KR100885075B1 - A Method for producing a hybrid seed using plant of novel Cytoplasmic?Genic Male Sterility Raphanus sativus line and DNA markers for selecting the plant of said Raphanus sativus line - Google Patents

Abstract

The present invention relates to a novel cytoplasmic-genic male sterility (CGMS) -free Raphanus. sativus L.) A method for producing a hybrid seed using a lineage plant and a DNA labeling factor for selecting a lineage-free plant, specifically a novel CGMS (D-CGMS) lineage plant, a method for producing a hybrid seed using the same, sequence Chloroplast DNA labeling factors for D-CGMS lineage-free plant selection having the nucleotide sequence set forth in No. 5 and mitochondrial DNA-based Single Nucleotide Polymorphism (SNP) for the selection of D-CGMS lineage-free plant located at base 171 of SEQ ID NO: 12 Regarding the labeling factor, the D-CGMS lineage plant of the present invention has a high male infertility stability and can be very useful for producing hybrid seeds, the chloroplast DNA labeling factors for selecting D-CGMS lineage plant of the present invention and Mitochondrial DNA-based SNP markers may be useful for selecting D-CGMS lineage plants during the breeding process.

Cytoplasmic-genic male infertility, CGMS, no, SNP, marker

Description

A method for producing a hybrid seed using plant of novel Cytoplasmic--Genic Male Sterility Raphanus sativus line with novel cytoplasmic-genetic male infertility (CMWS) lineage-free plants and DNA markers for selecting the plant of said Raphanus sativus line}

The present invention provides a novel cytoplasmic-genic male sterility (CGMS) free ( Raphanus ) sativus L.) A method for producing hybrid seeds using a lineage plant and a DNA labeling factor for selecting a lineage-free plant, and more particularly, a novel CGMS (D-CGMS) lineage line, a method for producing a hybrid seed using the same. , Chloroplast DNA labeling factors for selection of D-CGMS lineage-free plants having the nucleotide sequence of SEQ ID NO: 5 and mitochondrial DNA-based SNPs for selecting D-CGMS lineage-free plants located at the 171th sequence of SEQ ID NO: 12 ) Is related to labeling factors.

Upbringing of one hybrid variety using hybrid accents in plants has been ongoing for a long time, and most of the commercially available vegetable seeds are F ₁ hybrid seeds. F ₁ hybrid seed cultivation methods include artificial mating, self-incompatibility, hermaphrodite, male infertility, and cross-breeding but are difficult in terms of time, effort, uniformity and economy except for the use of male infertility. There are many studies on developing and using male fertility resources in many crops.

Raphanus In sativus L.), hybridization of F1 hybrids using self-incompatibility is common. However, the use of self-incompatibility has limitations in reducing the offspring. This is because some of the progeny are mixed out by the aging moisture even though the self-incompatibility is well fixed. Mixed breeding of F ₁ hybrids reduces seed purity and, in severe cases, compensatory claims from consumers, which can lead to seed disputes.

Male infertility refers to a phenomenon in which infertility occurs due to abnormalities in male organs such as pollen, anther, and stamen. It occurs mainly artificially or naturally by natural mutation, interdependent hybrid or mutant organic agent treatment. Male infertility is caused by genetic causes and environmental causes. Most male infertility systems used for breeding are male infertility due to genetic causes. Male infertility caused by these genetic causes can be divided into three types: genetic male sterility (GMS), cytoplasmic male sterility (CMS) and cytoplasmic-male sterility (Cytoplasmic- sterility) Genic Male Sterility (CGMS). Both CMS and CGMS are due to mitochondrial abnormalities in the cytoplasm, which also divide CMS and CGMS according to the presence of a fertility recovery gene (Rundfeldt, J., Z. Pflanzenzuchtung , 1960, 44: 30-62; Shivanna, KR and BM Johri., Pollen sterility , in the angiosperm pollen , structure and function . 1985. Wiley Eastern Ltd. New Delhi).

Genetic male sterility (GMS) is primarily recessive and infertile in the case of a homozygous recessive, so when producing F ₁ hybrid seeds using only 50% infertile Can be obtained. Therefore, in order to maintain and multiply male sterility, a lot of effort and cost are generated because it is necessary to check the existence of pollen by flowering each individual. Cytoplasmic Male Sterility (CMS) and Cytoplasmic-Genic Male Sterility (CGMS), on the other hand, cause abnormalities in the mitochondria in the cytoplasm, resulting in abnormal pollen, and thus losing maternal fertility. It is characterized by heredity.

In the case of CMS, since there is no pregnancy recovery gene, 100% infertility is produced even when crossing any fertility system, so it is easy to maintain male infertility, but in plants using seed assets such as rapeseed, there is no male infertility recovery mechanism. It cannot be used commercially because it does not form seeds and can only be used for leafy vegetables and root vegetables. On the other hand, CGMS produces 100% male infertility when mating male fertility, which does not have a gene that restores male infertility, and 100% male fertility when mating with a fertility that has a homozygous form of recovery gene. Therefore, the maintenance and proliferation of CGMS in the production of F ₁ seed of leafy vegetables and root vegetables is achieved by crossing with lines that do not have a recovery gene. In addition, in the production of F ₁ hybrid seeds of plants using seed assets such as rapeseeds, CGMS male sterility is introduced through protoplast fusion or cross-hybridization, and plants using recovery genes are used to produce F ₁ hybrid seeds. . F ₁ hybrid seed production of plants using such seed assets is possible only in the CGMS strain having a male sterility recovery mechanism, but not in a CMS strain without a male sterile recovery mechanism.

Among the male sterile strains of radish known to date, NWB-CMS ( Raphanus) sativus var NWB), Ogura-CGMS ( Raphanus sativus var Ogura) and Raphanus sativus cv Kosena (CGMS). Among them, NWB-CMS is known to cause male infertility by a pure cytoplasmic factor whose genetic source of restoring male infertility is unknown (Korean Patent Registration No. 0399333, Nahm et . Al ., Theor . Appl. . Genet 111:. 1191-1200, 2005 ). On the other hand, Ogura-CGMS and Corsena-CGMS are known as Cytoplasmic-Genic Male sterility, in which male infertility is not affected by complete cytoplasmic factors but male infertility is also affected by intranuclear factors.

Ogura-CGMS and Corsena-CGMS are known to cause male infertility with new ORF production in mitochondria in the cytoplasm. They are also known to have a recovery gene that restores male sterility in the nucleus (Desloire S. et. al ., EMBO report 4: 588-594, 2003). In particular, Ogura-CGMS and Corsena-CGMS have been reported to have almost similar characteristics of male infertility organic genes and recovery genes, and male infertility recovery mechanisms have also been reported to be similar (Koizuka, et . Al ., Theor ... Appl Genet 100: 949-955 , 2000; Koizuka et . al ., Plant J. 34: 407-415, 2003; Koizuka N, et . al ., Plant J. 34: 407-415, 2003; Koizuka N, et . al ., Theor. Appl . Genet . 100: 949-955, 2000). Ogura -CGMS has been widely used in non-F ₁ hybrid seed production because of the relatively stable male sterile entry rate, due to the presence of the male sterility mechanism restored by introducing a male sterility in Ogura -CGMS a plant using a seed product, such as rapeseed, etc. The method of producing F ₁ hybrid seeds is widely used. Ogura-CGMS is the most widely used male infertility resource because of these advantages, but it is difficult to secure a variety of maintenance systems because the maintenance system is rare. Thus, while the male sterility restoration genes exist maintaining systems ensure easy and requires male sterility introduction rate of development of the fertility resource is highly male, and these resources will not only be able to be effectively used in the production of non-F ₁ hybrid seeds such as rapeseed It can be used as a resource to introduce male infertility into plants using seed assets.

In conventional breeding, morphological markers have been used to select the lineage of the desired trait, but this method is disadvantageous because the method is very limited in terms of number and environmental factors. Therefore, recently, studies on molecular breeding for breeding using DNA markers associated with the target trait have been actively conducted. The use of such DNA markers is very useful in breeding by enabling selection, early environmental impact, and quantitative trait analysis in early breeding generation. Indeed, the development of such DNA markers in many crops is being actively carried out, increasing the selection efficiency as a new breeding technique. Most male infertility DNA markers are molecular markers based on mitochondrial DNA with relatively high genetic variation. Mitochondria, however, have many forms of subgenomics, even if the genes have the same sequence by frequent genome recombination and rearrangement using short repeat sequences. has a complicated structure present in DNA (M. Bellaoui, et al, Mol Gen Genet 257:....... 177-185, 1998; M. Arrieta-Montiel et al, Genetics, 158 (2), 851-864, 2001). In addition, the mitochondrial genome is mixed with a variety of gene structures showing a quantitative difference, it is necessary to test whether the male infertility and fertility is different due to the quantitative difference of the genome when developing DNA markers.

However, chloroplast DNA is known to have low genetic variation and stable inheritance, and there is no quantitative difference in specific gene structure. Therefore, the development of molecular markers for male infertility based on chloroplast DNA can enable more stable and accurate male infertility determination (MJ Havey, et . Al ., Appl . Genet . 90: 263-268, 1995; T. Motegi, et . al ., Euphytica 129: 319-323, 2003).

The usefulness of molecular markers in plant breeding has already been verified, but the development of molecular markers that can verify samples more economically and rapidly than conventional molecular markers has been continuously studied. With the development of molecular marker technology, various types of molecular markers such as Restriction Fragment Length Polymorphism (RFLP), Random Amplified Polymorphic DNA (RAPD) and Amplified Fragment Length Polymorphism (AFLP) have been developed, but these molecular markers are relatively expensive and in large quantities. There are many limitations in analyzing a sample. Therefore, the development of simpler sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers that can be more economically and mass-analyzed has been actively performed. In particular, in the case of SNP markers, the development of fluorescence technology and capillary electrophoresis can be used for efficient breeding because it can automate sample detection and analyze in large quantities. .

Accordingly, the present inventors collected resources to develop new male infertility resources, and then selected CGMS (D-CGMS) lineage plants having a male infertility mechanism different from the conventionally known NWB-CMS and CGMS (Ogura and Kosena). The characteristics of the D-CGMS male sterility introduction rate was higher than that of the existing Ogura-CGMS and confirmed that it was easy to secure the system, and furthermore, stable chloroplast DNA for the selection of the D-CGMS plant-free plant. The present invention has been completed by developing a DNA molecule marker based on DNA and a single nucleotide polymorphism (SNP) molecular marker based on mitochondrial DNA.

An object of the present invention is a novel cytoplasmic-gene male male infertility (CGMS) radish ( Raphanus ) sativus L.) plant, a method of producing a hybrid seed using the same, and to provide a DNA marker for selecting the lineage-free plant.

In order to achieve the above object, the present invention comprises a nucleotide sequence of SEQ ID NO: 5, D-CGMS specific SNP (Single Nucleotide Polymorphism) by the base located in the 171th base sequence of SEQ ID NO: 12 Novel Cytoplasmic-Genic Male Sterility (CGMS) D-CGMS Radical ( Raphanus sativus L.) lineage plants are provided.

In addition, the present invention provides a callus of the D-CGMS line system indicated by accession number KCTC11101BP.

In addition, the present invention provides a method for producing a CGMS lineage hybrid seed having cytoplasmic-genetic male infertility, comprising the step of mating the male D-CGMS lineage-free plants as male cross fertility plants to introduce male infertility to provide.

The present invention also provides a DNA labeling factor for selecting a D-CGMS lineage-free plant having a nucleotide sequence hybridized under stringent conditions with a nucleotide sequence set forth in SEQ ID NO: 5 or a DNA comprising a nucleotide sequence set forth in SEQ ID NO: 5 above. do.

In addition, the present invention is selected from the nucleotide sequence set forth in SEQ ID NO: 12, D- having an oligonucleotide consisting of 15 to 225 contiguous nucleotide sequences comprising the 171th base of the nucleotide sequence or a nucleotide sequence complementary thereto CGMS SNP markers for lineage-free plant selection are provided.

In addition, the present invention provides a selection kit of a D-CGMS lineage-free plant comprising a primer pair or probe capable of detecting the nucleotide sequence of the DNA labeling factor or the oligonucleotide of the SNP labeling factor.

Since the D-CGMS lineage plant of the present invention has a high cytoplasmic-genetic male sterility introduction rate into the F ₁ plant, D-CGMS can be very useful for producing hybrid seeds of the CGMS lineage. DNA markers specific for the D-CGMS lineage can be easily and quickly selected for D-CGMS lineage plants by amplification using primers set forth in SEQ ID NO: 3 and SEQ ID NO: 4. In addition, the primers described in SEQ ID NO: 15 and SEQ ID NO: 16 were used to identify D-CGMS specific SNPs (Single Nucleotide Polymorphism) located at the 171th base sequence of SEQ ID NO: 12 to select D-CGMS plant-free plants. Can be. In addition, the primers may be usefully used in the selection kit of D-CGMS lineage-free plants.

In the present invention, "D-CGMS ( Raphanus sativus var D-CGMS) strain-free "means a strain-free strain having a new genotype CGMS different from the conventional CGMS as a strain-free strain isolated and identified in the present invention.

Also in the present invention "plant" includes plant organs, plant tissues, real cells, seeds and callus.

Hereinafter, the present invention will be described in detail.

The present invention comprises a novel cytoplasmic-gene comprising a nucleotide sequence set forth in SEQ ID NO: 5 and having a D-CGMS specific Single Nucleotide Polymorphism (SNP) by a base located at 171 th of the nucleotide sequence set forth in SEQ ID NO: 12. Cytoplasmic-Genic Male Sterility (CGMS) Provides D-CGMS radish ( Raphanus sativus L.) lineage plants.

In order to improve the productivity of F ₁ hybrid seeds, the inventors of the present inventors have received a seedless system that has been distributed by the RDA Horticultural Research Institute (20 species collected from Uzbekistan, etc.) in order to develop a new strain having no cytoplasmic-genetic male infertility. We investigated the extent of fire tissue and pollen development. As a result, male infertility, which was inhibited in pollen development in one strain, was found to be "D-CGMS ( Raphanus sativus var D-CGMS). The newly discovered CGMS (D-CGMS) line is less pollen than normal fertility, and is mainly used for conventional hybrid seed production. Unlike CGMS, small amounts of infertile pollen are produced (see FIG. 1).

In addition, as a result of investigating the shape and vitality of D-CGMS pollen through electron microscopy (SEM) and fluorescein diacetate (FDA) staining, the pollen of D-CGMS is produced in small amount, and the shape is extremely abnormal and vitality It was found that none (see Figure 2). This phenotype is different from the previously reported Ogura-CGMS, and in insect-mediated population crosses, firearms are similar to normal individuals, which may increase efficiency in attracting insects.

Furthermore, the present inventors conducted histological observations to investigate more precise male infertility mechanisms. As a result, pollen development normally occurs in normal fertile individuals, whereas Tetrad development of pollen formation occurs in Ogura-CGMS-free lines. In the D-CGMS plant, the abnormal development occurs in the tetrad development stage, but the abnormal development occurs in the vesicular development stage. As a result, the pollen develops abnormally infertility. 3).

In addition, when the pollen of D-CGMS-free pollen was used as a model of normal fertility individuals, it showed that the male infertility system with no vitality of the pollen was confirmed by showing a phenotype with no seed at all. However, seed is normally produced when crossed with other pollen, using the D-CGMS-free line as a model (see Table 1). This is a result of clearly confirming that there is no abnormality in the magnetic organs, only male sterility due to abnormal development of pollen. Therefore, D-CGMS of the present invention can be efficiently used for F ₁ seeding in hybrid seed breeding and hybrid stress breeding because the use of D-CGMS as a breeding model eliminates the need to remove pollen from artificial breeding. .

The D-CGMS-free system differs significantly from the existing Ogura-CGMS in male infertility mechanisms, and has no male infertility due to abnormal development of pollen without abnormalities in magnetic organs, and the shape of firearms is similar to that of normal fertile individuals, Because of its lack of vitality, F ₁ hybrid seed production can be useful for attracting insects in insect-mediated population crosses.

In addition, the present invention provides a callus of the D-CGMS line system indicated by accession number KCTC11101BP.

In addition, the present invention provides a method for producing a CGMS lineage hybrid seed having cytoplasmic-genetic male infertility, comprising the step of mating the male D-CGMS lineage-free plants as male cross fertility plants to introduce male infertility to provide.

F ₁ seed incorporating cytoplasmic-gene male infertility was produced by crossing with male fertility plants intended to introduce cytoplasmic-genic male infertility of the D-CGMS-free lineage of the present invention. In addition, in order to compare the cytoplasmic-genetic male infertility ability of the D-CGMS lineage with the Ogura-CGMS lineage, the same male fertility plants were mated using D-CGMS and Ogura-CGMS as models. As a result, male sterility introduction rate was much higher than that of conventional Ogura-CGMS, and it was confirmed that maintenance-friendly growth of D-CGMS-free system was easier. In particular, 100% male sterile strains of F ₁ hybrid seeds produced from crosses of strains with Ogura-CGMS-free recovery genes and D-CGMS-free strains appeared. It means that it is completely different from a system. As a result, the method of producing F ₁ seed using cytoplasmic-genetic male infertility without D-CGMS lineage has a much higher male infertility introduction rate than the existing Ogura-CGMS lineage, and thus can be used as a broader breeding seed when producing F ₁ hybrid seed. (See Table 2).

In addition, to confirm the presence or absence of a D-CGMS non-recovery gene, 10 lines were collected from Uzbekistan and Russia, using D-CGMS as a model. As a result, it was confirmed that fertility emerged from the F ₁ hybrid seeds produced in the crossing of the "DB112 strain" and "DB117 strain", which "DB112 strain" and "DB117 strain" is the recovery of the D-CGMS-free strain It means you have a gene. Therefore, it was confirmed that the new D-CGMS lineage is a cytoplasmic-genic male sterility (CGMS) lineage in which the recovery gene is present (see Table 3).

As a result, it was confirmed that D-CGMS is a cytoplasmic-genic male sterility (CGMS) lineage that has a recovery gene, and D-CGMS than conventional Ogura-CGMS in terms of introduction rate of male sterility in cross breeding. This is far superior, and this may complement the existing shortcomings that many breeding lines fail to introduce existing Ogura-CGMS male sterility. F ₁ hybrid seeds can be produced by mating with normal fertility individuals who wish to introduce male infertility using the D-CGMS-free plants. The method of the present invention can be applied to all male fertility strains that do not have a D-CGMS recovery gene, and the male fertility strains include Samyang radish (family name: R012), success radish (R015), normal summer radish (R020), and lower weight Radish (R029), normal summer radish separation system (DB002), Hannong summer radish (DB003), Hannong summer radish separation system (DB111), Daebuyeong Summer Radish (DB084), Hachumu radish separation system (DB092), and overseas collection resources It is preferable that the DB019, DB421, DB037, DB067, DB121, DB261, DB321, DB401, DB501 and DB901 are not limited thereto.

The present inventors deposited the callus of the D-CGMS-free callus induced by inducing callus by differentiating seeds of the D-CGMS-free strain to the Gene Bank of Korea Research Institute of Bioscience and Biotechnology on March 27, 2007 (Accession No .: KCTC11101BP).

The present invention also provides a DNA labeling factor for selecting a D-CGMS lineage-free plant having a nucleotide sequence hybridized under stringent conditions with a DNA comprising a nucleotide sequence as set out in SEQ ID NO: 5 or a base sequence as set out in SEQ ID NO: 5. .

As seen above, the D-CGMS-free strain is a male sterile strain that is completely different from the conventional Ogura-CGMS-free strain, and by using it, the present inventors can effectively produce F ₁ hybrid seeds. DNA molecular markers were developed to select CGMS plant-free plants.

Chinese cabbage ( Brassica rapa ssp. Based on chloroplast base sequence (DQ231548) information registered in GenBank of Pekinensis), 20 chloroplast-based primer pairs were constructed from relatively interspecies conserved regions, and PCR of normal fertility line, Ogura-CGMS line, and D-CGMS line Was performed. In this process, it was confirmed that the normal fertility lines are classified into two lines having different chloroplast base sequences, which are named "DBRMF1" and "DBRMF2". This result was consistent with the report that the normal fertile lineage could be classified into two lines based on previously reported mitochondrial nucleotide sequences (Kim et . Al ., Theor . Appl . Genet . 115: 1137-1145 , 2007).

As a result, the product was subjected to PCR using the forward primer described in SEQ ID NO: 1 ('5-AGGGCGGTGCTCTGACCAATTGAACTA-3') and the reverse primer described in SEQ ID NO: 2 ('5-GAGCGGTTAATGGGGACGGACTGTAAA-3'), resulting in D-CGMS. Showed a difference (see FIG. 4). Unlike other individuals, this was a genotype of a repeating base sequence of "ATATATTGATATCTATA" in D-CGMS, and described in SEQ ID NO: 3 ('5-GCGGGTAGCTTACATATTCCTTCTTATG-3') to facilitate the selection of the D-CGMS family. PCR was performed by constructing a forward primer and a reverse primer set forth in SEQ ID NO: 4 ('5-CGGCCTTGCTATCACTAAAGTGATATC-3'), and the base sequence was reconfirmed again. As a result, PCR amplification products of 156 bp were identified only in D-CGMS-free strains among normal fertility strains, Ogura-CGMS strains, and D-CGMS strains (see FIG. 5). 5-GCGGGTAGCTTACATATTCCTTCTTATGATTTAATCTTAATCATTTAAATTTTAGATTCAAATTAGTGTTTTGTAACAAAGAAAGTCACAAGTAATATATTGATATCTATAATATATTGATATCTATATGGATATCACTTTAGTGATAGCAAGGCC-3 ').

However, primers for amplifying D-CGMS specific DNA molecular markers of the present invention are all available to amplify only the DNA labeling factor represented by SEQ ID NO: 5, and more preferably, those described in SEQ ID NO: 3 and SEQ ID NO: 4 are used. It is not limited to this.

The DNA labeling factor of the present invention is preferably any nucleotide sequence that hybridizes under stringent conditions to the DNA including the nucleotide sequence of SEQ ID NO: 5, and most preferably the nucleotide sequence of SEQ ID NO: 5. Stringent conditions are determined upon cleaning after hybridization. One of the stringent conditions is 15 minutes with 6 × SSC, 0.2% SDS at room temperature, 30 minutes with 2 × SSC, 0.2% SDS at 45 ° C, 30 minutes with 2 × SSC, 0.2% SDS at 50 ° C. Repeat the wash twice. Those skilled in the art can clearly set these conditions in order to obtain the stringent conditions required.

In order to confirm whether the DNA molecule marker of the present invention is capable of D-CGMS specific selection, PCR was performed on 30 commercially known varieties using a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4. As a result, only 156 bp amplification products were identified in the D-CGMS cell line (see FIG. 6), and it was confirmed that the D-CGMS cell line could be selected through this.

Therefore, stable chloroplast-based DNA markers capable of selecting the D-CGMS lineage of the present invention can be very useful for D-CGMS lineage selection and new breed development.

In addition, the present invention is selected from the nucleotide sequence set forth in SEQ ID NO: 12, D- having an oligonucleotide consisting of 15 to 225 contiguous nucleotide sequences comprising the 171th base of the nucleotide sequence or a nucleotide sequence complementary thereto CGMS SNP markers for lineage-free plant selection are provided.

The 171th base of the nucleotide sequence set forth in SEQ ID NO: 12 is preferably a guanine (1bp) is inserted, but is not limited thereto.

The inventors have developed a D-CGMS lineage-specific SNP labeling factor that is more economical and capable of rapidly verifying samples at high volumes.

Raphanus atp6 gene of sativus) nucleotide sequence (GenBank accession number; M24671) 1 primary forward primer described in SEQ ID NO: 6 (5'-AATCAAATAGGGCTGGTGGCGCAGT-3 ' ) in the 5'-direction of the atp6 gene ORF based on the (Primary forward primer) And a secondary forward primer described in SEQ ID NO: 7 (5'-CGCAGTCCCCACTTGACCAATTTGA-3 ') were prepared and subjected to 3'-genome walking. The result is a sequence at the base sequence at 8, which is shown in SEQ ID NO: 8 (5'-AAAAGGGGAGGAGGAAACTTAGTCCCAAATGCTTGGCAATCCTTGGTAGAGCTTCTTTATGATTTCGTGCTGAACCTGGTAAAGGAACAAATTTTAAGATTTTGAAATAAATTGAATTTCAAGACAGTTAGTCTAATCAACCAAGCTAGACCAT-3 '), and is shown in the sequence 3p6 of the base sequence. Genotypes were found. In addition, the ORF portion of the normal atp 6 gene showed a feature in which one base was inserted as compared with the previously known radish atp6 gene (see FIG. 7).

In addition, the inventors of the present invention, based on the nucleotide sequence shown in SEQ ID NO: 8 to identify the 5'-direction nucleotide sequence of the novel atp6 genotype, the primary reverse primer and sequence number of SEQ ID NO: 9 (5'-TAGCCATTTGGTGTGACCTCTGACCG-3 ') A secondary reverse primer of 10 (5'-TAACCGGCCTCAACCATGGTCTAGC-3 ') was prepared and 5'-RACE (Rapid Amplification of cDNA Ends) PCR was performed. As a result, the nucleotide sequence described in SEQ ID NO: 11 (5 '-3') was obtained. As shown in FIG. 8, when compared with the normal atp6 gene (GenBank accession number; M24671), which is not derived from D, The new atp6 genotype of CGMS plants is similar to the normal atp6 gene. This group was matched sequence, the nucleotide in the 3'-part of the ORF is inserted 1bp was confirmed that the strain by recombination. With this base 1bp insert and the recombinant was able to confirm the generation of a new genotype atp6 ORF, this gene was named as "orf225" was described in SEQ ID NO: 12 (5'-ATGAATCAAATAGGGCTGGTGGCGCAGTCCCCACTTGACCAATTTGAGATTGTCCCATTGATTCCTATGAATATCGGAAACTTCTATTTCTCATTCACAAATCCATCTTTGTTCATGCTGCTAACTCTGAGTTTTTTCCTACTTCTGATTCATTTTATTACTAAAAAGGGGAGGAGGAAACTTAGTCCCAAATGCTTGGCAATCCTTGGTAGAGCTTCTTTATGA-3 ') (see Fig. 8). In order to confirm the gene expression of the new atp6 genotype, cDNA of normal fertility line (DBRMF2) and D-CGMS line was used as a template for forward primer of SEQ ID NO: 13 (5'-GTACAAAGTTCAGCCTTTAAGGAGGC-3 ') and 5'-RACE. The primer of SEQ ID NO: 10 (5'-TAACCGGCCTCAACCATGGTCTAGC-3 ') was used to confirm expression. As a result, as shown in Figure 9, the size of the amplification product can not be compared, but it can be seen that it is expressed in both normal fertility strain and D-CGMS strain (see Figure 9).

In addition, the present inventors on the basis of the base sequence obtained from the 3 ' genome walking and 5'-RACE PCR SEQ ID NO: 14 (5'-GGAGTGATCTTTCTCGAAATGAATTAAGTAAGGGCGCTATGTTCAGATTCTGAACCAAAGCACTAGTTGAGGTCTGAAAGCCTTATGAGCAGAAGTAATAAATACCTCGGGGAAGAAGCGGGGTAGAGGAATTGGTCAACTCATCAGGCTCATGACCTGAAGATTACAGGTTCGAATCCTGTCCCCGCACTAAGTAAGGGTTTCATTCTGCATCACTCTCCCCGTCGTTCTCGACCTCGCAAGGTTTTTGAAGCGGCCGAAGCGGGAAGTGACAATACCGCTTTTCTTCAGCACATTTTGGATGATTTGAGCGAAAACGGAGTACAAAGTTCAGCCTTTAAGGAGGCTATGAATCAAATAGGGCTGGTGGCGCAGTCCCCACTTGACCAATTTGAGATTGTCCCATTGATTCCTATGAATATCGGAAACTTCTATTTCTCATTCACAAATCCATCTTTGTTCATGCTGCTAACTCTGAGTTTTTTCCTACTTCTGATTCATTTTATTACTAAAAAGGGGAGGAGGAAACTTAGTCCCAAATGCTTGGCAATCCTTGGTAGAGCTTCTTTATGATTTCGTGCTGAACCTGGTAAAGGAACAAATTTTAAGATTTTGAAATAAATTGAATTTCAAGACAGTTAGTCTAATCAACCAAGCTAGACCATGGTTGAGGCCGGTTATTAGTTTCTATTGCAAGGTTTTTGCACTATTGGAAATGTATAATTTAAGTGCATTTCTTTAATAAAGAAAAAGAAAACCCACAAATTGTATTTATAACTTCGGTCAGAGGTCACACCAAATGGCTAATTATTTTGGACAAAAAGAGAAACATAATCAGTCAGAGCTACACATAGAGTAGTTGTGTCAAGCTA It was obtained the nucleotide sequence represented by CTTTATTTAATGATCTTCTTCTTGTATTCTCGTCTTCCTCCATCATAATCACATCATAGATATTGGTGCCAATGAAAAGAGTAAAGATCATAGAAGGAAGTCCAAAATAGAGTGAGGGCTAAAGCAGTA GAGATTGCGTCAGCATTCCTATTGCAACAGGTCCAGTCAAAGAGGCGGCCCATTATCTTTTCTTCTTCGTTAAATACAATTATTTCTGTAAAAAAATCTTTGATAACCAGTTGGTTAATTCTTATTTCTAAATGGTGCCGGTGAAAAAGCATCGAGGTTATTTTACGATTAGTGAACCTGAACTGACATTGGTTCACCTTTGTAAGCCAGTTTATTATGTTTACTGTTCCCCATGATCGCATCAAATGTTAAAAATGGTTACATTTGTGCAAAATTCAACCACAATTTTACCCCAAAAAAGGGAAAAGAAAATCAACCACAGCGTAGCCTCCGCAGTGCACAGACTTGTGTTTCAAGTTTGAACCACAAAATAGTTTTGACTAGATATTCTTGTTCTATCCCTAAAAACAGACTAAGAAACTTTTTGAATGATGTACTTTTCTGGTAGTATGTAGGTGCCTAGGTGGTGACTCGGTACTATAATATGCCATAGCAAAGTCATCGATCAATATATACCCATCGAACGTATGGTTTGTATT-3 '), orf225 gene as shown in Figure 10 was composed of a base of the gun and 225bp encoding the protein of 75 codons. In addition, the first to 603 sequences of SEQ ID NO: 14 corresponded to the normal atp6 gene derived from non-plants, except that the guanine base 1bp in the 519 sequence (SEQ ID NO: 12, 171) The inserted SNP could be confirmed, and recombination occurred at the 604 th sequence, thereby confirming that a gene completely different from the normal atp6 gene sequence was generated (see FIG. 10).

The inventors of the present invention are directed to the normal primers (DBRMF1, DBRMF2), Ogura-CGMS and NWB-CMS line to determine whether the orf225 gene is present in the forward primer described in SEQ ID NO: 15 (5'-ATACCTCGGGGAAGAAGCGGGGT-3 ') and SEQ ID NO: 16 ( 5'-TAGCCATTTGGTGTGACCTCTGACCG-3 ') was prepared and confirmed by PCR and sequencing. As a result, the amplified products on the agarose gel as shown in Figure 11, there was no difference between the lines, but after analyzing the base sequence of these amplified products as shown in Figure 12 is a normal value (DBRMF1, DBRMF2), Ogura Single Nucleotide Polymorphism (SNP) in which the 1C base was inserted only in the D-CGMS-free line was found in the non-CGMS and NWB-CMS-free lines, and only in the D-CGMS-free line (see FIGS. 11 and 12).

As a result, as shown in FIG. 13, normal fertility (DBRMF1, DBRMF2), Ogura-CGMS, and NWB-CMS lines were confirmed to have recombination at the 254th base of the normal atp6 gene ORF, resulting in a total of 267 bp of new ORF. this named as "orf267", which was described in SEQ ID NO: 17 (5'-ATGAATCAAATAGGGCTGGTGGCGCAGTCCCCACTTGACCAATTTGAGATTGTCCCATTGATTCCTATGAATATCGGAAACTTCTATTTCTCATTCACAAATCCATCTTTGTTCATGCTGCTAACTCTGAGTTTTTTCCTACTTCTGATTCATTTTATTACTAAAAAGGGAGGAGGAAACTTAGTCCCAAATGCTTGGCAATCCTTGGTAGAGCTTCTTTATGATTTCGTGCTGAACCTGGTAAAGGAACAAATTTTAAGATTTTGA-3 '). However, in the D-CGMS line, SNP (Single Nucleotide Polymorphism) containing guanine 1bp is inserted in the 171th base of the normal atp6 gene ORF, and recombination occurs at the 255th base to create a new ORF (orf225) of 225bp. It was confirmed (see FIG. 13).

In addition, as shown in FIG. 14, protein codons were changed due to SNP (Single Nucleotide Polymorphism) in which guanine 1bp of the normal atp6 gene ORF was inserted in the D-CGMS-free system, and is normal (DBRMF1, DBRMF2). ), Ogura-CGMS, NWB-CMS strain and D-CGMS strain was confirmed that the C-terminal end region (C-terminal end region) is different (see Fig. 14).

The inventors of the present invention are normal (DBRMF1, DBRMF2), Ogura-CGMS, NWB-CMS to determine whether or not the guanine 1bp inserted SNP can be used to specifically select D-CGMS lineage And three D-CGMS strains were tested. As a result, as shown in FIG. 15, it was confirmed that PCR amplification products were present in all normal fertility (DBRMF1, DBRMF2), Ogura-CGMS, NWB-CMS, and D-CGMS strains. CGMS specific SNPs were identified (see FIG. 15).

As a result, as shown in FIG. 16, all normal analyzes (DBRMF1, DBRMF2), Ogura-CGMS and NWB-CMS strains were analyzed as "GGG", and only D-CGMS strains were "GGGG" guanine (Guanine). It was demonstrated that 1 bp had an inserted SNP. Therefore, the D-CGMS-specific SNPs identified above were found to be normal (DBRMF1, DBRMF2), Ogura-CGMS, and NWB-CMS-free strains, and thus the D-CGMS-specific SNPs located at the 171th base sequence of SEQ ID NO: 12. It can be seen that the SNP can be used as a molecular marker capable of specifically selecting only D-CGMS lineages (see FIG. 16).

In addition, the present invention provides a D-CGMS plant-free plant selection kit.

The selection kit includes primer pairs or probes and a PCR reaction mixture capable of detecting nucleotide sequences of DNA labeling factors or oligonucleotides of SNP labeling factors specific to the D-CGMS line.

The primer pair for amplifying the DNA labeling factor specific for the D-CGMS-free line can amplify the DNA labeling factor as set forth in SEQ ID NO: 5, and can be used as long as all primers can be designed by those skilled in the art. It is preferable to use the primer pair described by number 4. In addition, primer pairs for amplifying D-CGMS specific SNP labeling factors can amplify D-CGMS specific SNP labeling factors and can be used as long as all primers can be designed by those skilled in the art, and are described by SEQ ID NO: 15 and SEQ ID NO: 16. Preference is given to using primer pairs.

The PCR reaction mixture may include general materials required for the PCR reaction, for example, Tag polymerase, reaction buffer, dNTP, MgCl ₂ , BSA, distilled water, and the like, and agarose and electricity capable of detecting PCR products. The electrophoretic buffer may further comprise.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example 1 Development and Characterization of New D-CGMS System

<1-1> New  D- CGMS  Selection

We collected new male infertility resources to improve the productivity of F ₁ hybrid seeds. Among them, we investigated the degree of development of firearms and pollen in non-systems collected from over 20 Uzbekistan farms, which were distributed by the Rural Horticultural Research Institute.

As a result, pollen development was inhibited and one strain showing Cytoplasmic-Genic Male Sterility (CGMS) was selected, which was named "D-CGMS ( Raphanus sativus var D-CGMS)".

Flowers and stamens of the selected D-CGMS, normalized fertility individuals, and flowers and stamens of the Ogura-free line (Ogura-CGMS) were observed under an anatomical microscope. Since the Ogura-CGMS is mainly used for conventional hybrid seed production, it was used as a control.

As a result, it was found that the newly discovered male fertility system (D-CGMS) has less pollen than normal fertility individuals, and a small amount of pollen is produced unlike the previously reported Ogura-CGMS (no pollen at all). 1).

<1-2> D- CGMS Pollen vitality survey

In order to investigate the vitality of the pollen of D-CGMS selected in Example <1-1>, the pollen of the newly discovered male infertility system through Scanning Electron Microscope (SEM) and FDA (fluorescein diacetate) staining. The shape and vitality of the pollen was closely observed. Electron microscopy and FDA staining were carried out by harvesting normal fertile individuals and pollen of D-CGMS-free pollen, and Ogura-CGMS-free pollen was not produced at all, and thus excluded from observation. FDA staining for the investigation of pollen vitality was observed by fluorescence microscopy after staining the potted plants of normal fertility individuals and D-CGMS-free flowering flowers with 0.002% fluorescein diacetate (FDA) solution.

As a result, the pollen of the newly discovered male infertility individuals was distorted form unlike normal fertility individuals, and was found to have no vitality even in pollen vitality investigation (FIG. 2).

<1-3> D- CGMS Histologic observation

We performed histological observations to investigate more precise male infertility mechanisms of D-CGMS. First, normal fertility subjects, Ogura-CGMS and D-CGMS-free Anthers were taken at the same developmental stage, and then fixed with fixed solution (Pipes 50 mM, 4% p-formaldehyd) at 4 ° C. for 24 hours. Thereafter, dehydration was performed once every 25 hours at 50%, 75% and 100% alcohol in 25% to ascending concentration at room temperature, followed by 24 hours dehydration in 100% alcohol. At room temperature, 25% to 50%, 75% and 100% xylene were treated once every two hours in order of increasing concentration, followed by pretreatment by treating 100% xylene twice for two hours. After three treatments for 2 hours in paraffin, the samples were embedded in paraffin. After fabrication of the paraffin block, specimen preparation was made by using a tissue micro knitting machine (rotary microtome) to make slices of 10 μm thickness, attached to slide glass coated with albumin, and then heated using a warmer (Slide warmer, Fisher Scientific, USA). Dry at 40 ± 3 ° C. The completely dried slides were deparaffinized with xylene, dehydrated with alcohol and stained with 0.25% toluidine blue and 0.05% aniline blue. After passing alcohol and xylene through the dyed tissue again, the slide was sealed with an encapsulant, dried for one day in a 60 ° C. warmer, and then examined under a microscope and photographed with an optical microscope.

As a result, normal fertility individuals (A, D, G, J, and M in FIG. 3) develop pollen normally while tetrad development in Ogura-CGMS-free lines (B, E, H, K, and N in FIG. 3). It was confirmed that no pollen is produced at all because a male sterility mechanism is formed in a form in which no abnormality occurs from the step (FIG. 3E) and no pollen development occurs. In contrast, in the D-CGMS-free line (C, F, I, L and O in FIG. 3), the tetrad development stage (F in FIG. 3) is similar to normal individuals but in the vesicular development stage (I and L in FIG. 3). Abnormalities occurred, and as a result, it was confirmed that the pollen has a male infertility mechanism that is abnormally developed (Fig. 3).

<1-4> D- through mating CGMS Pollen vitality survey

The present inventors also examined the vitality of the pollen of D-CGMS through mating, and when the pollen of the D-CGMS-free pollen was used as a model of normal fertility individuals, it was possible to confirm that no seed was produced. However, as a result of confirming the normal development of the magnetic organs based on the D-CGMS non-system as a model, it was confirmed that the seed is normally generated when mating with other pollen (Table 1). At this time, the male fertility plants used as paternity to check the normal status of D-CGMS magnetic organs are used as Samyang Radish (family name: R012), Sugi (R015), summer radish (R020), and Hachumu (R029). The plant used as a mother tree to use the normal presence or absence of the male and female organs was large Chuseok Radish (R049), Baekbong Radish (R106) and the overseas collection resources "R122" and "R126" possessed by the present inventors. Crosses were performed using the "R127" male fertility lines.

D- through artificial cross CGMS  Check the potted plant vitality and the normality of the magnetic organs Mother Paternity D-CGMS R012 R015 R020 R029 D-CGMS - + + + + R049 - + + + + R106 - + + + + R122 - + + + + R126 - + + + + R127 - + + + +

-: No seed formation; And +: seed formation takes place.

<Example 2> D-CGMS system male male infertility introduction ability confirmation and F _One  Hybrid seed production

Example 1 In to a D-CGMS-free system selected from the mating mobon cytoplasmic-genetic male sterility (CGMS) CGMS-free system F ₁ crossed with male fertile plants to be introduced to the male sterility for producing hybrid seed with Was carried out. In addition, in order to compare the ability to introduce cytoplasmic-genetic male infertility of D-CGMS-free strains to Ogura-CGMS-free strains, male fertility plants crossed with D-CGMS-free strains were bred using Ogura-CGMS as a model. . Whether male sterility was introduced in the produced F ₁ hybrid seeds was confirmed by investigating the development of pollen and the vitality of pollen. At this time, the males of the male fertility plant (father system) that want to introduce male sterility are normal summer radish separation system (DB002), Hannong summer radish (DB003), Hannong summer radish separation system (DB111), Samyang radish (DB021), Daebuyeong summer radish ( DB084), Hachumumu separation system (DB092) and the male child fertility system collected by the present inventors "DB019", "DB421" no system was used for breeding. In addition, the Ogura-CGMS radish system used as a control group used large Chuseokmu (R049) and Baekbongmu (R106) as mothers.

As a result, in the mating combination of Ogura-CGMS with eight different male fertility strains, the F ₁ hybrid seeds generated from the six mating combinations were 100% Male Fertile Progenies, and one mating combination (R106 × DB421) was divided into male and female fertility strains at a ratio of about 1: 1. In addition, one hybrid combination (R106 × DB019) produced 100% male sterile strains of the resulting F ₁ hybrid seeds. However, in the mating combination of D-CGMS-free strains and eight different male fertility strains, F ₁ hybrid seeds produced in all mating combinations were 100% male sterile strains (Table 2). Therefore, it was confirmed that the male sterility introduction rate using D-CGMS was much higher than that of the existing Ogura-CGMS, and it was confirmed that the maintenance of the maintained system was easier. In addition, 100% male sterile strains of F ₁ hybrid seeds produced from crosses of strains with Ogura-CGMS-free recovery genes and D-CGMS-free strains appeared. This means that it is completely different from CGMS-free lines. As a result, the F ₁ seed production method using cytoplasmic-genetic male infertility without D-CGMS lineage has a much higher male infertility introduction rate than the existing Ogura-CGMS lineage, which can be used as a broader breeding seed when producing F ₁ hybrid seeds. It was confirmed that there is.

Through mating Ogura - CGMS And D- CGMS  Nonsystemic Male Infertility  Determine whether it is introduced Mating Number of plants Male-sterile progenies Msle-fertile progenies Total number of plants D-CGMS × DB002 16 0 16 D-CGMS × DB003 8 0 8 D-CGMS × DB019 14 0 14 D-CGMS × DB021 20 0 20 D-CGMS × DB084 12 0 12 D-CGMS × DB092 16 0 16 D-CGMS × DB111 15 0 15 D-CGMS × DB421 16 0 16 OguraCGMS-R106 × DB002 0 11 11 OguraCGMS-R106 × DB003 0 11 11 OguraCGMS-R106 × DB019 13 0 13 OguraCGMS-R049 × DB021 0 20 20 OguraCGMS-R106 × DB084 0 14 14 OguraCGMS-R106 × DB092 0 8 8 OguraCGMS-R106 × DB111 0 17 17 OguraCGMS-R106 × DB421 4 4 8

< Example  3> D- CGMS  Nonsystemic Male Infertility  Recovery gene source development

In order to find the male infertility recovery system of the D-CGMS-free strain selected in <Example 1>, 10 male fertility lines and D-CGMS-free strains collected in Uzbekistan and Russia were used as a model. At this time, 10 male fertility lines used as paterns were collected from overseas (Uzbekistan, Russia), so only the line names were written because there was no breed name. Whether male sterility was introduced in the produced F ₁ hybrid seeds was confirmed by investigating the development of pollen and the vitality of pollen.

As a result, male fertile strains emerged from F ₁ hybrid seeds produced in crosses with two male fertility strains among 10 mating combinations. The separation of male and female fertility from F ₁ hybrid seeds produced from cross-breeding between D-CGMS and DB112-free strains showed that the DB112-free strains were heterozygous for the D-CGMS-free male infertility recovery gene. (Heterozygote) form proved to have. In addition, 100% male fertility strains of F ₁ hybrid seeds produced from crosses of D-CGMS and DB117-free strains showed that male sterility recovery genes of D-CGMS-free strains were dominant homozygotes. Homozygous dominant). Therefore, it was confirmed that the new D-CGMS lineage is a cytoplasmic-gene male male sterility (CGMS) lineage in which the recovery gene is present.

D through mating CGMS  Nonsystemic Male  Infertility Recovery System Discrimination Mating Number of plants Male-sterile progenies Msle-fertile progenies Total number of plants D-CGMS × DB037 20 0 20 D-CGMS × DB067 19 0 19 D-CGMS × DB112 8 9 17 D-CGMS × DB121 17 0 17 D-CGMS × DB117 0 9 9 D-CGMS × DB261 11 0 11 D-CGMS × DB321 17 0 17 D-CGMS × DB401 19 0 19 D-CGMS × DB501 17 0 17 D-CGMS × DB901 17 0 17

< Example  4> D- CGMS  Nonsystemic Callus  Judo

Seeds of the D-CGMS-free strain of the present invention were immersed in 70% (v / v) ethanol for 1 minute and then washed twice with sterile water. Next, after immersing in 2% sodium hypochloride (NaOCl) solution for 15 minutes, the surface was washed three times with sterile water. The sterilized seeds were germinated by germinating in germination medium (1/2 MS salts, 3% sucorse, 0.8% agar), and then cut on elongated hypocotyls at intervals of 5 mm on MS 7 (BAP 4 mg / liter, Callus was induced by differentiation in NAA 2 mg / liter). Induced callus was subcultured on MS medium (including BAP 1 mg / liter and IBA 0.5 mg / liter) on a 4-week cycle and stably grown callus (calus without D-CGMS) as of March 27, 2007 It was deposited with the Korea Institute of Biotechnology Gene Bank (Accession No .: KCTC11101BP).

< Example  5> D- CGMS Chloroplast-based to identify Molecular Marker  Development

The present inventors confirmed that the D-CGMS-free strain is a male sterile strain that is completely different from the conventional Ogura-CGMS-free strain through the <Examples 1 to 3>, and effectively using the D-CGMS-free strain, F ₁ hybrid seed. It was confirmed that can be produced. Differences in chloroplast sequences through PCR and sequencing of normal fertility individuals, Ogura-CGMS and D-CGMS to develop DNA molecular markers based on the stable chloroplast genome capable of discriminating such D-CGMS strains It was confirmed.

<5-1> D- CGMS Genetic Factor Identification of

Cruciferous cabbage as first registered in GenBank (Brassica rapa ssp. Based on the chloroplast nucleotide sequence (DQ231548) information of pekinensis), 20 primer pairs were prepared based on chloroplasts in a relatively conserved region. PCR was performed on each of five normal fertility strains, the Ogura-CGMS strain, and the D-CGMS strain. 0.1 g of the leaves collected from each individual were completely crushed with liquid nitrogen, DNA was extracted using a kit (DNeasy plant kit, Qiagen, USA), and PCR was performed using 50 ng of the extracted DNA as a template. PCR kit (Advantage 2 PCR kit, Clonetech, USA) was used, PCR conditions were pre-denaturation for 5 minutes at 94 ℃, 30 seconds at 94 ℃; 30 seconds at 65 ° C .; And one cycle of two minutes at 72 ° C. was repeated 40 times, followed by a final extension of 10 minutes at 72 ° C. to terminate the reaction. After completion of the reaction, the nucleotide sequence of the PCR product was analyzed to confirm the difference in the chloroplast base sequence between the normal fertility line, the Ogura-CGMS line, and the D-CGMS line. Sequence analysis was performed by requesting from Genotech Co., Ltd.

As a result of checking the nucleotide sequences of various chloroplast-based PCR products, two different types of chloroplast sequences with chloroplast variation were found in normal fertility individuals. Individuals with chloroplasts with different base sequences among normal fertility individuals were named "DBRMF1" and "DBRMF2", respectively. Among the chloroplast-based PCR products, a primer (forward primer) and SEQ ID NO. The product performed PCR using the base primer (reverse primer) showed a difference in D-CGMS. As a result of analyzing the nucleotide sequence of this amplification product, it was confirmed that the insertion of 17 bp nucleotide sequence (ATATATTGATATCTATA) occurred only in D-CGMS (FIG. 4).

<5-2> D- CGMS Specific to DNA  Marker development

As described in <5-1>, the D-CGMS, unlike other individuals, was characterized by repeating the nucleotide sequence of ATATATTGATATCTATA once more, and in order to facilitate the selection of the non-D-CGMS lineage described in SEQ ID NO: 3 Forward primer and SEQ ID NO: 4 PCR was performed by constructing the reverse primer of the substrate.

PCR was performed using 50 ng of DNA prepared in the same manner as in <5-1> in each of the leaves of the normal fertility line, the Ogura-CGMS line, and the D-CGMS line as a template (Advantage 2 PCR kit, Clonetech, USA). PCR was performed using the PCR conditions, which were pre-denaturated for 5 minutes at 94 ° C., followed by 25 seconds at 94 ° C .; 25 seconds at 68 ° C .; And 40 cycles of 25 seconds at 72 ° C. followed by a final extension of 1 minute at 72 ° C. to terminate the reaction. After completion of the reaction, the size of the amplification product was observed in the agarose gel, and it was confirmed that the PCR amplification product was increased only in the D-CGMS-free line (FIG. 5). As a result of rechecking the nucleotide sequence of the PCR amplification product, a PCR amplification product of 156 bp was identified, which was set forth as SEQ ID NO: 5.

<5-3> Specific DNA  D- using marker factor CGMS Selection of

In order to confirm whether the DNA molecule marker developed in Example <5-2> is capable of specific selection of the newly developed D-CGMS, a forward primer described in SEQ ID NO: 3 of 30 commercially known commercial varieties and It was confirmed by performing PCR in the same manner as in Example <5-2> using the reverse primer described in SEQ ID NO: 4.

As a result, it was found that the size of the amplification product was increased only in the D-CGMS-free strain, and it was confirmed that the DNA molecular marker of the present invention was able to select a novel D-CGMS-free strain (Fig. 6). When the nucleotide sequence of the amplification product (156 bp) was reconfirmed, the nucleotide sequence shown in SEQ ID NO: 5 was obtained.

< Example  6> D- CGMS  Specific atp6  Genotyping and D- CGMS Mitochondrial based to identify SNP Marker  Development

<6-1> genome Walking  Through D- CGMS of atp6  Genotyping

The present inventors examined the D-CGMS specific genotype through genome walking of the atp6 gene. The atp6 gene is a gene present in the mitochondrial genome, which encodes the ATPase subunit 6 protein involved in ATP synthesis. Previous reports have reported that the structural characteristics of the atp6 gene differ according to the characteristics of male and female fertility (Makaroff CA et. Al., J. Biol . Chem. 264: 11706-11713, 1989; Kim et. al., Theor . Appl . Genet . 115: 1137-1145, 2007). In particular, in the case of pepper male infertility resource, the atp6 gene structure in which part of the 3'- portion of the atp6 gene was deleted was found only in the male infertility line, and using this characteristic, the sequence-characterized amplified region of pepper male infertility resource was used. (Kim et. Al., Et al., 2004). Mol . Cells , 20: 416-422, 2005).

First, in order to investigate the structural characteristics of the atp6 gene of D-CGMS, the sequence number for the 3 'genome walking in the 5'-direction of the atp6 ORF based on the known atB6 gene sequence (GenBank accession number M24671) A primary forward primer described as 6 and a secondary forward primer described as SEQ ID NO: 7 were prepared. The genome working library completely crushes 0.1 g of D-CGMS non-leaf using liquid nitrogen, extracts DNA using a kit (DNeasy plant kit, Qiagen, USA), and uses genome walking with 3 ug of extracted DNA. The Genome Working Library was constructed using the Library Kit (Universal GenomeWalker ^™ Kit, Clontech, USA). Primary PCR was performed using the primer set forth in SEQ ID NO: 6 using 1 ul of the genome working library as a template. The PCR conditions were pre-denaturated at 94 ° C. for 3 minutes, followed by 7 cycles of 25 seconds at 94 ° C. and 3 minutes at 72 ° C., followed by 25 seconds at 94 ° C. and 67 ° C. One cycle of 3 minutes was repeated 32 times, followed by a final extension of 7 minutes at 67 ° C. to terminate the reaction. After completion of the reaction, the reaction was diluted 50-fold and 1 ul was subjected to secondary PCR (nested PCR) with a primer described in SEQ ID NO: 7 as a template. The PCR conditions were pre-denaturated at 94 ° C. for 3 minutes, followed by five cycles of 25 seconds at 94 ° C. and 3 minutes at 72 ° C., followed by 25 seconds at 94 ° C. and 67 ° C. The cycle was repeated 20 times for 3 minutes and then the final extension was terminated at 67 ° C. for 7 minutes.

As a result, the amplification product in the agarose gel was found to have generated several bands, and as a result of analyzing the nucleotide sequence, as shown in Figure 7 3'-part of the normal atp6 gene is deleted and the new nucleotide sequence ( A new atp6 genotype with SEQ ID NO: 8) was discovered. In the ORF portion of the normal atp 6 gene, one base was inserted as compared with the previously known radish atp6 gene (FIG. 7).

<6-2> 5'- RACE Through D- CGMS New in atp6  Genotyping

As described in Example <6-1>, a new atp6 gene having a 3'-part deleted and a new base sequence recombined with the known normal atp6 gene was identified, and the 5'-direction of the new atp6 gene was identified. 5'-RACE (Rapid Amplification of cDNA Ends) PCR was carried out to confirm the nucleotide sequence. The RNA used for the RACE cDNA preparation was completely disrupted with 0.1 g of D-CGMS-free flowers using liquid nitrogen, and then all RNAs were extracted using Tri Reagent RNA Isolation Kit (Sigma, USA). MRNA was isolated from all extracted RNA using PolyATtract mRNA Isolation System IV (Promega, USA). RACE cDNA was prepared using the RACE cDNA synthesis kit (SMART ^™ RACE cDNA Amplification Kit, Clontech, USA). In addition, based on the nucleotide sequence described in SEQ ID NO: 8, a reverse primer specific for the novel atp6 genotype described in SEQ ID NO: 9 and SEQ ID NO: 10 was prepared. PCR reaction was performed by the first 5'-RACE PCR using a reverse primer described in SEQ ID NO: 9 as a template of 1ul RACE cDNA, PCR conditions were pre-denaturation for 5 minutes at 94 ℃ 94 5 cycles of 30 seconds at 70 ° C., 3 minutes at 70 ° C., then 25 cycles of 30 seconds at 94 ° C., 30 seconds at 68 ° C., 3 seconds at 72 ° C., and then 72 ° C. The reaction was terminated by a final extension at 10 minutes at. After completion of the reaction, the reaction was diluted 50-fold and 1ul was subjected to a second 5'-RACE PCR (nested PCR) with a reverse primer as set forth in SEQ ID NO: 10 as a template. The PCR conditions were pre-denaturated at 94 ° C. for 5 minutes, followed by 35 cycles of 30 seconds at 94 ° C., 30 seconds at 68 ° C., 3 minutes at 72 ° C., and then at 72 ° C. The reaction was terminated by final extension for 10 minutes. After completion of the reaction, the amplification product was confirmed in agarose gel, the amplification product was cloned into pGEM-T Easy vector (Promega, USA), and then subjected to sequencing. The obtained nucleotide sequence is set forth in SEQ ID NO: 11. In addition, the new atp6 genotype of the D-CGMS plant has a 5'-part normal atp6 gene and base when compared with the non-generic normal atp6 gene (GenBank accession number; M24671), which has been previously reported as shown in FIG. 8. The sequences were matched and it was confirmed that 1bp of base was inserted into the ORF and the 3'-part was modified by recombination. This was confirmed to be in agreement with the result of Example <6-1>. In addition, an ORF of the new atp6 genotype could be identified and named "orf225" and set forth in SEQ ID NO: 12.

In addition, to re-verify whether the new atp6 genotype is expressed, RT-PCR was confirmed in cDNA of normal fertility strain (DBRMF2) and D-CGMS strain. cDNA was completely disrupted with 0.1 g of normal fertility strains and D-CGMS flowers using liquid nitrogen, and then all RNAs were extracted using Tri Reagent RNA Isolation Kit (Sigma, USA). It was made using a synthesis kit (SuperScriptTM First-strand Synthesis System for RT-PCR, Invitrogen, USA). In addition, a forward primer described in SEQ ID NO: 13 was prepared and RT-PCR was performed together with the reverse primer of SEQ ID NO: 10 used for 5'-RACE. The RT-PCR conditions were pre-denaturated at 94 ° C. for 5 minutes, followed by 45 cycles of one cycle of 30 seconds at 94 ° C., 30 seconds at 64 ° C., and 40 seconds at 72 ° C., followed by 72 The reaction was terminated by a final extension at 5 ° C. for 5 minutes. After completion of the reaction, the amplification product was confirmed in the agarose gel. As a result, as shown in Figure 9 it was confirmed that not only D-CGMS lineage but also amplification in normal fertility lineage, it was confirmed that the new atp6 genotype gene (Fig. 9).

<6-3> orf225  Sequencing of genes and SNP  quest

Based on the nucleotide sequences identified in Examples <6-1> and <6-2>, a nucleotide sequence as shown in FIG. 10 could be obtained, which was described as SEQ ID NO: 14. The secured nucleotide sequence shown in SEQ ID NO: 14 consists of a total of 1540 bp of base, and as shown in FIG. 10, the orf225 gene consists of a total of 225 bp of base 349 through 573, and includes 75 protein codons. Was encrypted (FIG. 10). In addition, the first to the 603 nucleotide sequence described in SEQ ID NO: 14 was identical to the normal atp6 gene derived from a plant, but only in the 519 nucleotide sequence (the 171 nucleotide sequence of SEQ ID NO: 12), a guanine base. SNP was found to be inserted 1bp. In addition, it was confirmed that recombination occurred at the 604 th sequence, thereby generating a gene completely different from the normal atp6 gene sequence. Recombinant genes from the 604th to the 1540th sequence were analyzed by the gene homology program (BlastN), and only a part showed low homology (73% homology) with the Arabidopsis gene sequence. As homologous genes were not detected.

In order to confirm whether orf225 gene is also present in normal fertility (DBRMF1, DBRMF2), Ogura-CGMS and NWB-CMS strains, a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 16 were prepared to prepare PCR and base. It was confirmed by sequencing. The positions of the prepared forward primer and reverse primer are shown in FIG. 10. The PCR reaction was performed using normal nitrogen (DBRMF1, DBRMF2), Ogura-CGMS and NWB-CMS strains, 0.1 g of the plant leaves were completely disrupted with liquid nitrogen, and then extracted using a kit (DNeasy plant kit, Qiagen, USA). PCR was carried out using each of the extracted DNA as a template, using the forward primer of SEQ ID NO: 15 and the reverse primer of SEQ ID NO: 16. The PCR conditions were pre-denaturated at 94 ° C. for 5 minutes, followed by 45 cycles of 30 seconds at 94 ° C., 30 seconds at 66 ° C., and 1 minute at 72 ° C., followed by 5 at 72 ° C. The reaction was terminated by final extension for a minute.

As a result, PCR amplification products showed no difference between normal-valued (DBRMF1, DBRMF2), Ogura-CGMS, NWB-CMS and D-CGMS strains as shown in FIG. 11 (FIG. 11). As a result of analyzing the nucleotide sequences of these amplification products, as shown in Fig. 12, normal sequences (DBRMF1, DBRMF2), Ogura-CGMS and NWB-CMS strains do not differ in nucleotide sequence, but D-CGMS strains have 1 bp base inserted therein. Single Nucleotide Polymorphism (SNP) could be confirmed (FIG. 12). As a result, as shown in FIG. 13, normal fertility (DBRMF1, DBRMF2), Ogura-CGMS, and NWB-CMS lines were confirmed to have recombination at the 254th base of the normal atp6 gene ORF, resulting in a total of 267 bp of new ORF. This was named "orf267 (SEQ ID NO: 17)". The orf267 gene encodes a total of 89 protein codons.

However, in the D-CGMS line, SNP (Single Nucleotide Polymorphism) containing guanine 1bp is inserted in the 171th base of the normal atp6 gene ORF, and recombination occurs at the 255th base to create a new ORF (orf225) of 225bp. It was confirmed that it was lost (Fig. 13). In addition, as shown in FIG. 14, in the D-CGMS system, protein codons were changed due to SNP (Single Nucleotide Polymorphism) in which guanine 1bp was inserted into the 171th sequence of the normal atp6 gene ORF, and is normal price. (DBRMF1, DBRMF2), Ogura-CGMS, NWB-CMS line and the D-CGMS line was confirmed that the difference between the C-terminal end region (C-terminal end region) (Fig. 14).

<6-4> D- CGMS  Specific to the non-system SNP Marker  Development

In order to confirm whether the SNP identified in Example <6-3> can specifically select a D-CGMS-free line (DBRMF1, DBRMF2), Ogura-CGMS, NWB-CMS and D -Three experiments were conducted on three CGMS strains. In particular, the D-CGMS-2 and D-CGMS-3 non-individuals were obtained by crossing the D-CGMS non-family based on the normal fertility lineage and confirmed that the D-CGMS-specific SNP is inherited even in the future. The PCR reaction was performed by completely crushing 0.1 g of leaves with liquid nitrogen from a total of 15 plants of normal value (DBRMF1, DBRMF2), Ogura-CGMS, NWB-CMS, and D-CGMS strains, and then using the kit (DNeasy plant kit, Qiagen). , USA), and PCR was performed using the reverse primers of SEQ ID NO: 15 and the forward primers of SEQ ID NO. PCR conditions were performed under the same conditions as in Example <6-3>.

As a result, as shown in FIG. 15, it was confirmed that PCR amplification products were present in all normal fertilizers (DBRMF1, DBRMF2), Ogura-CGMS, NWB-CMS, and D-CGMS strains. CGMS specific SNPs were identified (FIG. 15). As shown in FIG. 16, all normal analyzes (DBRMF1, DBRMF2), Ogura-CGMS and NWB-CMS lines were analyzed as "GGG", and only 1bp of guanine was inserted into "GGGG" line in the D-CGMS-free line. Proved to have SNPs (FIG. 16). In addition, D-CGMS-2 and D-CGMS-3, which are obtained by crossing the D-CGMS lineage with a normal child-bearing line, also exist in D-CGMS-specific SNPs, so that the specific SNPs are normally inherited in the future. It was confirmed. Therefore, the D-CGMS-specific SNPs identified in the above-described examples were found to be absent in normal-value (DBRMF1, DBRMF2), Ogura-CGMS, and NWB-CMS-free lines, and D-CGMS using D-CGMS-specific SNPs. It can be seen that only the non-system can be used as a molecular marker to specifically select.

FIG. 1 is a comparison of the morphology of open fires and surgery of a normal fertile individual, Ogura-CGMS (male sterility; Cytoplasmic-Genic Male Sterility) -free and novel CGMS (D-CGMS) -free lines:

    A: fires of normal fertility individuals;

    B: fire of Ogura-CGMS system;

    C: firearms without D-CGMS;

    D: surgery of normal childbearing individuals;

    E: surgery of the Ogura-CGMS system; And

    F: Surgery without D-CGMS.

2 is a photograph of pollen comparison between normal fertility individuals and D-CGMS strains:

    A: electron micrograph (SEM) of pollen of normal fertility individuals;

    B: Electron microscopy (SEM) images of D-CGMS-free strains;

    C: FDA stained pictures of pollen of normal fertility subjects; And

    D: FDA-stained photograph of the pollen of the D-CGMS-free pollen.

FIG. 3 is a histologic picture of normal fertility individuals, Ogura-CGMS free line and D-CGMS free line:

    A, D, G, J, and M: histological observations of the developmental stages of normal fertile pollen;

    B, E, H, K, and N: histologic observations of the developmental stages of Ogura-CGMS lined pollen by developmental stages; And

    C, F, I, L and O: Histological observations of the developmental stages of D-CGMS plant-free pollen.

Figure 4 is a photograph comparing the nucleotide sequence of the PCR product amplified using SEQ ID NO: 1 and SEQ ID NO: 2.

FIG. 5 is a photograph comparing PCR products amplified using SEQ ID NO: 3 and SEQ ID NO: 4 on agarose gel.

6 is Here is a picture showing PCR results of 30 different varieties of D-CGMS-free and commercially available DNA markers that can select D-CGMS-free lines:

   M; Marker, 1; D-CGMS, 2; Auspicious, 3; White radish, 4; Samyangmu, 5; Jeongjin Hand, 6; Cheonghakmu, 7; Sun radish, 8; Youngsan Mu, 9; Pyeonggang Kimjang, 10; Hachumu, 11; Summer, 12; D-CGMS, 13; Winter radish, 14; Specialty radish, 15; Baek Kyung-moo, 16; Glory, 17; Jang Moo, 18; Blue light, 19; Palgwangmu, 20; Green grass, 21; Taebaekmu, 22; Kanto Summer, 23; D-CGMS, 24; Large Chuseok, 25; Joongang Kim, 26; Green service, 27; Taewangmu, 28; Taepyeongmu, 29; Hanol large spring radish, 30; Mung bean radish, 31; White light, 32; Baekbongmu and 33; First article.

FIG. 7 is a photograph of nucleotide sequences obtained by performing 3′-direction genome walking using SEQ ID NO: 6 and SEQ ID NO: 7. FIG.

Figure 8 shows the base sequence obtained by 5'-directional Rapid Amplification of cDNA Ends (RACE) PCR using SEQ ID NO: 9 and SEQ ID NO: 10 with a non-generated normal atp6 gene (GenBank accession number; M24671). It is a comparative analyzed photo:

   Underlined: Open Reading Frame (ORF) of newly discovered D-CGMS specific orf225 gene.

Figure 9 is a photograph showing the results of confirming the expression of the new atp6 genotype in the normal fertility lineage and D-CGMS-free cDNA.

FIG. 10 is a photograph of sequencing of the novel atp6 genotype obtained by performing 3'-way genome walking and 5'-way RACE PCR in a D-CGMS lineage:

   Arrow marks 102-124 and 781-806: Forward primers and reverse primers set forth in SEQ ID NO: 15 and SEQ ID NO: 16 for developing D-CGMS specific SNP markers.

FIG. 11 is a photograph comparing PCR products amplified using SEQ ID NO: 15 and SEQ ID NO: 16 on agarose gel. FIG.

Figure 12 is a photograph of the comparative analysis by sequencing the PCR product amplified using SEQ ID NO: 15 and SEQ ID NO: 16.

Figure 13 shows a novel atp6 genotype of the previously reported lineage-free normal atp6 gene, normal titers (DBRMF1, DBRFM2), Ogura-CGMS and NWB-CMS (gene orf267), and a novel atp6 genotype specific to D-CGMS (orf225). The structure of genes is compared and analyzed.

14 is a photograph showing analysis results showing that the protein codons are changed due to D-CGMS lineage-specific SNPs, and thus normal differences (DBRMF1, DBRFM2), Ogura-CGMS and NWB-CMS-free lines, and D-CGMS-free lines remain. to be.

FIG. 15 is a photograph comparing PCR products amplified using SEQ ID NO: 15 and SEQ ID NO: 16 in normal fertility (DBRMF1, DBRFM2), Ogura-CGMS, NWB-CMS and D-CGMS lineages (FIG. Three in each strain).

FIG. 16 shows chromatogram picks through sequencing of PCR products amplified using SEQ ID NO: 15 and SEQ ID NO: 16 in normal lines (DBRMF1, DBRFM2), Ogura-CGMS, NWB-CMS, and D-CGMS lines. Chromatogram peak photo:

   A: DBRMF1 strain;

   B: DBRMF2 strain;

   C: Ogura-CGMS strain;

   D: NWB-CMS strain; And

   E: D-CGMS strain.

<110> Dongbu HiTek Co., Ltd. <120> A Method for producing a hybrid seed using plant of novel          Cytoplasmic-Genic Male Sterility Raphanus sativus line and DNA          marker for selecting the plant of said Raphanus sativus line <130> 8p-03-22 <160> 17 <170> KopatentIn 1.71 <210> 1 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 1 agggcggtgc tctgaccaat tgaacta 27 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 2 gagcggttaa tggggacgga ctgtaaa 27 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer 3 <400> 3 gcgggtagct tacatattcc ttcttatg 28 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 4 <400> 4 cggccttgct atcactaaag tgatatc 27 <210> 5 <211> 156 <212> DNA <213> Artificial Sequence <220> <223> PCR product of D-CGMS Raphanus sativus <400> 5 gcgggtagct tacatattcc ttcttatgat ttaatcttaa tcatttaaat tttagattca 60 aattagtgtt ttgtaacaaa gaaagtcaca agtaatatat tgatatctat aatatattga 120 tatctatatg gatatcactt tagtgatagc aaggcc 156 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer 6 <400> 6 aatcaaatag ggctggtggc gcagt 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer 7 <400> 7 cgcagtcccc acttgaccaa tttga 25 <210> 8 <211> 1029 <212> DNA <213> Artificial Sequence <220> <223> Genome walking product of D-CGMS Raphanus sativus <400> 8 aaaaggggag gaggaaactt agtcccaaat gcttggcaat ccttggtaga gcttctttat 60 gatttcgtgc tgaacctggt aaaggaacaa attttaagat tttgaaataa attgaatttc 120 aagacagtta gtctaatcaa ccaagctaga ccatggttga ggccggttat tagtttctat 180 tgcaaggttt ttgcactatt ggaaatgtat aatttaagtg catttcttta ataaagaaaa 240 agaaaaccca caaattgtat ttataacttc ggtcagaggt cacaccaaat ggctaattat 300 tttggacaaa aagagaaaca taatcagtca gagctacaca tagagtagtt gtgtcaagct 360 actttattta atgatcttct tcttgtattc tcgtcttcct ccatcataat cacatcatag 420 atattggtgc caatgaaaag agtaaagatc atagaaggaa gtccaaaata gagtgagggc 480 taaagcagta gagattgcgt cagcattcct attgcaacag gtccagtcaa agaggcggcc 540 cattatcttt tcttcttcgt taaatacaat tatttctgta aaaaaatctt tgataaccag 600 ttggttaatt cttatttcta aatggtgccg gtgaaaaagc atcgaggtta ttttacgatt 660 agtgaacctg aactgacatt ggttcacctt tgtaagccag tttattatgt ttactgttcc 720 ccatgatcgc atcaaatgtt aaaaatggtt acatttgtgc aaaattcaac cacaatttta 780 ccccaaaaaa gggaaaagaa aatcaaccac agcgtagcct ccgcagtgca cagacttgtg 840 tttcaagttt gaaccacaaa atagttttga ctagatattc ttgttctatc cctaaaaaca 900 gactaagaaa ctttttgaat gatgtacttt tctggtagta tgtaggtgcc taggtggtga 960 ctcggtacta taatatgcca tagcaaagtc atcgatcaat atatacccat cgaacgtatg 1020 gtttgtatt 1029 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 9 <400> 9 tagccatttg gtgtgacctc tgaccg 26 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer 10 <400> 10 taaccggcct caaccatggt ctagc 25 <210> 11 <211> 680 <212> DNA <213> Artificial Sequence <220> <223> 5'-RACE PCR product of D-CGMS Raphanus sativus <400> 11 ggagtgatct ttctcgaaat gaattaagta agggcgctat gttcagattc tgaaccaaag 60 cactagttga ggtctgaaag ccttatgagc agaagtaata aatacctcgg ggaagaagcg 120 gggtagagga attggtcaac tcatcaggct catgacctga agattacagg ttcgaatcct 180 gtccccgcac taagtaaggg tttcattctg catcactctc cccgtcgttc tcgacctcgc 240 aaggtttttg aagcggccga agcgggaagt gacaataccg cttttcttca gcacattttg 300 gatgatttga gcgaaaacgg agtacaaagt tcagccttta aggaggctat gaatcaaata 360 gggctggtgg cgcagtcccc acttgaccaa tttgagattg tcccattgat tcctatgaat 420 atcggaaact tctatttctc attcacaaat ccatctttgt tcatgctgct aactctgagt 480 tttttcctac ttctgattca ttttattact aaaaagggga ggaggaaact tagtcccaaa 540 tgcttggcaa tccttggtag agcttcttta tgatttcgtg ctgaacctgg taaaggaaca 600 aattttaaga ttttgaaata aattgaattt caagacagtt agtctaatca accaagctag 660 accatggttg aggccggtta 680 <210> 12 <211> 225 <212> DNA <213> Artificial Sequence <220> <223> orf225 <400> 12 atgaatcaaa tagggctggt ggcgcagtcc ccacttgacc aatttgagat tgtcccattg 60 attcctatga atatcggaaa cttctatttc tcattcacaa atccatcttt gttcatgctg 120 ctaactctga gttttttcct acttctgatt cattttatta ctaaaaaggg gaggaggaaa 180 cttagtccca aatgcttggc aatccttggt agagcttctt tatga 225 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 13 <400> 13 gtacaaagtt cagcctttaa ggaggc 26 <210> 14 <211> 1540 <212> DNA <213> Artificial Sequence <220> <223> new atp 6 of D-CGMS Raphanus sativus <400> 14 ggagtgatct ttctcgaaat gaattaagta agggcgctat gttcagattc tgaaccaaag 60 cactagttga ggtctgaaag ccttatgagc agaagtaata aatacctcgg ggaagaagcg 120 gggtagagga attggtcaac tcatcaggct catgacctga agattacagg ttcgaatcct 180 gtccccgcac taagtaaggg tttcattctg catcactctc cccgtcgttc tcgacctcgc 240 aaggtttttg aagcggccga agcgggaagt gacaataccg cttttcttca gcacattttg 300 gatgatttga gcgaaaacgg agtacaaagt tcagccttta aggaggctat gaatcaaata 360 gggctggtgg cgcagtcccc acttgaccaa tttgagattg tcccattgat tcctatgaat 420 atcggaaact tctatttctc attcacaaat ccatctttgt tcatgctgct aactctgagt 480 tttttcctac ttctgattca ttttattact aaaaagggga ggaggaaact tagtcccaaa 540 tgcttggcaa tccttggtag agcttcttta tgatttcgtg ctgaacctgg taaaggaaca 600 aattttaaga ttttgaaata aattgaattt caagacagtt agtctaatca accaagctag 660 accatggttg aggccggtta ttagtttcta ttgcaaggtt tttgcactat tggaaatgta 720 taatttaagt gcatttcttt aataaagaaa aagaaaaccc acaaattgta tttataactt 780 cggtcagagg tcacaccaaa tggctaatta ttttggacaa aaagagaaac ataatcagtc 840 agagctacac atagagtagt tgtgtcaagc tactttattt aatgatcttc ttcttgtatt 900 ctcgtcttcc tccatcataa tcacatcata gatattggtg ccaatgaaaa gagtaaagat 960 catagaagga agtccaaaat agagtgaggg ctaaagcagt agagattgcg tcagcattcc 1020 tattgcaaca ggtccagtca aagaggcggc ccattatctt ttcttcttcg ttaaatacaa 1080 ttatttctgt aaaaaaatct ttgataacca gttggttaat tcttatttct aaatggtgcc 1140 ggtgaaaaag catcgaggtt attttacgat tagtgaacct gaactgacat tggttcacct 1200 ttgtaagcca gtttattatg tttactgttc cccatgatcg catcaaatgt taaaaatggt 1260 tacatttgtg caaaattcaa ccacaatttt accccaaaaa agggaaaaga aaatcaacca 1320 cagcgtagcc tccgcagtgc acagacttgt gtttcaagtt tgaaccacaa aatagttttg 1380 actagatatt cttgttctat ccctaaaaac agactaagaa actttttgaa tgatgtactt 1440 ttctggtagt atgtaggtgc ctaggtggtg actcggtact ataatatgcc atagcaaagt 1500 catcgatcaa tatataccca tcgaacgtat ggtttgtatt 1540 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer 15 <400> 15 atacctcggg gaagaagcgg ggt 23 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer 16 <400> 16 tagccatttg gtgtgacctc tgaccg 26 <210> 17 <211> 267 <212> DNA <213> Artificial Sequence <220> <223> orf267 <400> 17 atgaatcaaa tagggctggt ggcgcagtcc ccacttgacc aatttgagat tgtcccattg 60 attcctatga atatcggaaa cttctatttc tcattcacaa atccatcttt gttcatgctg 120 ctaactctga gttttttcct acttctgatt cattttatta ctaaaaaggg aggaggaaac 180 ttagtcccaa atgcttggca atccttggta gagcttcttt atgatttcgt gctgaacctg 240 gtaaaggaac aaattttaag attttga 267  

Claims (15)

Cytoplasmic-Genic Male Sterility (CGMS) specific SNP (Single Nucleotide Polymorphism) comprising a nucleotide sequence set forth in SEQ ID NO: 5, and located at the 171th base of the nucleotide sequence set forth in SEQ ID NO: 12 CGMS Radish ( Raphanus sativus L.) lineage plant. The plant of claim 1, wherein the base located at 171th of the base sequence of SEQ ID NO: 12 is guanine. The CGMS plant-free plant according to claim 1, wherein the CGMS plant-free plant is derived from a callus described in Accession No. KCTC11101BP. Callus of CGMS-free line | wire which is shown by accession number KCTC11101BP. A method for producing CGMS lineage hybrid seed having cytoplasmic-genetic male infertility, comprising the step of mating the CGMS lineage-free plant of claim 1 as a mating parent and a male fertility plant intended to introduce male infertility. The method of producing a CGMS lineage hybrid seed according to claim 5, wherein the male fertility plant has been selected from a male fertility lineage that does not have a CGMS lineage-free recovery gene. The polynucleotide of claim 1, wherein the CGMS lineage-free plant selection has a nucleotide sequence set forth in SEQ ID NO: 5. A primer pair for amplifying the polynucleotide of claim 7. The primer pair of claim 8, wherein the primer pair has a nucleotide sequence set forth in SEQ ID NO: 3 and SEQ ID NO: 4. A polynucleotide according to claim 1, wherein the polynucleotide of claim 1 is selected from the nucleotide sequences set forth in SEQ ID NO: 12 and comprises 15 to 225 consecutive base sequences comprising the 171th base of the nucleotide sequence. The polynucleotide of claim 10, wherein the base located at 171th of the nucleotide sequence of SEQ ID NO: 12 is guanine. A primer pair for amplifying the polynucleotide of claim 10. 13. The primer pair of claim 12, wherein the primer pair has a nucleotide sequence set forth in SEQ ID NO: 15 and SEQ ID NO: 16. A selection kit of a CGMS lineage-free plant of claim 1, comprising a primer pair or probe capable of detecting the nucleotide sequence of claim 7 or the oligonucleotide of claim 10. 15. The kit according to claim 14, wherein the primer pair is a primer pair described in SEQ ID NO: 3 and SEQ ID NO: 4, or a primer pair described in SEQ ID NO: 15 and SEQ ID NO: 16.

Images