CN106434708A - Rice MSP1 gene mutant, and molecular identification method and application thereof - Google Patents
Rice MSP1 gene mutant, and molecular identification method and application thereof Download PDFInfo
- Publication number
- CN106434708A CN106434708A CN201610714718.6A CN201610714718A CN106434708A CN 106434708 A CN106434708 A CN 106434708A CN 201610714718 A CN201610714718 A CN 201610714718A CN 106434708 A CN106434708 A CN 106434708A
- Authority
- CN
- China
- Prior art keywords
- msp1
- rice
- paddy rice
- mutant
- gene mutation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention provides a rice MSP1 gene mutant and an application thereof, and belongs to the technical field of gene engineering. A hsien rice variety 93-11 is subjected to irradiation induction by cobalt 60 to induce one T base of a 1879th base of an encoding region of the rice MSP1 gene to be replaced with one C base; the MSP1 gene mutant is named as msp1-1972 and has the nucleotide sequence shown in SEQ ID No.1; the mutant is further confirmed to induce rice recessive genic male sterility, can be used for preparation of transgenic rice with recessive genic male sterility, and plays a major role in genetic improvement breeding of rice germplasm resources. The invention also provides a molecular marker identification method of the mutant and the application of the mutant in seed breeding and preparation.
Description
Technical field
The invention belongs to field of plant molecular biology is and in particular to a kind of paddy rice MSP1 gene mutation body msp1-1972
And its method for identifying molecules and application.
Background technology
Plants male sterility mutation is very universal phenomenon in nature, and at least oneself is in 43 sections, 162 617 belonging to
It is found that malesterile mutants in individual species.In heredity, plants male sterility is divided into nuclear male sterility, cytoplasm male
Property sterile and nucleus cytoplasm interaction male sterility three major types：1) nuclear male sterility is mutated by cell nucleus gene and produces,
There are dominant mutation and recessive mutation, have sporinite gene mutation and gametophytic development mutation.Dominant mutation and gametophytic development are dashed forward
Change can only be by oogamete heredity, and recessive mutation both by oogamete and can carry out heredity by andro gamete, and follows Meng
Dare law.Some sporinite Recessive Male sterilities are cloned at present, such as ms2, the ms45 of corn and the paddy rice of arabidopsis
(Aarts etc., 1997, The Arabidopsis MALE STERILITY 2protein shares such as mil1
Similarity with reductases in elongation/condensation complexes, Plant
Journal, 12:615-623；Albertsen, 2006, Male tissue-preferred regulatory sequences
Of MS45gene and method of using same, the patent No.：US7154024B2；Hong etc., 2012, Somatic
and reproductive cell development in rice anther is regulated by a putative
Glutaredoxin, Plant Cell, 24:577-588)；Some gametophyte Recessive Male sterilities are also cloned, such as arabidopsis
The abnormal mutant sidecar pollen of two After microspore mitosis and gemini pollen (Oh etc., 2010, The
SIDECAR POLLEN gene encodes a microspore-specific LOB/AS2domain protein
Required for the correct timing and orientation of asymmetric cell division,
Plant Journal, 64:839-50；Park etc., 1998, The Arabidopsis thaliana gametophytic
mutation gemini pollen1 disrupts microspore polarity,division asymmetry and
Pollen cell fate, Development, 125:3789-99)；One sporinite dominant genic male sterile has also been cloned on corn
Gene M S44 (Cigan and Albertsen, 1998, Reversible nuclear genetic system for male
Sterility in transgenic plants, US5750868)；2) cytoplasmic male sterility is then by cytogene control
System, not corresponding nuclear restorer gene, belong to matrocliny；3) male sterility of nucleus cytoplasm interaction is by cytogene
With cell nucleus gene co- controlling, its essence is the result of cytoplasm and nucleic genetic material discord.Sterile cytoplasm is one
Caused by mutation chondriogen a bit, but have corresponding nuclear restorer gene, sterile cytoplasm gene can be suppressed.Sterile cytoplasm
Gene can produce a kind of new protein, enough impact mitochondria normal function (Chen and Liu, 2014, Male
Sterility and fertility restoration in crops, Annu Rev Plant Biol, 65:5.1-
5.28).In terms of educating Restore gene, in current paddy rice, clone Rf-1, the gene (Komori such as Rf-2, Rf-4, Rf-5
Deng 2004, Map-based cloning of a fertility restorer gene, Rf-1, in rice (Oryza
Sativa L.), Plant Journal, 37:315-325；Itabashi etc., 2011, The fertility restorer
gene,Rf2,for Lead Rice-type cytoplasmic male sterility of rice encodes a
Mitochondrial glycine-rich protein, Plant Journal, 65:359-367；Tang etc., 2014, The
rice restorer Rf4for wild-abortive cytoplasmic male sterility encodes a PPR
Protein that functions in reduction of WA352transcripts, Molecular Plant, 7:
1497-500；Hu etc., 2012, The rice pentatricopeptide repeat protein RF5restorers
fertility in Hong-Lian Cytoplasmic male-sterile lines via a complex with the
Glycine-rich protein GRP162, Plant Cell, 24:109-22).
Paddy rice is the national industry of China, and hybrid rice has played important function to improving China's grain yield.At present, I
State hybrid rice adds up cultivated area more than 4,500,000,000 mu, and hybrid rice cultivated area has accounted for national Monitoring of Paddy Rice Plant Area
55% about.Hybrid rice is from two genetic background differences, the rice varieties that proterties again can be complementary simultaneously, is produced by hybridization
Life has heterotic first generation cenospecies and is used for producing.Hybrid rice has obvious hybrid vigour phenomenon, main performance
Growing vigorous, well developed root system, big panicle many grains per panicle, the aspect such as strong stress resistance.Hybrid rice reaches 30% than conventional Rice volume increase.At present I
The hybrid rice of state's plantation can be divided into Three-line Hybrid rice and two-line hybrid rice.Three-line Hybrid rice (ternary hybrid rice) is exactly
Producing this hybrid paddy rice needs three rice strains to complete：Paddy rice cytoplasmic nuclear male sterile line, rice cytoplasmic male are not
Educate maintainer and rice cytoplasmic male sterile restorer.Paddy rice cytoplasmic nuclear male sterile line (abbreviation sterile line, code name A) has
Yebai, the various kinds of cell matter type such as red lotus type.Rice cytoplasmic male sterile maintainer (abbreviation maintainer, code name B) is to use
Carry out a kind of paddy rice of breeding male sterile lines.Its cell nucleus gene type is identical with sterile line, but containing can hatching cell matter gene, can produce can
Educate pollen, being capable of self-fertility.Karyogene due to maintainer does not contain Restore gene, after therefore it produces to sterile line pollination
Generation is also sterile.Rice cytoplasmic male sterile restorer (abbreviation restorer, code name R) carries Restore gene, can repair
Cytoplasmic male sterility, the hybrid (i.e. hybrid paddy rice) producing with sterile line hybridization normally can educate.Three-line breeding method exist susceptible,
The low problem of poor quality, breeding efficiency.Because being restricted by Rescued virus, 95% rice pest insects cannot be used for crossbreeding.Two
It is that method hybrid paddy rice utilizes photoperiod-temperature sensitive genie male-sterile line mutant, it shows male sterility under long day hot conditions, can carry out hybridization system
Kind, show male-fertile under short day cryogenic conditions, can be with self propagated.Compared with three line method, two line method has significantly superior
Property：With restorer combo freely, apolegamy excellent combination probability is big for sterile line；Sterile line can one be dual-purpose.But two line method is sterile
It is easy light temperature ambient influnence, breeding is very risky.During the production of hybrid seeds, such as meet low temperature, sterile line will turn into can educate, produce
Selfed seed, the purity of impact hybrid seed；It is then sterile that some two-series hybrids meet high temperature, affects setting percentage, leads to the underproduction.
Therefore, find new male sterility breeding method and be still the important subject on crop breeding.
Using induced mutations such as physics radiation, it is chemically treated, the method such as tissue cultures, people obtain many on paddy rice
Plant new sterile mutant.Msp1-1 mutant is one of them, and its flower pesticide does not produce mature flower powder.This mutant is by MSP1
In gene, insertion Tos17 causes；MSP1 gene has 1 extron, the rich leucine membrane receptor of one 1294 amino acid of coding
Sample protein kinase；Before and after meiosis forms sporidiole, specific expressed in suede adhesion coating and sporidiole, as signal identification and
The key protein of transduction, participates in the number forming and affecting megasporocyte of tapetum；The mutation of MSP1, causes tapetum
Disappearance, the growth of impact early stage microsporocyte；Microsporocyte number increases, the abnormal formation of anther wall, has led to
Full male sterility.(Nonomura, 2003, The MSP1Gene Is Necessary to Restrict the Number of
Cells Entering into Male and Female Sporogenesis and to Initiate Anther Wall
Formation in Rice.The Plant Cell,15:1728-39).
Content of the invention
It is an object of the invention to provide a kind of paddy rice MSP1 gene mutation body msp1-1972 and its method for identifying molecules and should
With.
The present invention is first to rice variety 93-11 seed (M0Generation) carry out co-60 radiation mutagenic treatment, the kind that plantation is processed
Son obtains M1For plant；M1Produce seed for plant selfing (for M2Generation), plant M2For plant, to M2Carry out morphology, group for plant
Knit and science of heredity identification, screen sterile plant；Then gene sequencing and DNA sequence analysis are carried out to sterile plant, in molecule
Verified in level.Finally obtain the sterile individual plant of homozygosis, and be used for crossbreeding and biotechnology research.
The paddy rice MSP1 gene mutation body msp1-1972 that the present invention provides, it is paddy rice MSP1 gene coding region the 1879th
Bit base T replaces with base C, makes the 627th amino acid be transformed into proline by serine, leads to male sterility of rice phenotype.
Further, paddy rice MSP1 gene mutation body msp1-1972, its nucleotide sequence as shown in SEQ ID No.1, its
Amino acid sequence is as shown in SEQ ID NO.14.
The invention provides the expression vector containing paddy rice MSP1 gene mutation body msp1-1972 of the present invention.
The invention provides the host cell containing above-mentioned expression vector.
The invention provides application in prepare transgenosis plant for the paddy rice MSP1 gene mutation body msp1-1972.
The invention provides paddy rice MSP1 gene mutation body msp1-1972 is preparing the transgenosis water of Recessive male sterility
Application in rice.
The invention provides application in rice modification breeding, the production of hybrid seeds for the paddy rice MSP1 gene mutation body msp1-1972.
Present invention also offers detecting the molecular labeling of paddy rice MSP1 gene mutation body msp1-1972, this molecular labeling is
Obtained by following primer pair amplifies and HaeIII enzymes combinations, the nucleotides sequence of described primer pair is classified as：
Upstream primer 1972_F：ATTTTGTCTTCCAACCAGCGG (as shown in SEQ ID NO.2)
Downstream primer 1972_R：ACCATCACCATTGCACAGT (as shown in SEQ ID NO.3).
The invention provides application in the transgenic paddy rice preparing Recessive male sterility for the above-mentioned molecular labeling.
The invention provides application in Rice Germplasm Resources improvement for the above-mentioned molecular labeling.
A kind of method of the molecular labeling of paddy rice MSP1 gene mutation body msp1-1972, is treated to amplification by following primer
Inspection plant genome DNA, amplified production uses HaeIII digestion at 37 DEG C, and detects digestion products：
The nucleotides sequence of described primer pair is classified as：
Upstream primer 1972_F：ATTTTGTCTTCCAACCAGCGG (as shown in SEQ ID NO.2)
Downstream primer 1972_R：ACCATCACCATTGCACAGT (as shown in SEQ ID NO.3)；
The product that above-mentioned primer pair sample DNA expands is after HaeIII digestion, if digestion after expanding than wild type 93-11
, then there is mutator msp1-1972 in this sample in the short 20bp of product fragment.
The mutant msp1-1972 advantage that the present invention provides is as follows：
1) this mutant derives from long-grained nonglutinous rice backbone parent kind 93-11.This kind has completed genome sequencing, to water
Rice molecular breeding is highly beneficial.
2) document " Nonomura, 2003, The MSP1Gene Is Necessary to Restrict the Number
of Cells Entering into Male and Female Sporogenesis and to Initiate Anther
Wall Formation in Rice.The Plant Cell,vol.15:Mutant in 1728-39 " is transposons Tos17
Insertion mutation is it is difficult to study the relation between protein sequence and function.And the mutation of the present invention occurs in a MSP1 gene
In 1st extron, 1 T base replaces with 1 C base, makes the 627th amino acid of this gene be transformed into dried meat by serine
Propylhomoserin, leads to protein function coded by it to change, performance holandry is sterile, shows that this mutational site is this protein function
One of critical sites, have important value for research protein structure with function.
3) because radioinduction causes single base to replace, restriction enzyme site is added in mutational site by design of primers, in PCR and
Under enzymes combinations, using laboratory, the agarose commonly used or polyacrylamide gel electrophoresis just can carry out Molecular Detection, be also suitable
In various high flux long fragment detection techniques.This mutational site is a SNP in itself, is therefore also applied for fluorogenic probe hybridzation
(as TaqMan), high-resolution solubility curve method, genetic chip, single base sequencing and mass spectrography etc. are conventional or high flux SNP detects
Technology is used for mutational site genotype identification.
Brief description
Fig. 1 is the plant type of wild type 93-11 and 1972 mutant and fringe type photo in embodiment 2.
Fig. 2 is the Stereo microscope photo of wild type 93-11 and 1972 mutant flower pesticide in embodiment 3, with pollen iodine dye
Microphotograph.
Fig. 3 is that in embodiment 6, the mutational site of 1972 mutant MSP1 genes and amino acid residue change schematic diagram.
Fig. 4 is wild type 93-11 in embodiment 7, " 1972 × 93-11 " F2Fertile plant and sterile plant MSP1 gene in colony
Electrophoresis photographs after HaeIII digestion for the PCR primer in mutational site.
Fig. 5 is the Technology Roadmap of the hybridization transformation of embodiment 8.
Specific embodiment
Following examples are used for the present invention is described, but are not limited to the scope of the present invention.Without departing substantially from present invention spirit
In the case of essence, the modification that the inventive method, step or condition are made or replacement, belong to the scope of the present invention.
If not specializing, the conventional meanses that in embodiment, technological means used is well known to those skilled in the art.
The structure of embodiment 1 co-60 radiation mutagenesis mutant library
From long-grained nonglutinous rice backbone parent kind 93-11 as radiation treatment material, this kind completed full-length genome survey
Sequence, highly beneficial to Rice molecular breeding.
Summer in 2013, in Changsha Co 60 (60Co) radiate 93-11 seed (M0Generation) 10 kilograms, July plants in Hainan Lingao field
Between, point individual plant harvests M1For seed, harvest about 6500 parts of seeds altogether.
Choose M1For 3200 strains of seed, each strain plants 50 individual plants.Spring in 2014, plant in Hainan Lingao
Field.After transplanting, in tillering stage, boot stage, heading stage, florescence, pustulation period etc. through examining field proterties, examination strain
All types of mutant individual plant sowings are preserved as special mutant by all kinds mutant such as type, fringe type, fertility, yield.Often
Individual strain receives 6 individual plants, as mutant library resource conservation.
Embodiment 2 M2Generation plantation and character observation
In M2Generation heading, duration of flowering, observe to the form of flower pesticide in field, get colors shallow white, form is little, flower
The abnormal flower pesticide of the powder amount performance such as little carries out further microscopy under the microscope.Numbering be 1972 family in find 1 plant educate
The plant of sexual abnormality, this mutant is nourishing and growing, heading stage, fringe type are not all clearly distinguished from wild type, and Fig. 1 is this mutation
Body plant contrasts photo with the plant type (Fig. 1 left figure) of WT lines and fringe type (Fig. 1 right figure), but flower pesticide is less than wild type, face
Color is pale yellow, and setting percentage is very low, is selected as candidate mutant material and carries out next step research.
Embodiment 3 pollen microscopic examination, selfing and outcrossing
Stained with color and not colored pollen ratio by several iodine, count pollen fertility.Observe 1972 to dash forward under Stereo microscope
The little floral shape of variant, finds that gynoecium is no clearly distinguished from wild type, flower pesticide is less than wild type, color shallower (Fig. 2 left figure).Field
Collection florescence little Hua, takes out flower pesticide with tweezers, in Wagner's reagent (0.6%KI, 0.3%I2, w/w) in gently extrude
Flower pesticide, drops on slide, covered, examines under a microscope pollen iodine dye situation and takes pictures (Fig. 2 right figure).Wild type
Dye black-and-blue pollen more, and mutant then can't see pollen grain.
Normally solid after same family WT lines bagging selfing, and 1972 mutant are shaky.With rice varieties 93-
11 and in spend 11 for male parent give 1972 mutant pollination, all solid can obtain F1For seed.Show that this mutant is male sterility
Mutant.
To F1Obtain F for selfing2For seed, plant F2For 710 plants of plant, examine under a microscope after flower pesticide iodine is contaminated, its
In 524 plants of pollen normal iodine dye, and normal self-fertility, 186 plants of no pollen, selfing is shaky, meets 3:1 separates, and shows this
Sterile proterties is controlled by single recessive gene.
The sampling of embodiment 4 blade and DNA extract
Present study adopts CTAB method to extract rice leaf DNA, and concrete grammar is as follows：Weigh about 0.1g blade, put into from
Heart pipe, adds 600 μ L CTAB Extraction buffers, 5 μ L RNase A, concussion dispersion, 65 DEG C of water-bath 0.5hr, jog 2-3 therebetween
Secondary；Add equal-volume chloroform/Tris- saturated phenol (1:1, v/v), mix, jog 10min；4 DEG C of 10000rpm are centrifuged 20min；Turn
Move supernatant to manage to new, add 3M sodium acetate (pH value 5.2), the cold isopropanol of 0.6-1 times of volume of 1/10 volume；Jog mixes,
Occur to flocculent deposit；4 DEG C of 10000rpm are centrifuged 10min；Supernatant discarded, is washed with volumn concentration 70% ethanol and precipitates 2 times；
Air-dry, add 50 μ L 1 × TE dissolution precipitations, -20 DEG C of preservations.Detect DNA concentration with Nanodrop2000, be diluted to 10ng/L
As pcr template.
Embodiment 5 PCR reaction and product reclaim
The numbering being screened with special primer amplification 93-11 wild type and the embodiment 2 of paddy rice MSP1 gene is 1972
Mutant DNA.
With the fine MSP1 gene of rice varieties Japan as reference sequences, devise 5 pairs of primers and be used for expanding MSP1 fragment, then
It is spliced into wild type and 1972 mutant MSP1 full length sequences.The sequence of 5 pairs of primers used is shown in Table 1,：
Table 1 is used for expanding the primer pair sequence of MSP1
| Primer pair title | Forward primer | Reverse primer |
| MSP1_1 | GCTACTGACATGGTTAACCTCTTC | CATTTCCTTCAGCATCTTCAG |
| MSP1_2 | TCTGACTTCGGCCTTGC | GATCAAGCAGAGAGCATTACATG |
| MSP1_3 | CAAGCAGCAACCATTTCTCA | GCAAGGCCGAAGTCAGA |
| MSP1_4 | CATTTAAAGGGTGCACGAAC | TGAGAAATGGTTGCTGCTTG |
| MSP1_5 | CTGAAGATGCTGAAGGAAATG | GTTCGTGCACCCTTTAAATG |
PCR reaction system is：1 μ L 10 × reaction buffer, 0.25 μ L dNTP, 0.25 μ L forward primer and 0.25 μ L are anti-
To primer, 0.5U Taq enzyme, 1 μ L 10ng/ μ L template DNA, plus ultra-pure water mend cumulative volume to 10 μ L.PCR response procedures are：
94-98 DEG C of denaturation 1-3min, then executes following circulation：95 DEG C of denaturation 20s, 53-58 DEG C of renaturation 20s, 72 DEG C extend 30s, 30-
40 circulations.Circulation terminates latter 72 DEG C and supplements extension 3-10min, terminates reaction.Configure 1.5% Ago-Gel, in 5V/cm electricity
Electrophoresis 30min off field；PCR primer is reclaimed using market DNA gel QIAquick Gel Extraction Kit.
Embodiment 6 DNA sequence analysis
It is sequenced reclaiming gained wild type using ABI3730 sequenator with PCR primer DNA of mutant, sequencing is drawn
Thing is respectively using forward primer and reverse primer.Using common dna sequence analysis software DNAman6.0, two-way sequencing result is entered
Row splicing；The MSP1 allele of 1972 mutant is designated as msp1-1972.Wild type and mutant sequence are compared and sends out
Existing, replace with 1 base C in the 1879th base T of genome sequence of MSP1 gene；Sequential analysis of protein compares display, should
Mutation causes the 627th amino acid and is changed into proline by serine.
Embodiment 7 mutational site molecular labeling design isolates identification with genotype-Phenotype
Sequences Design gene specific primer according to the mutational site both sides obtaining in embodiment 6：Forward primer 1972_F,
Its nucleotide sequence is as shown in SEQ ID NO.2；Reverse primer 1972_R, its nucleotide sequence is as shown in SEQ ID NO.3.Its
3 ' second base in end of middle 1972_F are revised as G by original base T of gene, are formed in the amplified production of 1972 mutant
One HaeIII restriction enzyme site, and the amplified production of wild type is not then had.Therefore can be used after this primer pair amplifies
HaeIII digestion, the fragment of mutant 1972 can than wild type short 20 base-pairs.
Under PCR reaction condition described in embodiment 5, with the F to 93-11 and 1972 × 93-11 for the above-mentioned primer pair2Group
The DNA profiling of body is expanded.
Amplified production HaeIII digestion, enzymatic cleavage methods are as follows：According to pcr amplification product 10 μ L, remove nuclease water 18 μ L,
10 × Buffer 2 μ L, HaeIII 1-2 μ L, mixes each reactant, several seconds of micro- centrifugation, is incubated 1-2 hour, at 37 DEG C
Afterwards at 80 DEG C 20 minutes with terminating reaction.
Digestion products are separated by electrophoresis on 6% polyacrylamide gel.Polyacrylamide gel electrophoresis method is as follows：
(1) preparation of polyacrylamide gel：6%PA glue 80mL, 10% Ammonium Persulfate 98.5 250 μ L (winter)/125 μ L (summer), tetramethyl
Ethylenediamine (TEMED) 80 μ L.Shake up rear encapsulating.With washing agent glass plate scrub repeatedly, cleaned, dried with alcohol.?
After notch board being coated in fume hood 2% Repel Silane, then cleaned, be dried with alcohol, another one flat plate is coated 0.5%
Bingding Silane 1.5mL (add 7.5 μ L Binding Silane and 7.5 μ L glacial acetic acid in 1.5ml centrifuge tube,
Supply 95% ethanol to 1.5mL).In operating process, prevent two pieces of glass plates from mutually polluting, after being thoroughly dried, carry out glass plate again
Assembling, encapsulating.(2) prerunning：After gelling is solid, takes out comb, wash top gel off and especially notice that seam crossing will be cleaned surely.First
Under electrophoresis tank, groove (negative electrode) loads the electrode buffer of 1 × TBE, the gel slab of polymerization is contained in electrophoresis tank, in upper groove
The electrode buffer of injection 0.5 × TBE.Firm power 40W-65W, prerunning about 30min.Remove precipitation in glue surface with suction pipe
Urea and bubble, insert comb.(3) electrophoresis：5 μ l 5 × Loading Buffer are added to mix rear 95 DEG C of denaturation in amplified production
5 minutes, transfer to cooled on ice at once, draw 1.5-3 μ l and add loading hole；Firm power 40W-65W carries out electrophoresis, to bromine phenol
The blue electrophoresis trench bottom that reaches terminates.Distinguishable degree adjustment electrophoresis time depending on SSR amplified production molecular size range and difference banding pattern.
(4) silver staining colour developing, one piece of glass plate with glue is put in 10% glacial acetic acid fixer, and 65r/min vibrates about 30min, directly
All decolour to diformazan cyanophenyl；Distilled water flushing 2 times, each 5min；Offset plate after rinsing is put into the dyeing liquor (2L of new preparation
In water add 2g silver nitrate, 3mL 37% formaldehyde) in 65r/min shake 30min；Offset plate after dyeing is put into distilled water flushing
5s, takes out immediately and is developed；By offset plate be quickly transferred to 4 DEG C of precoolings developer solution (in 2L water add 30g NaOH,
10ml37% formaldehyde) it is shaken gently for band line appearance；Offset plate is placed in 10% glacial acetic acid fixer and is produced as to bubble-free
Only；With distilled water flushing 2 times, each 2min；After spontaneously drying under room temperature, preservation image of taking pictures.
Electrophoresis result is shown in Fig. 4, and amplified production has long and short two kinds of fragments, forms 3 kinds of banding patterns：The expansion of parental wildtype 93-11
Increasing-digestion banding pattern is larger single fragment, and in F2, phenotype is single large fragment or large and small heterozygosis for the individual banding pattern of wild type
Type；The all single short-movie sections of electrophoresis banding pattern of mutant amplified production.This result one side demonstrates prominent in embodiment 6
Become site, show that this mutational site and sterile phenotype isolate simultaneously.This result combines the mutant phenotype of this mutant
Deliver the phenotype description in document, the male sterility phenotype of deducibility 1972 mutant is prominent described in embodiment 6
Change causes.
Embodiment 8：The hybridization transformation of mutator
By the step of Fig. 5, the sterile allele msp1-1972 of 1972 mutant can be passed through to hybridize transformation to other water
In rice genetic background：
1. hybridize：It is maternal with 1972, obtain F with acceptor rice material for paternal hybrid1Seed；
2. first round backcrossing：F1After planting obtain F1Plant, by F1Plant is hybridized with recurrent parent, obtains BC1Kind
Son；
③BC1Sterile gene selects (foreground selection)：Sowing BC1Seed, obtains and is no less than 500 plants of seedling, adopt in Seedling Stage
Collect each single-strain blade, DNA is extracted with method described in embodiment 4, with listed primer pair (1972_F and 1972_ in embodiment 7
R) carry out expanding, HaeIII digestion and electrophoresis, choose the individual plant that genotype is heterozygosis and continue plantation, discard the list of homozygous wildtype
Strain；
④BC1Foreground selection：Existed many between 1972 and recurrent parent using one group (such as 100, or 200 etc.)
State, and on genome equally distributed molecular labeling (can be but not limited to SSR, SNP, INDEL, EST, RFLP,
The type marks such as AFLP, RAPD, SCAR), to step 3. in the individual plant selected identify, choose high with recurrent parent similarity
The material of (be greater than 88% similarity, or select rate etc. in 2%)；
5. the second wheel backcrossing：With step 4. in the individual plant selected be male parent, be recurrent parent pollination, obtain BC2Seed；
⑥BC2Prospect and Foreground selection：To the material repeat step the selected 3. operation 4. to step, select and samsara
Parent's similarity is higher than the BC of selection standard (selecting rate etc. as similarity is more than in 98%, or 2%)2For plant；
7. selfing obtains BC2F2Seed：To step 6. in the BC that selects2Plant carries out selfing, obtains BC2F2Seed；
⑧BC2F2Foreground selection：BC by step 7. middle acquisition2F2Seed is sowed, and obtains more than 500 plants seedling, in children
Seedling stage gathers blade, extracts DNA with method described in embodiment 4, with listed primer pair (1972_F and 1972_ in embodiment 7
R) carry out expanding, digestion and electrophoresis, select the individual plant that banding pattern is Mutants homozygous and heterozygous and continue cultivation, abandon homozygosis wild
The individual plant of type；
⑨BC2F2Foreground selection and application：By step 8. in the individual plant selected according to step, method 4. carries out background sieve
Choosing, selects the individual plant of 100% background homozygosis.If digestion banding pattern is after the 1972_F/1972_R primer pair amplifies of middle menu strain
Mutants homozygous, then this individual plant be final goal material, can further with recurrent parent hybridize preserve material, or with other paddy rice
Material is hybridized.If middle menu strain is heterozygosis banding pattern, can be directly used for preserving germplasm, or sterile plant is obtained by selfing and use
In crossbreeding or the production of hybrid seeds.
The above is only the preferred embodiment of the present invention it is noted that ordinary skill people for the art
For member, on the premise of without departing from the technology of the present invention principle, some improvements and modifications can also be made, these improvements and modifications
Also should be regarded as protection scope of the present invention.
Claims (10)
1. a kind of paddy rice MSP1 gene mutation body msp1-1972, it replaces with C for the T of paddy rice MSP1 gene the 1879th bit base,
This mutational site is located on extron.
2. paddy rice MSP1 gene mutation body msp1-1972 as claimed in claim 1, its nucleotide sequence such as SEQ ID No.1 institute
Show, its amino acid sequence is as shown in SEQ ID NO.14.
3. the expression vector containing MSP1-1972 gene mutation body msp1-1972 described in claim 1 or 2.
4. the host cell containing expression vector described in claim 3.
5. application in prepare transgenosis plant for the paddy rice MSP1 gene mutation body msp1-1972 described in claim 1 or 2.
6. the paddy rice MSP1 gene mutation body MSP1-1972 described in claim 1 or 2 turns base prepare Recessive male sterility
Because of the application in paddy rice.
7. the answering in rice modification breeding, the production of hybrid seeds of the paddy rice MSP1 gene mutation body msp1-1972 described in claim 1 or 2
With.
8. test right require 1 or 2 described in paddy rice MSP1 gene mutation body msp1-1972 molecular labeling it is characterised in that
This molecular labeling is to be obtained by following primer pair amplifies, and the nucleotides sequence of described primer pair is classified as：
Upstream primer 1972_F：ATTTTGTCTTCCAACCAGCGG,
Downstream primer 1972_R：ACCATCACCATTGCACAGT.
9. application in the transgenic paddy rice preparing Recessive male sterility for the molecular labeling described in claim 8.
10. the method for the molecular labeling of paddy rice MSP1 gene mutation body MSP1-1972 described in claim 1 or 2, its feature exists
In by following primer to expanding plant genome DNA to be checked, amplified production uses HaeIII digestion at 37 DEG C, and detects enzyme
Cut product：
The nucleotides sequence of described primer pair is classified as：
Upstream primer 1972_F：ATTTTGTCTTCCAACCAGCGG；
Downstream primer 1972_R：ACCATCACCATTGCACAGT；
If after above-mentioned primer pair amplifies, under HaeIII digestion, product is than digestion products fragment after wild type 93-11 amplification
The base of short 20bp, then indicate that this plant to be checked has paddy rice MSP1 gene mutation body msp1-1972.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610714718.6A CN106434708A (en) | 2016-08-24 | 2016-08-24 | Rice MSP1 gene mutant, and molecular identification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610714718.6A CN106434708A (en) | 2016-08-24 | 2016-08-24 | Rice MSP1 gene mutant, and molecular identification method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434708A true CN106434708A (en) | 2017-02-22 |
Family
ID=58182899
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610714718.6A Pending CN106434708A (en) | 2016-08-24 | 2016-08-24 | Rice MSP1 gene mutant, and molecular identification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434708A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107418953A (en) * | 2017-09-12 | 2017-12-01 | 四川农业大学 | A kind of method that corn phosphorus signal responsive genes are expanded in teosinte |
| CN109554373A (en) * | 2018-12-13 | 2019-04-02 | 海南波莲水稻基因科技有限公司 | A kind of rice FON2 gene mutation body and its method for identifying molecules and application |
| CN111411098A (en) * | 2020-05-07 | 2020-07-14 | 海南波莲水稻基因科技有限公司 | Rice A L S mutant gene, plant transgenic screening vector pCA L Sm2 containing gene and application thereof |
| CN113913545A (en) * | 2021-10-26 | 2022-01-11 | 淮阴师范学院 | Method for rapidly identifying rice meiosis genotype and specific molecular marker thereof |
| CN114480419A (en) * | 2022-01-24 | 2022-05-13 | 上海师范大学 | Plant temperature-sensitive sterile mutant tms15 and application thereof |
| CN116875580A (en) * | 2023-09-08 | 2023-10-13 | 北京首佳利华科技有限公司 | Artificial mutation for creating maize msp1 male sterile line |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7154024B2 (en) * | 1997-06-23 | 2006-12-26 | Pioneer Hi-Bred, Inc. | Male tissue-preferred regulatory sequences of Ms45 gene and method of using same |
| CN101514342A (en) * | 2008-05-26 | 2009-08-26 | 华南农业大学 | Rice cytoplasmic male sterile genes and application thereof |
| CN101805741A (en) * | 2010-02-08 | 2010-08-18 | 上海交通大学 | Male sterility gene TCL, coded protein and promoter, plasmid and host cell |
-
2016
- 2016-08-24 CN CN201610714718.6A patent/CN106434708A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7154024B2 (en) * | 1997-06-23 | 2006-12-26 | Pioneer Hi-Bred, Inc. | Male tissue-preferred regulatory sequences of Ms45 gene and method of using same |
| CN101514342A (en) * | 2008-05-26 | 2009-08-26 | 华南农业大学 | Rice cytoplasmic male sterile genes and application thereof |
| CN101805741A (en) * | 2010-02-08 | 2010-08-18 | 上海交通大学 | Male sterility gene TCL, coded protein and promoter, plasmid and host cell |
Non-Patent Citations (3)
| Title |
|---|
| NCBI: "Predicted: Oryza sativa Japonica Group leucine-rich repeat receptor protein kinase MSP1 (LOC4324355),transcript variant X1, mRNA", 《GENBANK登录号：XM_015766941.1》 * |
| NONOMURA KI，等: "The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice", 《THE PLANT CELL》 * |
| 王莹，等: "水稻msp1-4突变体的鉴定及其UDT1和GAMYB基因的表达分析", 《植物生理与分子生物学报》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107418953A (en) * | 2017-09-12 | 2017-12-01 | 四川农业大学 | A kind of method that corn phosphorus signal responsive genes are expanded in teosinte |
| CN109554373A (en) * | 2018-12-13 | 2019-04-02 | 海南波莲水稻基因科技有限公司 | A kind of rice FON2 gene mutation body and its method for identifying molecules and application |
| CN109554373B (en) * | 2018-12-13 | 2021-06-25 | 海南波莲水稻基因科技有限公司 | Rice FON2 gene mutant and molecular identification method and application thereof |
| CN111411098A (en) * | 2020-05-07 | 2020-07-14 | 海南波莲水稻基因科技有限公司 | Rice A L S mutant gene, plant transgenic screening vector pCA L Sm2 containing gene and application thereof |
| CN111411098B (en) * | 2020-05-07 | 2022-03-04 | 海南波莲水稻基因科技有限公司 | Rice ALS mutant gene, plant transgenic screening vector pCALSm2 containing gene and application thereof |
| CN113913545A (en) * | 2021-10-26 | 2022-01-11 | 淮阴师范学院 | Method for rapidly identifying rice meiosis genotype and specific molecular marker thereof |
| CN114480419A (en) * | 2022-01-24 | 2022-05-13 | 上海师范大学 | Plant temperature-sensitive sterile mutant tms15 and application thereof |
| CN114480419B (en) * | 2022-01-24 | 2023-06-09 | 上海师范大学 | Plant temperature-sensitive sterile mutant tms15 and application thereof |
| CN116875580A (en) * | 2023-09-08 | 2023-10-13 | 北京首佳利华科技有限公司 | Artificial mutation for creating maize msp1 male sterile line |
| CN116875580B (en) * | 2023-09-08 | 2023-12-01 | 北京首佳利华科技有限公司 | Artificial mutation for creating maize msp1 male sterile line |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104894144B (en) | A kind of Oryza sativa L. CYP704B2 gene mutation body and method for identifying molecules thereof and application | |
| CN106434708A (en) | Rice MSP1 gene mutant, and molecular identification method and application thereof | |
| CN105002191B (en) | A kind of Oryza sativa L. CYP704B2 gene mutation body and method for identifying molecules thereof and application | |
| CN106754954B (en) | A kind of corn MS8 gene mutation bodies and its method for identifying molecules and application | |
| CN102634522B (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| BR112020006386A2 (en) | use of a corn gene, method for preparing a transgenic corn, use of biological material, mutant gene, protein encoded by the mutant gene, use of the mutant gene, specific promoter of young ears, use of the specific promoter, molecular dna marker, primer , reagent or detection kit, and, use of the DNA molecular marker, primer or reagent or detection kit | |
| CN109295246B (en) | DNA molecular marker related to male fertility of corn and application thereof | |
| CN110800608A (en) | Molecular breeding method of reproductive heterozygous female sterile restorer line and application thereof | |
| CN109439667A (en) | Application of the corn gene ZmABCG20 in regulation crop male fertile | |
| CN107236810B (en) | Maize male nuclear sterility gene, molecular marker and application thereof | |
| CN108243963A (en) | A kind of rice PTC1 deletion mutants body and its method for identifying molecules and application | |
| CN111676229B (en) | Maize male nuclear sterility gene ms40 and molecular marker and application thereof | |
| CN109554373B (en) | Rice FON2 gene mutant and molecular identification method and application thereof | |
| US11761017B2 (en) | Rice thermo-sensitive male sterile gene mutant tms18 and uses thereof | |
| CN108277211B (en) | Corn MS30 gene mutant and molecular identification method and application thereof | |
| CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
| CN111088258B (en) | Rice photo-thermo-sensitive nuclear male sterility gene tms3650 and molecular marker and application thereof | |
| CN111100869B (en) | Molecular marker co-separated from rice photo-thermo-sensitive nuclear male sterility character and application | |
| CN106754975B (en) | A kind of corn SILKY1 gene mutation bodies and its method for identifying molecules and application | |
| CN103320463B (en) | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene | |
| CN111778354B (en) | Molecular marker closely linked with photosensitive male sterility character of cotton PSM4, molecular identification method and application | |
| CN103704124A (en) | Seed selection method of oryza glaberrima cytoplasmic male sterile line | |
| CN112521472B (en) | Molecular marker related to rice fertility and floral organ number and application thereof | |
| CN109852590B (en) | Corn IPE1 mutant and detection method and application thereof | |
| CN117344050A (en) | Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR Candidate gene LOC_Os12g18729 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170222 |