CN111574606B

CN111574606B - Wheat disease-resistant and heading regulation gene TaCOK and related biological material and application thereof

Info

Publication number: CN111574606B
Application number: CN202010606680.7A
Authority: CN
Inventors: 张增艳; 王开; 郭飞龙; 王珂; 祝秀亮
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2020-06-29
Filing date: 2020-06-29
Publication date: 2021-11-16
Anticipated expiration: 2040-06-29
Also published as: CN111574606A

Abstract

The invention discloses a wheat disease-resistant and heading regulation gene TaCOK and related biological materials and application thereof. TaCOK is any one of the following proteins: A1) protein with amino acid sequence shown as SEQ ID No. 2; A2) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence defined by A1), has more than 90% of identity with the protein shown by A1), and is related to plant disease resistance; A3) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of A1) or A2). The TaCOK and the coding gene thereof provided by the invention can be used for improving the disease resistance of plants and regulating and controlling the expression of vernalization genes and vernalization related genes so as to regulate and control the heading of the plants, and have important significance for cultivating new plant varieties with disease resistance and wide adaptability.

Description

Wheat disease-resistant and heading regulation gene TaCOK and related biological material and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a wheat disease-resistant and heading regulation gene TaCOK and related biological materials and application thereof.

Background

Wheat is one of the important staple food crops of the world and Chinese people. More than 40% of the population in the world takes wheat as a staple grain crop, so the wheat plays a vital role in guaranteeing the safety of grains. With the increase of planting density and the change of water and fertilizer conditions and cultivation system, wheat sharp eyespot has developed into a main disease of wheat production in China, and becomes an important limiting factor for high and stable yield of wheat in China. Wheat sharp eyespot (wheat sharp eyespot), which is mainly caused by saprophytic nutritional pathogenic fungus, Rhizoctonia cerealis CAG-1 in China. The sheath blight disease can generally reduce the yield of the wheat by 10-30 percent, and the serious plot can reduce the yield of the wheat by more than 50 percent. According to the reports of agricultural technology promotion stations in China, the annual occurrence area of wheat sharp eyespot in China is about 1.0-1.3 hundred million acres in 2005-2018, the economic loss reaches more than billions of yuan, and the wheat sharp eyespot becomes the first large soil-borne disease in the main wheat production area in China. Therefore, breeding and popularizing the new wheat variety resisting the sheath blight is the most economic, safe and effective way for preventing and treating the disease, and is very important for ensuring the stable and high yield of wheat in China. However, conventional breeding methods have been slow in breeding of sheath blight resistant wheat varieties due to the lack of readily available sheath blight resistant wheat germplasm resources. Molecular biology and genetic engineering, especially the great progress of the separation and cloning and function research of disease-resistant important genes, lay the foundation for efficiently culturing the wheat with the sheath blight resistance.

The heading period is of exceptional importance for wheat and has a great influence on traits related to the growth cycle and yield. Heading is largely controlled by the vernalization and photoperiod reactions of the plants. Vernalization-related genes are important genes affecting wheat heading, and regulate wheat heading together with environmental temperature. The proper heading stage is an important precondition for ensuring high and stable yield of crops, and the excavation of the gene related to vernalization and heading stage can provide a candidate gene for cultivating new wheat varieties with adaptation to different ecological environments, and has important significance for cultivating new wheat varieties with wide adaptability.

Disclosure of Invention

The invention aims to provide a wheat disease-resistant and heading regulation gene TaCOK and related biological materials and application thereof.

In a first aspect, the invention claims an energetic protein.

The protein claimed by the invention, named TaCOK, is derived from wheat line CI12633 resisting sheath blight, and can be protein A1), A2) or A3) as follows:

A1) protein with amino acid sequence shown as SEQ ID No. 2;

A2) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence defined by A1), has more than 90% of identity with the protein shown by A1), and has the same function;

A3) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of A1) or A2).

In the above protein, SEQ ID No.2 consists of 632 amino acid residues.

In order to facilitate the purification of the protein, a tag as shown in Table 1 may be attached to the amino terminus or the carboxy terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 2.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression. The coding gene of the protein can be obtained by deleting one or more codons of amino acid residues in the DNA sequence shown in SEQ ID No.2, and/or carrying out missense mutation of one or more base pairs, and/or connecting the coding sequence of the label shown in the table 1 at the 5 'end and/or the 3' end.

In the above proteins, identity refers to the identity of amino acid sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, the identity of a pair of amino acid sequences can be searched, calculated, and then a value (%) of identity can be obtained.

In the above protein, the 90% or more identity may be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

In the above protein, the TaCOK may be derived from wheat.

In a second aspect, the invention claims a biomaterial associated with TaCOK.

The biological material related to TaCOK claimed by the invention can be any one of the following B1) to B9):

B1) a nucleic acid molecule encoding TaCOK;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector;

B5) a transgenic plant cell line comprising B1) the nucleic acid molecule or a transgenic plant cell line comprising B2) the expression cassette;

B6) transgenic plant tissue comprising the nucleic acid molecule of B1) or transgenic plant tissue comprising the expression cassette of B2);

B7) a transgenic plant organ containing the nucleic acid molecule of B1), or a transgenic plant organ containing the expression cassette of B2);

B8) a nucleic acid molecule that reduces the expression of the protein of claim 1;

B9) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule according to B8).

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In the above biological material, the nucleic acid molecule of B1) may be 1) or 2) or 3) or 4) as follows:

1) the coding sequence (ORF) of the coding strand is a cDNA molecule or a DNA molecule of nucleotides 53 to 1951 of SEQ ID No.1 of the sequence Listing;

2) the nucleotide of the coding strand is a cDNA molecule or a DNA molecule of SEQ ID No. 1;

3) a DNA molecule which hybridizes under stringent conditions with a cDNA molecule or a DNA molecule as defined in 1) or 2) and which codes for TaCOK;

4) a DNA molecule which has more than 90% of identity with the cDNA molecule or DNA molecule defined in 1) or 2) or 3) and codes for TaCOK.

In the above nucleic acid molecules, identity refers to the identity of nucleotide sequences. The identity of the nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST web page of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, the identity of a pair of nucleotide sequences can be searched, calculation can be performed, and then the value (%) of identity can be obtained.

In the above nucleic acid molecules, the 90% or greater identity may be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

In the above biological material, the nucleic acid molecule B8) may be a DNA molecule reverse-complementary to any of the DNA molecules shown in SEQ ID No.1, such as a DNA molecule reverse-complementary to the DNA fragment shown in 1897-2148 th nucleotide of SEQ ID No.1 (i.e. SEQ ID No. 3).

Wherein, SEQ ID No.1 consists of 2181 nucleotides, the ORF sequence is 53-1951 of SEQ ID No.1, and encodes the protein shown in SEQ ID No. 2.

The stringent conditions may be hybridization and membrane washing at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS.

In the above-mentioned biological materials, the expression cassette according to B2) means a DNA capable of expressing the protein described in the first aspect in a host cell, and the DNA may include not only a promoter for promoting transcription of the desired gene but also a terminator for terminating transcription of the desired gene. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter of cauliflower mosaic virus 35S; a wound-inducible promoter from tomato, the leucine aminopeptidase promoter ("LAP", Chao et al (1999) Plant Physiology 120: 979-992); a chemically inducible promoter from tobacco, a pathogenesis-related 1 promoter (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoters (U.S. patent 5,187,267); tetracycline-inducible promoter (Us patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128(CN101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators (see, e.g., Odell et al (I)⁹⁸⁵) Nature 313: 810; rosenberg et al (1987) Gene,56: 125; guerineau et al (1991) mol.gen.genet,262: 141; proudfoot (1991) Cell,64: 671; sanfacon et al Genes Dev.,5: 141; mogen et al (1990) Plant Cell,2: 1261; munroe et al (1990) Gene,91: 151; ballad et al (1989) Nucleic Acids Res.17: 7891; joshi et al (1987) Nucleic Acid Res, 15: 9627).

The recombinant expression vector containing the expression cassette can be constructed by using the existing plant expression vector. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. Such as pWMB123, pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Corp.) and the like. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The poly A signal can lead poly A to be added to the 3 'end of mRNA precursor, and the untranslated regions transcribed at the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (such as nopaline synthase gene Nos) and plant genes (such as soybean storage protein gene) have similar functions. When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), marker genes for antibiotics which are expressible in plants (e.g., nptII gene which confers resistance to kanamycin and related antibiotics, bar gene which confers resistance to phosphinothricin which is a herbicide, hph gene which confers resistance to hygromycin which is an antibiotic, dhS gene which confers resistance to methatrexate, EPSPS gene which confers resistance to glyphosate), or marker genes for chemical resistance (e.g., herbicide resistance), mannose-6-phosphate isomerase gene which provides the ability to metabolize mannose, etc. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

In the present invention, the promoter for initiating transcription of the nucleic acid molecule in the recombinant vector may be a Ubiquitin promoter. Specifically, the recombinant vector is obtained by inserting a DNA fragment shown in positions 53-1951 of SEQ ID No.1 into the downstream of a Ubiquitin promoter (such as between BamH I and SpeI) of a pWMB123 vector.

In the above biological material, the recombinant microorganism may be specifically yeast, bacteria, algae and fungi.

In a third aspect, the invention claims an article.

The product claimed by the invention has the functions shown in the following a1) and/or a2), and contains the protein (TaCOK) or/and the biological material (TaCOK).

a1) Enhancing the disease resistance of plants;

a2) the premature heading of the plant under the vernalization action is regulated and controlled by promoting the expression of vernalization genes and/or vernalization-related genes.

In a fourth aspect, the invention claims the use of any of the following P1-P9 of the protein or the biomaterial described hereinbefore:

use of P1, a protein as described hereinbefore (TaCOK) or a biological material as described herein for modulating disease resistance in plants;

use of P2, the protein (TaCOK) described above, or the biological material for the preparation of a product for increasing disease resistance in plants;

use of P3, the protein (TaCOK) described hereinbefore or the biological material for growing disease-resistant plants;

use of P4, the protein (TaCOK) described hereinbefore or the biological material for the preparation of a product for combating plant diseases;

use of P5, the protein (TaCOK) described hereinbefore or the biological material for regulating vernalization of plants

Use of P6, a protein as described hereinbefore (TaCOK) or the biological material for regulating the expression of vernalization genes and/or vernalization-associated genes in plants;

use of P7, a protein as described hereinbefore (TaCOK) or said biological material for regulating the heading stage of a plant by regulating the expression of vernalization genes and/or vernalization-associated genes;

use of P8, a protein as described hereinbefore (TaCOK) or said biological material for regulating pre-heading of a plant under vernalization by promoting expression of vernalization genes and/or vernalization-associated genes;

use of P9, a protein as described hereinbefore (TaCOK) or said biological material in plant breeding.

In a fifth aspect, the invention claims any of the following methods:

the method A comprises the following steps: a method of growing disease resistant plants, comprising the steps of: increasing the expression level or/and activity of the protein (TaCOK) or the coding gene thereof in the receptor plant to obtain a target plant; the disease resistance of the target plant is higher than that of the receptor plant.

In the above method, the increase in the expression level of the protein (TaCOK) or the gene encoding the protein (TaCOK) in the recipient plant may be achieved by introducing a gene encoding the protein (TaCOK) into the recipient plant.

In the above method, the coding gene of the protein (TaCOK) may be modified as follows, and then introduced into the recipient plant to achieve a better expression effect:

1) modifying the sequence of the gene adjacent to the initiating methionine to allow efficient initiation of translation; for example, modifications are made using sequences known to be effective in plants;

2) linking with promoters expressed by various plants to facilitate the expression of the promoters in the plants; such promoters may include constitutive, inducible, time-regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space requirements of expression, and will also depend on the target species; for example, tissue or organ specific expression promoters, depending on the stage of development of the desired receptor; although many promoters derived from dicots have been demonstrated to be functional in monocots and vice versa, desirably, dicot promoters are selected for expression in dicots and monocot promoters for expression in monocots;

3) the expression efficiency of the gene of the present invention can also be improved by linking to a suitable transcription terminator; tml from CaMV, E9 from rbcS; any available terminator which is known to function in plants may be linked to the gene of the invention;

4) enhancer sequences, such as intron sequences (e.g., from Adhl and bronzel) and viral leader sequences (e.g., from TMV, MCMV, and AMV) were introduced.

The gene encoding the protein (TaCOK) can be introduced into Plant cells by conventional biotechnological methods using Ti plasmids, Plant virus vectors, direct DNA transformation, microinjection, electroporation and the like (Weissbach,1998, Method for Plant Molecular Biology VIII, academic Press, New York, pp.411-463; Geiserson and Corey,1998, Plant Molecular Biology (2nd Edition).

In the above method, the target plant may be a transgenic plant or a plant obtained by a conventional breeding technique such as crossing.

The method B comprises the following steps: a method of breeding a transgenic plant with reduced disease resistance, comprising the steps of: reducing the expression level or/and activity of a gene encoding a protein (TaCOK) as described above in a recipient plant, to obtain a transgenic plant having a lower disease resistance than the recipient plant.

In the above method, the reduction of the expression level of the gene encoding the aforementioned protein (TaCOK) in the recipient plant can be achieved by introducing into the recipient plant a DNA molecule reverse-complementary to the DNA fragment represented by nucleotides 1897-2148 of SEQ ID No.1 (i.e., SEQ ID No. 3).

In the above methods, the transgenic plant is understood to include not only the first to second generation transgenic plants but also the progeny thereof. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.

The method C comprises the following steps: a method of growing plants with a controlled heading date comprising the steps of: increasing the expression level or/and activity of the protein or the coding gene thereof according to claim 1 in a recipient plant to obtain a target plant; if the target plant is sown (naturally vernalized) according to the cultivation growth rule of the receptor plant, the target plant and the receptor plant enter a heading stage synchronously; if the vernalization treatment is carried out before the target plant is sown, the target plant is sown when the cultivation growth rule of the receptor plant is not met, and the ear of the receptor plant can be pulled out earlier than that of the receptor plant under the same condition.

In each of the above aspects, the plant may be a monocot or a dicot.

Further, the monocotyledon may be a gramineae plant.

Further, the gramineous plant may be wheat.

In the above aspects, the disease resistance may be resistance to sheath blight.

Further, the pathogenic bacteria of sheath blight disease can be Rhizoctonia cerealis (Rhizoctonia cerealis), and specifically can be Rhizoctonia cerealis (Rhizoctonia cerealis) WK207 or R0301.

In the above aspects, the temperature of the vernalization treatment may be 4 ℃, and the time of the vernalization treatment may be 30 days.

In a particular embodiment of the invention, the vernalization gene is in particular the TaVRN1 gene and/or the TaVRN3 gene; the vernalization-related gene is specifically TaVRT2 gene.

Experiments prove that: on one hand, TaCOK gene is introduced into Zhoumai 18, and TaCOK overexpression is found to be capable of obviously improving the resistance of transgenic wheat plants to banded sclerotial blight. The TaCOK gene in the wheat CI12633 is silenced by adopting a virus-mediated gene silencing technology, and the result shows that the defense capacity of the wheat CI12633 against rhizoctonia solani is reduced by the silencing of the TaCOK gene. The above results indicate that TaCOK is a gene essential for wheat to resist sheath blight. On the other hand, the TaCOK gene is introduced into Zhou wheat 18, and compared with a non-transgenic control, TaCOK overexpression can promote expression of vernalization genes and/or vernalization related genes, so that transgenic wheat can be vernalized and spiked under conditions of unsuitable temperature and the like, and the application area of wheat popularization and planting, namely wide adaptability, is increased. The wheat with the gene type has wide adaptability, can be propagated and added into generations in Yunnan/Hainan, can shorten the breeding period (2-3 years), and is beneficial to the development of wheat breeding industry. In a word, the invention has important significance for breeding new plant varieties with disease resistance and wide adaptability.

Drawings

FIG. 1 shows the analysis of TaCOK gene expression level. Wen6 denotes wenmai No. 6.

FIG. 2 shows 4 strains T₀And transferring PCR detection results of positive plants of the transgenic pWMB123-TaCOK Zhoumai 18. P represents pWMB123-TaCOK recombinant expression vector plasmid DNA, Z18 represents Zhouma 18, and COK1, COK2, COK3 and COK4 represent 4 transgenic wheat lines respectively. The arrow indicates the destination strip.

FIG. 3 shows 72 strains T₁PCR detection results of the transgenic pWMB123-TaCOK Zhoumai 18 individual plant. COK1, COK2, COK3 and COK4 represent 4 transgenes respectivelyDue to the wheat strain. The arrow indicates the destination strip.

FIG. 4 shows the relative expression levels of TaCOK genes in T1 generation plants of 4 transgenic wheat lines.

FIG. 5 is a photograph of the phenotype of sheath blight in wheat at harvest time and the corresponding disease grade.

FIG. 6 shows the expression level of TaCOK in BSMV TaCOK-silenced plants.

FIG. 7 is a quantitative PCR assay of the relative biomass of Rhizoctonia cerealis in BSMV infected wheat.

FIG. 8 shows the statistics of the disease after inoculation of Rhizoctonia solani with BSMV, TaCOK. A is a phenotype; b is the statistical result.

FIG. 9 shows the heading date difference between wild type wheat Zhoumai 18 and TaCOK transgenic Zhoumai 18.

FIG. 10 shows the expression levels of vernalization genes and vernalization-associated genes in TaCOK transgenic Zhoumai 18.

In each figure, indicates that the difference was significant at the P <0.01 level.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

In the following examples, wheat CI12633 is germplasm from the agricultural germplasm resource protection and utilization platform (germplasm resource bank of the agricultural academy of sciences of Jiangsu province), and wheat CI12633 exhibits resistance to sheath blight. Wenmai No. 6 is germplasm from a national plant germplasm resource sharing platform (germplasm resource library of Chinese academy of agricultural sciences), and Wenmai No. 6 is highly susceptible to sheath blight. Wheat variety Zhouma 18 was purchased from the institute of agricultural science in Zhou Kou region, Zhouma 18 susceptible to sheath blight (https:// baike. baidu. com/item/% E5% 91% A8% E9% BA% A618/4103514fr ═ aladdin).

The wheat sharp eyespot pathogen, Rhizoctonia cerealis, a highly pathogenic strain WK207, is a gift from the university of Shandong agriculture plant protection institute in professor Jinfeng (reference: Ji, L., Liu, C., Zhang, L., Liu, A., and Yu, J. (2017) Variation of rDNA internal transformed space sequences in Rhizoctonia cerealis, Current. Microbiol.74,877-884.doi:10.1007/s 00284-017-. Rhizoctonia cerealis R0301 is from the agricultural academy of Jiangsu province (reference: Sambu, Zhang Aixiang, Liwei, Chen Huai Gu. New wheat variety (series) of Jiangsu province for resistance analysis of banded sclerotial blight. Jiangsu agro-Proc., 2010, 26 (6): 1176-1180). The above-mentioned biomaterial public can be obtained from the institute of crop science of the academy of agricultural sciences of china to repeat the experiments of the present application, and cannot be used for other purposes.

Monocot expression vector pWMB 123: constructed by Keke et al, the institute of crop science, Chinese academy of agricultural sciences (ref: Generation of marker-free transgenic hexa of white tea in agricultural bacteria-mediated co-transformation in commercial biological tea in varieties, Ke Wang, Huiyun Liu, Lipu Du and Xingguo Ye, Plant Biotechnology Journal (2016), pp.1-10 doi: 10.1111/pbi.12660). The public can obtain from the research institute of crop science of Chinese academy of agricultural sciences to repeat the experiment of the application, and can not be used for other purposes.

The 3 components of the BSMV viral vectors, BSMV-alpha, BSMV-beta and BSMV-gamma plasmids and BSMV-gamma, are shown in the following examples: GFP plasmids were introduced from the United states (Holzberg S, Brosio P, Gross C, Pogue GP.2002.Barley stripe viral acids-induced gene cloning in a monocot Plant. the Plant Journal 30,315-327. Burch-Smith T M, Anderson J C, Martin G B, Dinesh-Kumar S P. applications and updates of virus-induced gene cloning for gene function clones in plants, the Plant Journal 2004,39: 734-.

pMD18-T is a product of Bao bioengineering (Dalian) Co., Ltd.

The sheath blight disease level criteria for wheat (Lensdeep, Li Anfei, Li Xianbin et al 1997, early indication of resistance of wheat germplasm to sheath blight. crop variety resources (4):31-33) are shown in Table 2.

TABLE 2 sheath blight disease class criteria for wheat

Wherein, 0 grade represents immunity, 1 grade represents resistance, 2 grade represents resistance, 3 grade-4 grade represents feeling, and 5 grade represents high feeling.

The preparation method of the toothpick of the rhizoctonia cerealis comprises the following steps: and (3) vertically filling the toothpick sections in a small beaker, preparing an MS liquid culture medium, pouring the MS liquid culture medium into the small beaker with the toothpick sections, inoculating the stored hypha blocks of the rhizoctonia cerealis into the beaker after sterilization, and culturing at a constant temperature of 25 ℃ until the hypha is densely distributed with the toothpicks.

The preparation method of the fungi wheat grain of the rhizoctonia cerealis comprises the following steps: preparing an MS liquid culture medium, sterilizing, inoculating a newly-cultured hypha block of the rhizoctonia cerealis into a triangular flask, and culturing at a constant temperature of 25 ℃ until the hypha is dense; and then the wheat grains are boiled for 20 minutes after being soaked for 5-6 hours, the triangular flask with the volume of 250 ml is filled with the 500 ml, the dense mycelium liquid is inoculated into the triangular flask, the mixture is shaken up, and the mixture is cultured at the constant temperature of 25 ℃ until the mycelium is densely distributed in the wheat grains.

Example 1 cloning of wheat protein TaCOK against sheath blight and its coding gene and analysis of expression induced by Rhizoctonia solani

1. Wheat protein TaCOK for resisting sheath blight and clone of coding gene thereof

The inventor of the invention separates and clones a wheat protein related to disease resistance from wheat germplasm CI12633 resisting sheath blight, the amino acid sequence of the wheat protein is shown as SEQ ID No.2, and the wheat protein is named as TaCOK protein. The gene for coding the TaCOK protein is named as a TaCOK gene, and the nucleotide sequence of the TaCOK gene is shown as SEQ ID No. 1.

The specific cloning method is as follows:

extracting wheat CI12633 stem total RNA inoculated with Rhizoctonia cerealis WK207 hyphae, performing reverse transcription on the extracted RNA sample according to the procedure of a first strand cDNA synthesis kit of Invitrogen company to synthesize first strand cDNA serving as a gene cloning template, and performing reverse transcription on the RNA sample to obtain a first strand cDNA (deoxyribonucleic acid) by using TaCOK-FL-U1: 5'-GCAGTCGCACCATCCAC-3' and TaCOK-FL-R1: 5'-CTGAGTTGTAGAGGCAGATA-3' is used as a primer, the first round of PCR amplification is carried out, and the amplification procedure is as follows: pre-denaturation at 96 ℃ for 2 minutes; then 35 cycles of 94 ℃ for 45 seconds, 54 ℃ for 35 seconds, and 72 ℃ for 2.5 minutes; extension at 72 ℃ for 10 min; using the first round PCR amplification product diluted 50 times as a template, the PCR amplification product was amplified using TaCOK-FLU 2: 5'-GCCGACACCACTTAGGAT-3' and TaCOK-FLR 2: 5'-TACACCCAACATTGCTTTT-3' is used as a primer, and the second round of PCR amplification is carried out by the following steps: pre-denaturation at 95 ℃ for 2 minutes; then, 5 cycles of 94 ℃ for 45 seconds, 54 ℃ for 35 seconds, and 72 ℃ for 2 minutes; 45 seconds at 94 ℃, 45 seconds at 52 ℃,2 minutes at 72 ℃ and 5 cycles; final extension at 72 ℃ for 10 min; after the second round of PCR reaction is finished, the target PCR band is recovered through 1.0% agarose gel electrophoresis detection. The second round PCR product was ligated into pMD18-T vector and sequenced. The sequencing result shows that the nucleotide sequence of the PCR amplification product is shown as nucleotides 1to 1976 of SEQ ID No. 1. The coding sequence (ORF) of SEQ ID No.1 is nucleotide 53-1951 thereof; encodes the protein TaCOK shown in SEQ ID No. 2.

In order to obtain the full-length cDNA sequence of the TaCOK gene, 3' -RACE primers (TaCOK-3 RA-F1: 5'-TGTGAGGCTGAGAACCAA-3' and TaCOK-3 RA-F2: 5'-CATTGGGCGGTAAGACCTCTGTTCATC-3') were designed and amplified from the disease-resistant wheat CI12633 cDNA to the 3' sequence, i.e., the 1712-th and 2181-th nucleotides from the 5' terminus shown in SEQ ID No.1, by 2 rounds of PCR amplification.

2. Expression analysis of TaCOK gene induced by Rhizoctonia solani

In order to research whether the expression quantity of the TaCOK gene is related to the resistance of the wheat sharp eyespot, the expression conditions of the TaCOK gene in the wheat with the sharp eyespot resistance and the sharp eyespot resistance on different days after the Rhizoctonia cerealis WK207 is inoculated are analyzed by RT-qPCR.

Inoculating a toothpick with sclerotium graminearum WK207 hypha between a leaf sheath and a stem of a disease-resistant wheat CI12633 and a seedling of Rhizoctonia solani wheat Wenming No. 6 in a tillering stage; inoculating the leaf sheath/stem tissue of each wheat material for 2,4, 7, 10, 14 and 21 days after non-inoculation (0) and inoculation, quickly freezing with liquid nitrogen, and storing in an ultra-low temperature refrigerator at-80 deg.C for later use.

Total RNA (about 5. mu.g of total RNA per sample) was extracted from each wheat material stem and reverse-transcribed into cDNA according to the procedure of Invitrogen first strand cDNA Synthesis kit. The cDNA concentration of the sample was normalized using constitutively expressed actin gene as an internal reference. Then, real-time quantitative PCR (RT-qPCR) analysis was carried out using primers specific for the TaCOK gene, using 2^-ΔΔCTMethod (Livak KJ, Schmitgen TD.2001.analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCTmethod.25: 402-408) analysis of the expression of the TaCOK gene under the treatment of Rhizoctonia cerealis, each group of samples was repeated 3 times.

Primer pairs of an internal reference gene TaActin:

TaActin-F：5′-CACTGGAATGGTCAAGGCTG-3′；

TaActin-R：5′-CTCCATGTCATCCCAGTTG-3′。

specific primer pairs of TaCOK gene:

TaCOK-Q-F：5′-TTTGGGATTCCATCCTTGCTG-3′；

TaCOK-Q-R：5′-ATGTTTGGTTGCCATTGCTCT-3′。

the results are shown in FIG. 1. The results of analysis of TaCOK gene expression levels show that the TaCOK gene expression levels in CI12633 before and after inoculation of Rhizoctonia cerealis (Rhizoctonia solani) are always higher than those in Wenmax No. 6; and the TaCOK gene is obviously induced and expressed by the rhizoctonia cerealis in the Rhizoctonia cerealis resistant wheat CI12633, the expression quantity of the TaCOK gene in the Rhizoctonia cerealis resistant wheat CI12633 is the highest when the rhizoctonia cerealis is inoculated for 10 days, and the expression quantity of the TaCOK gene in the Rhizoctonia cerealis susceptible wheat Wenming No. 6 is obviously improved only when the rhizoctonia cerealis is inoculated for 10 days. The TaCOK gene is suggested to participate in the resistance reaction of wheat to banded sclerotial blight.

Example 2 obtaining, molecular and disease resistance identification of TaCOK transgenic wheat against sheath blight

Construction of recombinant expression vector

Constructing the complete ORF sequence of the TaCOK gene into pWMB123, and specifically operating as follows:

1. adopts a primer pair consisting of TaCOK-TV-F and TaCOK-TV-R.

TaCOK-TV-F：5′-TTCTGCAGGTCGACTCTAGAATGGAGAAGACGACAGGGAT-3' (sequences underlined indicate vector homologous sequences);

TaCOK-TV-R：

(sequences indicated underlined are vector homologous sequences and sequences indicated in boxes are 6 × His tag coding sequences).

2. Using DNA fragment shown in SEQ ID No.1 as template, using primer pair composed of TaCOK-TV-F and TaCOK-TV-R, performing PCR amplification under the action of high fidelity amplification enzyme PRIMERSTAR (TAKARA company), obtaining PCR amplification product, and recovering

PCR reaction procedure: pre-denaturation at 98 ℃ for 1 min; 34 cycles of 10s at 98 ℃,15 s at 56 ℃ and 2min at 72 ℃; 10min at 72 ℃.

3. And (3) recovering and purifying the PCR amplification product obtained in the step 2.

4. The monocot expression vector pWMB123 was digested with restriction enzymes BamH I and Spe I and the vector backbone was recovered.

5. And (4) connecting the enzyme digestion product recovered in the step (3) with the vector skeleton recovered in the step (4) to obtain a recombinant expression vector pWMB 123-TaCOK.

According to the sequencing result, the structure of the recombinant expression vector pWMB123-TaCOK is described as follows: a DNA molecule "from position 53 to 1948 + CATCATCATCATCATCACTAA of SEQ ID No. 1" (encoding a TaCOK protein fused to a6 XHis tag) was inserted between the BamHI and speI cleavage sites of the monocot expression vector pWMB 123. In the recombinant expression vector pWMB123-TaCOK, the TaCOK gene is controlled by a Ubiquitin promoter. The recombinant expression vector pWMB123-TaCOK also has 1 Bar gene expression cassette controlled by 35S promoter, and can provide resistance marker for screening transformed regeneration plants by using herbicide Bialaphos (Bialaphos) in subsequent work.

Second, obtaining transgenic plants

1. And (3) introducing the recombinant expression vector pWMB123-TaCOK into competent cells of agrobacterium tumefaciens C58C 1to obtain the recombinant agrobacterium tumefaciens.

2. Transforming the recombinant agrobacterium obtained in the step 1 into the young embryo callus of Zhoumai 18, and then carrying out post-treatment on an osmotic pressure culture medium for 16 h.

3. After completion of step 2, the calli were transferred to SD2 medium (VB 11 mg/L, asparagine 150mg/L, 2, 4-D2 mg/L in the inorganic salt content of MS medium) and cultured for 2 weeks (26 ℃ C., dark culture).

4. After the step 3 is completed, transferring the callus into a differentiation and screening culture medium (1/2MS culture medium, 1mg/L naphthylacetic acid, 1mg/L kinetin and 2-5mg/L bialaphos), and culturing for 14 days at 24-26 ℃ by illumination.

5. After completing step 4, transferring the callus differentiated plantlets into a growth screening culture medium (1/2MS culture medium + bialaphos 2-3mg/L), and culturing under illumination at 24-26 ℃.

16 regenerated wheat plants were obtained.

6. Transferring the regenerated plant obtained in the step 5 to a strong seedling culture medium (1/2MS culture medium +0.5mg/L naphthylacetic acid), and transplanting the transformed seedling with the height of 7-8cm and developed root system to a flowerpot.

After 3 weeks of transplantation, 14 wheat plants (T0 generation) survived.

7. Molecular characterization of transgenic wheat

In the 4-leaf stage, 1 leaf of each surviving regeneration wheat plant is taken to extract genome DNA, the genome DNA is used as a template, a specific sequence of a TaCOK gene is used as an upstream primer (TaCOK-F: 5'-TTTGGGATTCCATCCTTGCTG-3') and a specific sequence of a carrier Tnos sequence is used as a downstream primer (tNOS-R: 5'-AAAACCCATCTCATAAATAACG-3') for PCR amplification, a recombinant expression plasmid pWMB123-TaKOC1 is used as a positive control, the genome DNA of Zhouma 18 is used as a negative control, and the expected amplification product fragment is about 1500 bp. PCR procedure: pre-denaturation at 94 ℃ for 3 min; 30s at 94 ℃, 30s at 58 ℃, 1min at 72 ℃ and 30s for 34 cycles; 72 ℃ for 10min

And (5) carrying out 2% agarose gel electrophoresis detection on the PCR amplification product, carrying out ultraviolet photographing, and recording the result.

The PCR detection result shows that 14 plants are transformed into pWMB123-TaCOK Zhoumai 18 plants (T)₀Generation), 4 PCR positive plants (i.e., transgenic plants) (fig. 2).

The harvested 4 transgenic wheat seeds were planted to obtain T₁And (4) generation of single plants. Will T₁And carrying out PCR identification on the generation individual plant by the same method as the steps.

In 72 strains T₁Among the generation individual plants, 58 positive plants (FIG. 3) belong to 4 lines, and the positive rate is 80.6%.

4 transgenic lines T are analyzed by using TaCOK gene specific quantitative primers (TaCOK-QF: 5'-TTTGGGATTCCATCCTTGCTG-3'; TaCOK-QR: 5'-ATGTTTGGTTGCCATTGCTCT-3') and RT-qPCR technology₁Relative expression of TaCOK gene in generation plant. Wheat endogenous actin gene is used as an internal reference. See example 1, step 2, for details. The results are shown in FIG. 4. In the figure, Z18 represents Zhouma 18, and COK1, COK2, COK3 and COK4 represent 4 transgenic wheat lines, respectively. The relative expression quantity of the TaCOK gene in the transgenic plant is obviously higher than that of Zhoumai 18.

Thirdly, obtaining of empty vector plants

Replacing the recombinant plasmid pWMB123-TaCOK with the vector pWMB123, and performing the other same steps to obtain a transgenic empty vector Zhoumai 18 plant as a control of the transgenic plant.

Fourth, identification of sheath blight resistance of transgenic plants and transcription level of TaCOK gene

1. Culturing of wheat sheath blight hypha

Vertically filling the toothpick sections in a small beaker, preparing an MS liquid culture medium, pouring the MS liquid culture medium into the small beaker with the toothpick sections, inoculating the preserved Rhizoctonia graminis (Rhizoctonia cerealis) WK207 mycelium blocks into the beaker after sterilization, and culturing at a constant temperature of 25 ℃ until the hyphae are densely distributed with the toothpicks.

Preparing a wheat grain vermiculite culture medium (cooked wheat grains: sand in a volume ratio of 1:1, adding a proper amount of water, uniformly mixing), sterilizing, inoculating Rhizoctonia cerealis WK207, and culturing at a constant temperature of 25 ℃ until hyphae are densely distributed on the wheat grains.

2. Identification of sheath blight resistance

58T strains for which the experimental material for identification was step two₁Generation positive transgenic plants, 10 transgenic empty vector Zhouma 18 plants and 20 wild Zhouma 18 plants in the third step.

In the wheat jointing stage, two toothpicks full of wheat grain sclerotinia graminiformis WK207 are embedded between 1 st leaf sheath and 2nd leaf sheath at the base of the wheat, the natural stem holding state of the leaf sheaths is kept as much as possible during inoculation, and water is sprayed for moisturizing for 5 to 7 days after inoculation; and (5) investigating the disease condition of sheath blight at the wax ripeness stage and harvesting of wheat.

Sheath blight disease grading criteria were performed according to the method of plum depth et al (Table 2) (plum depth, plum Africa, plum Xianbi et al 1997, initial declaration of wheat germplasm for sheath blight resistance. crop variety resources (4):31-33).

The Disease Index (DI) is [ (Σ number of diseased plants per stage × representative value per stage)/(total number of plants × highest representative value) ] × 100.

Photographs of the sheath blight phenotype of wheat at harvest time and the corresponding disease grade are shown in fig. 5 and table 3.

The average grade of the banded sclerotial blight of 58 transgenic TaCOK Zhoumai 18 plants is 1.77, the disease index is 35.45, while the average grade of the banded sclerotial blight of wild type Zhoumai 18 plants is 2.61, and the disease index is 52.35 respectively, which shows that the transgenic TaCOK gene can enhance the resistance of the plants to the banded sclerotial blight. The strain number COK1-COK4 is TaCOK-transferred Zhoumai 18 plants; line number Z18 is wild-type zhou mai 18 (recipient plant); the strain number EV is a transferred empty vector plant.

Results show that TaCOK overexpression obviously improves the resistance of transgenic wheat plants to banded sclerotial blight.

TABLE 3 investigation results of sheath blight disease of transgenic wheat plants and controls

Line of plants	Grade of disease	Index of disease condition
			COK1	1.93^*	38.52^**
COK2	1.90^*	38.00^**
			COK3	1.73^*	34.60^**
COK4	1.53^**	30.60^**
			Z18	2.61	52.35
EV	2.66	53.33

Note: indicates that there is a significant difference in disease grade/disease index of each transgenic line from the weekly 18 disease grade/disease index at a P <0.05 level; indicates a significant difference in disease grade/disease index from bmass 18 for each transgenic line at P <0.01 levels.

Example 3 cultivation of wheat with reduced striae blight for TaCOK functional reverse analysis

Silencing TaCOK gene in wheat CI12633 by adopting virus-mediated gene silencing technology

1. The two ends of the DNA fragment represented by 1897-2148 th nucleotide of SEQ ID No.1 (SEQ ID No.3) are provided with NheI recognition sequence. After NheI digestion, inserting a DNA fragment (252bp) shown by 1897-position 2148-position nucleotide of SEQ ID No.1 into BSMV-gamma (gamma vector of BMSV virus) after NheI enzyme linearization by a reverse insertion method, and driving a DNA molecule (anti TaCOK) which is reversely complementary with the DNA fragment shown by 1897-position 2148-position nucleotide of SEQ ID No.1 by a T7 promoter of the gamma vector to obtain a recombinant vector BSMV-gamma: anti TaCOK.

2. Preparation of transcription reaction solution

(1) Taking the BSMV-alpha plasmid, carrying out enzyme digestion by using a restriction enzyme MluI, and recovering a linearized plasmid, namely the linearized BSMV-alpha. Taking the BSMV-beta plasmid, carrying out enzyme digestion by using a restriction enzyme SpeI, and recovering a linearized plasmid which is named as linearized BSMV-beta. Taking a recombinant plasmid BSMV-gamma: anti TaCOK, BSMV-gamma: GFP, digested with restriction enzyme MluI, recovered linearized plasmids, designated linearized BSMV- γ: anti TaCOK, linearized BSMV- γ: GFP.

(2) Taking the linear plasmid, and carrying out in vitro transcription reaction by using RiboMAX Large Scale RNA Production Systems-T7 kit (Promega) to obtain transcription reaction liquid.

When the linearized vector is linearized BSMV-alpha, the obtained transcription reaction solution is named as transcription reaction solution BSMV-alpha. When the linearized vector is linearized BSMV-beta, the obtained transcription reaction solution is named as transcription reaction solution BSMV-beta. The linearized vector is a linearized BSMV-gamma: in the case of GFP, the obtained transcription reaction solution was named as transcription reaction solution BSMV- γ: GFP. The linearized vector is a linearized BSMV-gamma: in the anti TaCOK process, the obtained transcription reaction solution is named as transcription reaction solution BSMV-gamma: TaCOK.

3. BSMV inoculated wheat plant

Taking 1.5ml of centrifuge tube, adding 10 mul of transcription reaction solution BSMV-alpha, 10 mul of transcription reaction solution BSMV-beta and 10 mul of transcription reactionLiquid BSMV- γ: TaCOK or transcription reaction solution BSMV-gamma: GFP, mix well, then add 60. mu.l RNase-free ddH₂O, adding 90 μ l GKP solution (solvent is water, containing 50mM glycine and 30mM K)₂

HPO

₄1% Bentonite and 1% Celite, pH9.2) to obtain a mixture of BSMV and TaCOK virus or a mixture of BSMV and GFP virus. When the seedlings of the wheat CI12633 grow to the three-leaf one-heart period, sucking the BSMV: TaCOK virus mixed liquor or the BSMV: GFP virus mixed liquor, rubbing and inoculating the mixture on the second leaf and the third leaf of the seedling (10 mu l of each leaf), spraying 0.1% DEPC aqueous solution on the surfaces of the leaves, covering the leaves with a film, preserving moisture for 24 hours, removing the preservative film, and spraying 0.1% DEPC aqueous solution on the surfaces of the leaves every 3 hours.

4. Quantitative RT-PCR detection of gene silencing

Taking the fourth leaf on the 12 th day of inoculation, extracting RNA, adopting wheat endogenous TaActin gene as an internal reference gene, detecting the silencing condition of TaCOK gene by RT-qPCR, and using primers:

TaCOK-QF：5′-TTTGGGATTCCATCCTTGCTG-3′；

TaCOK-QR：5′-ATGTTTGGTTGCCATTGCTCT-3′。

see example 1, step 2, for details.

The results are shown in FIG. 6: introducing BSMV: TaCOK genes in CI12633 plants of TaCOK are silenced to obtain a CI12633 (named as BSMV: TaCOKCI12633) with the silenced TaCOK genes; in contrast, the expression level of TaCOK gene in CI12633 (designated as BMSV: GFPCI12633 as a control) into which BSMV: GFP was introduced did not significantly change from that in CI12633, which is a wild-type wheat.

Secondly, identifying disease resistance of silenced plants

Transfecting BSMV to the wheat in the first step till the full tillering period (about 60 days), inoculating Rhizoctonia cerealis (Rhizoctonia cerealis) WK207 to the wheat by adopting a toothpick inoculation method, embedding toothpicks full of Rhizoctonia cerealis WK207 hyphae between the 1 st leaf sheath and the 2nd leaf sheath of the base part, placing the wheat grains of the wheat in the stem base part of the plant, slightly surrounding the wheat grains with wet absorbent cotton, and preserving moisture for 3 days. 15 days after inoculation of Rhizoctonia cerealis WK207, extracting RNA of the stem at the diseased part, performing quantitative and semi-quantitative RT-PCR analysis, and detecting the relative expression of Rhizoctonia solani Actin gene. The primers used for RT-qPCR were:

RcActin-F：5’-gcatccacgagaccacttac-3’；

RcActin-R：5’-gcgtcccgctgctcaagat-3’。

the results show that the relative expression amount of the Rhizoctonia cerealis WK207 Actin gene in the BSMV-TaCOK plant is significantly higher than that in the BSMV-GFP CI12633 (FIG. 7), namely the accumulation amount of the Rhizoctonia cerealis WK207 gene in the BSMV-TaCOKCI 12633 plant after the expression of the TaCOK gene is silenced is significantly higher than that of the Rhizoctonia cerealis WK207 gene in the control (BSMV-GFP CI12633) plant in which the TaCOK gene is normally expressed.

The grade of sheath blight was identified 45 days after inoculation of Rhizoctonia cerealis WK 207. The results are shown in FIG. 8, the sheath blight spots (average disease grade 3.00) of the stems of the plants with TaCOK gene expression silenced BSMV: TaCOK CI12633 are obviously larger than the spots (average disease grade 1.83) of the plants with the control (BSMV: GFPCI12633), and the spots of the wild plants have no statistical difference compared with the plants with the control (BSMV: GFP CI 12633). The results show that the defense capacity of CI12633 against rhizoctonia solani is reduced by the silencing of the TaCOK gene, and the results show that TaCOK is a gene required by the response of CI12633 against rhizoctonia solani and is also an important gene for resisting rhizoctonia solani of wheat.

Example 4 TaCOK transgenic wheat significantly regulates vernalization and photoperiod gene expression, and further regulates heading date

After germination, seeds of wild wheat Zhouma 18 and TaCOK transgenic Zhouma 18 (COK 2, COK3 and COK4 in example 2) were placed in a refrigerator at 4 ℃ for 30 days, and planted in flowerpots in 2019 for 30 months, with 8 germinated seedlings in each pot, 3-4 pots in each line, and moved to the outdoor growth of the institute of crop science in the national academy of agriculture, China, No. 12, Nanjiu, Guancun, Beijing. The transgenic wheat is moved to the greenhouse growth of the crop scientific research institute of Chinese academy of agriculture, 12-street, Beijing Zhongguancun, No. 12, 12 and 28 days in 2019, TaCOK gene Zhoumai 18 is transferred to the heading stage in 28 days in 12 and 18 days in 2020, 1 and 8 days in 2020, and further, TaCOK overexpression is further proved to remarkably promote vernalization and heading of the transgenic wheat. FIG. 9 shows the difference in heading date between wild type wheat Zhoumai 18 and TaCOK transgenic Zhoumai 18 photographed on day 1, month 3 of 2020.

In order to investigate the molecular mechanism thereof, the present inventors analyzed the vernalization gene TaVRN1(l.yan, a.loukoianov, G) in transgenic peripheral wheat 18 (COK 2, COK3, COK4 in example 2) and wild-type peripheral wheat 18 using a quantitative PCR technique.

M.

Fahima, and J.Dubcovsky, Positional cloning of The where Vernalization VRN1, PNAS May 13,2003vol.100no. 106263-6268), TaVRN3(L.Yan, D.Fu, C.Li, A.Blechl, G.tranquili, M.Bonafide, A.Sanchez, M.Vaiklar, S.Yasuda, and J.Dubcovsky, The where Verheatand barrel version gene 387N 2 is hologue of FT, PNAS December 19,2006.1035119581-19586), vernalization related gene TaVRT VRT 64 (protein coding therefor interacting with TaN 1, Li Xilieg Zhang, Kentunshang, Wakutan 20181-19586), vernalization related gene TavrT2 (protein coding for protein interaction with Tan 1, Li Xyle, Young Zhang, K, Wakuwang Zhang, K20181-wo, Wei, Shanghai, Cheng Hua, Shanghai, Shi-Sanhua, Shi Xue, Wei Xue, Shi Xue, Shi, Shi.

The wheat endogenous TaActin gene is used as an internal reference gene, which is specifically referred to step 2 of example 1.

Primer sequences for detecting TaVRN1 gene:

TaVRN1-QF：5’-GTATGAGCGCTATTCTTATG-3’；

TaVRN1-QR：5’-GATTCAAGATCCTCTCCCAT-3’。

primer sequences for detecting TaVRN3 gene:

TaVRN3-QF：5’-CAGGCCGGTCGATCTATACTA-3’；

TaVRN3-QR：5’-TCCTGTTCCCGAAGGTCA-3’。

primer sequences for detecting TaVRT2 gene:

TaVRT2-QF：5’-CAGAGGAAAATATGCGCTTG-3’；

TaVRT2-QR：5’-CATCATTGTCCTGCGAGCTT-3’。

the results are shown in fig. 10, and the expression level of 3 vernalization-associated genes (TaVRN1, TaVRN3, TaVRT2) in3 lines of TaCOK transgenic wheat is significantly higher than that in wild-type wheat Zhoumai 18.

According to the cultivation growth rule of receptor Zhoumai 18 (semiwinterness wheat), the Zhoumai 18 is respectively sown in the test fields of the crop science research institute of Chinese academy of agriculture of south Avenue of Guancun, Beijing in 10 months and 2019 in 10 months and 8 days, wherein the Zhoumai 18 and the Zhoumai 18 are basically synchronously introduced into the heading stage in 5 months and 2-5 days in 2019 and 1-3 days in 5 months and 2020, and the days of introduction into the heading stage of the Zhoumai 18 and the TaCOK gene-transferred Zhoumai 18 are not obviously different.

The heading phenotype and the expression condition of vernalization related genes of the empty vector transferred plant are basically consistent with those of wild wheat Zhoumai 18, and no obvious difference exists.

The results show that TaCOK can obviously regulate and control the expression of vernalization related genes in transgenic wheat, so that the transgenic wheat can be vernalized to perform ear-picking under the conditions of unsuitable temperature and the like, and the application area of wheat popularization and planting, namely wide adaptability, is increased. The wheat with the gene type has wide adaptability, can be propagated and added into generations in Yunnan/Hainan, can shorten the breeding period (2-3 years), and is beneficial to the development of wheat breeding industry.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> wheat disease-resistant and heading regulation gene TaCOK and related biological material and application thereof

<130> GNCLN201563

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2181

<212> DNA

<213> Triticum aestivum L.

<400> 1

gccgacacca cttaggattc agattagagg cggggaaaag cggaaaaagc agatggagaa 60

gacgacaggg atggcaggct cccagcccac cgacaccgag tcgttcgagt acatgctgct 120

ggagaaggac cccgaccact accggacggt cttctccggc ccgagccaga taagcccgtg 180

gatcgacccg gcggtgctga atctgaagca ccggatagga agaggcccct tcggggacgt 240

ctggatagcg acgcaccacc agaggacgga agattatgac cggtaccacg aggtcgccgt 300

gaagatgatg cacccggtca gggacgacca gctgcaggtg ttctcggcga ggttcgacga 360

ggtgttcggc aaatgccagg gcctgggcaa tgtctgcttc ctacatggca tctcaacgca 420

gaatgggagg ctttgcatag cgatgaagtt ttatgaagga tccatcgggg acaagatggc 480

tcggcttaaa ggtggaaggc tccctttgtc ggatgtttta agatgtggtg ccgatttggc 540

gcgtggtgtg ctagacctac actccagggg aatatttgtt cttaatctca agccttgcaa 600

ttttctcctt gatgaccatg accatgctgt gctgggggat tttgggattc catccttgct 660

gtttggactt tctctgccaa acccagagct tatccaaaga cttgggactc caaattacat 720

ggccccagag caatggcaac caaacatcag aggtccaatt agttacgaga cagattcatg 780

gggctttgcc tgcagcattc ttgagatgtt cagtggcgtt cagccttggc gtggcaaatc 840

accagatgaa atttatcagt tggttgtcct gaagaaagag aaaccgatat tcccatacaa 900

cttacctgca gaggttgaga atgtcctttc tagctgcttt gagtacgact ttcgggatcg 960

ccccttgatg tcagatatct tgcaagcatt tgaaagtgct aaagatgtgg attatgacaa 1020

caatggctgg gatagttctg aaaacccaag ggcagtagtg ccaagtcaca ctaattggtc 1080

acaccttaag gataagctgc aagttggtga caaggtccgc tcgagaaagg ttaaaaactc 1140

ttgtactcct gaagcaatgg aaattcctga tggaaccata gttggcatgg aggaggatgg 1200

agaacgtgat agctacattc ttgtacgagt ccatggaata catgaccctt tgaaggtcca 1260

ttcctcgaca gtggagaggg tgacctatgg tttcgctgcc ggaggctggg taaggcttag 1320

ggaggaagac aagaagcggt ctcaggtcgg aattcttcat agcattgacc gtaatggcac 1380

cgtgtatgtt ggtttaatag gaatggacac cctctggaag ggggaatatt caggtctgca 1440

aatggccgaa gcctactgtg tgggacaatt tgtgaggctg agaaccaaca cttcaagccc 1500

gcggttcgaa tggcagcgaa agagaggcgg ggtgtttgcc acaggccgta tttcacagat 1560

actctcgaat ggatgccttg ttgtgacctt ctctggcaag ttgagccttg gcgaagtgtg 1620

cagctgcttg gccgaccctt ctgaggtgga ggtggtgagc ttcgacaagt gcgagggggt 1680

tgtgaagaag tatgagcacc tcgaggactt ccattgggcg gtaagacctc tgttcatcgc 1740

cataggtttc tttactgcta tggagctagg tgtgttcgtc gggaagagca tcacaaggcc 1800

aaggagtcga aaggtcgcca gcgtctccga tcagggtgcc gatcctcaga aagttcagca 1860

gcaagaagtg cacaacagtg ccggcacggc atggctccct ccacccgtcg caaacatgct 1920

tttcagggac ggtcctgcgc cttctgggta aaactgcaaa agcaatgttg ggtgtaccct 1980

gaagtatatc tcgatcatgc aacgctttga acaagccgtg ctgtgtatat ttagggctgt 2040

aattttctac cttgccaaaa ccttgtaaat tagtatctgc ctctacaact cagcatgcct 2100

gagctcaact gctctaggat cattcctaga tgtttctaga agcatgcaac tacgggaggt 2160

tcaaaaaaaa aaaaaaaaaa a 2181

<210> 2

<211> 632

<212> PRT

<213> Triticum aestivum L.

<400> 2

Met Glu Lys Thr Thr Gly Met Ala Gly Ser Gln Pro Thr Asp Thr Glu

1 5 10 15

Ser Phe Glu Tyr Met Leu Leu Glu Lys Asp Pro Asp His Tyr Arg Thr

20 25 30

Val Phe Ser Gly Pro Ser Gln Ile Ser Pro Trp Ile Asp Pro Ala Val

35 40 45

Leu Asn Leu Lys His Arg Ile Gly Arg Gly Pro Phe Gly Asp Val Trp

50 55 60

Ile Ala Thr His His Gln Arg Thr Glu Asp Tyr Asp Arg Tyr His Glu

65 70 75 80

Val Ala Val Lys Met Met His Pro Val Arg Asp Asp Gln Leu Gln Val

85 90 95

Phe Ser Ala Arg Phe Asp Glu Val Phe Gly Lys Cys Gln Gly Leu Gly

100 105 110

Asn Val Cys Phe Leu His Gly Ile Ser Thr Gln Asn Gly Arg Leu Cys

115 120 125

Ile Ala Met Lys Phe Tyr Glu Gly Ser Ile Gly Asp Lys Met Ala Arg

130 135 140

Leu Lys Gly Gly Arg Leu Pro Leu Ser Asp Val Leu Arg Cys Gly Ala

145 150 155 160

Asp Leu Ala Arg Gly Val Leu Asp Leu His Ser Arg Gly Ile Phe Val

165 170 175

Leu Asn Leu Lys Pro Cys Asn Phe Leu Leu Asp Asp His Asp His Ala

180 185 190

Val Leu Gly Asp Phe Gly Ile Pro Ser Leu Leu Phe Gly Leu Ser Leu

195 200 205

Pro Asn Pro Glu Leu Ile Gln Arg Leu Gly Thr Pro Asn Tyr Met Ala

210 215 220

Pro Glu Gln Trp Gln Pro Asn Ile Arg Gly Pro Ile Ser Tyr Glu Thr

225 230 235 240

Asp Ser Trp Gly Phe Ala Cys Ser Ile Leu Glu Met Phe Ser Gly Val

245 250 255

Gln Pro Trp Arg Gly Lys Ser Pro Asp Glu Ile Tyr Gln Leu Val Val

260 265 270

Leu Lys Lys Glu Lys Pro Ile Phe Pro Tyr Asn Leu Pro Ala Glu Val

275 280 285

Glu Asn Val Leu Ser Ser Cys Phe Glu Tyr Asp Phe Arg Asp Arg Pro

290 295 300

Leu Met Ser Asp Ile Leu Gln Ala Phe Glu Ser Ala Lys Asp Val Asp

305 310 315 320

Tyr Asp Asn Asn Gly Trp Asp Ser Ser Glu Asn Pro Arg Ala Val Val

325 330 335

Pro Ser His Thr Asn Trp Ser His Leu Lys Asp Lys Leu Gln Val Gly

340 345 350

Asp Lys Val Arg Ser Arg Lys Val Lys Asn Ser Cys Thr Pro Glu Ala

355 360 365

Met Glu Ile Pro Asp Gly Thr Ile Val Gly Met Glu Glu Asp Gly Glu

370 375 380

Arg Asp Ser Tyr Ile Leu Val Arg Val His Gly Ile His Asp Pro Leu

385 390 395 400

Lys Val His Ser Ser Thr Val Glu Arg Val Thr Tyr Gly Phe Ala Ala

405 410 415

Gly Gly Trp Val Arg Leu Arg Glu Glu Asp Lys Lys Arg Ser Gln Val

420 425 430

Gly Ile Leu His Ser Ile Asp Arg Asn Gly Thr Val Tyr Val Gly Leu

435 440 445

Ile Gly Met Asp Thr Leu Trp Lys Gly Glu Tyr Ser Gly Leu Gln Met

450 455 460

Ala Glu Ala Tyr Cys Val Gly Gln Phe Val Arg Leu Arg Thr Asn Thr

465 470 475 480

Ser Ser Pro Arg Phe Glu Trp Gln Arg Lys Arg Gly Gly Val Phe Ala

485 490 495

Thr Gly Arg Ile Ser Gln Ile Leu Ser Asn Gly Cys Leu Val Val Thr

500 505 510

Phe Ser Gly Lys Leu Ser Leu Gly Glu Val Cys Ser Cys Leu Ala Asp

515 520 525

Pro Ser Glu Val Glu Val Val Ser Phe Asp Lys Cys Glu Gly Val Val

530 535 540

Lys Lys Tyr Glu His Leu Glu Asp Phe His Trp Ala Val Arg Pro Leu

545 550 555 560

Phe Ile Ala Ile Gly Phe Phe Thr Ala Met Glu Leu Gly Val Phe Val

565 570 575

Gly Lys Ser Ile Thr Arg Pro Arg Ser Arg Lys Val Ala Ser Val Ser

580 585 590

Asp Gln Gly Ala Asp Pro Gln Lys Val Gln Gln Gln Glu Val His Asn

595 600 605

Ser Ala Gly Thr Ala Trp Leu Pro Pro Pro Val Ala Asn Met Leu Phe

610 615 620

Arg Asp Gly Pro Ala Pro Ser Gly

625 630

<210> 2

<211> 252

<212> DNA

<213> Triticum aestivum L.

<400> 2

ccctccaccc gtcgcaaaca tgcttttcag ggacggtcct gcgccttctg ggtaaaactg 60

caaaagcaat gttgggtgta ccctgaagta tatctcgatc atgcaacgct ttgaacaagc 120

cgtgctgtgt atatttaggg ctgtaatttt ctaccttgcc aaaaccttgt aaattagtat 180

ctgcctctac aactcagcat gcctgagctc aactgctcta ggatcattcc tagatgtttc 240

tagaagcatg ca 252

Claims

1. The protein is the protein of A1) or A2) as follows:

A1) protein with amino acid sequence shown as SEQ ID No. 2;

A2) a1) to the N-terminus or/and C-terminus.

2. The biomaterial related to the protein of claim 1, which is any one of the following B1) to B5):

B1) a nucleic acid molecule encoding the protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B5) a nucleic acid molecule that reduces the expression of the protein of claim 1.

3. The related biological material according to claim 2, wherein: B1) the nucleic acid molecule is 1) or 2) as follows:

1) the coding sequence of the coding chain is a DNA molecule of nucleotides 53 to 1951 of SEQ ID No.1 in the sequence table;

2) the nucleotides of the coding strand are DNA molecules of SEQ ID No. 1.

4. Use of any one of the following P1-P9 of the protein of claim 1 or the biomaterial of claim 2 or 3:

use of P1, a protein as defined in claim 1, or a biomaterial as defined in claim 2 or 3 for modulating disease resistance in plants;

use of P2, the protein of claim 1, or the biomaterial of claim 2 or 3 for the preparation of a product for enhancing disease resistance in plants;

use of P3, a protein according to claim 1 or a biomaterial according to claim 2 or 3 for growing disease-resistant plants;

use of P4, a protein according to claim 1 or a biomaterial according to claim 2 or 3 for the preparation of a plant disease resistant product;

use of P5, a protein according to claim 1 or a biomaterial according to claim 2 or 3 for modulating vernalization in a plant;

use of P6, a protein according to claim 1 or a biomaterial according to claim 2 or 3 for modulating the expression of a vernalization gene and/or vernalization-associated gene in a plant;

use of P7, the protein of claim 1 or the biomaterial of claim 2 or 3 for modulating the heading stage of a plant by modulating vernalization gene and/or vernalization-related gene expression;

use of P8, a protein according to claim 1 or a biomaterial according to claim 2 or 3 for modulating pre-spiking of plants under vernalization by promoting expression of vernalization genes and/or vernalization-associated genes;

use of P9, the protein of claim 1 or the biological material of claim 2 or 3 in plant breeding;

the plant is wheat;

the disease resistance is banded sclerotial blight resistance;

the vernalization gene is a TaVRN1 gene and/or a TaVRN3 gene; the vernalization-related gene is specifically TaVRT2 gene.

5. Use according to claim 4, characterized in that: the pathogenic bacteria of the sheath blight are rhizoctonia cerealis.

6. Any one of the following methods:

the method A comprises the following steps: a method of growing disease-resistant plants comprising the steps of: increasing the expression level of the protein of claim 1 or a gene encoding the protein in a recipient plant to obtain a plant of interest; the disease resistance of the target plant is higher than that of the receptor plant;

the method B comprises the following steps: a method of breeding a transgenic plant with reduced disease resistance comprising the steps of: reducing the expression level of a gene encoding the protein of claim 1 in a recipient plant to obtain a transgenic plant having a lower disease resistance than the recipient plant;

the method C comprises the following steps: a method of growing plants with a controlled heading date comprising the steps of: increasing the expression level of the protein of claim 1 or a gene encoding the protein in a recipient plant to obtain a plant of interest; if the target plant is sown according to the cultivation growth rule of the receptor plant, the target plant and the receptor plant enter a heading stage synchronously; if the vernalization treatment is carried out before the target plant is sown, the target plant is sown when the cultivation growth rule of the receptor plant is not met, and the ear of the target plant can be pulled out earlier than that of the receptor plant under the same condition;

the plant is wheat;

the disease resistance is banded sclerotial blight resistance.

7. The method of claim 6, wherein: increasing the expression level of the protein of claim 1 or a gene encoding the protein in the recipient plant by introducing the gene encoding the protein of claim 1 into the recipient plant.

8. The method of claim 6, wherein: the reduction of the expression level of the gene encoding the protein of claim 1 in the recipient plant is achieved by introducing into the recipient plant a DNA molecule reverse-complementary to the DNA fragment represented by nucleotides 53 to 1951 of SEQ ID No. 1.

9. The method of claim 6, wherein: the temperature of the vernalization treatment is 4 ℃, and/or the time of the vernalization treatment is 30 days.

10. The method of claim 6, wherein: the pathogenic bacteria of the sheath blight are rhizoctonia cerealis.