CN117344050A - Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR Candidate gene LOC_Os12g18729 - Google Patents
Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR Candidate gene LOC_Os12g18729 Download PDFInfo
- Publication number
- CN117344050A CN117344050A CN202311313576.9A CN202311313576A CN117344050A CN 117344050 A CN117344050 A CN 117344050A CN 202311313576 A CN202311313576 A CN 202311313576A CN 117344050 A CN117344050 A CN 117344050A
- Authority
- CN
- China
- Prior art keywords
- rice
- cold
- seedling stage
- early
- early seedling
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 110
- 235000009566 rice Nutrition 0.000 title claims abstract description 106
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 61
- 240000007594 Oryza sativa Species 0.000 title description 95
- 238000009395 breeding Methods 0.000 claims abstract description 15
- 230000001488 breeding effect Effects 0.000 claims abstract description 13
- 210000000349 chromosome Anatomy 0.000 claims abstract description 9
- 241000209094 Oryza Species 0.000 claims abstract 15
- 238000000034 method Methods 0.000 claims description 17
- 239000002773 nucleotide Substances 0.000 claims description 16
- 125000003729 nucleotide group Chemical group 0.000 claims description 16
- 108020004414 DNA Proteins 0.000 claims description 13
- 238000012408 PCR amplification Methods 0.000 claims description 10
- 230000003321 amplification Effects 0.000 claims description 9
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 9
- 238000011144 upstream manufacturing Methods 0.000 claims description 7
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 6
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 4
- 230000001351 cycling effect Effects 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 4
- 230000036425 denaturation Effects 0.000 claims description 4
- 239000000203 mixture Substances 0.000 claims description 4
- 238000012257 pre-denaturation Methods 0.000 claims description 4
- 229910021642 ultra pure water Inorganic materials 0.000 claims description 4
- 239000012498 ultrapure water Substances 0.000 claims description 4
- 230000000694 effects Effects 0.000 abstract description 12
- 238000011222 transcriptome analysis Methods 0.000 abstract description 6
- 238000004458 analytical method Methods 0.000 description 15
- 239000003147 molecular marker Substances 0.000 description 15
- 241000196324 Embryophyta Species 0.000 description 12
- 241000746966 Zizania Species 0.000 description 12
- 235000002636 Zizania aquatica Nutrition 0.000 description 12
- 238000011084 recovery Methods 0.000 description 11
- 230000014509 gene expression Effects 0.000 description 8
- 230000004083 survival effect Effects 0.000 description 8
- 239000000463 material Substances 0.000 description 7
- 230000002595 cold damage Effects 0.000 description 6
- 238000011161 development Methods 0.000 description 6
- 238000012360 testing method Methods 0.000 description 6
- 230000002068 genetic effect Effects 0.000 description 5
- 238000012163 sequencing technique Methods 0.000 description 5
- 108091026890 Coding region Proteins 0.000 description 4
- 238000011529 RT qPCR Methods 0.000 description 4
- 238000000354 decomposition reaction Methods 0.000 description 4
- 238000013507 mapping Methods 0.000 description 4
- 238000010899 nucleation Methods 0.000 description 4
- 238000012795 verification Methods 0.000 description 4
- 208000009084 Cold Injury Diseases 0.000 description 3
- 230000008645 cold stress Effects 0.000 description 3
- 238000001514 detection method Methods 0.000 description 3
- 108700028369 Alleles Proteins 0.000 description 2
- 240000002582 Oryza sativa Indica Group Species 0.000 description 2
- DBMJMQXJHONAFJ-UHFFFAOYSA-M Sodium laurylsulphate Chemical compound [Na+].CCCCCCCCCCCCOS([O-])(=O)=O DBMJMQXJHONAFJ-UHFFFAOYSA-M 0.000 description 2
- 230000000996 additive effect Effects 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000012217 deletion Methods 0.000 description 2
- 230000037430 deletion Effects 0.000 description 2
- 235000013305 food Nutrition 0.000 description 2
- 230000037433 frameshift Effects 0.000 description 2
- 230000006872 improvement Effects 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 2
- 230000000306 recurrent effect Effects 0.000 description 2
- 230000001105 regulatory effect Effects 0.000 description 2
- 230000002441 reversible effect Effects 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 238000009394 selective breeding Methods 0.000 description 2
- 101150112497 26 gene Proteins 0.000 description 1
- 108010001572 Basic-Leucine Zipper Transcription Factors Proteins 0.000 description 1
- 102000000806 Basic-Leucine Zipper Transcription Factors Human genes 0.000 description 1
- 101150045313 COLD1 gene Proteins 0.000 description 1
- 102100030794 Conserved oligomeric Golgi complex subunit 1 Human genes 0.000 description 1
- 102100030797 Conserved oligomeric Golgi complex subunit 2 Human genes 0.000 description 1
- 108700039691 Genetic Promoter Regions Proteins 0.000 description 1
- 101000920124 Homo sapiens Conserved oligomeric Golgi complex subunit 1 Proteins 0.000 description 1
- 101000920113 Homo sapiens Conserved oligomeric Golgi complex subunit 2 Proteins 0.000 description 1
- 108700026244 Open Reading Frames Proteins 0.000 description 1
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 1
- 102000006382 Ribonucleases Human genes 0.000 description 1
- 108010083644 Ribonucleases Proteins 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 229910052799 carbon Inorganic materials 0.000 description 1
- 210000002421 cell wall Anatomy 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 230000004186 co-expression Effects 0.000 description 1
- 239000002131 composite material Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000006378 damage Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000009355 double cropping Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000010195 expression analysis Methods 0.000 description 1
- 238000000556 factor analysis Methods 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 238000005286 illumination Methods 0.000 description 1
- 108010053156 lipid transfer protein Proteins 0.000 description 1
- 230000004807 localization Effects 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 230000004060 metabolic process Effects 0.000 description 1
- 229920002401 polyacrylamide Polymers 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 230000005451 protein repair Effects 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 230000003938 response to stress Effects 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
- 238000009331 sowing Methods 0.000 description 1
- 230000010473 stable expression Effects 0.000 description 1
- 230000035882 stress Effects 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000002195 synergetic effect Effects 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a main effect QTLqCTES12 for cold resistance of rice in early seedling stage DWR Candidate gene LOC_Os12g18729, which relates to the technical field of agricultural biology. Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR The gene is positioned in a RM5939-RM27947 interval on a No. 12 chromosome of the rice, the interval size is 195kb, the physical distance is 10,066,394-10,266,442p, and the candidate gene loc_Os12g18729 is identified based on BSA-seq and transcriptome analysis, so that the gene can be used for identification of rice early-seedling-stage cold-resistant varieties and molecular breeding.
Description
Technical Field
The invention relates to the technical field of agricultural biology, in particular to a cold-resistant major QTL qCTES12 for rice in the early seedling stage DWR Candidate gene LOC_Os12g18729.
Background
Oryza sativa (Oryza sativa l.) is a major food crop in about half of the world population, with yields affecting global food safety. Asian cultivated rice originates from tropical and subtropical areas and is a warm-loving crop with a suitable growth temperature of 25-35 ℃ and is sensitive to low temperature stress. The low temperature seriously affects the geographical distribution, growth and development, yield and quality of rice, and also affects the sowing time. In addition, the north limit of rice planting is shifted to 39.15m and 24.93km respectively in high-altitude and high-latitude areas, so that the probability of encountering low-temperature cold injury is gradually increased. Indica rice and japonica rice can be subjected to low-temperature cold injury at 18 ℃ and below 15 ℃ respectively. Cold damage at low temperatures may occur during any period of rice growth, eventually leading to reduced yields and quality, while the seedling stage is one of the growth stages with higher susceptibility to cold damage. If the ambient temperature is lower than 15 ℃, the physiological metabolism of the seedling stage rice can be affected. Especially in the middle and downstream double-cropping rice areas in Yangtze river, the cold injury of 'cold in the back spring' and the low temperature of water and soil in cold soaked fields cause the stiff seedling, rotten seedling and dead seedling of rice. Since labor costs are increased, direct-seeding rice in southern rice areas is highly favored by rice farmers, and is not being popularized. However, the 'cold in the back spring' causes the rotten seeds, the rotted buds and the dead seedlings of the direct seeding early rice, thereby causing uneven emergence of seedlings, low seedling rate, delay of development and weed harm (Liu Citao, etc., 2018) and seriously affecting the safe production of the direct seeding early rice. Therefore, the method improves the cold resistance of the rice in the seedling stage, and has important theoretical and practical significance for reducing the cold damage loss of the rice in the seedling stage, promoting the transformation of early rice transplanting to direct seeding (saving cost and reducing white pollution), and realizing green, low-carbon, high-quality and high-efficiency production of the rice.
The cold resistance of rice is a quantitative trait controlled by multiple genes. Traditional breeding methods based on phenotype identification cannot clearly determine the genetic structure of cold tolerance, are difficult to accurately select, have low selection efficiency and slow progress. QTL (Quantitative Traits Loci) analysis can effectively analyze quantitative characters and promote efficient rice cold-resistant breeding. More than 270 COLD-tolerant QTLs have been reported (Li J H, zhangZY, chongK, et al Chilling tolerance in rice: past and present J Plant Physiol,2022,268:153576https:// doi.org/10.1016/j.jplph.2021.153576; lv Y, hussain M Az, luo D, et al Current understanding ofgenetic and molecular basis of COLD tolerance in rice Mol Breeding,2019,39:159, https:// doi.org/10.1007/S11032-019-1073-5), wherein 10 seedling stage COLD tolerance QTL/genes (bZIP 73, COG1, COG2, COLD1, COLD11, HAN1, osLTPL159, osWRKY115, qPSR10 and qCTS-9) were cloned (Feng J L, li Z T, luo W, et al CO 2 negatively regulates chilling tolerance through cell wall components altered in rice. TheorAppl Genet,2023,136:1-11;Natural variation ofcodon repeats in COLD11 endows rice with chilling resilience.Sci Adv,2023,9 (1): eabq5506; liu H L, yang L M, xu S B, et al, osKKY115 on qCT7 links to COLD tolerance in rice. TheorApl Genet,2, 135:2353-2367;Mao D H,XinYY,TanY J,et al.Natural variation in the HAN1 gene confers chilling tolerance in rice and allowed adaptation to a temperate climate.Proc NatlAcad Sci,2019,116:3494-3501;Zhao J,Wang S S,Qin J J,et al.The lipid transfer protein OsLTPL159 is involved in COLD tolerance at the early seedling stage in rice.Plant Biotechnol J,2020,18:756-769) lay a foundation for the COLD tolerance molecule of rice. Therefore, by utilizing the cold-resistant gene and the molecular marker closely linked with the cold-resistant gene, the molecular marker assisted selective breeding is developed, and the accurate and stable selection can be performed in the early generation and early breeding period, so that the breeding process is accelerated, and the breeding efficiency is improved.
Disclosure of Invention
In order to solve the problems, the invention provides a cold-resistant major QTL qCTES12 for rice in early seedling stage DWR The candidate gene LOC_Os12g18729 can be used for identifying cold-resistant varieties in early seedling stage of rice and molecular breeding.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a main effect QTL qCTES12 for cold resistance of rice in early seedling stage DWR Gene is located in RM5939-RM27947 interval on chromosome 12 of rice, the interval size is 195kb, the physical distance is 10,066,394-10,266,442p, and the candidate gene loc_Os12g18729 is identified.
Preferably, the method comprises the steps of,
1) The nucleotide sequence of the upstream primer in the primer pair CTES12 is the nucleotide sequence shown as SEQ ID NO.1 in the sequence table, and the nucleotide sequence of the downstream primer in the primer pair CTES12 is the nucleotide sequence shown as SEQ ID NO.2 in the sequence table;
2) A nucleotide sequence which hybridizes with a DNA sequence defined by SEQ ID NO.1 or SEQ ID NO.2 in the sequence Listing under high stringency conditions;
3) The DNA sequence has more than 90 percent of homology with the DNA sequence defined in 1) or 2), and can amplify the sequence of the cold resistance related gene of the rice in the early seedling stage;
CTES12-F：5'-TTCCTTGCTTGAACTCGAGC-3'(SEQ ID NO.1)
CTES12-R：5'-CATCTGTGTTGCTCATGAGG-3'(SEQ ID NO.2)。
the invention also provides the rice early seedling stage cold-resistant main effect QTL qCTES12 DWR The gene is applied to the identification or breeding of the cold-tolerant rice varieties in the early seedling stage.
The invention also provides a method for identifying the cold-resistant rice variety in the early seedling stage, which comprises the following steps:
1) Extracting genome DNA of rice to be detected;
2) Performing PCR amplification on the CTES12 by using the genomic DNA obtained in the step 1) as a template through the primer pair in the technical scheme to obtain an amplification product;
3) And 2) performing agarose gel electrophoresis on the amplification product obtained in the step 2), and when a 230bp band is obtained, obtaining the rice to be detected as the early seedling stage cold-resistant rice variety.
Preferably, the PCR amplification system of step 2) is: 2X Tolo FastTaqPremix 5.0.0. Mu.L, 10 pmol/. Mu.L of each of the upstream and downstream primers in the above-mentioned protocol was 1. Mu.L, 300 to 500 ng/. Mu.L of rice genomic DNA, and sterilized ultrapure water was added to 10. Mu.L.
Preferably, the step 2) of PCR amplification comprises the following steps: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 55℃for 30s, extension at 72℃for 45s, and cycling for 35 times; finally, the mixture is extended for 10min at 72 ℃; the amplified product was stored at 4 ℃.
The invention also provides a kit for identifying the cold-resistant rice variety in the early seedling stage, which comprises the primer pair CTES12 in the technical scheme.
The invention utilizes Xieqing early B/Dongxiang wild rice BC 1 F 10 Backcross recombinant inbred line (Backcross inbred lines, BILs) L5339 backcrossed with recurrent parent Xieqing early B3 times and 1 time, and Xieqing early B/Dongxiang wild rice BC is developed 5 F 2 Generation BILs, a high density genetic map containing 2059 recombinant Bin markers was constructed by high throughput resequencing. 120 parts of Xieqing early B/Dongxiang wild rice BC is utilized 5 F 2 BILs were subjected to a 1-leaf 1-heart treatment at 5℃for 10 hours at night/at 8℃for 14 hours for 5 days, and after 7 days of recovery growth, the survival rate of seedlings was counted, and as a result, the survival rate of BILs was 0-100%, and the average value was 33.7%. The complete interval mapping method (Inclusive Composite Interval Mapping, ICIM) adopting QTLIci mapping V4.2 software detects that the rice 12 th chromosome interval 12_867129-12_11651936 is positioned to control the novel rice early seedling stage cold-resistant main effect QTL qCTES12 DWR (FIG. 1). The LOD value of the QTL is 5.34, the phenotype contribution rate is 19.38%, the synergistic allele of the QTL is from wild rice in east and countryside and is different from the cloned 10 cold-resistant genes in seedling stage, and a new cold-resistant gene source is provided for cold-resistant breeding improvement of cultivated rice. Further utilizing the carried target QTLqCTES12 DWR Development of 4 sets of BC 5 F 3 The population was finely mapped, and cold tolerance phenotype and genotype combined, and cold tolerance introgression line 19H19 was screened. Subsequent binding of remaining hybrid (Residual heterozygous lines, RHL) method utilizing 19H19 developed RIL-F 2 Secondary localization population, qCTES12 DWR The interval was narrowed to the interval RM5939-RM27927 to within about 195kb of physical locations 10,066,394-10,266,447 b p (FIG. 2).
BC constructed by further backcrossing 19H19 and Xieqing early B 5 F 2 Cold tolerance identification of populations and their parents based on BSA-seq (FIG. 3) and transcriptome analysis, qCTES12 DWR 76 candidate genes related to early seedling stage cold tolerance are identified in the interval, wherein the coding regions of 26 genes undergo frame shift or nonsensical mutation, and 4 genes are found to be differentially expressed under cold stress by transcriptome analysis. Sequencing analysis of the 4 genes revealed that the 3 rd coding region of loc_os12g18729 gene of Xieqing early B was deleted by 42 bases compared with 19H19 (FIG. 4), and the cold-tolerant strain was deleted by 42 bases compared with the cold-tolerant strain as well, and the corresponding molecular marker CTES12 was developed. Practical PCR-based channels in the present inventionThe economic molecular marker CTES12 can be used for identifying and molecular breeding of early-seedling-stage cold-resistant rice varieties.
Compared with the prior art, the invention has the following advantages and effects:
1. the cold-resistant gene of rice in early seedling stage can be stably expressed in different genetic generations, and has strong reliability.
2. Through screening of molecular markers closely linked with the early-seedling-stage cold-resistant genes, rice materials or varieties with strong early-seedling-stage cold resistance can be identified and obtained.
3. The molecular marker can be used for identifying and selecting rice seedling genotypes to obtain individuals carrying excellent natural allelic variation of the cold-resistant genes in early seedling stage, and can overcome the defects of long time period, difficult phenotype identification, poor repeatability and the like of a conventional breeding method and cultivate new varieties of the high cold-resistant rice.
The invention uses the wild rice BC from Xiqing early B/Dongxiang 4 F 2 Backcross recombinant selfing single plant 19H19 development 120 BC 5 F 2 The segregating population was the study population and constructed a high density genetic map containing 2059 recombinant Bin markers. BILs are grown to 1 leaf 1 heart stage, 5 days are carried out at 5 ℃ for 10h night/8 ℃ for 14h day treatment, and after 7 days of growth recovery, the survival rate of seedlings is counted. 120 parts of Xieqing early B/Dongxiang wild rice BC is utilized 5 F 2 BILs are subjected to 5-day treatment at 5 ℃ for 10h night/8 ℃ for 14h in 1-leaf 1-heart period for 5 days, and after 7 days of growth recovery, the survival rate of seedlings is counted, and the result shows that the survival rate of BILs is between 0 and 100%, and the average value is 33.7%. ICIM method adopting QTLICiMappingV4.2 software detects that 12_867129-12_11651936 located in chromosome 12 interval of rice controls novel cold-resistant main effect QTLqCTES12 in early seedling stage of rice DWR (FIG. 1). The LOD value of the QTL is 5.34, the phenotype contribution rate is 19.38%, and the synergy allele is from wild rice in Dongxiang.
Early seedling stage cold-resistant gene locus qCTES12 for performing evidence and decomposing stable expression DWR And molecular markers closely linked with the molecular markers. Wait 4 sets of BC 5 F 3 The material of the generation near isogenic line grows to 1 leaf and 1 heart period, is subjected to 5-day treatment at 5 ℃ for 10h at night/8 ℃ for 14h, and the survival rate of seedlings is counted after 7 days of growth recovery. Using one-way analysis of varianceThe method detects the phenotype variation of two homozygous genotype lines in the same near isogenic line, if the phenotype of different genotypes has significant difference (P<0.05 Estimating the additive effect and the phenotype contribution rate, and carrying out QTL effect decomposition. The analysis was performed by the general linear model (Proc GLM) of SAS software (SAS Institute inc., 1999), eventually narrowing the target QTL interval to within the interval RM5939-RM27947, physical locations 10,066,394-10,266,447 bp, physical interval approximately 195kb (see fig. 2).
Meanwhile, 19H19 is utilized to backcross with Xieqing early B to develop BC 5 F 2 The colony is treated for 4 days at 8 ℃ for 14 hours in the early seedling stage (1 leaf 1 heart stage) and at 5 ℃ for 10 hours at night, and after 7 days of growth recovery, 30 strains with the live seedling rate of more than 80% and less than 20% are respectively selected to construct a cold-resistant and cold-resistant mixing pool. BSA-seq analysis was performed on 2 extreme pools and parents, resulting in a total of 215,572 Single Nucleotide Polymorphism (SNP) sites and 131,456 insertion or deletion (InDel) sites for subsequent gene mapping. At a 95% confidence level, the window of 9Mb-13 Mb for chromosome 12 was greater than the threshold by both SNP-index and InDel-index analysis, and could be used as candidate interval (FIG. 3). Based on the annotated results of ANNOVAR, 76 candidate genes for insertion or substitution of promoter regions and coding regions, and non-synonymous mutation types, were selected.
In combination with transcriptome sequencing and BSA sequencing analysis (fig. 3 and 4), early-stage cold tolerance-related candidate genes were identified within the target interval.
76 candidate genes were identified in the candidate QTL region, of which 26 gene coding regions were frameshift or nonsensical mutated, and transcriptome analysis found that 4 genes were differentially expressed under cold stress. Sequencing analysis of the 4 genes revealed that the 3 rd coding region of LOC_Os12g18729 gene of the cold tolerant parent Xeno B was deleted 42 bases from the cold tolerant parent 19H19, and the cold tolerant strain was deleted 42 bases from the cold tolerant strain as well (FIG. 4), the sequencing primer was Forward (SEQ ID No. 3): 5'-CAACTTAGTTCAGATGCTG-3'; reverse (SEQ ID No. 4): 5'-TCAAGAGATACAACACGCG-3'. According to the sequence difference, a cold-resistant linkage molecular marker CTES12 is developed, and the sequence of the cold-resistant linkage molecular marker CTES12 is Forward (SEQ ID No. 1): 5'-TTCCTTGCTTGAACTCGAGC-3'; reverse (SEQ ID No. 2): 5'-CATCTGTGTTGCTCATGAGG-3' provides a theoretical basis for rice molecular marker assisted selective breeding.
Further WGCNA analysis of transcriptome-differential genes indicated similar gene expression patterns in the following 18 modules. And qCTES12 DWR The expression level of the candidate gene LOC_Os12g18729 (red frame mark) in the cold treatment 19H19 is significantly reduced, while the expression level of the Xueqing early B is not greatly changed, which indicates that the Xueqing early B responds to cold stress in 19H19. Further GO enrichment indicates that the modular gene is associated with redox, stress response and protein repair, indicating that loc_os12g18729 gene may regulate rice cold tolerance mechanism by co-expression with these functional genes (fig. 5).
FIG. 5 shows the expression patterns of the transcriptome-differentiated genes of Xiqing early B and 19H19 (the darker the color shows the higher the expression level).
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is qCTES12 DWR A position on the rice chromosome;
FIG. 2 is a drawing of the cold-resistant major QTL qCTES12 at the early seedling stage DWR Verifying and decomposing genetic effects;
FIG. 3 is a graph showing analysis of candidate genomic regions for cold tolerance in early rice seedling stage;
FIG. 4 Xieqing early B, 19H19 and BC thereof 5 F 2 A group cold-tolerant and cold-tolerant strain LOC_Os12g18729 gene sequence;
FIG. 5 shows the expression patterns of the differential transcriptome genes of Xiqing early B and 19H19 (the darker the color shows the higher the expression level);
FIG. 6qCTES12 DWR qRT-PCR and transcriptome analysis of candidate gene loc_Os12g 18729;
FIG. 7qCTES12 DWR Molecular marker detection cold-resistant and cold-resistant BC (BC) of candidate gene loc_Os12g18729 5 F 2 Genotype of strain. DWR, xieqing early B, 19H19, 3, 37, 42, 43, 71, 88, 91 and 102 are respectively the Dongxiang wild rice fomentation family mountain dwelling group 194 for cold tolerance identification and Xieqing early B/Dongxiang wild rice BC 5 F 2 Backcross strainAnd 11 rice materials are used.
Detailed Description
The invention provides a main effect QTL qCTES12 for cold resistance of rice in early seedling stage DWR Gene is located in RM5939-RM27947 interval on chromosome 12 of rice, its interval size is 195kb, physical distance is 10,066,394-10,266,442p, its candidate gene loc_Os12g18729, and its nucleotide sequence is shown in SEQ ID No. 5. In the invention, the main effect QTL qCTES12 for cold tolerance of rice in early seedling stage DWR The upstream nucleotide sequence of the molecular marker of the candidate gene Loc_Os12g18729 is shown as SEQ ID No.1, and the downstream nucleotide sequence of the molecular marker is shown as SEQ ID No. 2.
SEQ ID No.5：
GCCACCACTGCTTTCCCTCCTCCTCATCCTCATCTTCATCTCTAGACCTCATCTTCTCCAGCCACCACCGCCTCCCTTCCCACCGGTGGTGGCAGCGGGAAGACAGCGGCTCGGTTGAGCCCGGCGGGGAGGGCACGATTTGGTATGGGAGGAGCAGCGGCGACTCCATCCGGCGGTGGATCCGCCGCCTCCTAGTCCCAGCTCTCTCTCCCCCGATCCTCCTCCTCCCCTTCCTCCACCGCCACCACCCACCCCTCTCCCTCTCTCAGATCTGGTGCGCGGGGAGCGGTGGAGGCTACGGCGGCGGCGGCGGCGAGATCGGTAGCAGTGATGGTGGAGAGGACGGATCCGATGGCGGTGGTTCTCGTCAACCAGTTCAAGGACGACGACAGCAGCGGCTGCTGCAACGATGGATAGGCTCTGGGCGGCTCCTCCACTCTCCTCCCCTCTCTCATATCCAGTGGCTCGGGGTGGTGGGGCGTGGCCGACGCATCCGGCGGCGGAGCTCGGGTATCGATCCGGCATGTTTTTTTTTCTCCAAAATCAATTTTTCTTGGTGGTCGGGAAACGGATTTTCAATTTTCTTTTTTTCGCTCGAATATCTTTTTCGCTGGCGGTCAACGTAACTTAACCGCTTGTGAAAACAAGCTTTAAAGTTTCGCTAGTGAAGATTGTTATTTTCACTTGCCATTTGTTTGCGGGCGGCTGACAGTGCCACCAGCGAAAAACTCTTTTGCTAGTAGTGATTGCTAGATGGTCAGCAGAGAACTTGTGGAGCATATGACTATCAACTAACAGTACACTTCAGCAGAAAGAGGATGGTTCTAGCTCTCCGATGGTTTAATATTGAAACGTACAGCCCACCCACCACCACCCCAGTCGTCCCCAGCTAAGCGCTCCCTTGCTTGCCTCAGTAGACGAGCTGCCAACTAGTAGCACTCCAGCAAGCAGCGGGTCAGCGGAGTCCGGAGGGCGCACGTGCGCCGCAGCGAGGTATCAGCATGGCCAGGCGGCGGCTGGCTGGCCGGCCGGGTTCGGCAAGCGGCTAAGCAGGTAATTAAGGGACTGCAGATACTGCTTGTGATCATCCCTTAAAATTTCGTCTTTCTTGTCTTGGGCCAGGTTTAATTCCTAATTTTTTCTTCAAACTTTCAACTTTTCCATCACATCAAAACTTTTCTACACACACAAACTTTCAACTTAATTTTCCGTCACATCGTTCCAATTTCAATCAAACTTCTAATTTTAGCGTGAACTAAACACACCCTTGGTTGTGACTCTGGGAGTCGATACATAGGCCTTAATGCTCGTAGTTTGTGGATTTTGGGGTTAAACTGGCGTGGAACTTTACTTGGATACCACCTGGGAGTTGATGTGATTTTAGTGTTTAGTACAGTTTAGAGTTTATTACCTACCGGTTTCTTGGTGCCTGGCGCACACTGAGCATGCAAATGCAGTGAGAGCCAGTATCATCTAAGACGGCTGGACCTGAAATATTTTACCATGTATATATCAAACTCGACTTGATCAGGTGTTTAGCGGAGGAAGGATCGATGTCCGGCGCCGGACAGAGCCGTGGTCATCGCCTTGGATTACACATTGATTCGGATTGGCCAGAGGTCTTGTTGATCAATGACTATGCGGTGTTCATGGGGTACCTGTCGATGGTTGTCACCGGGACGGGGTTCCTGGTGCTCACGTGGTCCACCGTCATCCTCCTCGGTGGATTCGTCTCCATGCTATCCAACAAGGACTTCTGGAGTCTCACGGTGATCACGCTCGTTCAAACAAGGTGAGCTATCTATAGCCATCTCCACCAGACTTATATTTATTTCGCGTTCCCAACATTAACCAGTTCAGCCAAGCATTTGGAGTTTCGCATTGCTAGCTAGCTACTAGTTTACTGTCAGATCTAGTGTTGCGAACCGAATATGCTGCAAAACGTTGCAATTCCAGAGTGGCTTTATATACTACATTGATATGAAAATATTCAAGTCCCATATTTGCAAAATCAA。
The invention also provides the rice early seedling stage cold-resistant main effect QTL qCTES12 DWR Application of candidate gene Loc_Os12g18729 in early seedling stage cold-tolerant rice variety identification or breeding.
The invention provides a primer pair for amplifying the molecular marker in the technical scheme, wherein the nucleotide sequence of an upstream primer of the primer pair is shown as SEQ ID No. 1; the nucleotide sequence of the downstream primer of the primer pair is shown as SEQ ID No. 2.
SEQ ID No.1：CTES12-F：5'-TTCCTTGCTTGAACTCGAGC-3'；
SEQ ID No.2：CTES12-R：5'-CATCTGTGTTGCTCATGAGG-3'。
The invention provides a method for identifying a cold-resistant rice variety in an early seedling stage, which comprises the following steps:
1) Extracting genome DNA of rice to be detected;
2) Taking the genome DNA obtained in the step 1) as a template, and carrying out PCR amplification by using the primer pair according to the technical scheme to obtain an amplification product;
3) And 2) performing agarose gel electrophoresis on the amplification product obtained in the step 2), and when a 230bp band is obtained, obtaining the rice to be detected as the early seedling stage cold-resistant rice variety.
The method for extracting the genome DNA of the rice to be detected is not particularly limited, and can be carried out by a person skilled in the art according to routine.
The invention uses the obtained genome DNA as a template, and carries out PCR amplification by the primer pair according to the technical scheme to obtain an amplification product. In the present invention, the system for PCR amplification is preferably: 2X Tolo FastTaq Premix 5.0.0. Mu.L, 10 pmol/. Mu.L of each of the upstream and downstream primers in the above-mentioned protocol was 1. Mu.L, 300 to 500 ng/. Mu.L of rice genomic DNA, and sterilized ultrapure water was added to 10. Mu.L. In the present invention, the procedure for PCR amplification is preferably: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 55℃for 30s, extension at 72℃for 45s, and cycling for 35 times; finally, the mixture is extended for 10min at 72 ℃; the amplified product was stored at 4 ℃.
The invention carries out agarose gel electrophoresis on the obtained amplified product, and when a 230bp band is obtained, the rice to be detected is a cold-resistant rice variety in the early seedling stage. In the invention, if the size of the PCR product is 230bp, the rice to be detected is a rice variety with strong cold resistance in the early seedling stage; if the size of the PCR product is 188bp, the rice to be detected is a rice variety with weak cold resistance. In the invention, the rice variety with strong cold resistance in the early seedling stage is a rice variety with the seedling survival rate higher than 70% after 7 days of recovery growth, wherein the rice variety is subjected to 5 ℃ for 10h at night/14 h day treatment at 8 ℃ for 5 days in the 1-leaf 1-heart stage; the rice variety with weak cold resistance is a rice variety with a live seedling rate lower than 15% after 7 days of recovery growth by carrying out 5-DEG C10 h night/8 DEG C14 h day treatment for 5 days in a 1-leaf 1-heart period.
The invention also provides a kit for identifying the cold-resistant rice variety in the early seedling stage, which comprises the primer pair in the technical scheme. In the invention, the kit also comprises conventional amplification reagents such as 2X Tolo FastTaq Premix and the like.
The present invention will be described in detail with reference to examples for further illustration of the invention, but they should not be construed as limiting the scope of the invention.
The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified. The cold resistance test in the following examples was set up in three replicates and the results averaged.
Example 1
Cold-resistant gene qCTES12 for rice in early seedling stage DWR Decomposition verification and development of CTES12 molecular marker-rice early seedling stage cold-resistant QTLqCTES12 DWR Verification decomposition of (a)
1. Test material construction
Early stage hybrid and backcross of cold sensitive indica rice variety Xieqing B bred by using strong cold-resistant wild Dongxiang rice and Anhui agricultural academy of sciences rice, and development of 237 BC 1 F 10 And (3) carrying out cold tolerance identification in early seedling stage in 1-leaf 1-heart stage on the backcross recombinant inbred line population (BIL) of the generation. Developed BC is obtained after 3 backcrosses of recurrent parent Xieqing early B and extremely cold-resistant strain 5339 are selfed 1 time 4 F 2 And (3) screening the high-generation backcross population to obtain the cold-resistant introgression line 19H19 in the early seedling stage by combining the cold-resistant phenotype and genotype. Subsequent binding of Remaining Hybrid (RHL) method with 19H19 developed RIL-F 2 And carrying out QTL verification on the secondary positioning group. BC constructed by further utilizing backcrossing of 19H19 and Xieqing early B 5 F 2 The populations were subjected to BSA-seq analysis.
2. Genotyping
The test materials are planted in Nanchang test bases of the national institute of agricultural sciences, oryza sativa, tender leaves of oryza sativa are cut, and DNA of the whole genome is extracted by using a sodium dodecyl sulfate SDS method. 196 SSR markers which have good amplification effect, polymorphism among parents and are uniformly distributed on 12 chromosomes of rice are screened out to be used for 19H19 and 120 BC derived from the same 5 F 2 And (5) locating group genotype identification.
The PCR reaction system is as follows: 2X Tolo FastTaq Premix 5.0.0. Mu.l, 10 pmol/. Mu.l of primer set CTES 121. Mu.l, 300-500 ng/. Mu.l of rice genomic template DNA 1. Mu.l, and sterilized ultrapure water was added to 10. Mu.l.
The PCR conditions were as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 55℃for 30s, extension at 72℃for 45s, and cycling for 35 times; finally, the mixture is extended for 10min at 72 ℃; the amplified product was stored at 4 ℃.
The amplified products are denatured by 6% polyacrylamide or separated by 3% agarose gel electrophoresis, and each molecular marker is detected by 260V constant-pressure electrophoresisAmplifying the bands, amplifying 19H19 and its derivative BC 5 F 2 The amplified band type of the single plant of the population is compared with that of the wild rice of Dongxiang and Xieqing early B. Wherein the band type is marked as 1 which is the same as the parent Xieqing early B type, the band type is marked as 2 which is the same as the parent Dongxiang wild rice type, and the deletion is marked as "-".
3. Early seedling stage cold resistance identification
The cold resistance test in seedling stage is carried out in the institute of paddy rice, national academy of sciences of agriculture in Jiangxi province, 11 th year 2021 and 4 th year 2022. And planting 30 seeds in each plant line, putting the plant line into a GHP-300E intelligent illumination incubator (Shanghai Santa scientific instrument Co., ltd.) until the plant line grows to 1 leaf and 1 core period, carrying out low-temperature treatment at 5 ℃ for 10h/8 ℃ for 14h for 5 days, recovering the plant line to grow for 7 days, and investigating the live seedling rate, wherein the average value of 3 times of repetition is used as an early seedling stage cold resistance evaluation index of the plant line.
Example 2
From BC at Nanchang assay base 5 F 2 4 RHL single plants are selected from the population, F2 populations derived from the 4 RHL single plants are planted in a triple-test base, and genotype analysis is carried out on SSR markers by using 9 of RM3246, RM7887, RM7195, RM5359, RM27947, RM27950, RM27955, RM5364, RM27983 and the like, so that 4 sets of BC5F3 generation RIL-F2 populations are constructed for fine positioning. Wait 4 sets of BC 5 F 3 The material of the generation near isogenic line grows to 1 leaf and 1 heart period, is subjected to 5-day treatment at 5 ℃ for 10h at night/8 ℃ for 14h, and the survival rate of seedlings is counted after 7 days of growth recovery. Detecting phenotype variation of two homozygous genotype lines in the same set of near isogenic lines by adopting a single factor analysis of variance method, if the phenotypes of different genotypes have significant differences (P<0.05 Estimating the additive effect and the phenotype contribution rate, and carrying out QTL effect decomposition. The analysis was performed by the general linear model (Proc GLM) of SAS software (SAS Institute inc., 1999), eventually narrowing the target QTL interval to within the interval RM5939-RM27947, physical locations 10,066,394-10,266,447 bp, physical interval approximately 195kb (see fig. 2).
Example 3
Expression analysis and verification of cold-tolerant candidate genes
Total RNA from seedlings of rice was extracted using a RNeasy Plant Mini Kit (QIAGEN, germany) kit. By usingPremix Ex TaqTMII (Tli RNase Plus) (Takara) was subjected to RT-qPCR analysis, and gene Osactin was used as an internal reference. The instrument used was a real-time fluorescent quantitative PCR instrument ViiA7 from America Applied Biosystems. 1 leaf 1 heart stage of Xiqing early B and 19H19 is treated for 5 days at 5 ℃ for 10H night/14H day and at 8 ℃ at low temperature, after 7 days of recovery growth, RT-qPCR and transcriptome analysis are respectively carried out on rice seedling samples after room temperature and low temperature recovery growth, and qCTES12 under low temperature treatment is found as a result DWR The expression of the candidate gene loc_os12g18729 was up-regulated and early B-regulated after recovery from growth (fig. 6). For analysis of qCTES12 DWR The primers of the candidate gene loc_Os12g18729RT-qPCR are as follows:
RT-F(SEQ ID No.6):5'-CCCCTCTCTCATATCCAGTGGCT-3'；
RT-R(SEQ ID No.7):5'-TGTAATCCAAGGCGATGACCACG-3'。
example 4
Cold-resistant gene qCTES12 for rice in early seedling stage DWR Detection of linkage molecular marker CTES12
Detection of Xieqing early B, 19H19, household mountain group 194 of Dongxiang wild rice and BC by utilizing gene LOC_Os12g18729 linkage marker CTES12 5 F 2 The result of the colony cold-resistant and cold-resistant strain genotypes shows that the cold-resistant and cold-resistant genotype strains are consistent and identical with the cold resistance corresponding to the colony cold-resistant and cold-resistant genotype strains respectively, which indicates that the molecular marker CTES12 is linked with the cold resistance of rice in early seedling stage, can accurately assist in selecting the cold resistance of rice in early seedling stage (figure 7), and can be applied to assist in selecting the breeding improvement.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.
Claims (7)
1. Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR A gene, characterized in that it is located on chromosome 12 of riceWithin the interval RM5939-RM27947, the size of the interval is 195kb, the physical distance is 10,066,394-10,266,442bp, and the candidate gene Loc_Os12g18729 is identified.
2. The rice early seedling stage cold-resistant major QTL qtes 12 of claim 1 DWR The candidate gene is LOC_Os12g18729, which is characterized in that,
1) The nucleotide sequence of the upstream primer in the primer pair CTES12 is the nucleotide sequence shown as SEQ ID NO.1 in the sequence table, and the nucleotide sequence of the downstream primer in the primer pair CTES12 is the nucleotide sequence shown as SEQ ID NO.2 in the sequence table;
2) A nucleotide sequence which hybridizes with a DNA sequence defined by SEQ ID NO.1 or SEQ ID NO.2 in the sequence Listing under high stringency conditions;
3) The DNA sequence has more than 90 percent of homology with the DNA sequence defined in 1) or 2), and can amplify the sequence of the cold resistance related gene of the rice in the early seedling stage;
CTES12-F：5'-TTCCTTGCTTGAACTCGAGC-3'(SEQ ID NO.1)
CTES12-R：5'-CATCTGTGTTGCTCATGAGG-3'(SEQ ID NO.2)。
3. the rice early seedling stage cold tolerance major QTL qtes 12 of claim 1 or 2 DWR The gene is applied to the identification or breeding of the cold-tolerant rice varieties in the early seedling stage.
4. A method for identifying a cold-tolerant rice variety in an early seedling stage, comprising the steps of:
1) Extracting genome DNA of rice to be detected;
2) Performing PCR amplification on the CTES12 by using the genomic DNA obtained in the step 1) as a template and using the primer pair of claim 2 to obtain an amplification product;
3) And 2) performing agarose gel electrophoresis on the amplification product obtained in the step 2), and when a 230bp band is obtained, obtaining the rice to be detected as the early seedling stage cold-resistant rice variety.
5. The method according to claim 4, wherein the PCR amplification system of step 2) is: 2X Tolo FastTaq Premix 5.0.0. Mu.L, 10 pmol/. Mu.L of the upstream and downstream primers of claim 2 were 1. Mu.L, 300 to 500 ng/. Mu.L of rice genomic DNA, respectively, and sterilized ultrapure water was added to 10. Mu.L.
6. The method according to claim 4, wherein the step 2) of PCR amplification is performed by: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 55℃for 30s, extension at 72℃for 45s, and cycling for 35 times; finally, the mixture is extended for 10min at 72 ℃; the amplified product was stored at 4 ℃.
7. A kit for identifying a variety of cold-tolerant rice in early seedling stage, comprising the primer pair CTES12 of claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311313576.9A CN117344050A (en) | 2023-10-11 | 2023-10-11 | Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR Candidate gene LOC_Os12g18729 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311313576.9A CN117344050A (en) | 2023-10-11 | 2023-10-11 | Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR Candidate gene LOC_Os12g18729 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117344050A true CN117344050A (en) | 2024-01-05 |
Family
ID=89366189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311313576.9A Pending CN117344050A (en) | 2023-10-11 | 2023-10-11 | Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR Candidate gene LOC_Os12g18729 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117344050A (en) |
-
2023
- 2023-10-11 CN CN202311313576.9A patent/CN117344050A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220346335A1 (en) | Molecular breeding method for wheat fusarium head blight-resistance | |
| CN105695478B (en) | Gene for regulating plant type and yield of plant and application thereof | |
| CN111334603A (en) | Specific InDel molecular marker for detecting OsNRAMP5 gene of rice and application thereof | |
| WO2011072478A1 (en) | Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof | |
| CN106811462B (en) | Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof | |
| CN110684858A (en) | Molecular marker of rice long and thin grain type gene and application thereof | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN111676229A (en) | Maize male nuclear sterility gene ms40 and molecular marker and application thereof | |
| CN109006456B (en) | Breeding method of pimento nuclear male sterile dual-purpose line | |
| CN113179884B (en) | Method for cultivating high-yield wheat with gibberellic disease resistance in Huanghuai wheat area based on polygene polymerization | |
| CN112410460B (en) | Stably expressed molecular marker closely linked with cold-resistant QTL (quantitative trait locus) in rice germination stage and application thereof | |
| CN115232823A (en) | Leaf development related gene of Echinacea purpurea and application thereof | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN117344050A (en) | Cold-resistant major QTL qCTES12 for early seedling stage of rice DWR Candidate gene LOC_Os12g18729 | |
| CN113943732A (en) | SNP (Single nucleotide polymorphism) marker related to heat resistance of cucumber in adult stage, primer group, kit and application | |
| CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof | |
| CN111621589A (en) | Molecular marker of brown planthopper resistant gene qBPH6 of rice and application thereof | |
| CN116814846B (en) | Molecular marker linked with salt-tolerant gene qSST4 of Dongxiang ordinary wild rice and application thereof | |
| Awasthi et al. | Marker assisted selection for the improvement of Sarjoo-52 for drought tolerance by introgression of MQTL1. 1 from the source Nagina–22 | |
| CN116574829B (en) | Molecular marker linked with rice mesocotyl elongation gene qML3 and application thereof | |
| CN114672581B (en) | Molecular marker of rice heterologous cytoplasmic fertility restoration QTL qRf5.1 and application thereof | |
| CN116904638B (en) | Kasp markers linked to early females of quinoa and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |