CN105002191A

CN105002191A - Rive CYP704B2 gene mutant, and molecular identification method and applications thereof

Info

Publication number: CN105002191A
Application number: CN201510385192.7A
Authority: CN
Inventors: 黄培劲; 李新鹏; 李京琳; 安保光; 张维; 龙湍
Original assignee: Hainan Bolian Rice Gene Science & Technology Co Ltd
Current assignee: Hainan Bolian Rice Gene Science & Technology Co Ltd
Priority date: 2015-07-03
Filing date: 2015-07-03
Publication date: 2015-10-28
Anticipated expiration: 2035-07-03
Also published as: CN105002191B

Abstract

The invention provides a rive CYP704B2 gene mutant, and applications thereof, and belongs to the technical field of gene engineering. According to the rive CYP704B2 gene mutant, indica rice 93-11 is subjected to cobalt 60 radiation-induced mutation so as to replace three G bases after the 794th base of rice CYP704B2 gene with one T base; the CYP704B2 gene mutant is named as cyp704B2-3; the nucleotide sequence of the CYP704B2 gene mutant is represented by SEQ ID No.1; it is further confirmed that rice recessive genic male sterility is induced by the CYP704B2 gene mutant; the CYP704B2 gene mutant can be used for culturing transgenic rice with recessive genic male sterility, and possesses great importance in rice genetic resource genetic improvement-breeding. The invention also provides a molecular marked identification method and applications of the rive CYP704B2 gene mutant in breeding.

Description

A kind of paddy rice CYP704B2 gene mutation body and molecular assay method thereof and application

Technical field

The invention belongs to field of plant molecular biology, be specifically related to a kind of paddy rice CYP704B2 gene mutation body cyp704B2-3 and molecular assay method thereof and application.

Background technology

Plants male sterility sudden change is the very general phenomenon of occurring in nature, and at least oneself has found malesterile mutants in 43 sections, 162 617 species belonged to.In heredity, plants male sterility is divided into nuclear male sterility, cytoplasmic male sterility and nucleus tenuigenin make male sterile three major types mutually: 1) nuclear male sterility is suddenlyd change by cell nucleus gene and produces, there are dominant mutation and recessive mutation, have sporophyte transgenation and gametophytic development sudden change.Dominant mutation and gametophytic development sudden change can only by megagamete heredity, and recessive mutation both also carried out heredity by microgamete by megagamete, and followed Mendelism.Some sporophyte Recessive Male sterilities are cloned at present, as the ms2 of Arabidopis thaliana, (the Aarts etc. such as the ms45 of corn and the mil1 of paddy rice, 1997, The Arabidopsis MALE STERILITY 2protein sharessimilarity with reductases in elongation/condensation complexes, PlantJournal, 12:615-623; Albertsen, 2006, Male tissue-preferred regulatorysequences of MS45gene and method of using same, the patent No.: US7154024B2; Hong etc., 2012, Somatic and reproductive celldevelopment in rice anther is regulated by a putative glutaredoxin, PlantCell, 24:577-588); Some gametophyte Recessive Male sterilities are also cloned, as mutant sidecar pollen and the gemini pollen (Oh etc. of two After microspore mitosis exceptions of Arabidopis thaliana, 2010, The SIDECAR POLLEN gene encodes amicrospore-specific LOB/AS2domain protein required for the correcttiming and orientation of asymmetric cell division, Plant Journal, 64:839-50; Park etc., 1998, The Arabidopsis thaliana gametophyticmutation gemini pollen1disrupts microspore polarity, division asymmetryand pollen cell fate, Development, 125:3789-99); Corn is also cloned a sporophyte dominant male sterile gene MS44 (Cigan and Albertsen, 1998, Reversiblenuclear genetic system for male sterility in transgenic plants, US5750868); 2) cytoplasmic male sterility is then controlled by plasmone, not corresponding nuclear restorer gene, belongs to matrocliny; 3) nucleus tenuigenin does male sterile mutually by plasmone and cell nucleus gene co-controlling, its essence is the result that tenuigenin and nucleic genetic material are got along well.Sterile cytoplasm is that some are caused by the chondriogen that suddenlys change, but has corresponding nuclear restorer gene, can suppress sterile cell's plasmagene.Sterile cell's plasmagene can produce a kind of new protein, enough effect string plastochondria normal function (Chen and Liu, 2014, Malesterility and fertility restoration in crops, Annu Rev Plant Biol, 65:5.1-5.28).Educating in Restore gene, Rf-1 has been cloned in current paddy rice, the genes such as Rf-2, Rf-4, Rf-5 (Komori etc., 2004, Map-based cloning of a fertilityrestorer gene, Rf-1, in rice (Oryza sativa L.), Plant Journal, 37:315-325; Itabashi etc., 2011, The fertility restorer gene, Rf2, for Lead Rice-typecytoplasmic male sterility of rice encodes a mitochondrial glycine-richprotein, Plant Journal, 65:359-367; Tang etc., 2014, The rice restorer Rf4for wild-abortive cytoplasmic male sterility encodes a PPR protein thatfunctions in reduction of WA352transcripts, Molecular Plant, 7:1497-500; Hu etc., 2012, The rice pentatricopeptide repeat protein RF5restorers fertility in Hong-Lian Cytoplasmic male-sterile lines via acomplex with the glycine-rich protein GRP162, Plant Cell, 24:109-22).

Paddy rice is the national industry of China, and hybrid rice has played vital role to raising China grain yield.At present, China hybrid rice adds up cultivated area more than 4,500,000,000 mu, and hybrid rice cultivated area has accounted for about 55% of national Monitoring of Paddy Rice Plant Area.Hybrid rice selects two genetic background differences, the rice varieties that simultaneously proterties again can be complementary, by hybridization generation have heterotic first-generation cross-fertilize seed for the production of.Hybrid rice has obvious hybrid vigour phenomenon, is mainly manifested in growth vigorous, well developed root system, big panicle many grains per panicle, the aspects such as strong stress resistance.Hybrid rice reaches 30% than conventional Rice volume increase.The hybrid rice of current China plantation can be divided into Three-line Hybrid rice and two-line hybrid rice.Three-line Hybrid rice (ternary hybrid rice) is exactly produce this hybridisation rice to need three rice strains: paddy rice cytoplasmic nuclear male sterile line, rice cytoplasmic male sterile maintenance line and rice cytoplasmic male sterile restorer.Paddy rice cytoplasmic nuclear male sterile line (being called for short sterile line, code name A) has Yebai, the various kinds of cell matter types such as red lotus type.Rice cytoplasmic male sterile maintenance line (being called for short maintenance line, code name B) is used to a kind of paddy rice of breeding male sterile lines.Its cell nucleus gene type is identical with sterile line, but containing can hatching cell plasmagene, can produce fertile pollen, can self-fertility.Because the nuclear gene of maintenance line is not containing Restore gene, the offspring that therefore it produces to sterile line pollination is also sterile.Rice cytoplasmic male sterile restorer (be called for short restorer, code name R) carries Restore gene, can repair cell matter male infertility, hybridizes the hybrid (i.e. hybridisation rice) produced normally can educate with sterile line.There is the problems such as susceptible, poor quality, breeding efficiency are low in three-line breeding method.Because of the restriction by Rescued virus, the rice pest insects of 95% can not be used for cross-breeding.Two-line hybrid rice utilizes photoperiod-temperature sensitive genie male-sterile line mutant, and it shows male sterile under long day hot conditions, can carry out hybrid seeding, shows male-fertile under short day cold condition, can self propagated.Compared with three series, bilinear method has significant superiority: freely, apolegamy fine combination probability is large for sterile line and restorer combo; Sterile line can one be dual-purpose.But bilinear method sterile line is subject to photo-thermal reaction impact, and breeding is very risky.Such as during the production of hybrid seeds, meet low temperature, sterile line will transfer to can educate, and produces selfed seed, affects the purity of cenospecies; It is then sterile that some two-series hybrids meet high temperature, affects setting percentage, causes the underproduction.Therefore, finding new male sterility breeding method is still important subject on crop breeding.

Utilize induced mutations such as physics radiation, chemical treatment, the methods such as tissue culture, people obtain multiple new sterile mutant on paddy rice.Cyp704B2 mutant is one of them.The flower pesticide of this mutant does not produce mature flower powder.This sterile gene is cloned, for CYP704B2 gene, belong to P450 family, there are 4 exons coding region, encode 544 amino acid whose albumen (Li etc., 2010, Cytochrome P450family memberCYP704B2catalyzes the ω-hydroxylation of fatty acids and is requiredfor anther cutin biosynthesis and pollen exine formation in rice, PlantCell, vol.22:173-190).CYP704B2 gene is formed before and after sporule in reduction division, suede adhesion coating and sporule specific expressed.CYP704B2 albumen participates in fatty acid metabolism, and fatty acid metabolites is cutin and sporopollenin precursor.The deletion mutantion of CYP704B2, make sporopollenin synthesize transhipment and be obstructed, cannot normally form sporule outer wall, the further impaired development of sporule, causes holandry sterile; Mutant flower pesticide surface horny is caused to lack in addition.Cyp704B2 mutant derives from the co-60 radiation mutagenesis mutant of japonica rice variety 9522, is to lack by one section of 3102bp segment the sudden change caused.This deletion fragment comprises the intergenic sequence of anterior 1732bp, the 1112bp upstream of coding region of CYP704B2 gene, and the 258bp sequence of upstream gene coding region 3 '-end.Because this sudden change deletes the partial sequence of upstream gene, therefore may there is potential Non-target traits variation in this mutant, may bring disadvantageous effect for its utilization.

Summary of the invention

The object of this invention is to provide a kind of paddy rice CYP704B2 gene mutation body cyp704B2-3 and molecular assay method thereof and application.

The present invention is first to rice variety 93-11 seed (M ₀generation) carry out co-60 radiation mutagenic treatment, the seed of plantation process obtains M ₁for plant; M ₁producing seed for plant selfing (is M ₂generation), plantation M ₂for plant, to M ₂morphology is carried out, histology and genetics qualification, screening sterile plant for plant; Then gene sequencing and DNA sequence analysis are carried out to sterile plant, verify on a molecular scale.Finally obtain the sterile individual plant that isozygotys, and for cross-breeding and biotechnology research.

Paddy rice CYP704B2 gene mutation body cyp704B2-3 provided by the invention, it is that 3 G bases after paddy rice CYP704B2 gene the 794th base replace with 1 T base, and this mutational site is positioned at the 3rd exon.

Further, paddy rice CYP704B2 gene mutation body cyp704B2-3, its nucleotide sequence is as shown in SEQ ID No.1.

The invention provides the expression vector containing paddy rice CYP704B2 gene mutation body cyp704B2-3 of the present invention.

The invention provides the host cell containing above-mentioned expression vector.

The invention provides the application of paddy rice CYP704B2 gene mutation body cyp704B2-3 in preparation transgenic plant.

The invention provides the application of paddy rice CYP704B2 gene mutation body cyp704B2-3 in the transgenic paddy rice preparing Recessive male sterility.

The invention provides the application of paddy rice CYP704B2 gene mutation body cyp704B2-3 in rice modification breeding, the production of hybrid seeds.

Present invention also offers the molecule marker detecting paddy rice CYP704B2 gene mutation body cyp704B2-3, this molecule marker is obtained by following primer pair amplifies, and the nucleotides sequence of described primer pair is classified as:

Upstream primer 1907_F:AGGTCGGGTTTGGGGTT (as shown in SEQ ID NO.2)

Downstream primer 1907_R:GATGTTGGCAGCGTCGAA (as shown in SEQ ID NO.3).

The invention provides the application of above-mentioned molecule marker in the transgenic paddy rice preparing Recessive male sterility.

The invention provides the application of above-mentioned molecule marker in Rice Germplasm Resources improvement.

A method for the molecule marker of paddy rice CYP704B2 gene mutation body cyp704B2-3, by following primer to amplification plant genome DNA to be checked, and detects amplified production:

The nucleotides sequence of described primer pair is classified as:

Upstream primer 1907_F:AGGTCGGGTTTGGGGTT (as shown in SEQ ID NO.2)

Downstream primer 1907_R:GATGTTGGCAGCGTCGAA (as shown in SEQ ID NO.3);

If the fragment of 2bp slightly shorter in wild-type 93-11 amplified production can be amplified with above-mentioned primer pair, then indicate that this plant to be checked exists paddy rice CYP704B2 gene mutation body cyp704B2-3.

Mutant cyp704B2-3 advantage provided by the invention is as follows:

1) this mutant derives from long-grained nonglutinous rice backbone parent kind 93-11.This kind completes genome sequencing, very favourable to Rice molecular breeding.

2) mutant in document " Li etc.; 2010; Cytochrome P450family member CYP704B2catalyzes the ω-hydroxylation of fatty acids and is required for anthercutin biosynthesis and pollen exine formation in rice; Plant Cell; vol.22:173-190 " is large fragment deletion, not only CYP704B2 genetically deficient, and 258 base pairs of upstream gene 3 '-end are also deleted, therefore with potential additive effect.And sudden change of the present invention occurs in 3 G bases in the 3rd exon of a CYP704B2 gene replaces with 1 T base, make this gene generation phase shift mutation, premature transcription termination, the C of CYP704B2 albumen is caused to hold 339 aminoacid deletion, replace with other 4 amino acid, performance holandry is sterile, there is not the additive effect problem that this is potential.

3) because radioinduction causes mutational site 2 base pairs fewer than wild-type, adopt the conventional polyacrylamide gel electrophoresis in laboratory just can carry out Molecular Detection, do not need special detection technique and method.

Accompanying drawing explanation

Fig. 1 is plant type and the fringe type photo of 1907 mutant and wild-type in embodiment 2.

Fig. 2 is flower pesticide Stereo microscope photo and the microphotograph of 1907 mutant in embodiment 3.

Fig. 3 is mutational site and the protein translation termination site schematic diagram of 1907 mutant CYP704B2 genes in embodiment 6.

Fig. 4-a and Fig. 4-b forms the comparison chart of wild-type 93-11 and 1907 mutant CYP704B2 gene DNA sequences in embodiment 6.

Fig. 5 is the comparison chart of wild-type 93-11 and 1907 mutant CYP704B2 gene protein sequences in embodiment 6.

Fig. 6 is the electrophoresis result of wild-type 93-11 in embodiment 7,1907 mutant and both cross-fertilize seed CYP704B2 gene amplification fragment.

Fig. 7 is that in embodiment 8,1907 × 93-11 combines F ₂the electrophoresis photographs of the PCR primer of fertile plant and sterile strain CYP704B2 gene mutation site in colony.

Fig. 8 is the Technology Roadmap of the hybridization transformation of embodiment 9.

Embodiment

Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.Without departing from the spirit and substance of the case in the present invention, the amendment do the inventive method, step or condition or replacement, all belong to scope of the present invention.

If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.

Embodiment 1: co-60 radiation mutagenesis mutant library

Select long-grained nonglutinous rice backbone parent kind 93-11 as the material of radiotreatment, this kind completes genome sequencing, very favourable to Rice molecular breeding.

Summer in 2013, in Changsha Co 60 ( ⁶⁰co) radiation 93-11 seed (M ₀generation) 10 kilograms, plant July in field, Lingao, Hainan, point individual plant results M ₁for seed, results about 6500 parts of seeds altogether.

Choose M ₁for seed 3200 strains, each strain plants 50 individual plants.Spring in 2014, plant in field, Lingao, Hainan.After transplanting, in tillering phase, boot stage, heading stage, flowering period, filling stage etc. through examining field proterties, all kinds mutant such as examination plant type, fringe type, fertility, output, all types of mutant individual plant sowing is preserved as special mutant.Each strain receives 6 individual plants, as mutant library resource conservation.

Embodiment 2:M ₂generation plantation and character observation

At M ₂generation heading, duration of flowering, observe the form of flower pesticide in field, and shallow white, that the performance such as form is little, pollen amount is little the is abnormal flower pesticide that gets colors carries out further microscopy under the microscope.The plant of 1 strain fertility exception is found in the family being numbered 1907, this mutant nourishing and growing, heading stage, fringe type all obviously do not distinguish with wild-type, Fig. 1 is that the plant type (on the left of Fig. 1) of this mutant plants and WT lines and fringe type (on the right side of Fig. 1) contrast photo, but flower pesticide is less than wild-type, color is pale yellow, setting percentage is very low, is selected as candidate mutant material and carries out next step research.

Embodiment 3: pollen microscopic examination, selfing, outcrossing

Look and not painted pollen ratio is stained with, statistics pollen fertility by several iodine.Under Stereo microscope, observe the little floral shape of 1907 mutant, find that gynoecium and wild-type are without obvious difference, flower pesticide is less than wild-type, color more shallow (on the left of Fig. 2).Field gathers little Hua in flowering period, takes out flower pesticide, at Wagner's reagent (0.6%KI, 0.3%I with tweezers ₂, w/w) in extrude flower pesticide gently, drop on slide glass, covered, examine under a microscope pollen iodine dye situation take pictures (on the right side of Fig. 2).Wildtype pollens is many and dye black-and-blue, and mutant then can't see pollen granule.

Normally solid after the selfing of same family WT lines bagging, and 1907 mutant are shaky.With 93-11 and in spend 11 for mutant pollination, all can be normally solid, obtain F ₁for seed.Show that this mutant is malesterile mutants, female unaffected.

To F ₁f is obtained for selfing ₂for seed, plantation F ₂for plant 123 strain, examine under a microscope after flower pesticide iodine is contaminated, wherein the normal iodine dye of 94 strain pollen, and normal self-fertility, 29 strain WUHUAFEN, and Natural seed setting rate is low, meets 3:1 and is separated, show that this sterile proterties is controlled by single recessive gene.

Embodiment 4: blade sampling and DNA extraction

This research adopts CTAB method to extract rice leaf DNA, and concrete grammar is as follows: take about 0.1g blade, put into centrifuge tube, adds 600 μ L CTAB Extraction buffers, 5 μ LRNase A, concussion dispersion, 65 DEG C of water-bath 0.5hr, therebetween jog 2-3 time; Add the saturated phenol (1:1, v/v) of equal-volume chloroform/Tris-, mixing, jog 10min; 4 DEG C of centrifugal 20min of 10000rpm; Transfer supernatant, to new pipe, adds the 3M sodium acetate (pH value 5.2) of 1/10 volume, the cold isopropanol of 0.6-1 times volume; Jog mixes, and occurs to flocks; 4 DEG C of centrifugal 10min of 10000rpm; Supernatant discarded, washes precipitation 2 times with volumn concentration 70% ethanol; Air-dry, add 50 μ L 1 × TE dissolution precipitations ,-20 DEG C of preservations.Detect DNA concentration with Nanodrop2000, be diluted to 10ng/L and be used as pcr template.

Embodiment 5:PCR reaction is reclaimed with product

With primer amplification 93-11 wild-type and the mutant DNA of candidate gene OsCYP704B2 gene.

Primer pair sequence for the OsCYP704B2 that increases sees the following form 1:

Table 1 is for the primer pair sequence of the OsCYP704B2 that increases

Primer pair title	Forward primer	Reverse primer
			OsCYP704B2_1	CAAAGATTGTCTCAAGGTTGGTAG	GGTATTAGGCAAGGAATTCAGTTG
OsCYP704B2_2	TCGAAGGACAGGACGGTGAC	TTTGAGCAAGAGAGGAAGGATC
			OsCYP704B2_3	GCAAGAACTAACCAAAATTCAGG	GGTCAGACGGAGGTGGAGA

PCR reaction system is: 1 μ L 10 × reaction buffer, 0.25 μ L dNTP, 0.25 μ L forward primer and 0.25 μ L reverse primer, 0.5U Taq enzyme, 1 μ L 10ng/ μ L template DNA, adds ultrapure water and mends cumulative volume to 10 μ L.PCR response procedures is: 94-98 DEG C of sex change 1-3min, then performs following circulation: 95 DEG C of sex change 20s, 53-58 DEG C of renaturation 20s, and 72 DEG C extend 30s, 30-40 circulation.After loop ends, 72 DEG C are supplemented extension 3-10min, terminate reaction.Configure 1.5% sepharose, electrophoresis 30min under 5V/cm electric field; Adopt market DNA gel to reclaim test kit and reclaim PCR primer.

Embodiment 6:DNA sequential analysis

Adopt ABI3730 sequenator to check order the PCR primer DNA reclaiming gained wild-type and mutant, sequencing primer uses forward primer and reverse primer respectively.Common dna sequence analysis software DNAman6.0 is used to splice two-way sequencing result; 1907 mutant CYP704B2 full length gene nucleotide sequences as shown in SEQ ID NO.1, by 1928 based compositions, by this mutant gene called after cyp704B2-3 of paddy rice CYP704B2 gene.To compare discovery to wild-type and mutant sequence, 3 G bases after genome sequence the 794th base of CYP704B2 gene replace with 1 T base; This mutational site is positioned at the 3rd exon, sequential analysis of protein comparison shows, this sudden change causes phase shift mutation, cause premature termination (see the alignment figure that Fig. 4-a and Fig. 4-b forms jointly, inverse display position is the mutational site of cyp704B2-3 gene), C in wild-type is caused to hold 339 amino acid in 1907 mutant, to replace with diverse sequence "-Tyr-Ala-Val-Thr " (see Fig. 5, inverse display position is the aminoacid sequence amino acid different from wild-type of cyp704B2-3 translation, and strigula represents the amino acid of disappearance).

Embodiment 7: the design of mutational site molecule marker and genotype identification

Sequences Design gene specific primer according to the both sides, mutational site obtained in embodiment 6: forward primer 1907_F, its nucleotide sequence is as shown in SEQ ID NO.2; Reverse primer 1907_R, its nucleotide sequence is as shown in SEQ ID NO.3.

Under PCR reaction conditions described in embodiment 5, with above-mentioned primer pair, 93-11 and 1907 mutant are increased.

Amplified production carries out electrophoretic separation on 12% polyacrylamide gel.Polyacrylamide gel electrophoresis method is as follows: the preparation of (1) polyacrylamide gel: 12%PA glue 80mL, 10% Ammonium Persulfate 98.5 250 μ L (winter)/125 μ L (summer), Tetramethyl Ethylene Diamine (TEMED) 80 μ L.Shake up rear encapsulating.With washing composition sheet glass scrub repeatedly, clean with alcohol, dry.After notch board being coated the Repel Silane of 2% in stink cupboard, again with alcohol clean, dry, another one flat plate is coated the Bingding Silane 1.5mL (add 7.5 μ L Binding Silane and 7.5 μ L Glacial acetic acid in 1.5ml centrifuge tube, supply 95% ethanol to 1.5mL) of 0.5%.In operating process, prevent two pieces of sheet glass from mutually polluting, after finish-drying, carry out sheet glass assembling, encapsulating again.(2) prerunning: after gelling is solid, takes out comb, washes top gel off and especially notice that seam crossing will be cleaned surely.First under electrophoresis chamber, groove (negative electrode) loads the electrode buffer of 1 × TBE, is contained in electrophoresis chamber by the gel slab of polymerization, injects the electrode buffer of 0.5 × TBE in upper groove.Firm power 40W-65W, prerunning is about 30min.Remove urea and bubble that glue face is precipitated with suction pipe, insert comb.(3) electrophoresis: add 5 μ l 5 × Loading Buffer in amplified production and mix rear 95 DEG C of sex change 5 minutes, transfer to cooled on ice at once, draws 1.5-3 μ l and adds loading hole; Firm power 40W-65W carries out electrophoresis, arrives bottom electrophoresis chamber terminate to tetrabromophenol sulfonphthalein.The degree distinguished depending on SSR amplified production molecular size range and difference banding pattern adjusts electrophoresis time.(4) silver dye colour developing, one piece of sheet glass of band glue is put into the glacial acetic acid stationary liquid of 10%, 65r/min vibrates about 30min, until diformazan cyanophenyl is all decoloured; Distilled water flushing 2 times, each 5min; Staining fluid (2L water adds 2g Silver Nitrate, the 3mL 37% formaldehyde) 65r/min that offset plate after flushing is put into new preparation shakes 30min; Offset plate after dyeing is put into distilled water flushing 5s, takes out immediately and develop; The developing solution (adding 30g sodium hydroxide in 2L water, 10ml 37% formaldehyde) offset plate being quickly transferred to 4 DEG C of precoolings shakes to the appearance of band line gently; Offset plate is placed in the glacial acetic acid stationary liquid of 10% to bubble-free produces; With distilled water flushing 2 times, each 2min; Under room temperature after seasoning, preservation image of taking pictures.

The results are shown in Figure 6, the amplified production 2bp shorter in wild-type 93-11 of 1907 mutant, and 1907 × 93-11 cross combination F ₁the amplified production in generation then has sudden change and wild-type two strip-type, consistent with sequencing result.

Embodiment 8: genotype-mutant phenotype is separate authentication altogether

At the F of 1907 × 93-11 ₂in colony, leaf DNA is extracted in each 10 strains of plant of random selecting wild-type and mutation type surface, and method is with embodiment 4.To carry out increasing these DNA and parent 1907 mutant and wild-type 93-11DNA with primer 1907_F and 1907_R described in embodiment 7, and method carries out polyacrylamide gel electrophoresis as described in example 7 above.

Electrophoresis result is shown in Fig. 7, and phenotype is the electrophoresis banding pattern of WT lines amplified production is all wild-type 93-11 or heterozygous banding pattern, and the electrophoresis banding pattern of mutant amplified production is all identical with 1907 (cyp704B2-3) banding pattern.This result show mutational site described in embodiment 6 and recessive nucleus male sterility gene be divided into from.This result is in conjunction with the mutant phenotype of this mutant, mutational site, and the phenotype delivered in document describes, and the male sterile phenotype of deducibility 1907 mutant is caused by the sudden change described in embodiment 6.

Embodiment 9: the hybridization transformation of mutator gene

By the step of Fig. 8, the sterile gene cyp704B2-3 of 1907 can be passed through hybridization transformation in other rice genetic background:

1. hybridize:

Being maternal with 1907, is that paternal hybrid obtains F with acceptor rice material ₁seed;

2. the first round backcrosses:

F ₁after planting obtain F ₁plant, by F ₁plant and recurrent parent are hybridized, and obtain BC ₁seed;

3. BC ₁sterile gene selects (foreground selection):

Sowing BC ₁seed, acquisition is no less than 500 strain seedling, each single-strain blade is gathered at Seedling Stage, DNA is extracted with method described in embodiment 4, carry out increasing and electrophoresis with primer pair (1907_F and 1907_R) listed in embodiment 7, choose the individual plant continuation plantation that genotype is heterozygosis, discard the individual plant of homozygous wildtype;

4. BC ₁foreground selection:

Adopt one group (such as 100, or 200 etc.) exist between 1907 and recurrent parent polymorphic, and on genome equally distributed molecule marker (can be but be not limited to the type marks such as SSR, SNP, EST, RFLP, AFLP, RAPD, SCAR), to step 3. in the individual plant selected identify, choose the material of high with recurrent parent similarity (be such as greater than 88% similarity, or select rate etc. in 2%);

5. second take turns and backcross: with step 4. in the individual plant selected be male parent, be recurrent parent pollination, obtain BC ₂seed;

6. BC ₂prospect and Foreground selection: to the material repeating step selected 3. to step operation 4., select and the BC of recurrent parent similarity higher than choice criteria (as similarity is greater than 98%, or selecting rate etc. in 2%) ₂for plant;

7. selfing obtains BC ₂f ₂seed: to step 6. in the BC that selects ₂plant carries out selfing, obtains BC ₂f ₂seed;

8. BC ₂f ₂foreground selection: by step 7. in obtain BC ₂f ₂planting seed, obtain the above seedling of 500 strain, blade is gathered at Seedling Stage, DNA is extracted with method described in embodiment 4, carry out increasing and electrophoresis with primer pair (1907_F and 1907_R) listed in embodiment 7, select the individual plant continuation cultivation that banding pattern is Mutants homozygous and heterozygous, abandon the individual plant of homozygous wildtype;

9. BC ₂f ₂foreground selection and application: by step 8. in the individual plant selected carry out background screening according to step method 4., select the individual plant that 100% background is isozygotied.If the 1907_F/1907_R primer pair amplifies banding pattern of middle menu strain is Mutants homozygous, then this individual plant is our ultimate aim material, can hybridize further and preserve material, or hybridize with other rice material with recurrent parent.If middle menu strain is heterozygosis banding pattern, conserving species matter can be directly used in, or obtain sterile strain for cross-breeding or the production of hybrid seeds by selfing.

Claims

1. a paddy rice CYP704B2 gene mutation body cyp704B2-3, it is that 3 G bases after paddy rice CYP704B2 gene the 794th base replace with 1 T base, and this mutational site is positioned at the 3rd exon.

2. paddy rice CYP704B2 gene mutation body cyp704B2-3 as claimed in claim 1, its nucleotide sequence is as shown in SEQ ID No.1.

3. the expression vector containing CYP704B2 gene mutation body cyp704B2-3 described in claim 1 or 2.

4. the host cell containing expression vector described in claim 3.

5. the application of the paddy rice CYP704B2 gene mutation body cyp704B2-3 described in claim 1 or 2 in preparation transgenic plant.

6. the application of paddy rice CYP704B2 gene mutation body cyp704B2-3 in the transgenic paddy rice preparing Recessive male sterility described in claim 1 or 2.

7. the application of paddy rice CYP704B2 gene mutation body cyp704B2-3 in rice modification breeding, the production of hybrid seeds described in claim 1 or 2.

8. test right requires the molecule marker of the paddy rice CYP704B2 gene mutation body cyp704B2-3 described in 1 or 2, and it is characterized in that, this molecule marker is obtained by following primer pair amplifies, and the nucleotides sequence of described primer pair is classified as:

Upstream primer 1907_F:AGGTCGGGTTTGGGGTT (as shown in SEQ ID NO.2)

Downstream primer 1907_R:GATGTTGGCAGCGTCGAA (as shown in SEQ ID NO.3).

9. the application of molecule marker according to claim 8 in the transgenic paddy rice preparing Recessive male sterility.

10. the method for the molecule marker of the paddy rice CYP704B2 gene mutation body cyp704B2-3 described in claim 1 or 2, is characterized in that, by following primer to amplification plant genome DNA to be checked, and detects amplified production:

The nucleotides sequence of described primer pair is classified as:

Upstream primer 1907_F:AGGTCGGGTTTGGGGTT (as shown in SEQ ID NO.2)

Downstream primer 1907_R:GATGTTGGCAGCGTCGAA (as shown in SEQ ID NO.3);

If the fragment of 2bp shorter in wild-type 93-11 amplified production can be amplified with above-mentioned primer pair, then indicate that this plant to be checked exists paddy rice CYP704B2 gene mutation body cyp704B2-3.