixed solution of 7% Sodium Dodecyl Sulfate (SDS), 0.5MNaPO4 and 1mM EDTA, rinsing at 50 ℃,2 XSSC, 0.1% SDS; also can be: hybridizing at 50 ℃ in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, rinsing at 50 ℃,1 XSSC, 0.1% SDS; also can be: hybridizing at 50 ℃ in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing at 50 ℃ in 0.5 XSSC, 0.1% SDS; also can be: hybridizing at 50 ℃ in a mixed solution of 7% SDS, 0.5MNaPO4 and 1mM EDTA, and rinsing at 50 ℃ in 0.1 XSSC, 0.1% SDS; also can be: hybridizing at 50 ℃ in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing at 65 ℃ in 0.1 XSSC, 0.1% SDS; can also be: hybridizing in a solution of 6 XSSC, 0.5% SDS at 65 ℃ and then washing the membrane once each with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS; can also be: 2 XSSC, 0.1% SDS in a solution at 68 ℃ hybridization and washing of membranes for 2 times, 5min each, and 0.5 XSSC, 0.1% SDS in a solution at 68 ℃ hybridization and washing of membranes for 2 times, 15min each; can also be: 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS, at 65 ℃.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In the above applications, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, per residual Gap cost, and Lambda ratio to 11,1 and 0.85 (default values), respectively, and performing a calculation by searching for the identity of a pair of amino acid sequences, a value (%) of the identity can be obtained.

In the above applications, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

In the above application, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be an RNA, such as an mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

In the above application, the substance for regulating the activity or content of the polypeptide may be a substance for regulating the expression of a gene encoding the AtZSP1 polypeptide.

In the above application, the substance for regulating gene expression may be a substance for regulating at least one of the following 6: 1) Regulation at the level of transcription of said gene; 2) Regulation after transcription of the gene (i.e., regulation of splicing or processing of a primary transcript of the gene); 3) Regulation of RNA transport of the gene (i.e., regulation of nuclear to cytoplasmic transport of mRNA of the gene); 4) Regulation of translation of the gene; 5) Regulation of mRNA degradation of the gene; 6) Post-translational regulation of the gene (i.e., regulation of the activity of a polypeptide translated from the gene).

The substance for regulating gene expression may specifically be any one of the biomaterials described in B1) -B3) and D1) -D3).

In the above application, B2) said expression cassette (AtZSP 1 gene expression cassette) refers to DNA capable of expressing AtZSP1 polypeptide in host cells, which may include not only a promoter for initiating transcription of AtZSP1 gene, but also a terminator for terminating transcription of AtZSP1 gene. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter of cauliflower mosaic virus 35S: the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiol 120; a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN 2) or LAP promoter (both inducible with methyl jasmonate); heat shock promoters (U.S. patent 5,187,267); tetracycline inducible promoter (us patent 5, 057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN 101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators (see, e.g., odell et al (I985) Nature 313.

The existing expression vector can be used for constructing a recombinant vector containing the AtZSP1 gene expression cassette. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Corp.) etc. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can direct polyadenylic acid to the 3 'end of the mRNA precursor, and similar functions can be found in untranslated regions transcribed from the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (e.g., nopaline synthase gene Nos) and plant genes (e.g., soybean storage protein gene). When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The sources of the translational control signals and initiation codons are wide ranging from natural to synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound capable of producing a color change (GUS gene, luciferase gene, etc.), a marker gene for antibiotics (e.g., nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to phosphinothricin as an herbicide, hph gene conferring resistance to hygromycin as an antibiotic, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or a marker gene for chemical resistance (e.g., herbicide resistance), a mannose-6-phosphate isomerase gene providing the ability to metabolize mannose, which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

In the above application, the vector may be a plasmid vector, a cosmid vector, a phage vector, a viral vector, or an artificial minichromosome vector.

In the above application, the microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be derived from Escherichia (Escherichia), erwinia (Erwinia), agrobacterium (Agrobacterium), flavobacterium (Flavobacterium), alcaligenes (Alcaligenes), pseudomonas (Pseudomonas), bacillus (Bacillus), etc. The bacterium may specifically be Escherichia coli.

The polypeptides of the invention, including peptides, polypeptides or small peptides, whether naturally occurring or synthetic.

The present invention also provides a method of increasing the size of a plant seed and/or organ, the method comprising increasing the size of a plant seed and/or organ by increasing or increasing expression and/or activity of an AtZSP1 polypeptide in a plant.

In the method, the improvement or increase of the expression and/or activity of the AtZSP1 polypeptide in the plant is realized by improving or increasing the expression level of a coding gene of the polypeptide in the plant.

Further, the increasing or increasing expression and/or activity of an AtZSP1 polypeptide in a plant may be overexpression of a gene encoding an AtZSP1 polypeptide in a plant.

Further, the method comprises the steps of:

m1) constructing an overexpression vector containing an AtZSP1 polypeptide coding gene;

m2) directly introducing the overexpression vector of M1) or introducing the overexpression vector into a receptor plant by utilizing agrobacterium mediation to obtain a transgenic plant containing the coding gene of the overexpression AtZSP1 polypeptide.

The overexpression vector contains a strong promoter, and the strong promoter drives the coding sequence of the AtZSP1 polypeptide to be overexpressed in a receptor plant.

The strong promoter can be a 35s promoter, or more than two 35s promoters, or a 35s promoter plus a Ubi promoter.

Further, in one embodiment of the present invention, the plant is Arabidopsis thaliana.

The present invention also provides a method for reducing the size of a plant seed and/or organ, the method comprising reducing the size of a plant seed and/or organ by inhibiting or reducing expression of a gene encoding an AtZSP1 polypeptide and/or activity of an AtZSP1 polypeptide in the plant.

In the above method, the method for inhibiting or reducing the expression of the gene encoding the AtZSP1 polypeptide and/or the activity of the AtZSP1 polypeptide in a plant may be deleting nucleotides 31 to 58 of SEQ ID No.2 in the genome of the plant.

The invention also provides the use of a method of increasing or decreasing the size of a seed and/or organ of a plant for growing a plant having an increased or decreased size of a seed and/or organ.

The invention also provides the use of a method of increasing or decreasing the size of a plant seed and/or organ in plant breeding.

The plant breeding can be transgenic breeding that increases or decreases crop seed and/or organ size.

The modulating the plant seed and/or organ size may be increasing or decreasing the plant seed and/or organ size.

Above, the plant may be any one of:

f1 A monocot or dicot;

f2 Plants of the order Capillales, plants of the order Gramineae, or plants of the order Leguminosae;

f3 Cruciferous, gramineous, or leguminous plants;

f4 Arabidopsis, brassica, zea, oryza, setaria, sorghum, or glycine;

f5 Arabidopsis, rape, chinese cabbage, maize, rice, millet, sorghum or soybean.

The invention utilizes T-DNA insertion mutant library, adopts a reverse genetics method, classifies unknown small peptide protein of arabidopsis thaliana according to bioinformatics analysis, discovers a gene for coding 57 amino acids when identifying single copy genes with the amino acid length of less than 100, and names the small peptide gene as AtZSP1. And identifying the T-DNA insertion mutant of the gene, and screening out a homozygous mutant. And another homozygous mutant is obtained by using the CRISPR/Cas9 technology, and both mutants are full knockout mutants. A series of gene functions of the homozygous mutant are researched by using the thought of reverse genetics. The mutant phenotype generated by gene knockout is the phenotype after the gene is deleted, so the relationship between the function of the gene and the phenotype is directly shown, and the function of the gene can be directly and quickly detected.

The observation of the phenotype of the homozygous mutant shows that the seed size and the hundred-grain weight of the mutant are obviously smaller than those of the wild type, the plant is short and small, and the leaf size, the bud number and the silique number on the main stem are all smaller than those of the wild type. The deletion of the AtZSP1 gene was shown to affect the seed and organ size of Arabidopsis thaliana. In addition, the phenotype of the obtained homozygous over-expression plants is observed, and the phenotype of the over-expression plants is completely opposite to that of the mutant. As the size of the plant organ is determined by the cell number and the cell size, the statistics of the cell number and the cell size of the cotyledon of the wild type and the mutant are carried out, and the result shows that the total cell number of the cotyledon of the mutant is obviously reduced, and the average cell size of the cotyledon of the mutant is smaller than that of the wild type. It is suggested that the AtZSP1 gene may influence the size of organs by controlling cell proliferation and cell expansion. In addition, the polypeptide coded by the gene has homologous proteins in crops such as rape, corn, rice, chinese cabbage, soybean, millet and sorghum, and the sequences of the proteins are relatively conserved in the species, which suggests that the AtZSP1 has good prospects in crop variety improvement.

The invention successfully identifies the AtZSP1 small peptide for the first time, clones the AtZSP1 gene, verifies the gene function, increases the size of plant seeds and/or organs by a gene engineering method, obtains an AtZSP1 overexpression plant, enriches high-quality gene resources for the development and application fields of small peptides, can be well applied to the improvement of crop varieties, improves the crop yield and has important practical value for plant breeding work.

Drawings

FIG. 1 is an electrophoretogram identifying atzsp1-1 homozygous mutants.

FIG. 2 shows the structure of AtZSP1 gene and the insertion site of T-DNA. The AtZSP1-1 mutant is a T-DNA insert at 27bp from ATG on the first exon of the AtZSP1 gene.

FIG. 3 is a schematic diagram of the selection and mutation form of the atzsp1-2 mutant target constructed by CRISPR/Cas9 technology. The mutant atzsp1-2 is a homozygous mutation with a 28bp deletion between two targets, resulting in the premature appearance of a stop codon TGA after 118bp, leading to premature termination of protein translation.

FIG. 4 shows atzsp1-2 mutant without cas9 vector. 1/2MS Medium indicates growth on 1/2MS Medium, and 1/2MS + Hyg Medium indicates growth on hygromycin-containing Medium.

FIG. 5 is a graph showing the results of analysis of the expression level of AtZSP1 gene in the mutant. Col represents the wild type arabidopsis control.

FIG. 6 is a graph showing the leaves and fresh weight analysis results of the mutant and the complementary plants.

FIG. 7 is a schematic diagram of the construction of a complementary cloning vector. Wherein pCAMBIA1300 is a basic vector; the gene of the gene AtZSP1 (1948 bp) is a full-length AtZSP1 gene and comprises a 1184bp promoter, a 25bp 5 'non-coding sequence, a 278bp gene coding sequence (exon + intron) and a 461bp 3' non-coding sequence; bamHI and PstI are two single enzyme cutting sites used for constructing complementary vectors; kan represents kanamycin, and is a gene for screening kanamycin resistance as an antibiotic.

FIG. 8 is a schematic diagram of the construction of an overexpression vector.

FIG. 9 is a diagram showing the results of the analysis of the AtZSP1 gene expression levels in mutants and over-expressed plants.

FIG. 10 is a graph of seed size and hundred kernel weight analysis results for mutants and over-expressed plants.

FIG. 11 is a graph of the results of mature embryo analysis of mutants and over-expressed plants.

FIG. 12 is a graph showing the results of leaf analysis of mutants and over-expressed plants grown in soil for 17 days.

FIG. 13 is a graph of the results of plant height, number of buds and number of siliques analysis of mutants and over-expressed plants.

FIG. 14 is a graph showing the results of analysis of the number of cotyledon cells and cell size of the mutant.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The wild type Arabidopsis thaliana (WT, col) in the examples described below was Columbia ecotype Arabidopsis thaliana (Col-0), arabidopsis Biological Resource Center (ABRC).

pCBC-DT1T2 in the following examples was obtained from university of agriculture in China as taught by Chen Jijun, a premium in the laboratory (Lei Zhu, liang-Cui Chu, yan Liang, xue-Qin Zhang, li-Qun Chen, de Ye1.The Arabidopsis CrRLK1L protein kinases BUPS1 and BUPS2 are required for normal growth of polen tubes in the same Plant Journal (2018) 95, 474-486), publicly available from university of agriculture for repeating the experiments of the present invention.

pHEC401 in the following examples was obtained from university of agriculture in China as taught by professor Chen Jijun, a premium in the laboratory (Lei Zhu, liang-Cui Chu, yan Liang, xue-Qin Zhuang, li-Qun Chen, de Ye1.The Arabidopsis CrRLK1L protein kinases BUPS1 and BUPS2 are required for normal growth of polen tubes in the same Plant Journal (2018) 95, 474-486), publicly available from university of agriculture for repeating the experiments of the present invention.

The following examples of pSuper1300, offered by the national university of agriculture Zhizhong laboratory (Yang Ding, jian Lv, yiting Shi, junping Gao, jian Hua, chun Song, zhun Gong, shuhua Yang. EGR2 phosphor orientations OST1 kinase activity and free distance in Arabidopsis. The EMBO output Journal (2019) 38), are publicly available from the national university of agriculture to repeat the experimental university of the present invention.

Example 1 screening of atzsp1 mutant and identification of AtZSP1 Gene

Screening of atzsp1 mutants

According to the invention, unknown small peptides with the amino acid length of less than 150 in Arabidopsis are screened and classified, and 3698 genes which are not identified are provided. To obtain the efficiency of efficient mutants, the range was further narrowed down, from which single copy genes with amino acid length less than 100 were identified and T-DNA insertion mutants inserted on exons were ordered from TAIR officials (http:// www.arabidopsi s.org /). After the homozygous mutant is screened by PCR, a gene participating in regulating the sizes of seeds and organs of arabidopsis thaliana is identified by primary phenotype observation, and the gene is named as AtZSP1 gene. The coded amino acid sequence of the AtZSP1 gene is a polypeptide AtZSP1 shown in SEQ ID No.1 in a sequence table. The genomic gene of AtZSP1 is a double-stranded DN A shown by SEQ ID No.3 in a sequence table, nucleotides 1 to 1184 are promoters, nucleotides 1185 to 1209 are 5'UTR, nucleotides 1210 to 1277 are first exons, nucleotides 1278 to 1381 are first introns, nucleotides 1382 to 1487 are second exons, and nucleotides 1488 to 1948 are 3' UTR. The cDNA gene of AtZSP1 is double-stranded DNA shown in SEQ ID No.4 of the sequence table, and the 26 th to 199 th nucleotides are coding sequences (CDS).

After the AtZSP1 gene is mutated, the heights of seeds, leaves, root lengths, inflorescences and plants are all smaller than those of the wild type, and the heights of the seeds, leaves, root lengths, inflorescences and plants of over-expressed plants are all larger than those of the wild type. In addition, through the search of plant genome sequences and the research of bioinformatics, a protein which is homologous with the AtZSP1 does not exist in Arabidopsis thaliana, and the protein sequence is highly conserved in crops such as corn, rice, rape, chinese cabbage, soybean and the like, which means that the AtZSP1 gene identified by the invention is widely applicable to other plant species in which orthologous AtZSP1 genes with similar functions exist.

Identification of atzsp1 mutant and AtZSP1 Gene

(1) atzsp1-1 mutant

The T-DNA insertion mutant (SALK-11106C) ordered from TAIR organ on-line was named AtZSP1-1, and was identified by PCR using two specific primers on AtZSP1 gene and specific primers on T-DNA, and it was shown that the mutant was a homozygous mutant (FIG. 1). In FIG. 1, LP and RP are primers on AtZSP1 gene, and LBb1.3 is a specific primer on T-DNA. The sequencing result showed that the T-DNA was inserted 27bp away from the ATG on the first exon of the AtZSP1 gene (FIG. 2).

(2) atzsp1-2 mutant

Constructing a second mutant by using a CRISPR/Cas9 technology, wherein the specific process comprises the following steps: firstly, a double-Target vector is constructed, and sequences at the 24-46bp position and the 53-75bp position from the number of an ATG (initiation codon) on the gene are selected as two targets, namely sequences shown as Target1 and Target2 in figure 3. The sequence of Target1 is: CCAAACAGTGGCAATCTCCGGCG, target2 has the sequence CCGCCGTCTCATGCTGGTGAGTG. PCR is carried out on the coding DNA of the Target1-Target2 by taking pCBC-DT1T2 as a template and using a primer, after the obtained PCR product (the sequence of the PCR product is shown as SEQ ID No. 5) is recovered, the PCR product, a pHEC401 vector, bsaI restriction endonuclease and T4 Ligase are added into an enzyme digestion-ligation reaction system at the same time for enzyme digestion and ligation, the ligated product is transferred into escherichia coli competent DH5 alpha cells, and the correctly ligated plasmid is named pHEC401-ZSP1-cas9 through colony PCR and sequencing. pHEC401-ZSP1-cas9 is a recombinant expression vector for expressing sgRNA1, sgRNA2 and cas9 targeting two Target points of Target1 and Target2, which is obtained by replacing a fragment between two BsaI recognition sites of pHEC401 with a DNA fragment shown in the 13 th to 614 th positions of SEQ ID No.5 and keeping other sequences of pHEC401 unchanged.

pHEC401-ZSP1-cas9 was transformed into Agrobacterium tumefaciens GV3101, and the correctly identified recombinant Agrobacterium was named GV-ZSP1-cas9.GV-ZSP1-cas9 is transferred into a wild type arabidopsis inflorescence by an agrobacterium dip-dyeing method; and (3) screening seeds (T0 generation seeds) formed by the harvested T0 generation transgenic plants on a hygromycin-containing culture medium, sequencing the screened T1 generation positive seedlings, and analyzing the mutation form of the AtZSP1 gene. From this a homozygous mutation was identified with a 28bp deletion between the two targets, resulting in the appearance of a termination codon TGA after 118bp (sequence before deletion) in advance, leading to premature termination of protein translation, and this mutant was named atzsp1-cas9 (FIG. 3). In order to eliminate the CRISPR/Cas9 vector in the mutant, atzsp1-Cas9 mutant was selfed for one generation, and the non-vector mutant which could not grow on hygromycin-containing medium (1/2MS +50 μ g/mL hygromycin) was isolated from the progeny plants, indicating that the vector had been eliminated, and the mutant was named as atzsp1-2 (FIG. 4). The nucleotide sequence of the AtZSP1 mutant gene in AtZSP1-cas9 is shown as SEQ ID No.6, the coding sequence is shown as 1-93 nucleotides in SEQ ID No.7, and the amino acid sequence of the AtZSP1 mutant polypeptide is shown as SEQ ID No. 8.

(3) Analysis of expression level

Expression amount analysis was performed on two homozygous mutants, atzsp1-1 and atzsp 1-2: RNA of seedlings grown by wild type Arabidopsis thaliana and two mutants for 10d under light is respectively extracted and is reversely transcribed into cDNA, and qRT-PCR analysis is carried out by using a primer (5'-CGTTCTCGTTGATCCAAACAG-3') and a primer (5'-GTGGAATCAGAATTGGAGCCT-3'). When the expression level of wild type arabidopsis thaliana was 1, the results showed that the expression of the AtZSP1 gene was not detected in both mutants, indicating that both mutants were complete knock-out mutants (fig. 5).

Cloning of AtZSP1 Gene and complementation experiment of atzsp1-1 mutant

Initial observation shows that the phenotypes of the two mutants, namely atzsp1-1 and atzsp1-2, are consistent and have the phenotype of small leaves, and the fresh weight of overground parts and the size of the leaf surface of the seedlings growing in soil for 17d are measured, so that the fresh weight of the leaves and the size of the leaf surface of the mutant are both obviously smaller than those of the wild type (figure 6). To determine that the phenotype of the AtZSP1-1 mutant is caused by deletion of the AtZSP1 gene, a complementing clone of the AtZSP1-1 mutant was constructed (fig. 7), and complementing experiments were performed.

The specific process is as follows:

(1) The genome DNA of wild Arabidopsis (the full length of AtZSP1 gene comprises 1184bp promoter, 25bp 5 'non-coding sequence, 278bp gene sequence and 461bp 3' non-coding sequence) is used as a template, PCR amplification is carried out by using specific primers (containing BamHI and PstI restriction enzyme sites) (5'-CGG GGATCC AAACGGGCATCGGTATGAAG-3' and 5'-CGA CTGCAG TTTCCCACATAGGTACAT ACA-3') on the AtZSP1 gene, the PCR product is purified, recovered and cut by enzyme and then is connected to a pCAMBIA1300 vector, and the recombinant anaplerosis expression vector with correct clone sequencing is named as pAtZSP1 (figure 7). AtZSP1 is a recombinant expression vector obtained by replacing a fragment (small fragment) between recognition sites of BamHI and Pst I of pCAMBIA1300 with a DNA fragment shown in SEQ ID No.3 in a sequence table and keeping other sequences of pCAMBIA1300 unchanged.

The recombinant plasmid pAtZSP1:: atZSP1 is transferred into agrobacterium GV3101 by an electric shock method, and the correctly identified recombinant agrobacterium is named as GV-pAtZSP1:: atZSP1. Transferring the T0 generation transgenic arabidopsis thaliana into atzsp1-1 mutant by an agrobacterium-mediated dip-dyeing inflorescence method to obtain T0 generation transgenic arabidopsis thaliana seeds.

(2) Sowing the T0 generation transgenic arabidopsis seeds obtained in the step (1) on a hygromycin-containing culture medium (1/2MS +50 mug/mL hygromycin), wherein the arabidopsis capable of growing normally is T1 generation transgenic Yang Zhizhu, and the seeds harvested from the T1 generation transgenic positive plants are T1 generation transgenic arabidopsis seeds.

For a certain T1 generation plant, the T1 generation plant is a transgenic plant with single copy insertion if the following two conditions are met: (1) the T1 generation plant is a hygromycin resistant plant; (2) in T2 generation plants obtained by the T1 generation plants through selfing, the number ratio of hygromycin resistant plants to hygromycin sensitive plants basically accords with 3:1.

For a certain T2 generation plant, the T2 generation plant and its inbred generation are a homozygous transgenic line if the following three conditions are met: (1) the T2 generation plant is a hygromycin resistant plant; (2) the T1 generation plant is a transgenic plant with single copy insertion; (3) the T3 generation plants detected by sampling are all hygromycin resistant plants.

66T 1 transgenic positive plants are identified by PCR, single copy plants are screened in the T2 generation, seeds born by the single copy plants are harvested, homozygote screening is carried out on a culture medium containing hygromycin (1/2MS +50 mu g/mL hygromycin), and 9 homozygote anaplerotic plants are co-screened, wherein two T2 transgenic plants are respectively named as atzsp1-comp-1 and atzsp1-comp-2. Data were processed using SPSS11.5 statistical software and experimental results were expressed as mean ± standard deviation, with P < 0.01 (. X.) indicating significant differences from wild-type arabidopsis and P < 0.001 (. X.) indicating very significant differences from wild-type arabidopsis using the t-test. Through phenotype observation, the leaf size of the replenisher plant is found to be consistent with that of the wild type, and the fresh weight of the overground part and the surface size of the largest leaf are measured on the seedling cultured for 17d in the soil, and the size of the seedling is also restored to the wild type level. It was demonstrated that the introduction of the AtZSP1 gene into the atzSP1-1 mutant plants could complement the small phenotype of the atzSP1-1 mutant organs, and that the small phenotype of the atzSP1-1 mutant organs was indeed caused by the deletion of the AtZSP1 gene (FIG. 6).

Example 2 obtaining of plants overexpressing AtZSP1 Gene

In order to further study the function of the AtZSP1 gene, an over-expression plant of the AtZSP1 gene was constructed.

The specific process is as follows:

(1) Construction of overexpression vectors

The cDNA of wild Arabidopsis thaliana was used as a template, primers 5'-CGA CTGCAG ATGCAAAAATCGTTCTC GTTG-3' and 5'-GAG ACTAGT GGAATGGGGAGTGGAATCAG-3' (respectively containing two restriction enzyme sites PstI and SpeI) were used for PCR amplification, and the PCR product was purified and recovered, double-digested with PstI and SpeI, and ligated to the pSuper1300 vector (FIG. 8). The ligation products were transformed into E.coli competent DH 5. Alpha. Cells, cultured on LB solid medium containing 50. Mu.g/mL kanamycin, and the colonies were sequenced after PCR to obtain the correct clones. The recombinant over-expression vector was named p35S:: atZSP1. And p35S:: atZSP1 is an AtZSP1 gene recombinant expression vector obtained by replacing a fragment (small fragment) between recognition sites of Pst I and Spe I of the pSuper1300 vector with a DNA fragment (with TGA removed) shown in SEQ ID No.2 of the sequence table and keeping other sequences of the pSuper1300 vector unchanged. The p35S:: atZSP1 is transferred into agrobacterium GV3101, and the correctly identified recombinant agrobacterium is named as GV-p35S:: atZSP1.

(2) Acquisition of AtZSP1 gene overexpression plant

Respectively taking 3mL of cultured GV-p35S, transferring 3mL of the Agrobacterium liquid of AtZSP1 (recombinant agrobacterium containing an overexpression vector) into 150mL of three-resistance LB culture medium (Rif + Gen + Kan), and culturing overnight at 28 ℃ and 250rpm until the liquid turns orange, so that the OD600nm value of the liquid is 1.6-1.8; transferring the bacterial liquid into a centrifuge bottle, and centrifuging at 4 ℃ and 3,000rpm for 15min; discarding supernatant, adding 1/2MS culture solution (0.22 g MS powder and 2g sucrose, dissolving in water, adjusting pH to 5.8, adding ddH ₂ After the volume of O is determined to be 100mL, adding 12mL Silwet L-77 reagent, stirring uniformly), suspending the bacterial precipitate, and adjusting the pH value to be 0.6-0.8; cutting off siliques before dip-dyeing, and dip-dyeing inflorescences of wild type Arabidopsis plants in the full-bloom stage in a culture dish containing bacterial liquid for 10s; and (4) putting the soaked plants in a tray, and culturing in a dark environment for 18-24h and then recovering normal light for culture. Seeds (T0 generation seeds) from T0 generation transgenic plants (p 35S:: atZSP1 transgenic plants) were collected. The plant grown under the seed of the T0 generation is the T1 generationBy analogy, T2 and T3 represent the 2 nd and 3 rd generations of transgenic plants, respectively.

Disinfecting the T0 generation seeds, spreading on 1/2MS +50 mug/mL hygromycin solid culture medium (Murashige and Skoog basal medium,0.8% agar powder, pH5.8, 50 mug/mL hygromycin), treating at low temperature of 4 ℃ for 2d, moving to 22 ℃, culturing under the condition of illumination (16 h illumination/8 h darkness) for 8-10d, picking resistant plants, planting in soil, and continuing culturing under the condition of illumination. Extracting the genome DNA of the leaf, carrying out PCR amplification on the AtZSP1-Flag fragment by using primers (F: 5'-ATGCAAAAATCGTTCTCGTTG-3' and R: 5'-CTTATCGTCATCGTCCTTGT-3'), and further determining a positive plant (about 240bp of a PCR product) through PCR identification.

(3) Identification of AtZSP1 gene over-expression plants

Extracting wild arabidopsis thaliana, atZSP1-1 and p35S by a Trizol method, namely, synthesizing cDNA (complementary deoxyribonucleic acid) by reverse transcription of total RNA of AtZSP1 transgenic plant seedlings (the specific method refers to the specification of a Genestar reverse transcription kit), and storing at 20 ℃ for later use. The detection of the expression level was performed using real-time fluorescent quantitative PCR (qRT-PCR). Amplification is carried out by using a specific primer 1 and a specific primer 2 of the coding region of the AtZSP1 gene.

Primer 1:5'-CGTTCTCGTTGATCCAAACAG-3'

Primer 2:5'-GTGGAATCAGAATTGGAGCCT-3'

The PCR reaction system is as follows:

2X power SYBR Green PCR Master Mix：10μL；

primer 1 (10. Mu. Mol/L): 0.2 mu L;

primer 2 (10. Mu. Mol/L): 0.2 mu L;

cDNA：1μL；

ddH2O：8.6μL。

real-time PCR reaction program: pre-denaturation at 95 ℃ for 5min; 25sec at 94 ℃, 30sec at 60 ℃, 30sec at 72 ℃,40 cycles, and then 2min at 72 ℃. The ACTIN2 gene is used as an internal reference, and the primer sequence is

ACTIN2-F：5’-GGTAACATTGTGCTCAGTGGTGG-3’

ACTIN2-R：5’-AACGACCTTAATCTTCATGCTGC-3’

The expression level was analyzed by the Δ Δ Ct algorithm.

Through PCR identification, 36 transgenic p 35S-AtZSP 1 transgenic positive plants are obtained in the T1 generation, and 11 homozygous plants are obtained in the T3 generation for subsequent analysis. The qRT-PCR results show that the expression level of the AtZSP1 gene in homozygous over-expressed plants is significantly higher than that of the non-transgenic wild type, which indicates that the expression of the AtZSP1 gene in transgenic plants is indeed enhanced (FIG. 9).

For p35S: atZSP1 overexpression transgenic plants, the segregation ratio is 3 after T2 generation screening: 1 (according to the genetic principle, the selfed progeny after single copy insertion can generate the segregation ratio of 3:1. The number of resistant seedlings and non-resistant seedlings on an antibiotic culture medium is counted by combining a statistical method, the transgenic plant is identified as a strain with single copy insertion by using a segregation ratio method, so that the transgenic plant is used for screening homozygote), and p35S:: atZSP1 transgenic homozygous plants are screened out through T3 generations, and two strains are respectively named as strain p35S:: atZSP1#1 and strain p35S:: atZSP1#2, and are used for carrying out the following experiments.

Example 3 phenotypic Observation of AtZSP1 mutant and AtZSP1 Gene overexpressing plants

1. Mutant, overexpression plant seed size

The experiment was repeated three times, and 30 seeds were taken from each line per replicate.

The seed sizes of the strain AtZSP1-1 and the strain AtZSP1-2 mutant are obviously smaller than that of the wild type through body type mirror observation, and in contrast, the seeds of the strain p35S of over-expression p35S: atZSP1#1 and the strain p35S: atZSP1#2 are obviously larger than that of the wild type. To quantify the extent of seed variation, we counted the area of the seeds of each line and showed that the seed areas of the mutant line AtZSP1-1 and the line AtZSP1-2 were smaller than the wild type, and similarly, the seeds of both line p35S:: atZSP1#1 and line p35S:: atZSP1#2 overexpressing p35S were larger than the wild type. The results are shown in FIG. 10. In addition, the hundred grain weight of each strain of individual seed is counted, the statistical result is shown in fig. 10, the hundred grain weight of the wild type seed is 1.70mg, the hundred grain weight of the mutant individual seed is smaller than that of the wild type seed, and is only 1.30mg and 1.33mg, which are respectively reduced by 24% and 22%; the weight of the seeds of the over-expression plants is obviously increased to 2.73mg and 2.53mg compared with the wild type, and is respectively increased by 38 percent and 33 percent. The scale in the figure is 1mm. Data were processed using SPSS11.5 statistical software and the results were expressed as mean ± standard deviation, P < 0.05 (. Star) for significant differences from wild type arabidopsis thaliana, P < 0.01 (. Star) for significant differences from wild type arabidopsis thaliana, and P < 0.001 (. Star) for very significant differences from wild type arabidopsis thaliana, using the t-test.

2. Mutant, overexpression of plant mature embryo size

The experiment was repeated three times, 10-15 mature embryos per line were taken per replicate.

Since seed size of seed mutants became smaller, mature embryos of mutants and over-expressed plants were observed and their size was measured for area. As a result, as shown in FIG. 11, the mature embryos of the mutants were significantly smaller than those of the wild type, and the area of the mature embryos of the wild type was 95.7X 10 ³ μm ² The mature embryo area of the mutant line atzsp1-1 was 71.8X 10 ³ μm ² The mature embryo area of the mutant strain atzsp1-2 was 78.6X 10 ³ μm ² The reduction of the expression level of the gene is 25.0% and 17.9% compared with the wild type, respectively, and the mature embryo area of the overexpression strain p35S: atZSP1#1 is 143.3X 10 ³ μm ² The mature embryo area of the over-expression strain p35S of AtZSP1#2 is 162.8 multiplied by 10 ³ μm ² The increase is 33.2 percent and 41.2 percent respectively compared with the wild type. The scale in the figure is 500. Mu.m. Data were processed using SPSS11.5 statistical software and experimental results were expressed as mean ± standard deviation, P < 0.05 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, P < 0.01 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, and P < 0.001 (. Beta.) -represents very significant difference from wild-type arabidopsis thaliana, using t-test.

3. Mutant, overexpression plant seedling size

The experiment was repeated three times, 10-15 plantlets were taken per line for each repetition.

Five lines of seeds were simultaneously sown in MS (Murashige and Skoog basal medium,0.8% agar powder, pH 5.8)) Treating on solid culture medium at 4 deg.C for 3 days, transferring to 22 deg.C incubator for 8 days, transplanting to soil, photographing aerial parts of seedlings after 14 days, and measuring the maximum leaf area of each seedling of five strains, with the result that the leaf area of wild type is 1.01cm ² The leaf areas of the mutant strain atzsp1-1 and the mutant strain atzsp1-2 were 0.62cm ² And 0.63cm ² The reduction is 39% and 38% respectively; meanwhile, the leaf area of the over-expression plant is obviously increased compared with the wild type, and the leaf areas of the over-expression strain p35S:: atZSP1#1 and the over-expression strain p35S:: atZSP1#2 are respectively 1.25cm ² And 1.24cm ² An increase of 19.2% and 18.5%, respectively. Meanwhile, the fresh weights of the aerial parts of these five lines were measured, and the results showed that the fresh weights of the aerial parts of the wild type were 0.11g, the fresh weights of the aerial parts of the mutant line AtZSP1-1 and the mutant line AtZSP1-2 were 0.068g and 0.063g, respectively, reduced by 38.2% and 42.7%, respectively, and the fresh weights of the aerial parts of the overexpression line p35S:: atZSP1#1 and the overexpression line p35S:: atZSP1#2 were 0.152g and 0.150g, respectively, increased by 27.6% and 26.7%, respectively (FIG. 12). The scale in the figure is 1cm. Data were processed using SPSS11.5 statistical software and experimental results were expressed as mean ± standard deviation, P < 0.05 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, P < 0.01 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, and P < 0.001 (. Beta.) -represents very significant difference from wild-type arabidopsis thaliana, using t-test.

4. Mutant, over-expression plant flowering period plant height, silique number and inflorescence size

The experiment was repeated three times, and 25 plants were taken per line per replicate.

After the seedlings in the step 3 grow in soil for 28 days, 25 plants are selected for each strain, photographing and plant height statistics are carried out, and the results are shown in the figure (figure 13), wherein the plant height of a wild type is 26.35cm, the plant heights of a mutant strain atzsp1-1 and a mutant strain atzsp1-2 are respectively 18.87cm and 19.91cm, and are respectively reduced by 28.4% and 24.4%; the plant heights of the over-expression strain p35S:AtZSP1 #1 and the over-expression strain p35S:AtZSP1 #2 are increased compared with the wild type, are 31.02cm and 30.04cm respectively, and are increased by 15.1 percent and 12.3 percent respectively. The scale in the figure is 1cm. Data were processed using SPSS11.5 statistical software and experimental results were expressed as mean ± standard deviation, P < 0.05 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, P < 0.01 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, and P < 0.001 (. Beta.) -represents very significant difference from wild-type arabidopsis thaliana, using t-test.

In addition, statistics on the number of siliques and the number of flowers on the main stems of each strain show that the number of siliques on the wild-type main stem is 14.43, and the number of siliques on the main stems of the mutant strain atzsp1-1 and the mutant strain atzsp1-2 is 7.93 and 8.87 respectively, which are respectively reduced by 45.0% and 38.5%; the quantity of the siliques on the main stem of the plant of the over-expression strain p35S:: atZSP1#1 and the over-expression strain p35S:: atZSP1#2 is obviously increased compared with the wild type, 18.12 and 17.19 respectively, and is increased by 20.4% and 16.1% respectively. The statistics of the number of flowers at the same period show that the number of buds of the wild type is 11.76, and the number of buds of the mutant strain atzsp1-1 and the mutant strain atzsp1-2 is 8.63 and 9.19 respectively, which are reduced by 26.6% and 21.9% respectively compared with the wild type; the number of buds of the over-expression strain p35S:: atZSP1#1 and the over-expression strain p35S:: atZSP1#2 is 15.81 and 13.79 respectively, which are increased by 25.6% and 14.7% respectively compared with the wild type. As shown in fig. 13. The scale in the figure is 2mm. Data were processed using SPSS11.5 statistical software and experimental results were expressed as mean ± standard deviation, P < 0.05 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, P < 0.01 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, and P < 0.001 (. Beta.) -represents very significant difference from wild-type arabidopsis thaliana, using t-test.

5. Mutant, overexpression plant leaf cell size and cell number

The experiment was repeated three times, 10-15 plants per line were taken for each repetition.

Since organ size is determined by both cell number and cell size, cotyledons of wild type and mutant cultured under light for 6d were performedObservation, the cotyledon area is firstly photographed under a stereoscope, and the measurement result shows that the cotyledon area of the wild type is 19.31mm ² The cotyledon areas of the mutant line atzsp1-1 and the mutant line atzsp1-2 were 12.16mm, respectively ² And 11.10mm ² . Then, the palisade cells of cotyledons were observed under a microscope and measured, and it was found (FIG. 14) that the total cell number per cotyledon of the wild type was 11.2X 10 ³ Total cell numbers in the cotyledons of mutant line atzsp1-1 and mutant line atzsp1-2 were 8.5X 10, respectively ³ And 7.8X 10 ³ The number of cells in cotyledons of the mutant is obviously reduced by 24.1 percent and 30.3 percent respectively; statistics of the average cell size of the cotyledons revealed that the average cell size of the wild-type cotyledons was 1.75X 10 ³ μm ² Whereas the average cell sizes of mutant line atzsp1-1 and mutant line atzsp1-2 were 1.43X 10, respectively ³ μm ² And 1.44X 10 ³ μm ² The reduction was 18.3% and 17.7%, respectively. The above results indicate that the AtZSP1 gene may affect leaf size through cell proliferation and cell expansion. Data were processed using SPSS11.5 statistical software and experimental results were expressed as mean ± standard deviation, P < 0.05 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, P < 0.01 (. Beta.) -represents significant difference from wild-type arabidopsis thaliana, and P < 0.001 (. Beta.) -represents very significant difference from wild-type arabidopsis thaliana, using t-test.

The invention classifies unknown small peptide proteins of arabidopsis thaliana, finds a gene for coding 57 amino acids from single copy genes with the amino acid length of less than 100, and names the gene as AtZSP1. And identifying the T-DNA insertion mutant of the gene, and obtaining another homozygous mutant by using CRISPR/Cas9 technology, wherein the two mutants are full knockout mutants. The phenotype of the mutant is observed, and the result shows that the seed size and the hundred grain weight of the mutant are obviously smaller than those of the wild type, the plant is short, and the leaf size, the bud number and the silique number on the main stem are all smaller than those of the wild type. The deletion of the AtZSP1 gene was shown to affect the seed and organ size of Arabidopsis thaliana. In addition, the phenotype of the obtained homozygous over-expression plants is observed, and the phenotype of the over-expression plants is completely opposite to that of the mutant. As the size of the plant organ is determined by the cell number and the cell size, the statistics of the cell number and the cell size of the cotyledon of the wild type and the mutant are carried out, and the result shows that the total cell number of the cotyledon of the mutant is obviously reduced, and the average cell size of the cotyledon of the mutant is smaller than that of the wild type. It is suggested that the AtZSP1 gene may influence the size of organs by controlling cell proliferation and cell expansion. In addition, the polypeptide coded by the gene has homologous proteins in crops such as rape, corn, rice, chinese cabbage, soybean, millet, sorghum and the like, and the sequences of the proteins are relatively conserved in the species, which suggests that the AtZSP1 gene may have good prospects in crop variety improvement.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> university of agriculture in China

<120> small peptide for regulating and controlling sizes of plant seeds and organs, and coding gene and application thereof

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 57

<212> PRT

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

Met Gln Lys Ser Phe Ser Leu Ile Gln Thr Val Ala Ile Ser Gly Val

1 5 10 15

Phe Ser Ala Val Ser Cys Trp Tyr Gly Phe Met Phe Gly Arg Glu Ser

20 25 30

Ala Arg Lys Glu Leu Gly Gly Leu Ile Glu Glu Leu Arg Arg Gly Gly

35 40 45

Ser Asn Ser Asp Ser Thr Pro His Ser

50 55

<210> 2

<211> 174

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 2

atgcaaaaat cgttctcgtt gatccaaaca gtggcaatct ccggcgtatt ctccgccgtc 60

tcatgctggt atggattcat gttcggtaga gaatcagcga gaaaagagct cggaggtttg 120

atcgaagagc tccgtcgtgg aggctccaat tctgattcca ctccccattc ctga 174

<210> 3

<211> 1948

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 3

aaacgggcat cggtatgaag gagcctggca tgaggggaga aggcaaggac ttggtatgta 60

cacgttcagg aatggtgaga cacaggcagg ccattgggaa gacggagttc ttaactgtcc 120

taccgagcag accactcgcc ctgattcatc gttttccatc agtcattcca aggttgtcga 180

cactgtccag gtaccttata atttatctta ctgctgctca tatatattaa gttagagttt 240

agatctttaa gaaattatct tactgctgcc aatgattgag tacccacatg agatttgatc 300

ctgctccctc tctctctttg atcaacagca agcaaggaaa gcagccaaga aagcacgcga 360

agttgtgaaa gttgaagaga gagtgaacag agcagtgatg gtcgcaaacc gagcagcaaa 420

tgctgctaga gttgctgcta caaaggctgt ccaaacccaa acatttcatt gtagtagtgg 480

tgacgatccc ttgtgagttc ctgcggcaaa gattttgaca taatcgcagt catgacctta 540

cctcgaactt ctacgaagac agaagagtga aagagagatg tttagagaac agcgtcagaa 600

ttcgcaatct ccgttgagat tttcttgaag gtgaaccact tggaaccaat gtcgagatct 660

cataagtaat aagtaagaga tctggctatg gagcaagtat tacaggttta ctttttcttt 720

tctcccactt gttttatgag caggctggtt taaaactgta catatgttgt tgaagagtaa 780

gcaatgtgtg ttaacaaaag atctttgtaa caagcgtaac ccatgtaaga gaagtaacaa 840

aacattgttt tacttttaca acgtgttgaa aataacacct tttttttact agatttctat 900

ggatagaaat tagaaaatga catgagaatt ccagattcaa atcaacttga caaaaccaac 960

aagggaaaga gtaaagatat ctggtctgtg acaaggtcca agtagagacg aattacagat 1020

catctaggta actgtgctta tggttcttca aaccctttca gcaaatccta gcagccagcc 1080

tttgtgtttg attaaagtgg gctgggctaa aatattggcc gaggcccatc aagtgattct 1140

ctcccgctca agtcttttaa tccttgagga gaaaatggac tggaaaattc acggaacttt 1200

aacagaaaga tgcaaaaatc gttctcgttg atccaaacag tggcaatctc cggcgtattc 1260

tccgccgtct catgctggtg agtgattgtt cccgtctttc aagctcttct tcttcaattc 1320

tcgtcttctt ctctttccat gtctcatctt tagggtttaa gctgccttac tcaatttcca 1380

ggtatggatt catgttcggt agagaatcag cgagaaaaga gctcggaggt ttgatcgaag 1440

agctccgtcg tggaggctcc aattctgatt ccactcccca ttcctgagtt aggcattcca 1500

atttcccagg acggaggagg ttcttcgtta tccgttgcta agttagtttc cgatttcgat 1560

taatgttcat gaaaattgat caattgttgt ataaaccgat gtgtttgaca aatcctttga 1620

gttaattcaa gtatgaaaga ttatcgtttg aacgagagat gcatattgat tgatgataag 1680

agaaactcac attgattgag ataatataaa actgtaggag aaaaatgcat agtatttgag 1740

attaagagta tgaagatgat gtacaaggaa aactcatagg aaacatctaa gtgtacatca 1800

tcttgatttt gcttctcttt gctctgactc tgacccagaa ttgtgcaaat ctatagcttt 1860

aacactctta ctggtttgat ctctctagtt atttatcaga caggaataca ataaacacca 1920

cactatatgt atgtacctat gtgggaaa 1948

<210> 4

<211> 660

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 4

aaattcacgg aactttaaca gaaagatgca aaaatcgttc tcgttgatcc aaacagtggc 60

aatctccggc gtattctccg ccgtctcatg ctggtatgga ttcatgttcg gtagagaatc 120

agcgagaaaa gagctcggag gtttgatcga agagctccgt cgtggaggct ccaattctga 180

ttccactccc cattcctgag ttaggcattc caatttccca ggacggagga ggttcttcgt 240

tatccgttgc taagttagtt tccgatttcg attaatgttc atgaaaattg atcaattgtt 300

gtataaaccg atgtgtttga caaatccttt gagttaattc aagtatgaaa gattatcgtt 360

tgaacgagag atgcatattg attgatgata agagaaactc acattgattg agataatata 420

aaactgtagg agaaaaatgc atagtatttg agattaagag tatgaagatg atgtacaagg 480

aaaactcata ggaaacatct aagtgtacat catcttgatt ttgcttctct ttgctctgac 540

tctgacccag aattgtgcaa atctatagct ttaacactct tactggtttg atctctctag 600

ttatttatca gacaggaata caataaacac cacactatat gtatgtacct atgtgggaaa 660

<210> 5

<211> 626

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

atatatggtc tcgattggcc ggagattgcc actgttgttt tagagctaga aatagcaagt 60

taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gctttttttt 120

gcaaaatttt ccagatcgat ttcttcttcc tctgttcttc ggcgttcaat ttctggggtt 180

ttctcttcgt tttctgtaac tgaaacctaa aatttgacct aaaaaaaatc tcaaataata 240

tgattcagtg gttttgtact tttcagttag ttgagttttg cagttccgat gagataaacc 300

aatattaatc caaactactg cagcctgaca gacaaatgag gatgcaaaca attttaaagt 360

ttatctaacg ctagctgttt tgtttcttct ctctggtgca ccaacgacgg cgttttctca 420

atcataaaga ggcttgtttt acttaaggcc aataatgttg atggatcgaa agaagagggc 480

ttttaataaa cgagcccgtt taagctgtaa acgatgtcaa aaacatccca catcgttcag 540

ttgaaaatag aagctctgtt tatatattgg tagagtcgac taagagattg actcaccagc 600

atgagacggg tttagagacc aataat 626

<210> 6

<211> 250

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

atgcaaaaat cgttctcgtt gatccaaaca tctcatgctg gtgagtgatt gttcccgtct 60

ttcaagctct tcttcttcaa ttctcgtctt cttctctttc catgtctcat ctttagggtt 120

taagctgcct tactcaattt ccaggtatgg attcatgttc ggtagagaat cagcgagaaa 180

agagctcgga ggtttgatcg aagagctccg tcgtggaggc tccaattctg attccactcc 240

ccattcctga 250

<210> 7

<211> 146

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

atgcaaaaat cgttctcgtt gatccaaaca tctcatgctg gtatggattc atgttcggta 60

gagaatcagc gagaaaagag ctcggaggtt tgatcgaaga gctccgtcgt ggaggctcca 120

attctgattc cactccccat tcctga 146

<210> 8

<211> 30

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 8

Met Gln Lys Ser Phe Ser Leu Ile Gln Thr Ser His Ala Gly Met Asp

1 5 10 15

Ser Cys Ser Val Glu Asn Gln Arg Glu Lys Ser Ser Glu Val

20 25 30

Claims

1. Use of a polypeptide, wherein said use is any of:

d1 Use of) a polypeptide for regulating seed and/or organ size in a plant;

d2 Use of) a polypeptide in the preparation of a product for regulating the size of a plant seed and/or organ;

d3 Use of) a polypeptide for growing plants with increased or decreased seed and/or organ size;

d4 Use of) a polypeptide in the preparation of a product for growing plants having an increased or decreased size of seeds and/or organs;

d5 Use of a polypeptide in plant breeding;

the polypeptide is any one of the following:

a1 Polypeptide with an amino acid sequence of SEQ ID No. 1;

a2 A fusion polypeptide obtained by connecting a label to the N terminal and/or the C terminal of A1);

a3 Polypeptide of which the amino acid sequence is SEQ ID No. 8;

a4 A fusion polypeptide obtained by attaching a tag to the N-terminus and/or C-terminus of A3).

2. Use of a biomaterial, wherein the use is any of the following:

e1 Use in regulating the size of seeds and/or organs of plants;

e2 Use in the preparation of a product for regulating the size of seeds and/or organs of a plant;

e3 Use in breeding plants with increased or decreased seed and/or organ size;

e4 Use) for the preparation of a product for breeding plants with increased or decreased seed and/or organ size;

e5 Use in plant breeding;

the biological material is any one of the following materials:

b1 A nucleic acid molecule encoding the polypeptide of claim 1;

d1 A nucleic acid molecule that inhibits or reduces the expression of a gene encoding the polypeptide of claim 1;

d2 An expression cassette comprising a nucleic acid molecule according to D1);

3. The use according to claim 2, wherein the nucleic acid molecule of B1) is a DNA molecule as shown in B1) or B2) below:

b2 ) the nucleotide sequence is a DNA molecule or cDNA molecule as shown in SEQ ID No. 2.

4. A method of increasing the size of a plant seed and/or organ, comprising increasing the size of a plant seed and/or organ by increasing or increasing the expression and/or activity of the polypeptide of claim 1 in a plant.

5. The method according to claim 4, wherein said increasing or increasing the expression and/or activity of the polypeptide of claim 1 in a plant is effected by increasing the expression level of a gene encoding said polypeptide in a plant.

6. A method of reducing seed and/or organ size in a plant, said method comprising reducing seed and/or organ size in a plant by inhibiting or reducing expression in the plant of a gene encoding a polypeptide according to claim 1 and/or activity of a polypeptide according to claim 1.

7. The method according to claim 6, wherein the method of inhibiting or reducing the expression of a gene encoding the polypeptide of claim 1 and/or the activity of the polypeptide of claim 1 in a plant is by deleting nucleotides 31 to 58 of SEQ ID No.2 from the genome of the plant.

8. The use according to any one of claims 1 to 3 or the method according to any one of claims 4 to 7, wherein the plant is any one of:

f1 A monocot or dicot;

f2 Plant of the order Cleodactyla, gramineae or Leguminosae;

f3 Cruciferous, gramineous, or leguminous plants;

f4 Arabidopsis, brassica, zea, oryza, setaria, sorghum, or Glycine;

f5 Arabidopsis, rape, chinese cabbage, maize, rice, millet, sorghum or soybean.

9. Use of the method of any one of claims 4 to 7 for growing plants with increased or decreased seed and/or organ size.

10. Use of the method of any one of claims 4 to 7 in plant breeding.