CN105002191B - A kind of Oryza sativa L. CYP704B2 gene mutation body and method for identifying molecules thereof and application - Google Patents

Abstract

The present invention provides a kind of Oryza sativa L. CYP704B2 gene mutation body and application thereof, belongs to gene engineering technology field.The rice variety 93 11 3 G bases after co-60 radiation mutation causes the 794th base of Oryza sativa L. CYP704B2 gene are replaced with 1 T base by the present invention, by the named cyp704B2 of this CYP704B2 gene mutation body 3, its nucleotide sequence is as shown in SEQ ID No.1, it is further characterized by this mutant and causes rice recessive male nuclear sterile, can be used for preparing the transgenic paddy rice of Recessive male sterility, act on great in the genetic improvement breeding of Rice Germplasm Resources.Present invention also offers the molecular marker identification method of this mutant and the application in the breeding production of hybrid seeds thereof.

Description

A kind of Oryza sativa L. CYP704B2 gene mutation body and method for identifying molecules thereof and application

Technical field

The invention belongs to field of plant molecular biology, be specifically related to a kind of Oryza sativa L. CYP704B2 Gene mutation body cyp704B2-3 and method for identifying molecules thereof and application.

Background technology

Plants male sterility sudden change is phenomenon the most universal in nature, and at least oneself is at 43 Section, 162 617 species belonged to are found that malesterile mutants.Plant in heredity Male sterility is divided into nuclear male sterility, cytoplasmic male sterility and nucleus Cytoplasm interaction Male sterility three major types: 1) nuclear male sterility by cell nucleus gene sudden change produce, have aobvious Property sudden change and recessive mutation, have sporinite gene mutation and gametophytic development sudden change.Dominant mutation Can only be by female gamete heredity with gametophytic development sudden change, recessive mutation both can by female gamete also Heredity can be carried out by androgamete, and follow Mendel's law.Some spores are cloned at present Daughter Recessive Male sterility, such as the ms2 of arabidopsis, the ms45 of Semen Maydis and the mil1 of Oryza sativa L. Deng (Aarts etc., 1997, The Arabidopsis MALE STERILITY 2protein shares Similarity with reductases in elongation/condensation complexes, Plant Journal, 12:615-623；Albertsen, 2006, Male tissue-preferred regulatory Sequences of MS45gene and method of using same, the patent No.: US7154024B2；Hong etc., 2012, Somatic and reproductive cell Development in rice anther is regulated by a putative glutaredoxin, Plant Cell, 24:577-588)；Some gametocyte Recessive Male sterilities are also cloned, such as arabidopsis The abnormal mutant sidecar pollen of two After microspore mitosis and gemini pollen (Oh etc., 2010, The SIDECAR POLLEN gene encodes a microspore-specific LOB/AS2domain protein required for the correct Timing and orientation of asymmetric cell division, Plant Journal, 64:839-50；Park etc., 1998, The Arabidopsis thaliana gametophytic mutation gemini pollen1disrupts microspore polarity,division asymmetry And pollen cell fate, Development, 125:3789-99)；One has also been cloned on Semen Maydis Individual sporinite dominant male sterile gene MS44 (Cigan and Albertsen, 1998, Reversible Nuclear genetic system for male sterility in transgenic plants, US5750868)；2) cytoplasmic male sterility is then by plasmagene control, not phase Corresponding nuclear restorer gene, belongs to matrocliny；3) nucleus Cytoplasm interaction male sterility by Plasmagene and cell nucleus gene co-controlling, its essence is Cytoplasm and Mesoplast heredity thing The result of matter discord.Sterile cytoplasm is that some are caused by the mitochondrial gene that suddenlys change, but has relatively The nuclear restorer gene answered, can suppress sterile cell's plasmagene.Sterile cell's plasmagene can produce one Kind new protein, enough affect mitochondrion normal function (Chen and Liu, 2014, Male Sterility and fertility restoration in crops, Annu Rev Plant Biol, 65:5.1-5.28).In terms of educating Restore gene, current Oryza sativa L. clones Rf-1, Rf-2, The genes such as Rf-4, Rf-5 (Komori etc., 2004, Map-based cloning of a fertility Restorer gene, Rf-1, in rice (Oryza sativa L.), Plant Journal, 37:315-325； Itabashi etc., 2011, The fertility restorer gene, Rf2, for Lead Rice-type cytoplasmic male sterility of rice encodes a mitochondrial glycine-rich Protein, Plant Journal, 65:359-367；Tang etc., 2014, The rice restorer Rf4 for wild-abortive cytoplasmic male sterility encodes a PPR protein that Functions in reduction of WA352transcripts, Molecular Plant, 7:1497-500；Hu etc., 2012, The rice pentatricopeptide repeat protein RF5 restorers fertility in Hong-Lian Cytoplasmic male-sterile lines via a Complex with the glycine-rich protein GRP162, Plant Cell, 24:109-22).

Oryza sativa L. is the national industry of China, and hybrid rice has played weight to improving China's grain yield Act on.At present, China hybrid rice adds up cultivated area more than 4,500,000,000 mu, hybrid rice Cultivated area has accounted for about the 55% of whole nation Monitoring of Paddy Rice Plant Area.Hybrid rice is selection two Individual genetic background is different, the rice varieties that character again can be complementary simultaneously, is had by hybridization generation Heterotic first generation cenospecies is used for producing.It is existing that hybrid rice has obvious hybrid vigor As, it is mainly manifested in aspects such as growing vigorous, well developed root system, big panicle many grains per panicle, strong stress resistance. Hybrid rice reaches 30% than conventional Rice volume increase.The hybrid rice of at present China's plantation can be divided into Method hybrid paddy rice and two-line hybrid rice.Three-line Hybrid rice (ternary hybrid rice) is exactly to produce this Planting hybrid paddy rice needs three rice strains to complete: Oryza sativa L. cytoplasmic nuclear male sterile line, Oryza sativa L. Cytoplasmic male sterility keeps system and rice cytoplasmic male sterile restorer.Oryza sativa L. nucleo-cytoplasmic interaction Male sterility line (being called for short sterile line, code name A) has the various kinds of cell matter such as Yebai, red lotus type Type.Rice cytoplasmic male sterile keeps system's (be called for short and keep system, code name B) to be used to numerous Grow sterile line one Oryza sativa L..Its cell nucleus gene type is identical with sterile line, but containing can hatching cell Plasmagene, can produce fertile pollen, it is possible to self-fertility.Owing to keeping the karyogene of system not contain Restore gene, the offspring that therefore it produces to sterile line pollination is also sterile.Rice cytoplasmic Male sterile restoring line (being called for short restorer, code name R) carries Restore gene, it is possible to repair thin Cytoplasmic male sterility, the hybrid (i.e. hybrid paddy rice) produced with sterile line hybridization normally can educate. There is the problems such as susceptible, poor quality, breeding efficiency are low in three-line breeding method.Because of by Rescued virus Restriction, the rice pest insects of 95% cannot be used for cross-breeding.Two-line hybrid rice utilizes light temperature sensitive Genetic Sterility mutant, it shows male sterility under long day hot conditions, can carry out hybrid seeding, Male-fertile is showed under short day cryogenic conditions, can be with self propagated.Compared with three line method, two are Method has significant superiority: sterile line with restorer combo freely, matches excellent combination probability Greatly；Sterile line can one be dual-purpose.But two line method sterile line easy light temperature environmental effect, breeding Very risky.Such as meeting low temperature during the production of hybrid seeds, sterile line will turn into can educate, and produces selfing Seed, affects the purity of hybrid seed；It is the most sterile that some two-series hybrids meet high temperature, impact Setting percentage, causes the underproduction.Therefore, find new male sterility breeding method and be still that crop educates Important subject in kind.

Utilize the methods such as induced mutations such as physics radiation, chemical treatment, tissue culture, people Oryza sativa L. obtains multiple new sterile mutant.Cyp704B2 mutant is one of them. The flower pesticide of this mutant does not produce mature flower powder.This sterile gene is cloned, for CYP704B2 gene, belongs to P450 family, and there are 4 exons coding region, encodes one 544 amino acid whose albumen (Li etc., 2010, Cytochrome P450family member CYP704B2catalyzes theω-hydroxylation of fatty acids and is required For anther cutin biosynthesis and pollen exine formation in rice, Plant Cell, vol.22:173-190).CYP704B2 gene is formed before and after sporidiole in meiosis, Specific expressed at floss adhesion coating and sporidiole.CYP704B2 albumen participates in fatty acid metabolism, and Fatty acid metabolites is cutin and sporopollenin precursor.The deletion mutation of CYP704B2, makes spore The synthesis transhipment of powder element is obstructed, it is impossible to normally forming sporidiole outer wall, sporidiole grows further and is subject to Resistance, causes holandry sterile；Mutant flower pesticide surface horny is additionally caused to lack. Cyp704B2 mutant derives from the co-60 radiation mutation mutant of japonica rice variety 9522, is The sudden change caused is lacked by one section of 3102bp segment.This deletion fragment includes CYP704B2 base The intergenic sequence of anterior 1732bp, the 1112bp upstream of coding region of cause, and upstream base 258bp sequence because of coding region 3 '-end.Owing to this sudden change deletes the part of upstream gene Sequence, therefore this mutant there may be potential Non-target traits variation, may utilize for it Bring adverse effect.

Summary of the invention

It is an object of the invention to provide a kind of Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 And method for identifying molecules and application.

The present invention is first to rice variety 93-11 seed (M₀Generation) carry out co-60 radiation mutation Processing, the seed that plantation processes obtains M₁For plant；M₁Producing seed for plant selfing (is M₂Generation), plant M₂For plant, to M₂Morphology, histology and hereditism is carried out for plant Identify, screen sterile plant；Then sterile plant is carried out gene sequencing and DNA sequence is divided Analysis, verifies on a molecular scale.Finally obtain the sterile individual plant that isozygotys, and educate for hybridization Plant and biotechnology research.

The Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 that the present invention provides, it is Oryza sativa L. 3 G bases after the 794th base of CYP704B2 gene replace with 1 T base, and this is dashed forward Displacement point is positioned at the 3rd exon.

Further, Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3, its nucleotides sequence Row are as shown in SEQ ID No.1.

The invention provides containing Oryza sativa L. CYP704B2 gene mutation body of the present invention The expression vector of cyp704B2-3.

The invention provides the host cell containing above-mentioned expression vector.

The invention provides Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 and turn base in preparation Because of the application in plant.

The invention provides Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 prepare hidden Application in the transgenic paddy rice of property male nuclear sterile.

The invention provides Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 to change in Oryza sativa L. Application in good breeding, the production of hybrid seeds.

Present invention also offers detection Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3's Molecular marker, this molecular marker is to be obtained by following primer pair amplifies, the nucleoside of described primer pair Acid sequence is:

Forward primer 1907_F:AGGTCGGGTTTGGGGTT is (such as SEQ ID NO.2 Shown in)

Downstream primer 1907_R:GATGTTGGCAGCGTCGAA is (such as SEQ ID NO.3 Shown in).

The invention provides above-mentioned molecular marker and prepare the transgenic water of Recessive male sterility Application in rice.

The invention provides the application in Rice Germplasm Resources is improved of the above-mentioned molecular marker.

A kind of method of the molecular marker of Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3, By following primer to expanding plant genome DNA to be checked, and detect amplified production:

The nucleotides sequence of described primer pair is classified as:

Forward primer 1907_F:AGGTCGGGTTTGGGGTT is (such as SEQ ID NO.2 Shown in)

Downstream primer 1907_R:GATGTTGGCAGCGTCGAA is (such as SEQ ID NO.3 Shown in)；

If with above-mentioned primer to amplifying than the wild type the shortest 2bp of 93-11 amplified production Fragment, then indicate that this plant to be checked exists Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3。

The mutant cyp704B2-3 advantage that the present invention provides is as follows:

1) this mutant derives from long-grained nonglutinous rice backbone parent kind 93-11.This kind completes Genome sequencing, highly beneficial to Rice molecular breeding.

2) document " Li etc., 2010, Cytochrome P450family member CYP704B2 catalyzes theω-hydroxylation of fatty acids and is required for anther Cutin biosynthesis and pollen exine formation in rice, Plant Cell, vol. 22:173-190 " in mutant be large fragment deletion, not only CYP704B2 gene delection, And 258 base pairs of upstream gene 3 '-end are also deleted, add thus with potential Effect.And the sudden change of the present invention occurs in the 3rd exon of a CYP704B2 gene 3 G bases replace with 1 T base, make this gene generation frameshift mutation, transcribe in advance Terminate, cause 339 aminoacid deletion of C end of CYP704B2 albumen, replace with other 4 Individual aminoacid, performance holandry is sterile, there is not this potential additive effect problem.

3) mutational site few 2 base pairs, employing experiment than wild type is caused because of radioinduction The polyacrylamide gel electrophoresis that room is commonly used just can carry out Molecular Detection, it is not necessary to particularly detects Technology and method.

Accompanying drawing explanation

Fig. 1 is the plant type of 1907 mutants and wild type and fringe type photo in embodiment 2.

Fig. 2 is flower pesticide Stereo microscope photo and the microscope of 1907 mutants in embodiment 3 Photo.

Fig. 3 is mutational site and the egg of 1907 mutant CYP704B2 genes in embodiment 6 White matter translation termination site schematic diagram.

Wild type 93-11 and 1907 mutants in Fig. 4-a and Fig. 4-b composition embodiment 6 The comparison chart of CYP704B2 gene DNA sequence.

Fig. 5 is wild type 93-11 and 1907 mutant CYP704B2 genes in embodiment 6 The comparison chart of protein sequence.

Fig. 6 is wild type 93-11 in embodiment 7,1907 mutants and both cenospecies The electrophoresis result of CYP704B2 gene amplification fragment.

Fig. 7 is that in embodiment 8,1907 × 93-11 combines F₂Fertile plant and sterile plant in colony The electrophoresis photographs of the PCR primer of CYP704B2 gene mutation site.

Fig. 8 is the Technology Roadmap of the hybridization transformation of embodiment 9.

Detailed description of the invention

Following example are used for illustrating the present invention, but are not limited to the scope of the present invention.Not In the case of deviating from present invention spirit and essence, the inventive method, step or condition are made Amendment or replacement, belong to the scope of the present invention.

If not specializing, technological means used in embodiment is ripe by those skilled in the art The conventional means known.

Embodiment 1: co-60 radiation mutation mutant library

Selecting long-grained nonglutinous rice backbone parent kind 93-11 as the material of radiation treatment, this kind is the completeest Become genome sequencing, highly beneficial to Rice molecular breeding.

Summer in 2013, in Changsha Co 60 (⁶⁰Co) radiation 93-11 seed (M₀Generation) 10 public affairs Jin, plants in field, Lingao, Hainan July, point individual plant results M₁For seed, results about 6500 altogether Part seed.

Choose M₁For 3200 strains of seed, each strain 50 individual plants of plantation.2014 In spring, plant in field, Lingao, Hainan.After transplanting, tillering stage, boot stage, heading stage, Florescence, pustulation period etc. through examining field character, examination plant type, fringe type, fertility, All types of mutant individual plant sowings are preserved as special sudden change by all kinds mutants such as yield Body.Each strain receives 6 individual plants, as mutant library resource conservation.

Embodiment 2:M₂Generation plantation and character observation

At M₂Generation heading, duration of flowering, observe the form of flower pesticide in field, choose Flower pesticide white, that the performance such as form is little, pollen amount is little is abnormal of light color is carried out under the microscope into one Step microscopy.The plant that 1 strain fertility is abnormal, this sudden change is found in the family of numbered 1907 Body nourishing and growing, heading stage, fringe type be not all clearly distinguished from wild type, Fig. 1 is that this is dashed forward Variant plant contrasts with plant type (on the left of Fig. 1) and the fringe type (on the right side of Fig. 1) of WT lines Photo, but flower pesticide is less than wild type, and color is pale yellow, and setting percentage is the lowest, is selected as Candidate Mutant Body material carries out next step research.

Embodiment 3: pollen microscopic examination, selfing, outcrossing

Stained with color and not colored pollen ratio by several iodine, add up pollen fertility.Micro-in body formula The little floral shape of Microscopic observation 1907 mutant, discovery gynoecium, is spent without being clearly distinguished from wild type Medicine is less than wild type, color shallower (on the left of Fig. 2).Field gathers little Hua in florescence, uses tweezer Son takes out flower pesticide, at Wagner's reagent (0.6%KI, 0.3%I₂, w/w) in squeeze gently Embossing medicine, drops on microscope slide, covered, examines under a microscope pollen iodine dye situation And take pictures (on the right side of Fig. 2).Wildtype pollens is many and dyes black-and-blue, and mutant is then seen not To pollen grain.

After same family WT lines bagging selfing the most solid, and 1907 mutants are not tied Real.With 93-11 and in spend 11 for mutant pollinate, all can be the most solid, obtain F₁In generation, plants Son.Show that this mutant is malesterile mutants, female unaffected.

To F₁F is obtained for selfing₂For seed, plant F₂For plant 123 strain, flower pesticide iodine is contaminated After examine under a microscope, wherein 94 ZHUHUA powder normal iodine dye, and normal self-fertility, 29 Strain WUHUAFEN, and Natural seed setting rate is low, meets 3:1 and separates, shows that this sterile character is by single Recessive gene controls.

Embodiment 4: blade sampling and DNA extraction

Present study uses CTAB method to extract rice leaf DNA, and concrete grammar is as follows: claim Take about 0.1g blade, put into centrifuge tube, add 600 μ L extract with CTAB buffer, 5 μ L RNase A, concussion dispersion, 65 DEG C of water-bath 0.5hr, therebetween jog 2-3 times；The bodies such as addition The long-pending saturated phenol of chloroform/Tris-(1:1, v/v), mixing, jog 10min；4 DEG C of 10000rpm from Heart 20min；Transfer supernatant, to new pipe, adds the 3M sodium acetate (pH value of 1/10 volume 5.2), the cold isopropanol of 0.6-1 times of volume；Jog mixes, and occurs to flocculent deposit；4℃10000 Rpm is centrifuged 10min；Supernatant discarded, washes precipitation 2 with volumn concentration 70% ethanol Secondary；Air-dry, add 50 μ L 1 × TE dissolution precipitations ,-20 DEG C of preservations.Use Nanodrop2000 Detection DNA concentration, is diluted to 10ng/L and is used as pcr template.

The reaction of embodiment 5:PCR is reclaimed with product

With primer amplification 93-11 wild type and the mutant of candidate gene OsCYP704B2 gene DNA。

For expanding the primer of OsCYP704B2 sequence be see table 1:

Table 1 is for expanding the primer of OsCYP704B2 to sequence

Primer is to title	Forward primer	Reverse primer
			OsCYP704B2_1	CAAAGATTGTCTCAAGGTTGGTAG	GGTATTAGGCAAGGAATTCAGTTG
OsCYP704B2_2	TCGAAGGACAGGACGGTGAC	TTTGAGCAAGAGAGGAAGGATC
			OsCYP704B2_3	GCAAGAACTAACCAAAATTCAGG	GGTCAGACGGAGGTGGAGA

PCR reaction system is: 1 μ L 10 × reaction buffer, 0.25 μ L dNTP, 0.25 μ L Forward primer and 0.25 μ L reverse primer, 0.5U Taq enzyme, 1 μ L 10ng/ μ L template DNA, Add ultra-pure water to mend cumulative volume to 10 μ L.PCR response procedures is: 94-98 DEG C of degeneration 1-3min, Then circulation below performing: 95 DEG C of degeneration 20s, 53-58 DEG C of renaturation 20s, 72 DEG C extend 30s, 30-40 circulation.After loop ends, 72 DEG C are supplemented extension 3-10min, terminate reaction.Configuration 1.5% agarose gel, electrophoresis 30min under 5V/cm electric field；Market DNA is used to coagulate Glue reclaims test kit and reclaims PCR primer.

Embodiment 6:DNA sequence analysis

ABI3730 is used to survey by reclaiming gained wild type PCR primer DNA with mutant Sequence instrument checks order, and sequencing primer uses forward primer and reverse primer respectively.Use common Two-way sequencing result is spliced by DNA sequence analysis software DNAman6.0；1907 dash forward Variant CYP704B2 full length gene nucleotide sequence is as shown in SEQ ID NO.1, by 1928 Individual base composition, by named for this mutant gene of Oryza sativa L. CYP704B2 gene cyp704B2-3.Wild type and mutant sequence are compared discovery, at CYP704B2 base 3 G bases after the 794th base of the genome sequence of cause replace with 1 T base； This mutational site is positioned at the 3rd exon, and sequential analysis of protein comparison shows, this sudden change causes Frameshift mutation, causes and terminates in advance (seeing the sequence pair that Fig. 4-a and Fig. 4-b collectively constitutes Than figure, inverse display position is the mutational site of cyp704B2-3 gene), cause in wild type 339 aminoacid of C end replace with diverse sequence in 1907 mutants "-Tyr-Ala-Val-Thr " (seeing Fig. 5, inverse display position is cyp704B2-3 translation The aminoacid that aminoacid sequence is different from wild type, strigula represents the aminoacid of disappearance).

Embodiment 7: the design of mutational site molecular marker and genotype identification

Sequential design gene specific primer according to the both sides, mutational site obtained in embodiment 6: Forward primer 1907_F, its nucleotide sequence is as shown in SEQ ID NO.2；Reverse primer 1907_R, its nucleotide sequence is as shown in SEQ ID NO.3.

Described in embodiment 5 under PCR reaction condition, with above-mentioned primer to 93-11 and 1907 mutants expand.

Amplified production is separated by electrophoresis in 12% polyacrylamide gel.Polyacrylamide coagulates Gel electrophoresis method is as follows: the preparation of (1) polyacrylamide gel: 12%PA glue 80mL, and 10% Ammonium Persulfate 98.5 250 μ L (winter)/125 μ L (summer), tetramethylethylenediamine (TEMED) 80μL.Shake up rear encapsulating.With detergent glass plate scrub repeatedly, with ethanol clean, Dry.After notch board is coated in fume hood the Repel Silane of 2%, then with ethanol clean, It is dried, another one flat plate is coated the Bingding Silane 1.5mL of 0.5% (at 1.5ml Centrifuge tube adds 7.5 μ L Binding Silane and 7.5 μ L glacial acetic acid, supplies 95% ethanol To 1.5mL).In operating process, prevent two pieces of glass plates from mutually polluting, the most again Carry out glass plate assembling, encapsulating.(2) prerunning: after gelling is solid, takes out comb, washes off Top gel especially notices that seam crossing to be cleaned surely.First under electrophoresis tank, groove (negative electrode) loads The electrode buffer of 1 × TBE, is contained in the gel slab of polymerization in electrophoresis tank, notes in upper groove Enter the electrode buffer of 0.5 × TBE.Firm power 40W-65W, prerunning about 30min. Remove carbamide and the bubble of precipitation in glue surface with suction pipe, insert comb.(3) electrophoresis: amplification is produced Thing adds 5 μ l 5 × Loading Buffer and mixes rear 95 DEG C of degeneration 5 minutes, shift at once To cooled on ice, draw 1.5-3 μ l and add loading hole；Firm power 40W-65W carries out electricity Swimming, arrives to bromophenol blue and terminates bottom electrophoresis tank.Depending on SSR amplified production molecular size range and The degree distinguished of difference banding pattern adjusts electrophoresis time.(4) silver staining colour developing, by one piece of glass of band glue Glass plate is put in the glacial acetic acid fixative of 10%, and 65r/min vibrates about 30min, until diformazan Cyanophenyl is all decoloured；Distilled water flushing 2 times, each 5min；Offset plate after rinsing is put into 65r/min in the dyeing liquor (adding 2g silver nitrate, 3mL 37% formaldehyde in 2L water) of new preparation Shake 30min；Offset plate after dyeing is put into distilled water flushing 5s, takes out immediately and show Shadow；The developer solution that offset plate is quickly transferred to 4 DEG C of pre-coolings (adds 30g hydroxide in 2L water Sodium, 10ml 37% formaldehyde) it is shaken gently for the appearance of band stricture of vagina；Offset plate is placed in the ice second of 10% Acid fixative produces to bubble-free；With distilled water flushing 2 times, each 2min；Room After the lower natural drying of temperature, preservation image of taking pictures.

Result is shown in Fig. 6, the amplified production of 1907 mutants 2bp shorter than wild type 93-11, and 1907 × 93-11 cross combination F₁The amplified production in generation then has sudden change and wild type two band Type is consistent with sequencing result.

Embodiment 8: genotype-mutant phenotype is divided into from checking

F at 1907 × 93-11₂In colony, randomly select planting of wild type and mutation type surface Leaf DNA is extracted in each 10 strains of strain, and method is with embodiment 4.With primer described in embodiment 7 1907_F and 1907_R carries out expanding these DNA and parent 1907 mutant and wild type 93-11DNA, and method carries out polyacrylamide gel electrophoresis as described in example 7 above.

Electrophoresis result is shown in Fig. 7, and phenotype is that the electrophoresis banding pattern of WT lines amplified production is all Wild type 93-11 or heterozygous banding pattern, the electrophoresis banding pattern of mutant amplified production is all with 1907 (cyp704B2-3) banding pattern is identical.This result show mutational site described in embodiment 6 with Recessive nucleus male sterility gene be divided into from.This result combines the sudden change table of this mutant Type, mutational site, and delivered the phenotype description in document, deducibility 1907 mutant Male sterility phenotype be to be caused by the sudden change described in embodiment 6.

Embodiment 9: the hybridization transformation of mutant gene

By the step of Fig. 8, the sterile gene cyp704B2-3 of 1907 can be arrived by hybridization transformation In other rice genetic background:

1. hybridization:

With 1907 for maternal, it is that paternal hybrid obtains F with receptor rice material₁Seed；

2. the first round backcrosses:

F₁After planting obtain F₁Plant, by F₁Plant hybridizes with recurrent parent, it is thus achieved that BC₁ Seed；

③BC₁Sterile gene selects (foreground selection):

Sowing BC₁Seed, it is thus achieved that no less than 500 strain seedling, gather each individual plant leaf at Seedling Stage Sheet, extracts DNA with method described in embodiment 4, with primer pair listed in embodiment 7 (1907_F and 1907_R) carries out expanding and electrophoresis, chooses the individual plant that genotype is heterozygosis and continues Continuous plantation, discards the individual plant of homozygous wildtype；

④BC₁Foreground selection:

Use one group (such as 100, or 200 etc.) between 1907 and recurrent parent Exist polymorphic, and equally distributed molecular marker (can be but not limited on genome The type marks such as SSR, SNP, EST, RFLP, AFLP, RAPD, SCAR), right Step 3. in the individual plant selected identify, choose and (be greater than with recurrent parent similarity height 88% similarity, or select rate etc. in 2%) material；

5. second take turns and backcross: with step 4. in the individual plant selected be male parent, pollinate for recurrent parent, Obtain BC₂Seed；

⑥BC₂Prospect and Foreground selection: the material selected repeated step 3. to step 4. Operation, select with recurrent parent similarity higher than selection standard (if similarity is more than 98%, or Select rate etc. in 2%) BC₂For plant；

7. selfing obtains BC₂F₂Seed: to step 6. in the BC that selects₂Plant carries out selfing, Obtain BC₂F₂Seed；

⑧BC₂F₂Foreground selection: by step 7. in obtain BC₂F₂Planting seed, it is thus achieved that The 500 above seedling of strain, gather blade at Seedling Stage, extract with method described in embodiment 4 DNA, with primer listed in embodiment 7 (1907_F and 1907_R) is carried out amplification and Electrophoresis, selects the individual plant that banding pattern is Mutants homozygous and heterozygous and continues cultivation, abandon open country of isozygotying The individual plant of raw type；

⑨BC₂F₂Foreground selection and application: by step 8. in the individual plant selected according to step 4. Method carry out background screening, select the individual plant that 100% background is isozygotied.If middle menu strain 1907_F/1907_R primer pair amplifies banding pattern is Mutants homozygous, then this individual plant be we Whole target material, can preserve material further with recurrent parent hybridization, or with other rice material Hybridize.If middle menu strain is heterozygosis banding pattern, can be directly used for conserving species matter, or pass through Selfing obtains sterile plant for cross-breeding or the production of hybrid seeds.

Claims (9)

1. an Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3, it is Oryza sativa L. 3 G bases after the 794th base of CYP704B2 gene replace with 1 T base, and this is dashed forward Displacement point is positioned at the 3rd exon；Described Oryza sativa L. CYP704B2 gene mutation body Cyp704B2-3, its nucleotide sequence is as shown in SEQ ID No.1.

2. contain the expression of CYP704B2 gene mutation body cyp704B2-3 described in claim 1 Carrier.

3. contain the host cell of expression vector described in claim 2.

4. the Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 described in claim 1 is in system Application in standby transgenic plant.

5. the Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 described in claim 1 exists Prepare the application in the transgenic paddy rice of Recessive male sterility.

6. the Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 described in claim 1 exists Application in rice modification breeding, the production of hybrid seeds.

7. test right requires the Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 described in 1 Molecular marker, it is characterised in that this molecular marker is to be obtained by following primer pair amplifies, institute The nucleotides sequence stating primer pair is classified as:

Forward primer 1907_F:AGGTCGGGTTTGGGGTT is (such as SEQ ID NO.2 Shown in)

Downstream primer 1907_R:GATGTTGGCAGCGTCGAA is (such as SEQ ID NO.3 Shown in).

8. the molecular marker described in claim 7 is preparing the transgenic of Recessive male sterility Application in Oryza sativa L..

9. Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3 described in claim 1 The method of molecular marker, it is characterised in that by following primer to expanding Plant Genome to be checked DNA, and detect amplified production:

The nucleotides sequence of described primer pair is classified as:

Forward primer 1907_F:AGGTCGGGTTTGGGGTT is (such as SEQ ID NO.2 Shown in)

Downstream primer 1907_R:GATGTTGGCAGCGTCGAA is (such as SEQ ID NO.3 Shown in)；

If with above-mentioned primer to amplifying than the wild type short 2bp's of 93-11 amplified production Fragment, then indicate that this plant to be checked exists Oryza sativa L. CYP704B2 gene mutation body cyp704B2-3。