CN101805741A - Male sterility gene TCL, coded protein and promoter, plasmid and host cell - Google Patents

Male sterility gene TCL, coded protein and promoter, plasmid and host cell Download PDF

Info

Publication number
CN101805741A
CN101805741A CN201010301369A CN201010301369A CN101805741A CN 101805741 A CN101805741 A CN 101805741A CN 201010301369 A CN201010301369 A CN 201010301369A CN 201010301369 A CN201010301369 A CN 201010301369A CN 101805741 A CN101805741 A CN 101805741A
Authority
CN
China
Prior art keywords
gene
tcl
seq
gly
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201010301369A
Other languages
Chinese (zh)
Inventor
张大兵
李晖
梁婉琪
袁政
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN201010301369A priority Critical patent/CN101805741A/en
Publication of CN101805741A publication Critical patent/CN101805741A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention relates to a male sterility gene TCL, a coded protein and a promoter, a plasmid and a host cell in the technical field of gene engineering. The male sterility gene TCL comprises gene of proteins having a code as (a) or (b): (a) is a protein comprising amino acid sequences shown as SEQ ID NO: 2; (b) is protein derived from (a), substituted, deleted or added with one or more amino acids in the amino acid sequences and having influence on programmed death activity of felt cell layer. The invention further relates to a promoter of a basic sequence shown as SEQ ID NO: 3. The invention further relates to a protein of an amino acid sequence shown as SEQ ID NO: 2. The invention further relates to a plasmid and a host cell comprising a gene of a basic sequence shown as SEQ ID NO: 1. The TCL gene has a function of keeping programmed death of anther felt layer of rice. The loss of the genetic function causes necrosis of felt cell and sterility of male rice.

Description

Male sterility gene TCL, encoded protein and promotor, plasmid and host cell
Technical field
The present invention relates to a kind of gene, encoded protein and promotor, plasmid and host cell of gene engineering technology field, be specifically related to a kind of male sterility gene TCL, encoded protein and promotor, plasmid and host cell.
Background technology
Paddy rice is one of topmost food crop of China, and it is staple food with rice that there is 60% above population in China, is maximum in the world rice producing country and country of consumption.3,000 ten thousand hectares of China paddy rice year sown areas account for 20% of the world; 1.85 hundred million tons of output account for the nearly 1/3 of the world, and 6.35 tons/hectare of yield per unit are higher by 65% than 3.85 tons/hectare of global mean yields.Paddy rice remains at about 40% of total amount in China's grain yield, occupied nearly half of the country, and one of them important reasons is exactly that very important effect has been brought into play in the invention of male sterible series of rice and heterotic widespread use.The F1 that parent's combo of the different genetic backgrounds of organic sphere is produced is for generation having stronger growth potential and resistance, hybrid vigour that Here it is than its father and mother.The crop heterosis utilization is the important channel of improving crop yield, the applying of hybrid rice, and for huge contribution has been made in the increases in grain production in the China and even the world, and the crop male sterile line is effectively to utilize heterotic prerequisite and basis.Utilize male sterible series of rice to produce cenospecies, making the hybrid vigour of paddy rice be able to widespread use on producing just becomes possibility.Therefore, the research novel male sterible series of rice of seed selection is also furtherd investigate its Regulation Mechanism, is further to excavate paddy rice high-quality and super high-yielding kind prerequisite and basis.
The growth of rice male organ flower pesticide is the process of a complexity, relates to the division differentiation of flower pesticide cell, the reduction division of pollen mother cell and the growth courses such as mitotic division of pollen, the unusual normal development that all can influence pollen of any growth course.The suede adhesion coating is the innermost layer cell in the anther wall cell, directly contacts with sporule with pollen mother cell, and this confluent monolayer cells is the active and the most vigorous confluent monolayer cells of metabolism in each confluent monolayer cells of flower pesticide.After microsporocyte reduction division is finished, tapetal cell begins degraded by the mode of programmed death, and be the further growth of sporule and ripe synthetic and secrete a large amount of nutritive substances and outer wall composition, so the death of this confluent monolayer cells is the basis that forms ripe and fertile flower powder.On the other hand, the normal formation of the degraded of tapetum and extine exists and interdepends, inseparable a kind of relation.Existing gene engineering technique is to be applied on the basis that is based upon abundant research of plant development process molecular regulation mechanism and understanding, therefore, the further investigation rice tapetum is grown and sporule ripening process, molecular regulation mechanism and regulated and control network and to be applied be the basis of the novel male sterile plant of research and development system on producing.The death and the normal development of sporule outer wall that hinder tapetal cell are the effective ways of cultivating rice male-sterile plants system.But at present molecular regulation network that rice tapetum is grown and extine composition and molecular regulation mechanism thereof and network are not clear.
Find there be not to find the report relevant so far with male sterility gene TCL of the present invention, encoded protein and promotor, plasmid and host cell through literature search to prior art.
Summary of the invention
The objective of the invention is to overcome the deficiencies in the prior art, a kind of male sterility gene TCL, encoded protein and promotor, plasmid and host cell are provided.TCL gene of the present invention is the anther-specific expression gene, this gene has the function of keeping Rice Anther tapetal cell programmed death, the disappearance of this gene function causes tapetal cell to necrose, and influences the growth of pollen and outer wall thereof then, causes the male sterile of paddy rice.
The present invention realizes by following technical scheme:
First aspect the present invention relates to a kind of male sterility gene TCL, this genes encoding following (a) or (b) described protein:
(a) protein of forming by the aminoacid sequence shown in the SEQ ID NO:2,
(b) aminoacid sequence in (a) is through replacing, lack or adding one or several amino acid and have the tapetal cell of an influence programmed death active by (a) deutero-protein.
Preferably, the base sequence of described gene is shown in SEQ ID NO:1.
Second aspect the invention still further relates to a kind of promotor that starts described genetic expression, and its base sequence is shown in SEQ ID NO:3.
The third aspect the invention still further relates to aforesaid male sterility of rice gene TCL encoded protein matter, and this proteinic aminoacid sequence is shown in SEQ ID NO:2.
Fourth aspect the invention still further relates to a kind of plasmid, and this plasmid comprises the gene of base sequence shown in SEQ ID NO:1.
Preferably, described plasmid also comprises the promotor of base sequence shown in SEQ ID NO:3.
The 5th aspect the invention still further relates to a kind of host cell, and this host cell comprises the gene of base sequence shown in SEQ ID NO:1.
Preferably, described host cell also comprises the promotor of base sequence shown in SEQ ID NO:3.
Compared with prior art, the present invention has following beneficial effect: the present invention has vital role at the programmed death of excavating and utilizing the early stage tapetum of paddy rice sporule aspect pollen and outer wall thereof, fertility, can or suppress the TCL gene by gene knockout and cause the new male sterible series of rice of unusual dead acquisition of tapetal cell, be used for producing cenospecies, in agriculture production, have crucial application.
Description of drawings
The morphological observation synoptic diagram of Fig. 1 tcl mutant plant;
Fig. 2 tcl mutant flower pesticide tapetal cell programmed death signal detection synoptic diagram;
Location, Fig. 3 TCL seat synoptic diagram;
The morphological observation figure of the complementary plant of Fig. 4 tcl;
Fig. 5 tcl mutant and wild-type 9522 anther tissues section synoptic diagram;
Fig. 6 TCL promoter activity analysis chart.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.These embodiment only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, for example the Sambrook equimolecular is cloned: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Term " coding influences the active proteic gene of tapetal cell programmed death " refers to encode and has the nucleotide sequence of regulation and control extine cutin monomer synthetic monooxygenase active polypeptide, as nucleotide sequence and the degenerate sequence thereof of base sequence shown among the SEQ ID NO:1 the 1st~2040.Degenerate sequence is meant, is arranged in the 1st~2040 Nucleotide of encoder block of SEQ ID NO:1 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO:1 in the 1st~2040 nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO:2 of also encoding out.This term also comprises can be under the moderate stringent condition, better under the height stringent condition with SEQ ID NO:1 in from the nucleotide sequence of the nucleotide sequence hybridization of the 1st~2040 in Nucleotide.This term also comprise with SEQ ID NO:1 in from the homology of nucleotide sequence at least 70% of the 1st~2040 in Nucleotide, preferably at least 80%, more preferably at least 90%, at least 95% nucleotide sequence best.This term also comprises encoding to have the variant form of open reading frame sequence among the proteic SEQ ID NO:1 with the identical function of natural adjusting and controlling rice flower pesticide tapetal cell programmed death.These variant forms comprise (but being not limited to): several (are generally 1~90, preferably 1~60, more preferably 1~20,1~10 best) disappearance, insertion and/or the replacement of Nucleotide, and at 5 Salvage? or 3 Relying song press and smooth postal? be generally in 60, preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
Term " influences the active albumen of tapetal cell programmed death " and refers to have the active SEQ ID of adjusting and controlling rice flower pesticide tapetal cell death protein NO:2 polypeptide of sequence.This term also comprises the variant form that has with the PHD finger Protein S EQ ID NO:2 sequence of natural adjusting and controlling rice flower pesticide tapetal cell programmed death.These variant forms comprise (but being not limited to): several (are generally 1~50, preferably 1~30, more preferably 1~20,1~10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.In the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance; Add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.
Among the embodiment, can select various carrier known in the art for use, the carrier as commercially available comprises plasmid, clay etc.When producing the Rice Anther tapetal cell programmed death related polypeptide of present embodiment, adjusting and controlling rice flower pesticide tapetal cell death protein encoding sequence operationally can be connected in expression regulation sequence, thereby form adjusting and controlling rice flower pesticide tapetal cell programmed death correlative protein expression carrier.
Term " operationally is connected in " and refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promoter regulation sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, then means in reading frame adjacent for the secretion leader sequence.
Term " host cell " is an eukaryotic cell, and eukaryotic host cell commonly used comprises yeast cell, rice cell and other vegetable cell.
Associated nucleotide full length sequence or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be according to the disclosed relevant nucleotide sequence of present embodiment, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
Except producing with recombination method, the also available solid phase technique of proteic fragment is produced by direct peptide synthesis among the embodiment.Can carry out by hand or automatically at external synthetic protein.Can distinguish proteic each fragment of chemosynthesis present embodiment, be connected to produce the molecule of total length with chemical process then.
Term " promotor " refers to the section of DNA sequence for RNA polymerase identification, combination and transcriptional start.Synthetic being called of RNA, transcribe under DNA instructs, the initial promotor control by DNA of transcribing.
Embodiment utilizes gamma-rays that japonica rice 9522 strains are handled, and for selecting the unusual mutant of anther development, selecting separation is research object than the recessive single-gene mutant that is 3: 1 at F2 in the plantation back.Obtain the new recessive male sterile mutant of a paddy rice tcl.By hereditary localization method, at first the mutator gene seat is positioned between paddy rice the 9th karyomit(e) InDel mark Ch901 and the Lh901.Further Fine Mapping, we have developed 5 pairs between these two marks have polymorphism InDel molecule marker, and this locus is positioned between Lh903-8 and the Lh903-5, and physical distance is 63.6kb.This zone comprises 7 encoding genes, one of them the coding proteic gene of PHD finger and Arabidopis thaliana male sterility gene MS1 homology, by twice order-checking to this gene, there is the insertion of a T base at second intron place of this gene of discovery mutant tcl, determines that by the function complementation experiment analysis dysfunction of male sterility gene TCL has caused the sterile of paddy pollen.By sterility of anthers mutant tcl development of floral organs being carried out tissue slice, scanning electron microscope, chromosome observation each period, after the sudden change of finding this gene can cause the paddy rice sporule to discharge from tetrad, tapetal cell does not have the PCD signal, sporule tapetal cell in mid-term is expanded gradually, and the tapetal cell content is infiltrated in the flower pesticide chamber, sporule begins degraded, WUHUAFEN grain in the mature anther; Adding molecule mark GUS analysis revealed TCL gene by promotor expresses in early stage tapetum of sporule and sporule; RT-PCR shows that also the TCL gene is specific expressed in flower pesticide, does not all express in root, stem, leaf and flower glume; Biochemical measurement analysis revealed mutant flower pesticide surface wax composition increases; Complementation test shows that the TCL gene can recover the phenotype of mutant.Illustrate that this gene function is the pollen development that has influence on paddy rice really, this influence may be to realize by the programmed death of regulating the flower pesticide tapetal cell.
Embodiment 1
Acquisition of tcl mutant plant and morphologic observation
With 60Co gamma-ray and mutagenesis japonica rice 9522 seeds, treatment dosage is 280Gy, gets mutant.To the F2 of mutagenesis in generation a male sterile mutant three generations backcross, obtain the mutant tcl of the genetic stability of recessive single-gene regulation and control.All vegetable materials are planted in the test base, Academy of Agricultural Sciences, Shanghai City.Tcl mutant and japonica rice 9522 are backcrossed, and F1 is for being to educate all, and separating appears in generation in selfing F2, and wherein normal plant is 189, and mutant strain is 55 (χ 2=0.65), shows that this male sterile mutation type surface is caused by a monokaryon transgenation.Morphological observation to tcl mutant plant.As Fig. 1, the phenotype contrast of wild-type and mutant tcl shows: the solid back of wild-type spike of rice sagging (left side), and the shaky vertical (right side) that is of tcl mutant small ear, wild-type flower pesticide comprises mature pollen and is rendered as yellow (left side) (B, C), mutant tcl flower pesticide is faint yellow and WUHUAFEN grain (right side) (B, C).
Embodiment 2
The programmed death signal detection of tcl mutant flower pesticide tapetal cell
Step 1, the paraffin section preparation of each etap wild-type and mutant tcl flower pesticide
(1) material requested an amount of (be no more than stationary liquid volume 1/20) is got in the penicillin bottle that fills the FAA stationary liquid.Slowly bleed (pumping process 10 minutes) with vacuum pump, vacuum state (>20atm) place 15 minutes after, slowly venting (deflation course 10 minutes).Can be observed the air vesicle and emerged, at the bottom of sample sinks to bottle, 4 ℃ of preservations;
(2) dehydration; Gradient is respectively: 50% ethanol (plant tissue sink to bottle at the bottom of explanation to bleed be sufficient), 50% ethanol, 60% ethanol, 70% ethanol, 85% ethanol, 95% ethanol, 100% ethanol, 100% ethanol, 1/4 dimethylbenzene, 3/4 ethanol, 1/2 dimethylbenzene, 1/2 ethanol, 3/4 dimethylbenzene, 1/4 ethanol, under the room temperature every grade 30 minutes.90% dimethylbenzene, 10% chloroform, 90% dimethylbenzene, 10% chloroform, 90% dimethylbenzene, 10% chloroform, under the room temperature every grade 60 minutes, at last 90% dimethylbenzene, 10% chloroform is filled half of penicillin bottle volume;
(3) with the careful sample flasket that contains 1/2 volume, 90% dimethylbenzene, 10% chloroform that drops into of 3~5 wax disk(-sc)s, and bottle is positioned in the baking oven that is tuned to 42 ℃, bottle is shaken in the wax dissolving gently after about 15 minutes, make dissolved paraffin uniform distribution, add 3~5 wax disk(-sc)s again.The back bottle is gradually full several times, keeps after 30 minutes, material is changed over to rapidly with tweezers be placed with in the new penicillium bottle that melts good wax disk(-sc) (on 60 ℃ baking oven), spends the night.Sooner or later respectively change wax 1 time every day, oozes best 2~3 day time of wax;
(4) embedding; Solvent paraffin in the canoe of going into to roll well, is clipped to material in the canoe with the tweezers that burn heat, and sets the position.The wax for the treatment of the surface coagulates slightly, canoe is dipped in rapidly in the cold water of having got ready, places at least 2 hours.Available clean container installed and places 4 ℃ to deposit after embedded wax stone dried;
(5) open 45~50 ℃ in baking oven in advance, the slide glass shelf is wrapped with disposable glove, put in the baking oven.Open 42 ℃ in exhibition sheet machine, (every adds water 2~3ml) to the water on the preheating slide glass.Roughly repair earlier piece, the meticulous again piece of repairing, 8~10 microns of slice thicknesses.42 ℃ of exhibition sheets use the dustless paper of wiping away when blotting.42 ℃ of exhibitions got final product in 1 minute.The slice, thin piece of Zhan Haohou is put on 45~50 ℃ the slide shelf of baking oven, wraps with disposable glove, in order to avoid pollute, roasting sheet is more than 24 hours.
Step 2, the section pre-treatment
The method of section pre-treatment and PCD signal detection derives from the experimental procedure content that the apoptosis testing product test kit (017959) of Promega company provides, and is undertaken by the method that company provides, and experimental procedure is as follows
The section dewaxing will be cut into slices and be immersed fresh 100% dimethylbenzene 5min, repeat once;
100% washing with alcohol 5min;
The dehydration of ethanol gradient, 100%, 95%, 85%, 70%, 50% 3min at different levels;
Wash 5min among the 0.85%NaCl;
PBS washs 5min;
37% formaldehyde solution is diluted to 3.7% with PBS, the immersion of will cutting into slices, immobilization material 15min;
The PBS washed twice, each 5min;
Excessive moisture is removed in suction, and section is placed on the smooth desktop; Every Proteinase K that adds 100 μ L, 20 μ g/mL covers anther tissue; Hatch 8~10min; (annotate: Proteinase K helps staining agent infiltration histocyte in the subsequent step; For best effect, should select the suitableeest incubation time; 4~6 μ m slabs can the proper extension time; But time expand, may cause in the subsequent wash step material being split away off from slide; )
PBS washs 5min;
Fixing 5min in the PBS solution of 3.7% formaldehyde;
PBS washs 5min; (should prepare this moment DNase1 handles over against according to)
Step 3, the detection of tapetum PCD signal
Pat slide to remove excessive moisture, coated with 100 μ L level pads, balance 5~10min under the room temperature;
In equilibrium process, according to every section 45 μ L level pads, 5 μ L Nucleotide Mix and 1 μ LrTdT enzyme are prepared the rTdT incubation buffer; Annotate: the rTdT incubation buffer should be placed on ice, and lucifuge;
Negative contrast: prepare the incubation buffer of a no rTdT enzyme, comprise 45 μ L level pads, 5 μ L NucleotideMix and 1 μ L deionized water; Handle negative contrast section according to step 3~12;
Over against photograph: add under the 100 μ L DNase I damping fluid room temperatures and hatch 5min; Pat the branch that anhydrates, add the enzyme buffer liquid that 100 μ L contain the DNase I of 5.5~10units/mL, hatch 10min under the room temperature; Remove excessive moisture, in competent deionized water, wash 3~4 times; Handle over against shining section according to step 1~12;
Annotate: DNase I handles cell can make chromosomal dna fragmentization, and exposes 3 ' of a large amount of Gong mark-OH; Should use the another one staining jar to handle over against shining section, because the activity of residual DNase I can be introduced the intensive background to experimental group;
At 5cm 2Equilibrium region adds 50 μ L rTdT incubation buffer, does not allow the cell drying; Plastic film coatedly can cut half use, the edge be turned up be convenient to remove;
Make the reaction reagent uniform distribution with plastic film coated cell is covered; Put into capacity thieving paper in wet box bottom, add water to supersaturation; To cut into slices in wet box 37 ℃ and hatch 60min, end reaction is carried out; With aluminium foil wet box is wrapped up and to avoid light direct beam;
With deionized water is 20 * SSC 2 * SSC by dilution in 1: 10, pours staining jar into; Throw off plastic film coatedly, will cut into slices and immerse among the SSC 15min with termination reaction; (annotate: SSC must guarantee that before use all salt all dissolves)
PBS washing three times, each 5min is with unconjugated fluorescence 12-dUTP flush away;
Propidium iodide (PI) is diluted to final concentration 1 μ g/mL in PBS, pours in the staining jar; Section is put into, and 10min dyes in the dark;
Deionized water wash three times, each 5min;
Get rid of excessive moisture, with thieving paper cell periphery moisture is inhaled and gone;
On slide glass, drip anti-fluorescent quenching mountant, the cover glass mounting;
Seal around the cover glass with the nail varnish of cleaning, dry 5~10min;
In case of necessity, slide is placed in the wet box preservation of spending the night of 4 ℃ of dark; Observe green fluorescence under 520 ± 20nm, (notes: PI all dyes redness with apoptotic cell and non-apoptotic cell to observe the red fluorescence of PI down at>620nm; Fluorescence 12-dUTP then only is combined in the nuclear of apoptotic cell).
Among Fig. 2, A to D is the PCD signal detection of wild-type 9522 flower pesticide cells; A, no any PCD signal in the flower pesticide cell of the 6th etap; Can both detect the signal of PCD in the flower pesticide (Fig. 2 C) of the flower pesticide of the 8th etap (Fig. 2 B), the 9th etap and the flower pesticide of the 10th etap (Fig. 2 D).E to H is the PCD signal detection of mutant tcl flower pesticide cell; No any PCD signal is detected in the flower pesticide (Fig. 2 F) of the flower pesticide cell of the 6th etap (Fig. 2 E), the 8th etap, the flower pesticide of the 9th etap (Fig. 2 G) and the flower pesticide of the 10th etap (Fig. 2 H).
Embodiment 3
The location of TCL gene and clone
Step 1, target group, with tcl and long-grained nonglutinous rice strain Long Tefu B hybridization, selfing obtains F2 generation, and selecting is target group for male sterile plants wherein;
Step 2, paddy DNA extracts.Adopt improved CTAB method to extract, comprising the steps: to get blade 0.1~0.2 gram (about half sheet) is put in the little mortar, add an amount of liquid nitrogen, be ground to powdery at once, the 2ml centrifuge tube of packing into, the 1.5xCTAB solution that adds 100 ℃ of preheatings of 700ul is in centrifuge tube, put into 56 ℃ of water-baths behind the careful mixing, take out centrifuge tube after 20 minutes, add equal-volume chloroform/primary isoamyl alcohol, fierce mixing, centrifugal 10 minutes of 13000rpm, get supernatant in new pipe, put more than half an hour for-20 ℃ behind the adding 900ul dehydrated alcohol mixing.The DNA that separates out is centrifugal, centrifugal 10 minutes of 14000rpm.Remove supernatant, will precipitate with 1ml70% ethanol and clean once, centrifugal drying is dissolved in 200ul 1/10TE or the water, and 4 ℃ of refrigerators are preserved;
Step 3, the InDel molecular marker analysis.Designed 132 pairs of polymorphism marks altogether, the SSR primer according to reported sequence synthetic (specifically can referring to
Http:// www.gramene.org.microsat/ssr.htmlhttp: //www.gramene.org/microsat/ssr.html), other InDel molecule marker designs are according to the nucleotide sequence of having announced that compares 9311 liang of strains of the japonica rice warm and fine long-grained nonglutinous rice of Japan, partial design primer to difference, verify 2 parent japonica rice 9522 and the wide land of the long-grained nonglutinous rice polymorphism between short, the pcr amplification program is: in the 10ul system, the 1ul template, 1ul 10pmol/ul Primer1,1ul 10pmol/ul Primer2,1ul 10 * Buffer (Mg 2+), 1ul 2mM dNTP, 0.1ul Taq, 3.9ul water; Pass through 6% PAGE gel electrophoresis afterwards, silver staining method detects.
Step 4, colony's compartment analysis is location and Fine Mapping just
Use these polymorphism marks and carry out the pcr amplification analysis, find that in 194 target groups mutator gene is chain with Marker Ch901 and Lh901 performance on No. 9 karyomit(e), further enlarge target group (1162) and design other polymorphism mark location and find that this gene is in apart from between the Lh903-8 of 63.6kb and two Marker of Lh903-5 (Fig. 3 A).This zone comprises 7 encoding genes, the homologous gene that the proteic gene Os09g27620 of one of them coding PHD finger is Arabidopis thaliana male sterility gene MS1, by twice order-checking to this gene, there is the insertion of a T base at second intron place of this gene of discovery mutant tcl.With molecule marker the male sterile individual plant in the target group is carried out gene type assay, the sequence of used mark is as shown in table 1.
Table 1InDel molecule marker and nucleotide sequence thereof
?Marker?Name ?Forward?primer(5’-3’) ?Reverse?primer(5’-3’) ??BAC?Name
?CH901?LH903-5?LH903-8?LH903-9?LH903-2?LH902-3?LH901-1 ?CAACCCATTCACTGACCGT?TCCATGCCTGTGGGAACA?GGCGAAAACTAACTTGTAGC?CGATCCCTCCGTAACTAACT?GTGTTGCCATTGCGATTGAG?CGGAGATACTACACCGTGAC?CCCAATACTCACCATAATCAC ?CTGATCGCCGAAGCCTT?GACGGCTATGTCATCAACTGC?TCACTAGCTGCTGAAACGG?TTCTTGCTTTGTTCCTCCTA?GCCGAGCCTGTTGAAGATGA?CACAAACTCCAAGACGCAAT?AGCCTACTCACGGACTGTTT ??AP005420??AP005308??AP005308??AP005308??AP005308??AP005655??AP005676
Embodiment 4
The functional analysis of TCL gene
From paddy rice 9522 genomes, use primer
TCL-lpF5:5’-caccgtcgacGAGTTAACAAGTGGATGGTG-3’,
And TCL-3R1:5 '-TTTggatcc ACAGTTGAAGGACGGGAACGACAC-3 ';
Amplify the 5255bp fragment that contains TCL full-length gene group sequence, this fragment covers Os09g027620 upstream from start codon 3043bp and gene terminator codon place (not comprising terminator codon).This fragment is inserted among the Gateway carrier PGWB7 by SalI and BamH1, this makes up the correct back of sequence verification and imports Agrobacterium EHA105 by thermal shock, use hereditary means to transform mutant children fringe callus, whether can cause that to observe plant recovers the wild-type proterties.T 0In generation, obtain complementary plant, and Fig. 5 shows T 0In generation,, complementary plant tcl mutant pollen development recovered, and contained the mature pollen yellowing in the flower pesticide, and T1 can educate for occurring: the separation ratio of sterile plant is 3: 1 (23 strains can be educated: 7 strains are sterile).This shows that the Os09g027620 gene of being cloned is the gene that causes tcl mutant male sterile phenotype; Among Fig. 5, E: epidermal area, En: endodermis, Mi: middle level, T: tapetum, Tds: tetrad, Ms: sporule, DMs: the sporule of degraded, ST: the tapetum that expands.Observe by sterility of anthers mutant tcl development of floral organs being carried out tissue slice each period, the sudden change of finding the TCL gene can cause paddy rice can not degrade at the early stage tapetum of sporule, sporule can not develop into normal mature pollen grain, is thoroughly disintegrated in mutant flower pesticide at last (Fig. 5).Illustrate that the TCL gene is the male sterile gene of adjusting and controlling rice, the degraded of flower pesticide tapetum is had regulating and controlling effect.
Embodiment 5
The TCL promoter activity is analyzed
From paddy rice 9522 genomes, use primer TCL-lpF5:5 '-caccgtcgacGAGTTAACAAGTGGATGGTG-3 ' and TCL-pR:5 '-aaaggatccCACCATCTTAGGCGCCAT-3 ' to amplify the 3043bp fragment that contains the TCL promoter sequence.The TCL promotor that amplification obtains is inserted among the Gateway carrier pGWB3 by SalI and BamH1.Make up pGWB3:TCL Pro: GUS is converted in the wild-type rice callus tissue by agrobacterium mediation method.The expression pattern of the activation analysis TCL promotor by analyzing beta-galactosidase, root genetically modified heterozygote plant, stem, leaf, dye by the GUS staining fluid among small ear and the Xiao Hua, tissue after the dyeing is handled with 75% ethanol decolorization, finds that TCL mainly expresses in the flower pesticide in the 8th stage that Rice Anther is grown and the 9th stage.It is fixing that the material of decolouring processing is put into the FAA stationary liquid, dehydration, processing such as infiltration and resin embedding, by section (10 μ m are thick) and ammoniated ruthenium oxychloride dyeing (0.05%, w/v, pH 9) 20min, observe (Leica DM2500) down by opticmicroscope, we find that the TCL gene mainly expresses in tapetum, and in sporule expression are arranged also.Among Fig. 6 A, the 6th etap of 1-; The 8th etap of 2-; The 9th etap of 3-; The 10th stage of 4-; The 10th late period in stage of 5-.Among Fig. 6 B, the St-stamen; Among Fig. 6 C, T, tapetum; Ms, sporule.Arrow among Fig. 6 represents to present the painted flower pesticide of GUS.
Sequence table
<110〉Shanghai Communications University
<120〉male sterility gene TCL, encoded protein and promotor, plasmid and host cell
<130>10011
<160>3
<170>PatentIn?version?3.3
<210>1
<211>2215
<212>DNA
<213〉paddy rice (Oryza sativa)
<400>1
atggcgccta?agatggtgat?cagcctgggg?agctcgcggc?ggcggaagcg?cggcgagatg??60
ctgttccggt?tcgaggcctt?ctgccagccc?ggctacccgg?cgaacttcgc?cggcgccggc??120
ggcttcaggg?acaacgtgag?gacgctgctc?ggcttcgcgc?acctggaggc?cggcgtccac??180
ggcgagacca?agtgctggtc?gttccagctc?gagctgcacc?gccacccccc?caccgtcgtg??240
aggctcttcg?tcgtcgagga?ggaggtcgcc?gcctcgccgc?accgccagtg?ccacctctgc??300
cgccatattg?gtccgtcgaa?caaactacaa?ttaatcaatc?aacctttaca?taggattgat??360
ccgatcgatg?ccatggtgtt?gtagggtggg?ggaggcatct?gatatgcagc?aagaggtatc????420
acttcttgct?gccgaggagg?gaatcggcgg?cggaagccga?cggcctgtgc?ttcgcgatca????480
accacggcgg?cggcggtggc?gcggagaaag?cgtcgtcgaa?agggacgacg?acgacggcct????540
ccagcagagg?ccacctgcta?cacggcgtcg?tgcacctcaa?cggctacggc?cacctcgtcg????600
ccctccacgg?cctcgagggc?ggctccgact?tcgtctccgg?ccaccagatc?atggacctct????660
gggaccgcat?ttgctcagcc?ttgcacgtaa?ggtagtagta?gtatacatgt?gcgtgtgcat????720
gcatgcaagc?aatgcaacga?tgtcgggctg?cgtgtgagaa?catttgcttg?ggcatggtgt????780
ggtgtatgca?aggacggtga?gcctggtgga?cacggcgagg?aagggccaca?tggagctgag????840
gctgctgcac?ggcgtcgcgt?acggcgagac?gtggttcggg?cggtgggggt?acaggtacgg????900
ccggccgagc?tacggcgtcg?cgctgccgtc?gtaccggcag?tcgctgcacg?tgctcggctc????960
catgccgctc?tgcgtgctgg?tgccgcacct?gtcgtgcttc?agccaggagc?tccccatggt????1020
ggtcaccaag?taccaggcca?tcagcggcca?caagctgctc?agcctcggcg?acctcctccg????1080
cttcatgctc?gagctgcgcg?cccgcctgcc?ggccacctcc?gtcacggcca?tggactaccg????1140
gggcatcatg?tcggaggcct?cgtgccggtg?gtcggcgaag?cgcgtcgaca?tggcggcgcg????1200
cgccgtcgtg?gacgcgctcc?gccgcgccga?gccggcggcg?cggtgggtca?cgcggcagga????1260
ggtgcgcgac?gcggcgcgcg?cctacatcgg?cgacacgggc?ctcctcgact?tcgtgctcaa????1320
gtccctcggc?aaccacatcg?tcggcaacta?cgtcgtgcgc?cgcaccatga?acccggtgac????1380
caaggtgctc?gagtactgcc?tcgaggacgt?ctccagcgtg?ctcccggcgg?tcgccgccgg????1440
cggcggcgtg?ccggcgcagg?gcaagatgag?ggtgaggttc?cagctcacgc?gtgcgcagct????1500
catgagggac?ctggtgcacc?tgtaccggca?cgtgctcaag?gagcccagcc?aggcgctcac????1560
cggcggcgcg?ttcggcgcga?tcccggtggc?ggtgcggatg?gtcctggaca?tcaagcactt????1620
cgtcaaagat?taccacgaag?gacaagccgc?ggcgagcagc?aatggcggtg?gcggattcgg????1680
gcatccccac?atcaacctgt?gctgcacgct?gctcgtgagc?aacgggagcc?cggagctagc????1740
tccaccgtac?gagacggtga?ccctgccggc?gcacgcgacg?gtgggcgagc?tgaagtggga????1800
ggcgcagagg?gtgttcagcg?agatgtacct?cggcctgagg?agcttcgcgg?cggactccgt????1860
cgtcggggtc?ggcgccgacc?aggagggcct?cccggtgctc?gggctggtcg?acgtcggaag????1920
cgccgtcgtg?gtgcaaggga?gcgtgggcga?gcagataaac?ggggaggacc?acgagaggaa????1980
ggaggaggcg?gcggcggcgg?ccgtgtgcga?ggggagcggc?ggcggcgagc?gcgtcgtgga????2040
ctgcgcgtgc?ggcgcggtgg?acgacgacgg?cgagcgcatg?gcgtgctgcg?acatctgcga????2100
ggcgtggcag?cacacgcggt?gcgccgggat?cgcggacacc?gaggacgcgc?cgcacgtctt????2160
cctctgcagc?cggtgcgaca?acgacgtcgt?gtcgttcccg?tccttcaact?gttag????2215
<210>2
<211>679
<212>PRT
<213〉paddy rice (Oryza sativa)
<400>2
Met?Ala?Pro?Lys?Met?Val?Ile?Ser?Leu?Gly?Ser?Ser?Arg?Arg?Arg?Lys
1???????????????5???????????????????10??????????????????15
Arg?Gly?Glu?Met?Leu?Phe?Arg?Phe?Glu?Ala?Phe?Cys?Gln?Pro?Gly?Tyr
20??????????????????25??????????????????30
Pro?Ala?Asn?Phe?Ala?Gly?Ala?Gly?Gly?Phe?Arg?Asp?Asn?Val?Arg?Thr
35??????????????????40??????????????????45
Leu?Leu?Gly?Phe?Ala?His?Leu?Glu?Ala?Gly?Val?His?Gly?Glu?Thr?Lys
50??????????????????55??????????????????60
Cys?Trp?Ser?Phe?Gln?Leu?Glu?Leu?His?Arg?His?Pro?Pro?Thr?Val?Val
65??????????????????70??????????????????75??????????????????80
Arg?Leu?Phe?Val?Val?Glu?Glu?Glu?Val?Ala?Ala?Ser?Pro?His?Arg?Gln
85??????????????????90??????????????????95
Cys?His?Leu?Cys?Arg?His?Ile?Gly?Trp?Gly?Arg?His?Leu?Ile?Cys?Ser
100?????????????????105?????????????????110
Lys?Arg?Tyr?His?Phe?Leu?Leu?Pro?Arg?Arg?Glu?Ser?Ala?Ala?Glu?Ala
115?????????????????120?????????????????125
Asp?Gly?Leu?Cys?Phe?Ala?Ile?Asn?His?Gly?Gly?Gly?Gly?Gly?Ala?Glu
130?????????????????135?????????????????140
Lys?Ala?Ser?Ser?Lys?Gly?Thr?Thr?Thr?Thr?Ala?Ser?Ser?Arg?Gly?His
145?????????????????150?????????????????155?????????????????160
Leu?Leu?His?Gly?Val?Val?His?Leu?Asn?Gly?Tyr?Gly?His?Leu?Val?Ala
165?????????????????170?????????????????175
Leu?His?Gly?Leu?Glu?Gly?Gly?Ser?Asp?Phe?Val?Ser?Gly?His?Gln?Ile
180?????????????????185?????????????????190
Met?Asp?Leu?Trp?Asp?Arg?Ile?Cys?Ser?Ala?Leu?His?Val?Arg?Thr?Val
195?????????????????200?????????????????205
Ser?Leu?Val?Asp?Thr?Ala?Arg?Lys?Gly?His?Met?Glu?Leu?Arg?Leu?Leu
210?????????????????215?????????????????220
His?Gly?Val?Ala?Tyr?Gly?Glu?Thr?Trp?Phe?Gly?Arg?Trp?Gly?Tyr?Arg
225?????????????????230?????????????????235?????????????????240
Tyr?Gly?Arg?Pro?Ser?Tyr?Gly?Val?Ala?Leu?Pro?Ser?Tyr?Arg?Gln?Ser
245?????????????????250?????????????????255
Leu?His?Val?Leu?Gly?Ser?Met?Pro?Leu?Cys?Val?Leu?Val?Pro?His?Leu
260?????????????????265?????????????????270
Ser?Cys?Phe?Ser?Gln?Glu?Leu?Pro?Met?Val?Val?Thr?Lys?Tyr?Gln?Ala
275?????????????????280?????????????????285
Ile?Ser?Gly?His?Lys?Leu?Leu?Ser?Leu?Gly?Asp?Leu?Leu?Arg?Phe?Met
290?????????????????295?????????????????300
Leu?Glu?Leu?Arg?Ala?Arg?Leu?Pro?Ala?Thr?Ser?Val?Thr?Ala?Met?Asp
305?????????????????310?????????????????315?????????????????320
Tyr?Arg?Gly?Ile?Met?Ser?Glu?Ala?Ser?Cys?Arg?Trp?Ser?Ala?Lys?Arg
325?????????????????330?????????????????335
Val?Asp?Met?Ala?Ala?Arg?Ala?Val?Val?Asp?Ala?Leu?Arg?Arg?Ala?Glu
340?????????????????345?????????????????350
Pro?Ala?Ala?Arg?Trp?Val?Thr?Arg?Gln?Glu?Val?Arg?Asp?Ala?Ala?Arg
355?????????????????360?????????????????365
Ala?Tyr?Ile?Gly?Asp?Thr?Gly?Leu?Leu?Asp?Phe?Val?Leu?Lys?Ser?Leu
370?????????????????375?????????????????380
Gly?Asn?His?Ile?Val?Gly?Asn?Tyr?Val?Val?Arg?Arg?Thr?Met?Asn?Pro
385?????????????????390?????????????????395?????????????????400
Val?Thr?Lys?Val?Leu?Glu?Tyr?Cys?Leu?Glu?Asp?Val?Ser?Ser?Val?Leu
405?????????????????410?????????????????415
Pro?Ala?Val?Ala?Ala?Gly?Gly?Gly?Val?Pro?Ala?Gln?Gly?Lys?Met?Arg
420?????????????????425?????????????????430
Val?Arg?Phe?Gln?Leu?Thr?Arg?Ala?Gln?Leu?Met?Arg?Asp?Leu?Val?His
435?????????????????440?????????????????445
Leu?Tyr?Arg?His?Val?Leu?Lys?Glu?Pro?Ser?Gln?Ala?Leu?Thr?Gly?Gly
450?????????????????455?????????????????460
Ala?Phe?Gly?Ala?Ile?Pro?Val?Ala?Val?Arg?Met?Val?Leu?Asp?Ile?Lys
465?????????????????470?????????????????475?????????????????480
His?Phe?Val?Lys?Asp?Tyr?His?Glu?Gly?Gln?Ala?Ala?Ala?Ser?Ser?Asn
485?????????????????490?????????????????495
Gly?Gly?Gly?Gly?Phe?Gly?His?Pro?His?Ile?Asn?Leu?Cys?Cys?Thr?Leu
500?????????????????505?????????????????510
Leu?Val?Ser?Asn?Gly?Ser?Pro?Glu?Leu?Ala?Pro?Pro?Tyr?Glu?Thr?Val
515?????????????????520?????????????????525
Thr?Leu?Pro?Ala?His?Ala?Thr?Val?Gly?Glu?Leu?Lys?Trp?Glu?Ala?Gln
530?????????????????535?????????????????540
Arg?Val?Phe?Ser?Glu?Met?Tyr?Leu?Gly?Leu?Arg?Ser?Phe?Ala?Ala?Asp
545?????????????????550?????????????????555?????????????????560
Ser?Val?Val?Gly?Val?Gly?Ala?Asp?Gln?Glu?Gly?Leu?Pro?Val?Leu?Gly
565?????????????????570?????????????????575
Leu?Val?Asp?Val?Gly?Ser?Ala?Val?Val?Val?Gln?Gly?Ser?Val?Gly?Glu
580?????????????????585?????????????????590
Gln?Ile?Asn?Gly?Glu?Asp?His?Glu?Arg?Lys?Glu?Glu?Ala?Ala?Ala?Ala
595?????????????????600?????????????????605
Ala?Val?Cys?Glu?Gly?Ser?Gly?Gly?Gly?Glu?Arg?Val?Val?Asp?Cys?Ala
610?????????????????615?????????????????620
Cys?Gly?Ala?Val?Asp?Asp?Asp?Gly?Glu?Arg?Met?Ala?Cys?Cys?Asp?Ile
625?????????????????630?????????????????635?????????????????640
Cys?Glu?Ala?Trp?Gln?His?Thr?Arg?Cys?Ala?Gly?Ile?Ala?Asp?Thr?Glu
645?????????????????650?????????????????655
Asp?Ala?Pro?His?Val?Phe?Leu?Cys?Ser?Arg?Cys?Asp?Asn?Asp?Val?Val
660?????????????????665?????????????????670
Ser?Phe?Pro?Ser?Phe?Asn?Cys
675
<210>3
<211>3043
<212>DNA
<213〉paddy rice (Oryza sativa)
<400>3
gagttaacaa?gtggatggtg?cttactgatt?ctgcttggaa?gattggagca?aaaggactag????60
aaagtgcatt?cttgaaggtt?ctttgtgatc?ctctttatta?ttattttcct?ttgtatccct????120
ccagtttttc?tttttctttt?gactaattca?gttttttttc?cttgaagggt?ggtagtgcat????180
tgactctgaa?aatgatctat?gaatcggtag?gtatactgtt?ttatgaagtt?agattgattt????240
tactttttct?tacagcatca?ttagacatta?atggacttat?catcatggta?gttagccaag????300
agactatctg?gaaagctgct?catggaggct?ggtaaatatg?agataaagaa?agaacttcta????360
aagcaggtat?atgtatttta?gttgatatct?gtaagcaatt?tttcctgatt?ttattatttg????420
ctcatctcat?aattctttta?acagaataat?agatatactc?atgttctggc?cccacctgaa????480
aaatgcagta?gcatagcttg?atacacagat?catatacaca?agctgtaact?atttttttaa????540
ttgttataat?aaatatcctt?tgggagtact?gaggtttgcc?atctgcaggg?tggacgatta????600
gctgctgtta?atctggagtc?tcgagctggt?ttgcttgcag?ctaggcaggt?aacattctca????660
tctgtcagca?gctacttcca?tgcataattg?gtatattatg?ctcccagtat?tatctgaaaa????720
actgcacatt?ttagatggtc?gtttgaataa?tcctcttgaa?tgtatgcatg?cagggtttgg????780
cacgtgcagc?atctagatat?gttggtctta?ggagtgtcat?gacgtttctt?ggaccaatgt????840
atgtttctgc?taatatatct?ggaatctgtt?tgttgctgta?tttttttaaa?tcaataatac????900
actatcaggt?ttccgcatgt?ttctataaaa?aatttgacct?cttttccttt?ttggtcaata????960
gtaggttctt?atggttaatt?tatttttggg?tgcatgatgt?attcatgttt?tgctacttca????1020
acttgctgtt?ctgagtttac?tgtttgtcag?atctactttt?taagtaatga?ttcattcaca????1080
ataagcttct?tcaaatgctt?tgttgtgttg?aattttgagc?agactataaa?tcagttactg????1140
actcttctgt?tctacaactt?cttgctgcat?agaatgtggg?ggacactctt?ggctgacatt????1200
gtgatccaaa?tgcttgggac?agactatgct?agaattgtgc?aggcaatcta?tgcttttgct????1260
caggtgagct?tctgattgtt?cagtttttcg?tccagtaact?cactgtccat?ccattgagtt????1320
cacatcttag?cctttctaac?agattcggct?gactaggaca?tcttacatag?aatctcatga????1380
agaataatca?acagtgggac?atttctggtc?tggactaaca?gggcattctg?ggcccatagt????1440
gtacattctg?atcatgcaga?acatttttgg?ttgagtgctg?gcgcaattct?cccaagagga????1500
ctcgaggaca?gtaagttcat?actttcacag?aagttgtgca?gctgatgtaa?atgcatagaa????1560
gttagatgac?agaacaattg?atagatgcta?ggtaggatag?atggtacaga?tgacacacaa????1620
atcatctatg?cttttgaatt?ctccaaggtt?taaggctgct?gcttaagtga?gagcttgtta????1680
tacattccag?gaaaaattaa?tttactgcca?ctatagaatg?gtgtaattgt?atttaagaaa????1740
tagctcacaa?tgaccattag?ggccacctac?tctctaaacg?cggtagttgt?gaatgaatat????1800
acatccactt?cacacttcca?cgagggcccg?aagttgtaga?ccatgcattc?cattctgctc????1860
cagttaatta?tgcaacaaaa?cggttcccct?gatcttaaac?tattgccccc?ctaacattca????1920
gttaggcaag?gcatacttca?ttgacattag?tccatgctta?tcccagccat?atgttacaga????1980
tatgcttacg?tgtaaacacc?agggcataat?ttgcatgttg?caccctgctt?attcccctta????2040
tcaaaacact?agcaactaat?ttatcagtac?aggctagata?tcattattca?aaatcgcaac????2100
aagtatggta?tactcacatt?accaaaactt?gccatacttc?atttagctaa?catgtctaac????2160
atgtggccaa?caaaattaaa?gccacacttt?agccatagga?gagtaaactt?gccacacttt????2220
tatgtgccaa?tgacatgtag?gacccacatc?atggtgaagg?aatcttgtta?aaagtgtggc????2280
accaaccaaa?cgaatgccta?actaagtcaa?acctggctaa?cttgagttgt?ggcatgatga????2340
ggcaaattgt?ggtagtgaac?caaacaaccc?cttaatatct?acttcctccg?tttcaggtta????2400
taagacttca?ttgcctacat?tcatatagat?gttaacgaat?ctagacacat?ttatataaat????2460
gtgtctagat?tcgttaacat?ctatatgaat?gtatataaat?gtgtctagat?tcgttaaaca????2520
tctatatgaa?tgtgggcaat?actagaaatt?cttataacct?gaaatggatg?tagtactaga????2580
ttgtgtaaca?attcagatag?ctagtgcaat?tggtgattga?ttaattttac?agtccttatg????2640
tatttggagg?tatcataatc?ttaagtgtta?atttgtgata?cctcctggtc?ctcaacacta????2700
gagagatact?aagtggtaac?actgcaaaat?gtggcatctc?ctggtacctt?ttaagtacca????2760
aatgcactag?gtgcctttgc?gcaaaattcc?cagatgagag?gacccaattt?gtgatcgtgt????2820
gcgacatgtc?tagaagggtg?gcccattgtt?tacattcctt?caccagatcg?ccgaagcttt????2880
ctaaatcgcg?ggcacttaac?gcgtgagaag?cccaatgaga?cctccaaatg?ctaaccttaa????2940
aatcgcagcg?ctgcacggcg?acatggtctc?ctagctagct?gcctagcttc?tcggcgacgt????3000
tgattggcag?caactagcta?gctcgccgtc?cggccggccg?gcc??????????????????????3043

Claims (8)

1. a male sterility gene TCL is characterized in that, this genes encoding following (a) or (b) described protein:
(a) protein of forming by the aminoacid sequence shown in the SEQ ID NO:2,
(b) aminoacid sequence in (a) is through replacing, lack or adding one or several amino acid and have the tapetal cell of an influence programmed death active by (a) deutero-protein.
2. male sterility gene TCL according to claim 1 is characterized in that, the base sequence of described gene is shown in SEQ ID NO:1.
3. a male sterility gene TCL expression promoter according to claim 1 is characterized in that, its base sequence is shown in SEQ ID NO:3.
4. a male sterility gene TCL encoded protein matter according to claim 1 is characterized in that this proteinic aminoacid sequence is shown in SEQ ID NO:2.
5. a plasmid is characterized in that, this plasmid comprises the gene of base sequence shown in SEQ ID NO:1.
6. plasmid according to claim 5 is characterized in that, described plasmid also comprises the promotor of base sequence shown in SEQ ID NO:3.
7. a host cell is characterized in that, this host cell comprises the gene of base sequence shown in SEQ IDNO:1.
8. host cell according to claim 7 is characterized in that, described host cell also comprises the promotor of base sequence shown in SEQ ID NO:3.
CN201010301369A 2010-02-08 2010-02-08 Male sterility gene TCL, coded protein and promoter, plasmid and host cell Pending CN101805741A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201010301369A CN101805741A (en) 2010-02-08 2010-02-08 Male sterility gene TCL, coded protein and promoter, plasmid and host cell

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201010301369A CN101805741A (en) 2010-02-08 2010-02-08 Male sterility gene TCL, coded protein and promoter, plasmid and host cell

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN 201110101911 Division CN102242110B (en) 2010-02-08 2010-02-08 Application of a vector with male-sterile gene TCL

Publications (1)

Publication Number Publication Date
CN101805741A true CN101805741A (en) 2010-08-18

Family

ID=42607695

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201010301369A Pending CN101805741A (en) 2010-02-08 2010-02-08 Male sterility gene TCL, coded protein and promoter, plasmid and host cell

Country Status (1)

Country Link
CN (1) CN101805741A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102559685A (en) * 2012-03-12 2012-07-11 西南大学 Anther tapetum specific expression promoter POsABCG15, recombinant expression vector thereof and application thereof
CN106434708A (en) * 2016-08-24 2017-02-22 海南波莲水稻基因科技有限公司 Rice MSP1 gene mutant, and molecular identification method and application thereof

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102559685A (en) * 2012-03-12 2012-07-11 西南大学 Anther tapetum specific expression promoter POsABCG15, recombinant expression vector thereof and application thereof
CN102559685B (en) * 2012-03-12 2013-01-23 西南大学 Anther tapetum specific expression promoter POsABCG15, recombinant expression vector thereof and application thereof
CN106434708A (en) * 2016-08-24 2017-02-22 海南波莲水稻基因科技有限公司 Rice MSP1 gene mutant, and molecular identification method and application thereof

Similar Documents

Publication Publication Date Title
CN100429311C (en) EPSP synzyme of high anti-cancrinia discoidea and its coding squence
Quesada et al. Genetic analysis of salt-tolerant mutants in Arabidopsis thaliana
US20170306421A1 (en) Gene dro1 controlling deep-rooted characteristics of plant and utilization of same
CN105112441A (en) Plants having enhanced yield-related traits and a method for making the same
Wang et al. Transcriptomic analysis of grapevine Dof transcription factor gene family in response to cold stress and functional analyses of the VaDof17d gene
US7745602B2 (en) Compositions and methods for drought tolerance
CN106232818A (en) Improvement plant
Sun et al. A late embryogenesis abundant protein GsPM30 interacts with a receptor like cytoplasmic kinase GsCBRLK and regulates environmental stress responses
AU2009251938B2 (en) Methods and compositions for plant improvement
CN102242110B (en) Application of a vector with male-sterile gene TCL
CN101798579A (en) Jatropha curcas farnesyl pyrophosphate synthase protein encoding sequence and application thereof in plants
CN108103074B (en) Bispica brachypodium japonicum drought-resistant gene, expression vector, coding protein and application thereof
CN110229825A (en) The brown Leaf color mutant GBL1 gene of rice ash and its application
CA2703701A1 (en) Resistance gene and uses thereof
CN101935342B (en) Moth orchid development B gene-PhAP3 coded sequence and application thereof
CN101805741A (en) Male sterility gene TCL, coded protein and promoter, plasmid and host cell
CN106793762A (en) Tomato plants with pink gloss fruit
CN101798576B (en) Encoding sequence for Late Embryogenesis Abundant protein of Jatropha curcas and application in plants
US20120185958A1 (en) Introgression of Festuca mairei Drought Tolerant Genome into Lolium Perenne Plants
BR112021011352A2 (en) EXPRESSION CONSTRUCTION, VECTOR, PLANT OR PLANT CELL, HARVEST PART OF A PLANT, METHODS FOR CHECKING, INCREASE OR MODIFYING RESISTANCE IN A PLANT AND FOR PRODUCTION OF A TRANSGENIC PLANT, USE OF AN EXPRESSION CONSTRUCTION, PRODUCT OF A PLANT, METHODS OF IMPROVING A PLANT AND IDENTIFICATION OF AN AGENT AND COATED PLANT
CN109055390A (en) Application of the rice Os ERF101 gene in the case where improving dry weather on Seed-Setting Percentage in Rice
CN101186919B (en) Protein coded sequence for regulating and controlling temperature and light sensitive nuclear sterility
AU2018242633A1 (en) Methods for improving traits in plants
Huang et al. BnEPFL6, an EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) secreted peptide gene, is required for filament elongation in Brassica napus
Duan et al. Genetic analysis and gene mapping of leafy head (lhd), a mutant blocking the differentiation of rachis branches in rice (Oryza sativa L.)

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Open date: 20100818