CN109006454A - A method of the third generation is obtained by hybridization technique and keeps system - Google Patents

Abstract

The method that the third generation keeps system is obtained by hybridization technique this application discloses a kind of, comprising the following steps: (1) female parent is remained with the third generation, normal conventional strain to be rebuilt is male parent, and hybridization obtains F1；(2) it chooses after F1 generation red-coloured seeds are planted and obtains BC1 seed with normal conventional strain to be improved backcrossing；(3) plantation BC1 obtains BC1 plant for red-coloured seeds；Divide single plant to number before heading, takes blade to extract DNA, the plant of sterile gene eat is contained using molecule assisting sifting, continues to be returned later；(4) step (3) are repeated, generally goes through the backcrossing and selection in mostly generation, the genetic background for being returned to backcross progeny restores 90% or more of recurrent parent；(5) it is selfed, which is the new third generation holding system that backcross transformation obtains.Backcross transformation can be carried out simultaneously to multiple materials simultaneously, it is most important that the result of backcross transformation has predictable, and the test period is shorter.

Description

A method of the third generation is obtained by hybridization technique and keeps system

Technical field

The present invention relates to Crop Genetic Breeding technical field, in particular to a kind of third generation genetic engineering keeps the application of system And the method for rice male-sterile plants system initiative.

Background technique

Rice is the important cereal crops in the whole world, and there are about 50% populations in the world using rice as staple food, and rice is also Process the raw material of numerous food product.Since the genome of rice is smaller, and rice conversion system is highly developed, can be used as list The model plant of leaf research, people need to be understood to rice reproductive development mechanism.

The new era of paddy rice cross breeding breeding has been started in the discovery and its utilization of male sterible series of rice, to raising rice yield Great function is played.There are fertility instabilities, cytoplasm negative effect for the sterile line as used in current paddy rice cross breeding process The disadvantages of, therefore carry out the research of male sterility of rice regulatory mechanism in a deep going way, to novel rice sterile line is obtained, improves agricultural and produce Amount etc. is of great significance.

Also there is important theory significance to molecular regulation mechanism for disclosing plants ' reproduction development etc. simultaneously.Male is not It educates and is: referring to and a kind of male degenerate normally female rice cannot since pollen is powerlessly lived for (mainly pollen degeneration) but gynoecium Self-pollination is solid, only by foreign pollen ability fertilization, therefore passes through by this female rice as genetic tool The method of artificial supplementary pollination can generate a large amount of hybrid seeds.From Breeding strategy, the development of hybrid rice can be divided into Three line method, two line method and one are three developing stage of method.

It often enters a new phase, is all the primary breakthrough in breeding, thus can the output increased of rice is new to one Step.The hybrid rice in production belongs to the scope of three line method interbreed use of advantage, this ternary hybrid rice now Generally than conventional rice volume increase 20% or so, still, Three-line Hybrid rice paddy seed Heterosis is complicated, by restorer and guarantor Holding is relationship limitation, keeps excellent combined screening relatively difficult.Although double-hybrid rice strains breaches extensive Bao Guan in three line method The restriction of system greatly improves the excellent combined efficiency of screening, but the fertility of two line method sterile line is by temperature and illumination shadow Sound is larger, and different regions varying environment all influences production of hybrid seeds effect, and the optional range of seed breeding base is smaller, and therefore, two line method is being made Kind produce that there are certain risks, once there are extreme weather conditions, consequence is extremely serious.

In recent years, hasty breaching was obtained by the third generation hybrid rice of core of engineering sterile line, it both solves three It is that method is restricted by Rescued virus, the low problem of resource utilization, while also avoiding being affected by the external environment when the two line method production of hybrid seeds The problem of.Therefore, the development of third generation hybrid rice will work rice breeding and be promoted to a new stage.Currently, the Three generations hybrid rice is in the stage of greatly developing, to quickly third generation hybrid rice technology screening be utilized to go out excellent group It closes, primarily solves the problems, such as to be how that quickly obtaining a collection of third generation engineering sterile line carries out the test of test cross combo, simultaneously It obtains corresponding third generation engineering and keeps system.

Summary of the invention

Technical problem to be solved by the present invention lies in, provide it is a kind of by hybridization technique obtain the third generation keep system Method.The method of the present invention, after theoretically obtaining an excellent transformation event using genetic engineering, i.e., using backcross transformation pair Any rice varieties are transformed into the third generation and keep system, and backcross transformation is theoretical simple, it can be readily appreciated that the works such as field hybridization Work is simple compared to laboratory molecular test, easy to operate, can carry out backcross transformation simultaneously to multiple materials simultaneously, it is most important that return It hands over the result of transformation to have predictable, and the test period is shorter, backcross improvement test is carried out with the speed in 1 year three season of plantation, It only needed for two years can be obtained new three generations and keeps system.

In order to solve the above technical problems, obtaining the side that the third generation keeps system by hybridization technique the present invention provides a kind of Method, which comprises the following steps:

(1) female parent is remained with the third generation, normal conventional strain to be rebuilt is male parent, and hybridization obtains F1；

(2) it chooses after F1 generation red-coloured seeds are planted and obtains BC1 seed with normal conventional strain to be improved backcrossing；

(3) plantation BC1 obtains BC1 plant for red-coloured seeds；Divide single plant to number before heading, blade is taken to extract DNA, utilizes Molecule assisting sifting contains the plant of sterile gene eat, continues to be returned later；

(4) step (3) are repeated, generally goes through the backcrossing and selection in mostly generation, the genetic background for being returned to backcross progeny is restored 90% or more of recurrent parent；

(5) it is selfed, which is the new third generation holding system that backcross transformation obtains.

The step (1) further comprises: it is female parent, normal conventional rice to be rebuilt that the third generation, which keeps system's military fortune round-grained rice 7, Strain is male parent, and hybridization obtains F1.

The step (3) further comprises:

The step of DNA is extracted；

The step of DNA is detected；

The step of PCR amplification；

The step of polyacrylamide gel electrophoresis.

The step of DNA is extracted, further comprise: every plant of BC1 plant takes 0.5g rice leaf to be put in -20 DEG C of low temperature colds In the grinding body of jelly.Liquid nitrogen grinding is added into white powder, is put into the centrifuge tube of 2mL.While grinding, opens water-bath and open Pass is heated to 65 DEG C.

The step of DNA is extracted further comprises: the CTAB cracking of 65 DEG C of 700 μ L preheating 1h being added into centrifuge tube Liquid, overturning are rocked several times, and 40min in 65 DEG C of thermostat water baths is placed into.

The step of DNA is extracted further comprises: sample being put into and cools down 5min at room temperature, 700 μ L phenol-chlorine is added Imitative-isoamyl alcohol againsts wall addition, and overturning is rocked several times, and checks whether leakage.

The step of DNA is extracted, further comprises: pushing down pipe lid with hand, slowly overturn several times, put on shaking table later One newspaper, sets each pipe, and 30rpm shakes 5~10 minutes at room temperature.

The step of DNA is extracted, further comprises: being put into refrigerated centrifuge, and 12000rpm is centrifuged 5min at 4 DEG C.

The step of DNA is extracted, further comprise: 700 μ L phenol-chloroforms-isoamyl is added in adherent Aspirate supernatant again Alcohol, extracting is primary again, and 10 μ LRnase are added in extracting supernatant, is placed at room temperature for 30min；If supernatant is clarified, directly skip This step carries out next step operation.

The step of DNA is extracted further comprises: it is adherent that isometric 700 μ L isopropanol is added, slowly overturn 15 times, There is flocculent deposit, be put into -20 DEG C of refrigerators, taken out after 30min, is centrifuged with refrigerated centrifuge trim.

Beneficial effect of the present invention includes: the method for the present invention, theoretically obtains an excellent transformation event using genetic engineering Later, i.e., the third generation is transformed into any rice varieties using backcross transformation and keeps system, and the theoretical letter of backcross transformation It is single, it is easy to operate it can be readily appreciated that the work such as field hybridization are simple compared to laboratory molecular test, can simultaneously to multiple materials simultaneously Carry out backcross transformation, it is most important that the result of backcross transformation has predictable, and the test period was shorter, with plantation three in 1 year The speed in season carries out backcross improvement test, only needed for two years can be obtained new three generations and keeps system.

Detailed description of the invention

Fig. 1 is third generation backcross transformation flow chart described in the embodiment of the present invention.

Specific embodiment

The present invention is described in detail below with reference to embodiment.To keep the objectives, technical solutions, and advantages of the present invention clearer, bright Really, the present invention is described in more detail below, but the invention is not limited to these embodiments.

System is kept to do donor parents using the existing third generation, normal conventional rice passes through backcross transformation as recurrent parent It obtains the new third generation and keeps system.

(1) it is female parent that the third generation, which keeps system's military fortune round-grained rice 7, and normal conventional rice strain to be rebuilt is male parent, and hybridization obtains F1,

(2) plantation of F1 generation red-coloured seeds is chosen, obtains BC1 seed with normal conventional rice strain to be improved backcrossing after heading,

(3) plantation BC1 obtains BC1 plant, divides single plant to number before heading for red-coloured seeds, and blade is taken to extract DNA, utilizes Molecule assisting sifting contains sterile gene eat, and genetic background is biased to the plant of recurrent parent, the Selection utilization point of genetic background Son label (seeing attached list 1) is screened, and continues to be returned after plant heading out to be screened；

(4) step (3) are repeated, generally goes through the backcrossing and selection in 3-4 generation, the genetic background of backcross progeny can restore circulation 90% or more of parent, wherein every generation backcross generations all need screening containing eat gene, and genetic background is biased to recurrent parent Plant；

(5) when 90% or more of the background recovery of backcross progeny to recurrent parent, make its selfing, and self progeny needs Single plant harvests, and red-coloured seeds are screened in self progeny and normal white seed rate is 1: 1, and the whole males of white seed are not The plant educated, the plant are the new third generation holding system that backcross transformation obtains, and can usually be sifted out when being selfed the second generation Target single plant.

DNA is extracted

1. every plant of BC1 plant takes 0.5g rice leaf to be put in the grinding body of -20 DEG C of cryogenic freezings.Liquid nitrogen grinding Cheng Bai is added Color is powdered, is put into the centrifuge tube of 2mL.While grinding, opens water-bath switch and be heated to 65 DEG C.

2. the CTAB lysate of 65 DEG C of 700 μ L preheating 1h is added into centrifuge tube, overturning is rocked several times, places into 65 DEG C 40min in thermostat water bath (every 20min, overturning is rocked several times)

3. sample is put into and cools down 5min at room temperature, 700 μ L phenol-chloroforms-isoamyl alcohol (25: 24: 1) is added, againsts wall and adds Enter, overturning is rocked several times, and checks whether leakage

4. pushing down pipe lid with hand, slowly overturn several times, puts a newspaper on shaking table later, set each pipe, at room temperature 30rpm shakes 5~10 minutes.

5. being put into refrigerated centrifuge, 12000rpm is centrifuged 5min at 4 DEG C.

6. 700 μ L phenol-chloroforms-isoamyl alcohol (25: 24: 1) is added in adherent Aspirate supernatant again, extracting is primary again, takes out It puts on clear liquid and 10 μ L Rnase (10mg/mL) is added, be placed at room temperature for 30min, can not put upside down.If supernatant is clarified, directly jump This step is crossed, next step operation is carried out.

7. adherent be added isometric 700 μ L (- 20 DEG C) isopropanol, slowly overturn 15 times, flocculent deposit occur, be put into -20 It in DEG C refrigerator, is taken out after 30min, is centrifuged (4 DEG C, 12000rpm, 10min) with refrigerated centrifuge trim

8. removing supernatant, 700 μ L is added, 70% ethyl alcohol is pre-chilled, blown and beaten with 200 μ L pipette tips, clean DNA, blotting net second After alcohol, drying of uncapping is put into aseptic operating platform.

9. 50 μ L ddH2O are added.

DNA detection

1. weighing agarose 1.4g (50 hole glue groove), the 1 × TAE of 140mL (70/35mL) is added, is put into micro-wave oven high Temperature is heated to boiling, limpid well-illuminated best without cotton-shaped muddiness in bottle.

Then plus ethidium bromide (100mL TAE adds 6 μ L) it is impregnated in cold water 2. being put into or washes away 1min in tap, delayed It is slow to pour into glue groove, it is inserted into comb, places 20min gel.

TAE formula: liquid (1 times) 0.04mol/L Tris- acetic acid+0.001mol/L EDTA is used

Storing liquid (50 times) Tris- alkali 242.2g, glacial acetic acid 57.1ml, 0.5mol/L EDTA (PH=8.0) plus water constant volume To 1L.

3. 6 × Loading Buffer, 3 μ L is added with PCR plate, the 3 μ L of DNA that has extracted is added, with rifle point to crying glue hole In, 12 one lattice of sky are good to distinguish, and can also set the voltage to 140V or so in the blank lattice point DNA Marker of differentiation, open Beginning electrophoresis.

6 × Loading Buffer formula: 100 μ of bromine Finland 0.015g+ dimethylbenzene cyanogen FF 0.015g+0.5M/L EDTA L+ ficoll 4g, adds water to be settled to 10ml)

4. seeing the position of indicator, glue can be taken out by going to 1.5cm or so, be put into and taken pictures according in glue imager.

The DNA concentration for being suitble to PCR is 50ng/Ml

PCR amplification

1. primer mother liquor: ddH2O is added in dry powder, and the number after OD value is exactly the milligram of added water multiplied by OD value.Dry powder Primer 13000rpm before is centrifuged, and dry powder is allowed all to sink to the bottom.Tap enzyme will be also centrifuged.

2. primer mix: in use, upstream and downstream primer respectively takes 10 μ l, 480 μ l deionized waters are added and mix.(this is female for primer The dilution of liquid)

3.PCR reaction system: each plate hole of PCR personality board clicks and enters following system

20 μ l altogether, a hole PCR, all the things will be loaded on ice, because of enzyme easy in inactivation.

4.PCR amplified reaction program:

Mix PCR system in advance: 200 μ l, d NTP of Buffer, 30 μ l, Tap enzyme 20 μ l, ddH2O1ml, upstream and downstream are drawn Object 1: 1 mixes plus 300 μ l, DNA separately add.Reaction mixture is as follows:

(6 μ l are primer mothers to 200 μ l+dNTP of Buffer, 30 μ l+Tap enzyme, 20 each 6 μ l of μ l+ddH2O1ml+ upstream and downstream primer Liquid), ddH2O288 μ l

After PCR plate has added all reaction systems, a drop paraffin (20 μ l) to be added to seal up for safekeeping.Adding primer mixed system is PCR Plate will be put on ice.

The PCR template added is put into -20 DEG C of preservations and waits PCR.Otherwise enzyme is easy inactivation.

5.PCR amplified reaction program:

Be added after amplification 8ml loading buffer (can carry out after the completion of this step agar sugar detection DNA whether PCR Band out), 94 DEG C of denaturation 10min, then be put into 4 DEG C of refrigerators and save, polyacrylamide gel electrophoresis is carried out in next step.

Polyacrylamide gel electrophoresis

1. spraying alcohol on glass otic placode first, then scrubbed with paper handkerchief, guarantees then to be put into logical without paper scrap above In wind kitchen, smeared with 2% removing silane (solvent is chloroform, formula: adding 10mL to remove silane, 490mL chloroform is added to mix) equal Even, dosage is probably 10mL, and it is suitable for being smooth to the touch after nuzzling up, this step is critically important, after directly affecting whether viscose glue, then Place 10min or so.

2. during placing otic placode, bottom plate is sprayed one time with alcohol, scrubbed, guaranteed above without dust with paper handkerchief, Then with affine silane (affine 50 μ L of silane, 50 μ L of acetic acid), add alcohol to 5mL (5mL bottle is filled it up with), be poured on bottom plate and smear Uniformly.(noticing that gloves cannot encounter glass plate when smearing, and will draw sleeve, otherwise scrap rubber).

3. edge strip is wiped clean, bottom plate the right and left respectively puts one, (the thickness of edge strip after impregnating in clear water with paper handkerchief Probably it is exactly the thickness of glue), the bottom edge for being directed at the both sides of bottom plate posts.

4. the otic placode dried is taken out from ventilating kitchen, the one side of removing silane is applied, alignment bottom plate applies the one of affine silane Face, plate are aligned with plate and press, then will respectively press from both sides upper two clips to good big plate the right and left, and clip will be clipped on edge strip, and altogether 4 A clip clips solid.

5. one big plate (is weighed) with about 70mL with graduated cylinder, and the inside first adds 10% with the PA glue of encapsulating bottled 6% 400 40 μ L of μ L, TEMED of APS.Then glue is poured into again, is slightly had in otic placode indentation, there from plate and is started to spread glue with a distance from a bit, one Side encapsulating strikes big plate on one side, guarantees that glue at the uniform velocity advances, gently pats to remove bubble.It is firmly beaten when encapsulating is to glass plate bottom A few lower bottom part glass plates, until glue is emerged but is not dripped preferably.Encapsulating terminates, and whether has bubble at procuratorial work encapsulating mouth, can if having Gone out with hook hook, extrusion can also be patted, then mends glue.

6. stripping fork is also soaked in water, cleans up and dry, one section of the tack of tooth is not put into otic placode indentation, there, first soaks Enter in glue, be inserted into big plate with skilful power, centainly guarantee no bubble, horizontal line is little by little best in the depth to excessive plate of insertion (about 1cm) mends a glue after being inserted into stripping fork again, then clips two big clips, and with horizontal ruler level-off, (pedestal is available to be inserted It is horizontal to enter pipette tips pad)

Gel (about 2h) is waited 7. placing

8. first removing all clips after gel, the stripping fork on plate is removed, is put on sink, by upper and lower two plates Surface residue glue liquid brushes off.

9. the groove of big plate upper ear plate is also brushed, this step is important, is related to and whether runs glue success.

10. big plate is put into electrophoresis frame, that puts otic placode facing towards wall, following 3 buttons is tightened simultaneously (first while stubborn Two of both sides, then intermediate button is twisted, it not twist too tight, otherwise can leak tank liquor, also should not be rather too tight, plate can be fried) so Big plate both sides are also set with button is clamping afterwards, and the button of the button folder on both sides tightens fixation to wall.

11. upper tank liquor is poured into upper slot, upper tank liquor did not had glue surface, the glue hole in a lower groove was urged with suction pipe, by broken glue It blows away, prevents stifled glue, Loading-Buffer level is added, first carry out prerunning 20min.

(upper tank liquor is prepared: upper tank liquor is 0.33 times of TBE, and 10 times of TBE of 30ml is taken to add water to 900ml)

(lower tank liquor is prepared: lower tank liquor is 1 times of TBE, and 10 times of TBE of 1000ml is taken to add water to 1000ml)

12.Loading-Buffer is gone to after certain position (at general 5cm), suspends electrophoresis, then by stripping fork with sawtooth That face is slowly inserted into glue-line, notices that stripping fork will stay a little outside glass plate, otherwise can not point sample, but stripping fork will also be pricked Enter in glue, each DNA sample can be separated well.

13. the glass plate of outer surface is wiped clean, then with the good line of red stroke.

Sample (4 DEG C of preservations) after 14.PCR takes out, and each 6 μ L of hole is clicked and entered in the hole of electrophoresis stripping fork.

15. after point complete, electrophoresis apparatus is opened, settable voltage needed for oneself, electric current, power (general voltage stabilization, selection 1500V~1800V) electrophoresis is carried out, general first race electrophoresis about 8em (three fingers are wide) can put second layer DNA sample again This, general 1h of electrophoresis or so in total.

16. correctly running glue: indicator decline is neat, and linear ribbon is walked downwards.It runs cementing beam: running the Article 2 of glue Blue Streak band (lose time that) go to board bottom and be advisable, can be considered that running electrophoresis terminates.(the fast blue zone of race ----bromophenol blue is run Obtain band ----xylene blue slowly)

17. closing electrophoresis apparatus, big plate is unloaded, in next step, silver staining, development.

18. plate is removed in gel electrophoresis, silver staining, development step:

(1) first upper tank liquor is exported, then removes the fixed clip in side, then remove the fixation of pedestal, taken plate, be put into sink In impregnate.

(2) two glass plates point are pried open come (correctly running glue, glue sample should prepare silver staining on bottom plate) with flat chisel

Sufficiently oscillation shakes up.Big plate is put into and is wherein protected from light silver staining 10min, it is not possible to which silver staining is too long, otherwise degumming.

Big plate taking-up is rinsed with distilled water after silver staining, development

Developer solution configuration: NaOH 30g (one bottle cap of NaOH bottle can with)

Formaldehyde 6ml (two bottle cap of formaldehyde bottle can be with, notices that smell is very big, finally plus)

Distilled water 1500ml

The good big plate of silver staining is sufficiently developed in developer solution, washes away alkali taste after development in water by abundant shaken well.

DNA band is observed in luminescent screen, is taken pictures.

EAT1 is mutated sterile gene eat selection

Eat primer

Primer

Upstream primer: TACAGGAGTAGCAGCGGTTC

Downstream primer: TGGTACCTAACTGGAGAGCTGA

EAT1 primer size: 78bp eat primer size: 76bp

Embodiment 1

A kind of backcross transformation method that system is kept about rice third generation, specifically comprises the following steps:

A. keep system's military fortune round-grained rice 7 for female parent with the rice third generation, yellow Hua Zhanwei male parent, selfing obtains F1 seed；

B. kind plants F1 red-coloured seeds, obtains F1 plant, accounts for backcrossing with yellow China and obtain BC1 for seed；

C. kind plants seed red in BC1 generation, obtains BC1F1 plant, after dividing it single plant to number, blade is taken to extract DNA, Detection contains sterile gene eat, and genetic background is biased to the plant that yellow China accounts for；

Continue after the single plant heading that D.BC1 generation filters out and Huang spent to account for be returned；

E. 3 generation of repeated backcross, and the screening of each backcross generations contains sterile gene eat, and genetic background is biased to wheel Return the plant of parent；

F.BC3 generation selfing is primary to obtain BC3F2；

G.BC3F2 is after planting selfed second and obtains BC3F3, divides single plant to harvest after mature；

H.BC3F3 seed presses single plant, and Red Indian race and white seed are all divided head progeny row to plant by each strain respectively, to flowering Phase observes the fertility of the sub- head progeny row plant of white race, if all plant of the head progeny row is sterile plant, the corresponding Red Indian race of the head progeny row Son is exactly that the new third generation holding being transformed is Huang Huazhan.

I. by signing, the improved third generation keeps system to account for genetic background similarity with former yellow China and is up to 95% or more, And field stable fertility, economical character is neat, meets rice breeding demand；

Embodiment 2

A. keep system's military fortune round-grained rice 7 for female parent with the rice third generation, Soviet Union R900 is male parent, and selfing obtains F1 seed；

B. kind plants F1 red-coloured seeds, obtains F1 plant, is returned to obtain BC1 for seed with Soviet Union R900；

C. kind plants seed red in BC1 generation, obtains BC1F1 plant, after dividing it single plant to number, blade is taken to extract DNA, Detection contains sterile gene eat, and genetic background is biased to the plant of Soviet Union R900；

Continue after the single plant heading that D.BC1 generation filters out and Huang spent to account for be returned；

E. 3 generation of repeated backcross, and the screening of each backcross generations contains sterile gene eat, and genetic background is biased to wheel Return the plant of parent；

F.BC3 generation selfing is primary to obtain BC3F2；

G.BC3F2 is after planting selfed second and obtains BC3F3, divides single plant to harvest after mature；

H.BC3F3 seed presses single plant, and Red Indian race and white seed are all divided head progeny row to plant by each strain respectively, to flowering Phase observes the fertility of the sub- head progeny row plant of white race, if all plant of the head progeny row is sterile plant, the corresponding Red Indian race of the head progeny row Son is exactly that the new third generation being transformed keeps Soviet Union of system R900.

I. by signing, the improved third generation keeps system to be up to 97% or more with former Soviet Union's R900 genetic background similarity, And field stable fertility, economical character is neat, meets rice breeding demand；

EAT1 nucleic acid sequence

Wild-type sequence

Mutant strain sequence

(subordinate list 1) Foreground selection sSR primer sequence

It is to be obtained by technique for gene engineering initiative, however formulate third in genetic engineering mostly that the current third generation, which keeps system, There are many uncertain factors when generation keeps being, and then influence the progress of entire initiative process, for example, different rice varieties, The condition of its callus induction is different, and the condition of genetic transformation is also different.In addition, the screening of later transformation event needs to consume largely Energy, and the probability for obtaining expected transformation event is relatively low.Using method of the present invention, theoretically obtained using genetic engineering After obtaining an excellent transformation event, i.e., the third generation is transformed into any rice varieties using backcross transformation and keeps system, And backcross transformation is theoretical simple, it can be readily appreciated that the work such as field hybridization are simple compared to laboratory molecular test, it is easy to operate, it can Backcross transformation carried out simultaneously to multiple materials simultaneously, it is most important that the result of backcross transformation has predictable, and tests week Phase is shorter, backcross improvement test is carried out with the speed in 1 year three season of plantation, then only needing for two years can be obtained new three generations Keep system.

The above is only several embodiments of the present invention, not any type of limitation is done to the present invention, although this hair It is bright to be disclosed as above with preferred embodiment, however be not intended to limit the invention, any person skilled in the art, it is not taking off In the range of technical solution of the present invention, a little variation or modification are made using the technology contents of the disclosure above and is equal to Case study on implementation is imitated, is belonged in technical solution of the present invention protection scope.

<110>Qingdao Yuan Ce Group Co., Ltd

<120>a kind of that the method that the third generation keeps system is obtained by hybridization technique

<160>3

<170> PatentIn Version 3.3

<210>1

<211>3433

<212>DNA

<213> Oryza glaberrima

<400>1

tttgaccttt attatatggt cataaagacc cttcagcaaa atgattgtta ctgctatcgg 60

cattttctgt tgtttttctt ttggaatcaa tcttgtgtga caccattgta ttgtttcatg 120

tcttgccact ataatagtct tggcatagca ctggatctca tgagtctttg agccgcaaat 180

tcatgaacat aagttctttc cattcaaccg ttggctgagg caaagataca ggtatgtttt 240

ttccagtgct tgctactact gtttgcagga tgcaaatcct aattagcatt ggtttatgtt 300

tctgtaaatt agttgttaag ttctatagaa ctttcaatca tactgaattt acagttctta 360

cttttagtga tcagcttata ataaatgaag tatatttggc attggcaatg atttcaagct 420

actcagcatt ttactgatta attagtaaac ttggggtggt tgaagcacat tttatcaaac 480

atcaatatga atatgattag aggcaaagaa agatggtaag gagtttgtta ggtctgcaac 540

aagcaaagtt gcttcatgtc tcattaatca tgctatatgc aacttctcta cacggaataa 600

acagacagac agattgcgta gcttaaactc cacggctcca tcttcccttg aaacaaccaa 660

aacagctaag ccaactgaaa attttcatgt ccgattgaat tatatccact gcttcattca 720

tgttgagtag ccctgtttcc cttaatatgt gcattgcaag taatttctat tttagcacta 780

gattagcacc catctaagat gctatttgtc cttcattttc atcctgtcct tgattcttct 840

gctcatatgt ttttttactt gtgttggttt tagatttgga gcgaaggtgc ctagcactgt 900

tttgccaaaa tgattgttgg ggctggttac tttgaggatt cccacgatca aagtctcatg 960

gcaggatctt tgatccatga ctcaaatcaa gctcctgcaa gcagtgaaaa cacaagcatt 1020

gatttgcaga aattcaaagt gcacccgtac tcaacagaag ctctctcgaa tacggccaat 1080

ctagctgaag ctgcaagagc aattaaccac cttcaacatc aactagaaat tgatttggag 1140

caagaggttc ccccagtaga aactgcaaac tgggatccag ctatctgcac tataccagat 1200

catatcatca accatcagtt tagcgaagat ccacaaaaca tattggtgga gcaacagatc 1260

cagcagtatg attctgcact ttatccaaat ggtgtttaca cacctgcacc agatctcctt 1320

aatcttatgc agtgcacaat ggctccagca ttcccggcaa cgacatccgt attcggtgac 1380

acaacactga atggtactaa ctatttggat cttaacggtg aacttacagg agtagcagcg 1440

gttccagaca gtgggagtgg gttgatgttt gctagtgatt cagctctcca gttagggtac 1500

catggtactc aatctcatct aataaaggat atctgccact cgttgcccca aaattatggg 1560

ttgtttccca gtgaggacga acgagatgtg attattggtg ttggaagtgg agatcttttt 1620

caggagatag atgacaggca gtttgatagt gtacttgaat gcaggagagg gaagggtgag 1680

ttcggaaagg gcaagggaaa agctaatttt gcaactgaga gagagaggcg ggagcagcta 1740

aatgtgaagt tcaggaccct aagaatgctc ttcccaaatc ctaccaaggt tagtcttatt 1800

catcatcttg caagttatta gttgtttagg ctgtaaataa cttggtgatt ctcacattaa 1860

cagacaacca ctcagatttt caataatatt tccatttgtt actcatgctc tgaagataat 1920

caaaatttta aatatcctca tccatttatt ctcagagaac taatgattca aaaactgcca 1980

acaccaatat agctccggtt tagcaaatct ctgttttttt acagatcaca aatacctaac 2040

agtaaattta taagtctgtg tattcatcta actggtataa attttgaaat tatctgtcca 2100

aaatttcttc aagttgcgtt accacatttt gatgcatatg tatatggaat atgctgtctg 2160

atatatcact caacatgatt gttttttgaa aaatagttca tcagtatgat gttctttact 2220

gataacagtg ccatgttatt aagggttgtt ttggttttaa gccaaattat gccctaccaa 2280

attgttggca ttttgaaaag ttatttggca aagtttggct tgccaccaaa gttggtcaag 2340

ttttggcact accaatatat tgacatggta acaaatcaaa acacccctaa ttgtgttcat 2400

cctaaccaag tgagttagcc cttctagtta gctaggagaa agcaatagaa gcattcagtt 2460

cgatatttcc tatgttcctt gccttttttg tgtgttagca cattccacaa tgttatcatc 2520

ctcatgatgt tacccttcaa caagattgta gcacttaaat atcttggttg tggcactaat 2580

gtgttacaaa ctgtgctcta gaatgacagg gcctcaatag taggtgatgc cattgagtat 2640

atagatgagc tcaatcgaac agtgaaggag ctgaagatcc tggtggaaca gaagaggcat 2700

ggaaataaca ggagaaaggt gttaaagttg gatcaagagg cagccgctga tggcgagagc 2760

tcatcgatga ggccagtgag ggatgatcaa gacaatcagc tccatggagc cataaggagc 2820

tcatgggttc agaggaggtc aaaggaatgc cacgttgatg tccgcatagt ggacgatgaa 2880

gtaaacatca agctcactga aaagaagaag gccaactctc tgcttcatgc agcaaaggtt 2940

ctagatgagt tccagctcga gcttatccat gtagtgggtg ggattatagg tgatcaccat 3000

atattcatgt tcaacactaa ggtaagtaac aattcagttt tcttaaagta gaatcaaaga 3060

ttctttttgt cccattacac atgttagcat cgatagtaac gattcatcat ccatggcaac 3120

tcaggtatca gaaggttcgg cggtttatgc atgtgcagtg gcaaagaagc tccttcaagc 3180

agtggacgtg caacaccagg ccctcgacat attcaactaa tctttagcaa cagtactgat 3240

tatctgaaca atgtcctaga ttttcagtta ccttgctgag caaacttatt tgaccaggat 3300

tggagagaat tttatcttta gcactagcta cctagcaaaa cttcttaaca atttggccat 3360

gtaacggctt gctgctgtcc ggttgtacac cttaactagc ctgactagga aagctttgat 3420

gcttgtcttg tgt 3433

<210>2

<211>369

<212>DNA

<213> Oryza glaberrima

<400>2

aaccatcagt ttagcgaaga tccacaaaac atattggtgg agcaacagat ccagcagtat 60

gattctgcac tttatccaaa tggtgtttac acacctgcac cagatctcct taatcttatg 120

aatggtacta actatttgga tcttaacggt gaacttacag gagtagcagc ggttccagac 180

agtgggagtg ggttgattgt ttgctagtga ttcagctctc cagttaggta ccatggtact 240

caatctcatc taataaagga tatctgccac tcgttgcccc aaaattatgg gttgtttcca 300

gtgaggacga acgagatgtg attattggtg ttggaagtgg agatcttttt caggagatag 360

atgacaggc 369

<210>3

<211>367

<212>DNA

<213> Oryza glaberrima

<400>3

aaccatcagt ttagcgaaga tccacaaaac atattggtgg agcaacagat ccagcagtat 60

gattctgcac tttatccaaa tggtgtttac acacctgcac cagatctcct taatcttatg 120

aatggtacta actatttgga tcttaacggt gaacttacag gagtagcagc ggttccagac 180

agggagtggg ttgattgttt gctagtgatt cagctctcca gttaggtacc atggtactca 240

atctcatcta ataaaggata tctgccactc gttgccccaa aattatgggt tgtttccagt 300

gaggacgaac gagatgtgat tattggtgtt ggaagtggag atctttttca ggagatagat 360

gacaggc 367

Claims (10)

1. a kind of obtain the method that the third generation keeps system by hybridization technique, which comprises the following steps:

(1) female parent is remained with the third generation, normal conventional strain to be rebuilt is male parent, and hybridization obtains F1；

(2) it chooses after F1 generation red-coloured seeds are planted and obtains BC1 seed with normal conventional strain to be improved backcrossing；

(3) plantation BC1 obtains BC1 plant for red-coloured seeds；Divide single plant to number before heading, takes blade to extract DNA, utilize molecule Assisting sifting contains the plant of sterile gene eat, continues to be returned later；

(4) step (3) are repeated, generally goes through the backcrossing and selection in mostly generation, the genetic background for being returned to backcross progeny restores circulation 90% or more of parent；

(5) it is selfed, which is the new third generation holding system that backcross transformation obtains.

2. obtaining the method that the third generation keeps system by hybridization technique according to claim 1, which is characterized in that the step (1) further comprise: it is female parent that the third generation, which keeps system's military fortune round-grained rice 7, and normal conventional rice strain to be rebuilt is male parent, and hybridization obtains Obtain F1.

3. obtaining the method that the third generation keeps system by hybridization technique according to claim 1, which is characterized in that the step (3) further comprise:

The step of DNA is extracted；

The step of DNA is detected；

The step of PCR amplification；

The step of polyacrylamide gel electrophoresis.

4. obtaining the method that the third generation keeps system by hybridization technique according to claim 3, which is characterized in that the DNA The step of extraction further comprises: every plant of BC1 plant takes 0.5g rice leaf to be put in the grinding body of -20 DEG C of cryogenic freezings.It is added Liquid nitrogen grinding is put into the centrifuge tube of 2mL at white powder.While grinding, opens water-bath switch and be heated to 65 DEG C.

5. obtaining the method that the third generation keeps system by hybridization technique according to claim 3, which is characterized in that the DNA The step of extraction, further comprises: the CTAB lysate of 700 μ L65 DEG C preheating 1h is added into centrifuge tube, overturning is rocked several times, Place into 40min in 65 DEG C of thermostat water baths.

6. obtaining the method that the third generation keeps system by hybridization technique according to claim 3, which is characterized in that the DNA The step of extraction, further comprises: sample being put into and cools down 5min at room temperature, 700 μ L phenol-chloroforms-isoamyl alcohol is added, againsts wall It is added, overturning is rocked several times, and checks whether leakage.

7. obtaining the method that the third generation keeps system by hybridization technique according to claim 3, which is characterized in that the DNA The step of extraction, further comprises: pushing down pipe lid with hand, slowly overturns several times, put a newspaper on shaking table later, sets each Pipe, 30rpm shakes 5~10 minutes at room temperature.

8. obtaining the method that the third generation keeps system by hybridization technique according to claim 3, which is characterized in that the DNA The step of extraction, further comprises: being put into refrigerated centrifuge, 12000rpm is centrifuged 5min at 4 DEG C.

9. obtaining the method that the third generation keeps system by hybridization technique according to claim 3, which is characterized in that the DNA The step of extraction, further comprises: adherent Aspirate supernatant, and 700 μ L phenol-chloroforms-isoamyl alcohol is added again, extracts one again Secondary, 10 μ LRnase are added in extracting supernatant, are placed at room temperature for 30min；If supernatant is clarified, this step is directly skipped, is carried out next Step operation.

10. obtaining the method that the third generation keeps system by hybridization technique according to claim 3, which is characterized in that the DNA The step of extraction, further comprises: it is adherent that isometric 700 μ L isopropanol is added, it slowly overturns 15 times, flocculent deposit occurs, put Enter in -20 DEG C of refrigerators, taken out after 30min, is centrifuged with refrigerated centrifuge trim.