WO2014154115A1

WO2014154115A1 - Spt transformation event of rice and detection method thereof

Info

Publication number: WO2014154115A1
Application number: PCT/CN2014/073891
Authority: WO
Inventors: 邓兴旺; 王海洋; 周君莉
Original assignee: 铁岭先锋种子研究有限公司
Priority date: 2013-03-25
Filing date: 2014-03-21
Publication date: 2014-10-02
Also published as: CN104067944A; CN104067944B; WO2014154115A4; PH12015502256A1; CN111118053B; CN111118053A

Abstract

Provided is a transgenic rice plant containing a seed production technical event and the plant genome DNA flanking a transgenic sequence. Additionally provided is the fertility recovery of a homozygous recessive genic male sterile rice plant, and uses of said homozygous recessive genic male sterile rice plant. Specifically provided are rice transformation events SPT-7R-949D and SPT-7R-1425D, a primer pair, a probe pair or a reagent kit for detecting and identifying said rice transformation events, a method for using said primer pair, probe pair or reagent kit to detect a transformed plant and offspring thereof, including a construct, a tissue, an organ, a plant or a seed of a plant related to the rice transformation event, and also a method for constructing male sterile line of rice, a method for restoring the male fertility of a sterile rice plant, and a method for preparing hybrid rice.

Description

Rice SPT transformation event and its detection method

Technical field

The invention relates to the field of plant molecular biology and breeding. In particular, embodiments of the invention relate to transgenic rice plants comprising seed production technology events and plant genomic DNA flanking the transgene sequences. More specifically, the present invention relates to fertility restoration of homozygous recessive nuclear male sterile rice plants and uses thereof. Further, the present invention relates to a method for constructing a rice male sterile line, a maintainer line, and a transformation event, and more particularly, the present invention relates to a construct, a rice cell, tissue or organ, and a method for constructing a rice male sterile line , a method for restoring male fertility of a rice sterile plant, a method for preparing rice seeds, a transformation event, a rice transformation event SPT-7R-949D, a rice transformation event SPT-7R-1425D, a primer for detecting a rice transformation event, a kit for detecting a rice transformation event, specifically, the kit is used to identify a binding region of the inserted T-DNA and plant genomic DNA and further identify the seed of the transformation event and Other tissue methods, a method for preparing hybrid rice, and a rice male sterile line for use in preparing hybrid rice.

Background technique

Commonly used in rice cross breeding is the "three lines" and "two lines" hybrids. The "three-line" hybrid requires specific restorer lines and maintainer lines, and the breeding program and production process are complex. The selection of new sterile lines and new combinations has a long cycle and low efficiency, and the utilization rate of germplasm resources is less than 5%. In addition, the three-line hybrid rice has weak heterosis, and the sterile cytoplasm is relatively single, and there is a potential danger of some devastating pest and disease outbreak. The "two-line" hybrid rice is not restricted by the relationship between restorer lines and maintainer lines, and the genetic diversity of the parents is significantly improved. The speed of breeding high-yield hybrid rice combinations is significantly accelerated, which promotes the research and production of super hybrid rice. . However, most of the sterile lines used in the "two-line" crosses are "light-temperature-sensitive" sterile lines, and their fertility is affected by temperature and light in the environment. The instability of these environmental factors will directly affect the purity and quantity of hybrid seeds, increase the risk of seed production, and cause serious economic losses to enterprises and farmers in severe cases, limiting the large-scale promotion of "two-line" hybrid rice. Moreover, the two-line hybrid rice sterile line that can be selected by the current technology is very limited. For example, there is almost no good two-line hybrid combination in the japonica rice variety, which limits the full utilization of the variety resources. Thus, the development of stable sterile lines that are not affected by the environment and can be propagated autonomously has become a technical bottleneck that limits the widespread use of "two-line" hybrid technology.

Therefore, the current rice hybridization technology still needs to be improved. The expression of a foreign gene in a plant is influenced by its insertion site in the plant genome, possibly due to a chromatin structure (such as a heterochromatin structure) surrounding the insertion site or a nearby transcriptional regulatory element ( (Weising et al., Foreign genes in plants: transfer, structure, expression, and applications. (1988) Ann. Rev. Genet 22:421-477), for example, can be observed in an exogenous source. There are large differences in the expression levels of exogenous genes among the many lines with different insertion sites, and the difference in the expression of exogenous genes in different transformed lines can be observed. It is not caused by an expression cassette constructed by an expression control element such as an artificially selected promoter. At the same time, the integration of foreign genes at different locations in the plant genome affects the overall phenotype of the plant. For example, the insertion of a foreign gene into the plant genome will affect the expression of the plant endogenous gene at the insertion site. . Therefore, in the creation process of transformation events, it is necessary to produce tens of thousands of independent transformed lines. By screening a large number of transformed lines, an optimized event that meets the requirements of industrialization is identified, and the desired foreign gene is obtained. Integrate loci and expression levels/patterns without affecting other phenotypes of the plant. Further, the exogenous gene of the optimized event can be transferred to other cultivars of the genetic background by hybridization through a conventional breeding method of backcrossing, and the progeny of these hybrids are endowed with the transgene expression of the original transformant. Characteristics, at the same time, also maintain a variety of excellent traits of the original variety.

In plants or seeds or their progeny or progeny of sexual crosses, it is important to specifically detect the presence or absence of a particular transformation event, and the event-specific detection method can identify the inserted foreign DNA and the recipient genome. A unique junction, which involves not only the transgene itself, but also its insertion integration position in the genome of the host plant or seed. In addition, methods for detecting specific events are also very helpful for compliance with pre-market licensing and labeling of plant foods, or for environmental monitoring and monitoring of crop traits in the field.

Summary of the invention

The present invention is directed to solving at least some of the above technical problems or at least providing a useful commercial choice. To this end, an object of the present invention is to provide a means for efficiently constructing a novel and stable recessive rice male sterile line and making full use of rice germplasm resources for cross breeding and improving the purity of the hybrid.

The present invention was completed based on the following findings of the inventors: the inventors used a homozygous recessive nuclear male sterile rice mutant as a transforming receptor material to transform three closely linked target genes into the sterile rice mutant receptor. In the plant. The three target genes are rice fertility restoration genes, pollen inactivation genes and colors. Mark the screening gene. Among them, the fertility restoration gene can restore the transformation of infertility by sports. The pollen inactivating gene can inactivate the pollen containing the transformed foreign gene, that is, the ability to inseminate, and the screening gene can be used for transgenic seeds and non-GM seeds. Sorting, sorted non-GM seeds are used as hybrid lines for the production of sterile lines, and transgenic seeds are used as a source of maintenance to continuously and stably produce sterile lines. For example, according to one embodiment of the present invention, the rice nuclear recessive sterile ms26 I ms26 mutant can be used as a transforming receptor material, and three closely related target genes can be transformed into the sterile line: wherein, the fertility restorer gene OsCYP704B2 (corresponding to wild-type rice MS26 gene) can restore the transformation of sports; pollen inactivation gene Zm-AAl can inactivate pollen containing foreign genes, ie lose fertility; fluorescent color selection gene DsRed(r) For the sorting of transgenic seeds and non-transgenic seeds, the sorted non-transgenic seeds are used as hybrid lines for the production of sterile lines, and the transgenic seeds are used as a source of the maintainer system to continuously produce the sterile lines. Because the technology uses biotechnology to produce non-GM products, it solves the bottleneck problem in the process of rice hybridization, that is, the low utilization rate of the three-line method and the instability of the sterile line in the two-line method.

Thus, in one embodiment of the invention, the invention proposes a construct. According to an embodiment of the present invention, the construct comprises: a first expression cassette, the first expression cassette comprising a first nucleic acid molecule, the first nucleic acid molecule encoding a rice male sterility recovery gene; and a second expression cassette, The second expression cassette contains a second nucleic acid molecule encoding a pollen inactivating gene. The construct can effectively introduce the rice male sterility recovery gene and the pollen inactivating gene into the homozygous recessive nuclear male sterile rice mutant plant, thereby obtaining a fertile plant carrying the foreign gene as a maintainer. Therefore, it is convenient to continuously produce the sterile line and the maintainer line by selfing, and in addition, the plant which does not carry the foreign gene can be used as the female parent of the hybrid. Thus, it can be effectively used for rice hybridization, and the obtained hybrid is also non-transgenic.

Thus, the aforementioned construct can be introduced into cells, tissues or organs of rice by a conventional technique such as Agrobacterium-mediated method to obtain a sample which can be subsequently used for research and hybridization. Thus, in a second aspect of the invention, the invention proposes a rice cell, tissue or organ. According to an embodiment of the invention, the rice cell, tissue or organ contains the construct described above.

In a third aspect of the invention, the invention proposes a method of constructing a rice male sterile line. According to an embodiment of the present invention, the method comprises: introducing the construct described above into a first rice homozygous recessive male sterile plant to obtain a second rice plant carrying the foreign gene, the second rice Plants are capable of producing fertile male gametes and are therefore capable of self-fertilization, with seeds carrying foreign genes and seeds not carrying foreign genes, each accounting for 50%. Among them, seeds that do not carry foreign genes can be used as Rice male sterile line. Thus, it is convenient to continuously produce the sterile line and the maintainer line by selfing, and in addition, the plant which does not carry the foreign gene can be used as a parent of the hybrid. Thus, the method can be effectively used for rice hybridization.

In a fourth aspect of the invention, the invention proposes a method of restoring male fertility in a rice sterile plant. According to an embodiment of the invention, the method comprises: introducing the construct described above into a rice homozygous recessive male sterile plant.

In a fifth aspect of the invention, the invention provides a method of preparing rice seeds. According to an embodiment of the invention, the method comprises the steps of: introducing the construct described above into a rice plant; and self-fertilizing the rice plant to obtain a seed comprising the construct described above. In a sixth aspect of the invention, the invention proposes a conversion event. According to an embodiment of the present invention, the transformation event is obtained by introducing the aforementioned construct into a rice homozygous recessive male sterile plant, wherein the construct comprises: a first expression cassette, The first expression cassette comprises a first nucleic acid molecule, the first nucleic acid molecule encoding a rice male sterility recovery gene; and a second expression cassette, the second expression cassette comprising a second nucleic acid molecule, the second nucleic acid molecule encoding pollen Inactivated genes. The construct can effectively introduce the rice male sterility recovery gene and the pollen inactivating gene into the homozygous recessive nuclear male sterile rice mutant plant, thereby obtaining a fertile plant carrying the foreign gene as a maintainer. Therefore, it is convenient to continuously produce the sterile line and the maintainer line by selfing, and in addition, the plant which does not carry the foreign gene can be used as the female parent of the hybrid. Thus, the construct can be effectively used for rice hybridization. Thus, the aforementioned construct can be introduced into cells, tissues or organs of rice by a conventional technique such as Agrobacterium mediated method to obtain a sample which can be used for research and hybridization.

In a seventh aspect of the invention, the invention proposes a rice transformation event SPT-7R-949D. According to an embodiment of the present invention, the rice transformation event SPT-7R-949D comprises at least one DNA sequence selected from the group consisting of SEQ ID NOS: 13, 14, 17, 18 and 53 in the genome. Thus, according to an embodiment of the invention, the invention proposes a plant, wherein the plant comprises a rice transformation event SPT-7R-949D. That is, at least one DNA sequence selected from SEQ ID NOS: 13, 14, 17, 18 and 53 or a complement thereof is contained in the genome of the plant. And the present invention proposes seeds, cells and tissues derived from the plant.

In an eighth aspect of the invention, the invention proposes a rice transformation event SPT-7R-1425D. According to an embodiment of the invention, the rice transformation event SPT-7R-1425D comprises a genome selected from the group consisting of SEQ ID NO: at least one DNA sequence of 15, 16, 19, 20 and 54. Thus, according to an embodiment of the invention, the invention proposes a plant, wherein the plant comprises rice transformation event SPT-7R-1425D. That is, at least one selected from the group consisting of SEQ ID NOS: 15, 16, 19, 20, and 54 is included in the genome of the plant.

DNA sequence or its complement. And the present invention proposes seeds, cells and tissues derived from the plant.

In a ninth aspect of the invention, the invention proposes a primer for detecting a rice transformation event. Primer for detecting rice transformation event SPT-7R-949D according to an embodiment of the present invention, characterized in that the primer comprises at least one selected from the group consisting of SEQ ID NO: 13, 14, 17, 18, 53 or a complement thereof One. Primer for detecting a rice transformation event SPT-7R-1425D, characterized in that the primer comprises at least one selected from the group consisting of SEQ ID NO: 15, 16, 19, 20, 54 or a complement thereof.

In a tenth aspect of the invention, the invention provides a kit for detecting a rice transformation event. According to an embodiment of the invention, the kit comprises the primers described above.

The additional aspects and advantages of the invention will be set forth in part in the description which follows.

DRAWINGS

The above and/or additional aspects and advantages of the present invention will become apparent and readily understood from

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic view showing the structure of a plant expression vector PSPT7R according to an embodiment of the present invention. Among them, from the right border, in turn contains the PG47 promoter:: ZM-BT1 leader peptide:: ZM-AA1 gene:: IN2-1 terminator expression cassette, OsCYP704B2 gene expression cassette, and END2 promoter:: DsRed(r) Gene:: 终止 Terminator expression cassette.

2 shows I2-IK staining results of fertile pollen grains and abortive pollen grains (infertile) according to one embodiment of the present invention, wherein SPT-7R-949D indicates staining results of SPT-7R-949D transformant pollen; SPT-7R-1425D indicates the staining result of pollen of SPT-7R-1425D transformant.

Figure 3 is a schematic diagram showing the T-DNA insertion site and integration mode in the transformation event SPT-7R-949D. In the genome of this transformation event, two T-DNAs were integrated, which are shown as T-DNA1 and T-DNA2, respectively.

Figure 4 is a schematic diagram showing the relationship between the T-DNA insertion sequence and the adjacent gene in the transformation event SPT-7R-949D and the verification primers, wherein SP3 is a primer designed according to the T-DNA sequence, and A949B-L-1 and A949B-R are inserted according to Primers designed for genomic sequence flanking the locus, in which primers A949B-L-1 and SP3 were performed The size of the fragment obtained by PCR amplification is 981 bp, and the specific nucleotide sequence thereof is shown in SEQ ID NO: 74; the size of the fragment obtained by PCR amplification of primers A949B-R and SP3 is 540 bp, and the specific nucleotide sequence thereof is specified. As shown in SEQ ID NO:75.

Figure 5 is a schematic diagram showing the insertion site and insertion pattern of the T-DNA in the transformation event SPT-7R-1425D. In the genome of the transformation event, one T-DNA was integrated with a right border of RB and a left border of LB.

Figure 6 is a schematic diagram showing the relationship between the position of the T-DNA insertion sequence and the adjacent gene in the transformation event SPT-7R-1425D and the verification primer. Among them, 7RB-3 and SP3 are primers designed according to the T-DNA sequence, and A1425RB-2 and A1425LB-2 are primers designed according to the genomic sequence flanking the insertion site, wherein primers A1425RB-2 and 7RB-3 are amplified by PCR. The fragment size is 864 bp, and the specific nucleotide sequence thereof is shown in SEQ ID NO: 76; the fragment size obtained by PCR amplification of A1425LB-2 and SP3 is 954 bp, and the specific nucleotide sequence thereof is SEQ ID NO: 77 shows.

Figure 7 is a schematic diagram of the probe position and restriction site on the T-DNA in the transformation event SPT-7R-949D, 7A shows the position of the probe sequence on the target gene and the Hind III restriction site; 7B shows the color selection gene Probe sequence position and EcoR I restriction site.

Figure 8 is a schematic representation of the expected hybridization fragment size and Hind III restriction site of the transformation event SPT-7R-1425D using OsCYP704B2 as a probe.

Figure 9 is a schematic representation of the expected hybridization fragment size and EcoR I restriction site for the transformation event SPT-7R-1425D using Zm-AAl and DsRed(r) as probes.

Figure 10 is a Southern blot of the transformant event SPT-7R-949D T2, Τ3, and Τ4 plants with the target gene as a probe, in which electrophoresis lanes 1, 7 and 13: molecular weight standards; 2, 8 and 14: positive control (plasmid) DNA+Wuyun No.7 DNA-BamHI); 3, 9 and 15: Negative control (Wuyun粳7 ms26/ms26 mutant DNA-BamHI); 4, 5 and 6: SPT-7R-949D-Hind III - T2 generation of 3 independent transgenic plants; 10, 11 and 12: SPT-7R-949D-Hind III-T3 generation 3 independent transgenic plants; 16, 17 and 18: SPT-7R-949D-Hind III - T4 generation of 3 independent transgenic plants.

Figure 11 is a Southern blot of the SPT-7R-949D Τ2, Τ3, and Τ4 generation plants using the color-selected gene as a probe, in which electrophoresis lanes 1, 7 and 13: molecular weight standards; 2, 8 and 14: positive control ( Plasmid DNA) + 武运粳7 DNA-BamHI; 3, 9 and 15: Negative control (Wu Yun粳 7 ms26/ms26 mutant DNA - BamHI); 4, 5 and 6: SPT-7R-949D - c. RI - T2 generation 3 Independent transgenic plants; 10, 11 and 12: SPT-7R-949D - EcoR l - T3 generations of 3 independent transgenic plants; 16, 17 and 18: SPT-7R-949D-c. RI - T4 generation 3 independent transgenic plants.

Figure 12 is a Southern blot of the transformation events SPT-7R-1425D T2, Τ3 and Τ4 plants using the OsCYP704B2 gene as a probe, in which electrophoresis lanes 1, 7 and B 13: molecular weight standards; 2, 8 and 14: positive control ( Plasmid DNA) + 武运粳7 DNA-BamHI; 3, 9 and 15: Negative control (Wuyun 粳7 ms26/ms26 mutant DNA-BamHI); 4, 5 and 6: SPT-7R-1425D-Hind III-T2 generation of 3 independent transgenic plants; 10, 11 and 12: SPT-7R-1425D-Hind III-T3 generation 3 independent transgenic plants; 16, 17 and 18: SPT-7R-1425D-Hind III-T4 generation 3 independent transgenic plants.

Figure 13 is a Southern blot of the Zm-AAl gene as a probe for transformation events SPT-7R-1425D Τ2, Τ3, and Τ4 generation plants, in which electrophoresis lanes 1, 7 and 13: molecular weight standards; 2, 8 and B 14: positive Control (plasmid DNA) + Wuyunjing 7 DNA-BamHI; 3, 9 and 15: Negative control (Wu Yunjing 7 ms26/ms26 mutant DNA-BamHI); 4, 5 and 6: SPT-7R- 1425D -EcoR l - T2 generation of 3 independent transgenic plants; 10, 11 and 12: SPT-7R-1425D - c. R I - T3 generation 3 independent transgenic plants; 16, 17 and 18: SPT-7R-1425D - . R I - T4 generation 3 independent transgenic plants.

Figure 14 is a Southern blot of the DsRed(r) gene as a probe for transformation events SPT-7R-1425D T2, Τ3 and Τ4 plants, in which electrophoresis lanes 1, 7 and 13: molecular weight standards; 2, 8 and B 14: Positive control (plasmid DNA) + Wuyunjing 7 DNA-BamHI; 3, 9 and 15: Negative control (Wu Yunjing 7 ms26/ms26 mutant DNA-BamHI); 4, 5 and 6: SPT-7R -1425D -EcoR l - T2 generation of 3 independent transgenic plants; 10, 11 and 12: SPT-7R-1425D-c. R I - T3 generation 3 independent transgenic plants; 16, 17 and 18: SPT-7R-1425D - . R I - T4 generation 3 independent transgenic plants.

Figure 15 is a schematic diagram showing the expression patterns of three target genes of TPT generation transformation event SPT-7R-949D by RT-PCR, in which the root is the seedling stage root; the stem is the seedling stage stem; the leaf is the seedling stage leaf; the P3 stage is the floret primordium Pear stage is the young panicle during meiosis of pollen mother cells; P8 stage is the young panicle of pollen maturity; seed is the seed of mature stage; mutant is Wuyunjing 7 m _S 26/ms26 _; wild The type is Wuyunjing No.7; the blank control is water as the amplification template; the positive control is the transformant genomic DNA as the amplification template.

Figure 16 shows the expression pattern of three target genes of TPT generation transformation event SPT-7R-1425D by RT-PCR. Fig., wherein the root is the seedling stage root; the stem is the seedling stage stem; the leaf is the seedling stage leaf; the P3 stage is the spikelet primordium differentiation stage young ear; the P6 stage is the pollen mother cell meiosis stage young ear; the P8 stage is the pollen Seeds at maturity; seed is seed at maturity; mutant is Wuyunjing 7 m _S 26/ms26 _; wild type is Wuyunjing 7; blank control is water as amplification template; positive control is The transformant genomic DNA is an amplification template.

Figure 17 is a schematic diagram showing the rice nuclear recessive sterility ms26 I ms26 mutant is a transforming receptor material, and the transformant obtained by transgenic is obtained by selfing, according to one embodiment of the present invention, wherein the receptor (ms) /ms) refers to homozygous recessive nuclear male sterility transgenic receptor material; maintainer line contains homozygous recessive nuclear male sterility loci and transgenic heterozygous loci, thus fertile; sterile line contains homozygous recessive The male male sterile site does not contain the transgene and is therefore male sterile; the pollen produced by the maintainer contains half of the transgene and half does not contain the transgene; the maintainer produces 50% of the sterile line and 50% of the maintainer seed. Detailed description of the invention

Embodiments of the present invention are described in detail below. The embodiments described below with reference to the drawings are intended to be illustrative of the invention and are not to be construed as limiting.

All references mentioned herein are incorporated herein by reference.

All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs, unless otherwise indicated. Unless otherwise indicated, the techniques used or referred to herein are standard techniques well known to those of ordinary skill in the art. The materials, methods, and examples are illustrative only and not limiting.

The term "event" refers to an original transformant comprising a heterologous DNA and the transformant includes, but is not limited to, progeny produced by selfing or hybridization or vegetative propagation. Transformation of a plant cell by heterologous DNA, BP, a nucleic acid construct comprising a target transgene, regeneration of a plant population produced by transgene insertion into a particular plant genome, and selection of specific features characterized by insertion of a particular genomic location Plants, to produce genetically modified "events." Thus, the term "event" also refers to progeny produced by sexual heterotypic hybridization between a transformant and another variety comprising heterologous transgenic DNA and flanking genomic DNA. The term "event" also refers to DNA from the original transformant that contains the inserted DNA and flanking genomic sequences in close proximity to the inserted DNA, and is expected to be transferred to a progeny that serves as a DNA comprising the inserted DNA. The result of sexual hybridization of the parental line (e.g., the original transformant and the progeny of selfing or vegetative propagation) with the parental line that does not contain the inserted DNA, accepts the insert DNA including the target transgene.

The terms "first" and "second" are used for descriptive purposes only and are not to be construed as indicating or implying that they are relatively important. Sexually or implicitly indicates the number of technical features indicated. Thus, features defining "first" and "second" may include one or more of the features, either explicitly or implicitly. In the description of the present invention, the meaning of "plurality" is two or more, unless specifically defined otherwise.

The present invention has been completed based on the following findings of the inventors: the inventors used a rice recessive infertility mutant as a transforming receptor material by transforming three closely related target genes into a sterile mutant, wherein Sexual recovery genes can restore transformation to physical activity. Pollen inactivation genes can inactivate pollen containing foreign genes, ie, lose fertility. Screening genes can be used for sorting of transgenic seeds and non-GM seeds, sorted out. Non-transgenic seeds are used as hybrid lines for the production of sterile lines, and transgenic seeds are used as a source of maintenance to continuously and stably produce sterile lines. For example, according to one embodiment of the present invention, the rice nuclear recessive sterility ms26 I ms26 mutant can be used as a transforming receptor material, and the three closely related target genes can be transformed into a sterile line: the fertility restorer gene OsCYP704B2 can be used. The transformation is physically restored. The pollen inactivation gene Zm-AAl can inactivate the pollen containing the foreign gene, that is, the ability to insemination is lost. The fluorescent color selection gene DsRed (r) is used for sorting of transgenic seeds and non-GM seeds. The picked non-transgenic seeds are used as hybrid lines for the production of sterile lines, and the transgenic seeds are used as a source of maintenance to continuously and stably produce the sterile lines. Because the technology uses biotechnology to produce non-GM products, it solves the bottleneck problem in the process of rice hybridization, that is, the low utilization rate of the three-line method and the unstable fertility of the two lines.

Thus, in one embodiment of the invention, the invention proposes a construct. According to an embodiment of the present invention, the construct comprises: a first expression cassette, the first expression cassette comprising a first nucleic acid molecule, the first nucleic acid molecule encoding a rice male sterility recovery gene; and a second expression cassette, The second expression cassette contains a second nucleic acid molecule encoding a pollen inactivating gene. By using the construct, the rice male sterility recovery gene and the pollen inactivating gene can be effectively introduced into a rice plant such as a rice homozygous recessive male sterility plant, thereby obtaining a fertile plant carrying the foreign gene as a maintainer. Therefore, it is convenient to continuously produce the sterile line and the maintainer line through self-crossing. In addition, plants that do not carry a foreign gene can be used as a parent in the cross. Thus, the construct can be effectively used for rice hybridization.

Herein, the form of the construct is not particularly limited, and according to a specific example of the present invention, it may be at least one of a plasmid, a phage, an artificial chromosome, a cosmid, and a virus. According to a specific example of the invention, the construct (sometimes also referred to as an expression vector, genetic vector or vector) is in the form of a plasmid. As a genetic carrier, the plasmid has the advantages of simple operation, can carry a large fragment, and is easy to handle and handle. The form of the plasmid is also not particularly limited, and may be a circular plasmid or a linear plasmid, that is, it may be Single-stranded, it can also be double-stranded. Those skilled in the art can make selections as needed. According to an embodiment of the present invention, a Ti vector may be employed, for example, the first and second expression cassettes may be disposed between the left and right boundaries of the T-DNA of the expression vector pSPT7R. Thus, the first and second expression cassettes can be transformed into a recipient plant, such as a rice ms26 recessive nuclear male sterility mutant, by Agrobacterium-mediated transformation. Thus, a rice transformed strain containing no herbicide resistance marker gene and antibiotic resistance marker gene can be obtained. The transformant strain thus obtained has the following characteristics: (1) The transformation site is always heterozygous in each generation, so that half of the pollen does not contain the foreign gene, and half of the pollen contains the exogenous gene, and the pollen containing the foreign gene is inactivated ( That is, the ability to insemination is lost), so the foreign gene is transmitted to the next generation only through the female gametes, and does not drift through the pollen into the environment; (2) The transformant self-crossing can be strong, and the fertile seeds (with fluorescent markers) and no The ratio of breeding seeds (without fluorescent labeling) is 1: 1, fertile plants (with exogenous genes) are used as maintainer lines, and the sterile lines and maintainer lines can be easily and continuously produced by selfing, infertility The strain (excluding the genetically modified component) is used as a parent for hybrid seed production; (3) because the sterile plant does not contain the transgene, the hybrid seed produced by the same does not contain the transgene, and the rice commercial grain produced by the hybrid is more It does not contain genetically modified genes, thus eliminating the hidden dangers of genetically modified organisms. The new hybrid breeding system provides a practical and technological breakthrough for making full use of rice heterosis.

The term "nucleic acid" as used in the present invention may be any polymer comprising deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RA, which is not of any length. Special restrictions. For the vector used to construct the recombinant cell, the nucleic acid is preferably DNA because DNA is more stable and easier to handle than R A .

According to an embodiment of the present invention, the type of the rice male sterility recovery gene is not particularly limited. In one embodiment of the invention, the rice male sterility recovery gene encodes a protein having the amino acid sequence set forth in SEQ ID NO: 6. That is, the rice male sterility recovery gene which can be used is OsCYP704B2, and thus, it can be used as a wild type fertility restorer gene of the rice receptor ms26 homozygous mutant (complete male sterility). The protein encoded by the OsCYP704B2 gene belongs to the cytochrome P-450 family and is specifically expressed in the velvet layer and microspores of the P8 to P10 stage of anther development. Mutation of the gene will cause the velvety layer to swell, the outer wall of the pollen is defective and the development is terminated and the stratum corneum of the anther is terminated, resulting in male sterility of the plant, while the female fertility is normal. Further chemical composition analysis revealed that almost no keratin monomer was detected in the anther of the gene deletion mutant, and it was found that the function of the gene was to catalyze the production of a hydroxy fatty acid having 16 and 18 carbon chains. According to a specific embodiment of the present invention, in one embodiment of the present invention, the rice male sterility recovery gene has the nucleotide sequence set forth in SEQ ID NO: 5. The nucleotide sequence shown by SEQ ID NO: 5 introduces three single nucleotide mutations, but does not change, compared to the wild-type OsCYP704B2 gene (the nucleotide sequence of which is shown in SEQ ID NO: 22). The encoded amino acid sequence, the position and specific mutation of these three single nucleotide mutations on the coding region of OsCYP704B2 gene are: 238 nucleotide A mutation to C; 240 nucleotide G mutation to C; 243 The nucleotide G mutation is C. The inventors have surprisingly found that the use of the nucleotide sequence set forth in SEQ ID NO: 5 facilitates the discrimination of foreign genes and endogenous genes in various molecular characterizations, and is more effective in inducing rice ms26/ms26 infertility. The fertility of the body plants was restored. The rice receptor ms26 homozygous mutant was obtained by radiation induction, and the mutation was caused by a 3103 bp deletion (including most fragments of OsCYP704B2) (missing segment physical position: ensembl plants oryza japonica group version 64.6 (MSU6) chromosome 3: 3,701,319 - 3,704,421 ). The large fragment deletion mutation makes the probability of back mutation very low, so the infertility trait is stable, thus ensuring the stability of the sterile line and reducing the risk of hybrid seed production.

In an embodiment of the present invention, the first expression cassette may further comprise: a first promoter, the first promoter being operably linked to the first nucleic acid molecule, the first promoter being a male gamete-specific promoter; and a first terminator operably linked to the first nucleic acid molecule. According to an embodiment of the present invention, the types of the first promoter and the first terminator are not particularly limited. According to one embodiment of the present invention, for the OsCYP704B2 gene, the sequences of the endogenous promoter, the 0RF region and the termination region of OsCYP704B2, which are wild rice genome sequences, can be used. In one embodiment of the invention, the first promoter has a nucleotide sequence as set forth in SEQ ID NO: 7. In one embodiment of the invention, the first terminator has a nucleotide sequence as set forth in SEQ ID NO: 8. The inventors have surprisingly found that the combination of the promoter and the terminator can further significantly increase the efficiency of expression of the corresponding protein, thereby improving the efficiency of constructing the sterile line using the construct, and enabling the rice ms26/ms26 to be more efficiently performed. The fertility of the sterile recipient plants was restored.

According to an embodiment of the present invention, the type of the pollen-inactivated gene is not particularly limited. According to an embodiment of the present invention, the pollen inactivating gene encodes a protein having the amino acid sequence set forth in SEQ ID NO:21. Thus, the α-amylase encoded by Zm-AAl can be encoded. The α-amylase is a glycosyl hydrolase. The gene was isolated from a cDNA library of maize embryos and endosperm 10 days after pollination, and its function is to catalyze the hydrolysis of (l-4)-ct-D-glucosides of polysaccharide molecules such as starch. Endogenous Zm-AAl gene in maize It is mainly expressed in the scutellum tissue of germinated seeds, and the expression of this gene is not detected in corn pollen. According to an embodiment of the present invention, the pollen inactivating gene has a nucleotide sequence as shown in SEQ ID NO: 9. Thereby, the efficiency of expressing the corresponding protein can be further improved. According to an embodiment of the present invention, the second expression cassette further comprises: a second promoter operably linked to the second nucleic acid molecule, the second promoter being a pollen-specific promoter; And a second terminator operably linked to the second nucleic acid molecule. Thereby, the expression efficiency of the corresponding gene can be more effectively improved. In addition, according to an embodiment of the present invention, a sequence encoding a peptide may be further included in the second expression cassette, whereby the second expression cassette can efficiently encode a pollen inactivating protein having a peptide, thereby enabling The gene of interest (pollen inactivating gene) can be targeted to specific organelles. For example, according to an embodiment of the present invention, the sequence encoding the leader peptide has the nucleotide sequence shown in SEQ ID NO: 36 (the sequence encoding the leader peptide (TP) from the brittle-1 gene of maize). Thereby, the expressed protein can be effectively targeted to the amyloplast, and the starch in the pollen is decomposed, thereby depriving the pollen, losing the ability to fertilize, and inactivating the transgenic pollen. Further, according to a specific embodiment of the present invention, the gene is driven by the maize pollen-specific promoter PG47, and the sequence encoding the leader peptide (TP) derived from the brittle-1 gene of maize and the terminator IN2-1 constitutes an expression cassette. It can specifically express amylase in mature pollen in the late development stage, and target the amyloid, and decompose the starch in the pollen, thereby depriving the pollen, losing the ability to insemination, and inactivating the transgenic pollen. This design inactivates all transgenic pollen containing this gene, can not be inseminated, and can strictly prevent biosafety problems such as gene drift. Inactivated pollen cannot be pollinated with other plants or weeds around, so the transgene cannot drift through the pollen to the environment.

In addition, according to an embodiment of the present invention, the construct may further comprise: a third expression cassette, the third expression cassette comprising a third nucleic acid molecule, the third nucleic acid molecule encoding a screening gene, and the screening gene is a luminescent gene . Thus, it is convenient to determine whether the plant and its part contain the gene introduced by the construct by screening the expression of the gene.

According to an embodiment of the present invention, a gene selected from the group consisting of a red fluorescent gene, a cyan fluorescent protein gene, a yellow fluorescent protein gene, a luciferase gene, a green fluorescent protein gene, an anthocyanin pi gene, and a glufosinate acetyltransferase encoding gene may be used. At least one is used as a screening gene. In one embodiment of the invention, a red fluorescent protein gene can be employed as a screening gene. The red fluorescent protein gene (DsRed), derived from the reef coral (Discosoma sp.), is the only gene sequence that expresses the source of the non-food crop in the box. The red fluorescent protein has a maximum absorption wavelength of 558 nm and a maximum emission wavelength of 583 nm. Amino acid encoded by DsRed The sequence is shown by alignment with allergen and toxic protein sequences with minimal similarity, toxicity and sensitization. DsRed is often used as a screening gene for genetic transformation, and there has never been a safety issue for genetically modified organisms. In one embodiment of the invention, the screening gene has the nucleotide sequence set forth in SEQ ID NO: 1. Thus, red fluorescent protein can be expressed more efficiently, and the expression of the DsRed gene in rice can be enhanced. The nucleotide sequence set forth in SEQ ID NO: 1 has two single nucleotide mutations, designated DsRed(r), compared to the wild-type DsRed gene (the nucleotide sequence of which is set forth in SEQ ID NO: 23). . The two single nucleotide mutations are: from the 21st base C to G, from the 315th base G to C. The inventors have surprisingly found that red fluorescent protein can be expressed more efficiently and enhance the expression of the red fluorescent protein gene in rice.

In one embodiment of the present invention, the third expression cassette further comprises: a third promoter, the third promoter is operably linked to the third nucleic acid molecule, and the third promoter is a callus a tissue or seed specific promoter; a third terminator, the third terminator being operably linked to the third nucleic acid molecule. In one embodiment of the invention, the third promoter has a nucleotide sequence as set forth in SEQ ID NO: 2. In one embodiment of the invention, the third terminator has a nucleotide sequence as set forth in SEQ ID NO: 3. Thus, according to one embodiment of the invention, the open reading frame of DsRed(r) is linked to the terminator END2 from maize and to the callus and seed (embryo and endosperm) and the terminator Pin II from potato. , reconstituting the DsRed(r) gene expression cassette (END2 : : DsRed(r): : PINlDo The rice seed containing the expression cassette exhibits a very recognizable red under fluorescent excitation, so the expression cassette is used in the present invention. Identify and sort the maintainer and sterile line seeds.

Thus, according to an embodiment of the present invention, a construct according to an embodiment of the present invention can be used, and a non-transgenic recessive nuclear male sterile rice (ms26/ms26) is used as a receptor for transformation, and genetic transformation is performed to obtain an integrated The following closely linked three foreign genes DsRed(r), Ms26, Zm-AAl rice maintainer, Ms26 g卩OsCYP704B2 fertility gene. The insertion of the foreign gene is not linked to the endogenous male sterility locus (ms26/ms26), so the resulting transgenic rice maintainer contains independent homozygous ms26 recessive sterility loci and heterozygous exogenous genes ( Includes the OsCYP704B2 gene) integration site.

Thus, the aforementioned construct can be introduced into cells, tissues or organs of rice by conventional techniques such as Agrobacterium-mediated method to obtain a sample which can be subsequently used for research and hybridization. Thus, in a second aspect of the invention, the invention proposes a rice cell, tissue or organ. According to an embodiment of the invention, the rice cell, tissue or organ contains the construct described above. In one embodiment of the invention, the rice cell, tissue or organ is derived from a rice homozygous recessive male sterile plant. In the real aspect of the invention In the embodiment, the rice homozygous recessive male sterile plant comprises a homozygous recessive allele of the Ms26 gene. Thus, the rice cells, tissues or organs of the present invention can be effectively used for the construction of male sterile plants. The features and advantages described above with respect to the constructs also apply to the rice cells, tissues or organs and will not be described again.

Thus, in a third aspect of the invention, the invention proposes a method of constructing a rice male sterile line. According to an embodiment of the present invention, referring to Figure 17, the method comprises: introducing the construct described above into a first rice homozygous recessive male sterile plant to obtain a second rice plant carrying the foreign gene, The second rice plant is capable of producing a fertile male gamete, and the foreign gene in the second rice plant is in a heterozygous state, so half of the second rice plant contains no foreign gene, and half contains a foreign gene, including The pollen of the source gene is inactivated (ie, the ability to insemination is lost). Further, the obtained second rice plant is cultivated, and the seed of the second rice plant, i.e., the transformant, is self-fertilized, and a seed which does not carry the foreign gene can be obtained, thereby constructing a rice male sterile line. According to an embodiment of the invention, the first rice homozygous recessive male sterile plant comprises a homozygous recessive allele of the Ms26 gene. Further, according to an embodiment of the present invention, the step of sorting by fluorescence detection, that is, by detecting whether or not rice seeds carry a luminescent gene, for example, whether or not to emit fluorescence, is sorted to distinguish whether or not it carries a foreign gene. The features and advantages described above with respect to the constructs also apply to the method and will not be described again.

In a fourth aspect of the invention, the invention proposes a method of restoring male fertility in a rice sterile plant. According to an embodiment of the invention, the method comprises: introducing the construct described above into a rice homozygous recessive male sterile plant. In one embodiment of the invention, the rice homozygous recessive male sterile plant comprises a homozygous recessive allele of the Ms26 gene. The features and advantages described above with respect to the constructs also apply to this method and will not be described again.

In a fifth aspect of the invention, the invention provides a method of preparing rice seeds. According to an embodiment of the invention, the method comprises the steps of: introducing the construct described above into a rice plant; and self-fertilizing the rice plant to obtain a seed comprising the construct described above. In one embodiment of the invention, the rice plant is a rice homozygous recessive male sterile plant. In one embodiment of the invention, the rice homozygous recessive male sterile plant comprises a homozygous recessive allele of the Ms26 gene.

In a sixth aspect of the invention, the invention proposes a conversion event. According to an embodiment of the invention, the transformation event is obtained by introducing the aforementioned construct into a rice homozygous recessive male sterile plant. In one embodiment of the invention, the rice homozygous recessive male sterile plant comprises a homozygous recessive allele of the Ms26 gene. In an embodiment of the invention, the conversion event is selected from the group consisting of At least one of SPT-7R-949D and SPT-7R-1425D. In one embodiment of the invention, the construct is introduced by Agrobacterium-mediated methods.

According to an embodiment of the present invention, the present invention utilizes Agrobacterium transformation to transform the closely linked OsCYP704B2, ZM-AA1 and DsRed(r) genes into rice, and obtains genetically stable SPT-7R-949D and SPT-7R- 1425D transgenic rice line. The flanking sequence of the T-DNA insertion site of the T1 generation plant was amplified by TAIL-PCR technology to obtain the flanking sequence; the obtained flanking sequence was sequenced and analyzed, and the database (MSU Rice Genome Annotation Project Release 7) , released on October 31, 2011, ftp: 〃 ftp.plantbiology.msu.edu/pub/data/ Eukaryotic_ Projects/o_sativa/annotation_dbs/pseudomolecules/version_7.0/) The alignment of the genome sequence of the water, and The T-DNA insertion sites of SPT-7R-949D and SPT-7R-1425D were found to be located near the centromere of the short arm of chromosome 3 (physical position: Chr3: 14,746,015-14,746,027) and the long arm of chromosome 1. The distal end (physical position: Chrl: 42,215, 016-42, 215, 095), both of which are not inserted into the rice endogenous gene; then, the junction region is PCR amplified to verify the foreign T-DNA insertion position The T-DNA integration method was preliminarily speculated, that is, PCR amplification was performed between the flanking sequence and the T-DNA insertion sequence, and the results were in agreement with the expectation, which further confirmed the correctness of the T-DNA insertion site and showed SPT-7R-949D is a double-plex integration of reverse tandem, while the T-DNA of SPT-7R-1425D is a single-copy insert.

Thus, in a seventh aspect of the invention, the invention proposes a rice transformation event SPT-7R-949D. According to an embodiment of the invention, the rice transformation event SPT-7R-949D comprises at least one DNA sequence selected from the group consisting of SEQ ID NOs: 13, 14, 17, 18 and 53 in the genome. Further, according to an embodiment of the present invention, the present invention provides a plant, wherein the plant comprises rice transformation event SPT-7R-949D. That is, at least one DNA sequence selected from the group consisting of SEQ ID NOS: 13, 14, 17, 18, and 53 or a complement thereof is included in the genome of the plant. And the present invention proposes seeds, cells and tissues derived from the plant. In an eighth aspect of the invention, the invention proposes a rice transformation event SPT-7R-1425D. According to an embodiment of the invention, the rice transformation event SPT-7R-1425D comprises at least one DNA sequence selected from the group consisting of SEQ ID NOs: 15, 16, 19, 20 and 54 in the genome. Further, according to an embodiment of the present invention, the present invention provides a plant, wherein the plant comprises rice transformation event SPT-7R-1425D. That is, at least one DNA sequence selected from the group consisting of SEQ ID NOS: 15, 16, 19, 20 and 54 or a complement thereof is included in the genome of the plant. And the present invention proposes seeds, cells derived from the plant And organization.

In addition, the present invention also provides a transgenic detection method and a composition thereof for detecting a transgenic/genomic DNA connection of a plant or seed from a rice event SPT-7R-949D, or a product derived from a part or seed of the transgenic plant. Area detection. Transformation event SPT-7R-949D, whose complete exogenous insert sequence is the ligated sequence of the T-DNA region and the 5' flanking sequence of the insertion site (also referred to as chimeric DNA molecule) as shown in SEQ ID NO: As shown in SEQ ID NO: 17, wherein the nucleotide sequence at positions 1-10 is rice endogenous genomic DNA, and the nucleotide sequence at positions 11-20 is an exogenously inserted T-DNA sequence; The ligation sequence consisting of the flanking sequences is as shown in SEQ ID NO: 18, wherein the nucleotide sequence at positions 1-10 is an exogenously inserted T-DNA sequence, and the nucleotide sequence at positions 11-20 is within rice. Source genomic DNA. In the present invention, the above-described ligation sequence may further comprise a longer genomic DNA sequence and an exogenously inserted T-DNA sequence based on SEQ ID NOS: 17 and 18, more specifically, said exogenous insertion T- The ligation sequence consisting of the 5' flanking sequence of the DNA sequence and the insertion site is set forth in SEQ ID NO: 13, wherein the nucleotide sequence of 884-903 of SEQ ID NO: 13 is set forth in SEQ ID NO: 17. The ligation sequence consisting of the exogenous insertion T-DNA sequence and the 3' flanking sequence of the insertion site is shown in SEQ ID NO: 14, wherein the nucleotide sequence of nucleotides 497-516 of SEQ ID NO: 14 is SEQ ID NO: :18 is shown. All of these sequences, as well as plants and seeds comprising these sequences, form an aspect of the invention. Thus, the present invention provides a novel DNA sequence derived from the DNA transgene/genomic region of transformation event SPT-7R-949D of SEQ ID NO: 13, SEQ ID NO: 53, SEQ ID NO: 14 or Complementary DNA molecule. Rice plants and seeds comprising SEQ ID NO: 13, SEQ ID NO: 53, SEQ ID NO: 14, or a complementary DNA molecule thereof in their genome are all within the scope of the present invention.

The invention also provides a set of PCR primers for DNA detection of the transformation event SPT-7R-949D, wherein the set of PCR primers comprises a first PCR primer and a second PCR primer, wherein the first PCR primer comprises SEQ ID NO: At least 11 or more contiguous polynucleotides of any portion of the T-DNA region of 13, the second PCR primer is derived from a continuous length of similar length of any portion of the 5' flanking rice genomic DNA region of SEQ ID NO: 13. Glycoside, these nucleic acid molecules are effective as primer molecules for PCR amplification. Or the first PCR primer comprises at least 11 or more contiguous polynucleotides of any portion of the T-DNA region of SEQ ID NO: 14, and the second PCR primer is derived from the 3' flanking rice genomic DNA of SEQ ID NO: 14. A contiguous polynucleotide of similar length for any portion of the region, which is effective when PCR amplification is performed together. Or the first PCR primer and the second PCR Primers are each derived from SEQ ID NO: 53, comprising at least 11 or more contiguous polynucleotides of any portion of SEQ ID NO: 53 that are effective for PCR amplification. The amplification product obtained by PCR using the above primers can be used to detect rice transformation event SPT-7R-949D. The DNA amplification product contains part or all of the DNA sequence shown in SEQ ID NO: 13, 14, 17, 18 or 53.

SEQ ID NOS: 13 and 17 span the 5' junction between the genomic flanking DNA and the inserted T-DNA. SEQ ID NO: 17 corresponds to position 884-903 of SEQ ID NO: 13.

SEQ ID NO: 13 is 1444 nucleotides in length. It contains 893 nucleotides (position 1-893) of the 5' flanking genomic region and 551 nucleotides (position 894-1444) of the T-DNA insert. Position 894 of SEQ ID NO: 13 corresponds to position 1 of the T-DNA insertion sequence (SEQ ID NO: 53). Position 1444 of SEQ ID NO: 13 corresponds to position 551 of the T-DNA insertion sequence (SEQ ID NO: 53).

SEQ ID NOS: 14 and 18 cover the 3' junction between the genomic flanking DNA and the inserted T-DNA. SEQ ID NO: 18 corresponds to position 497-516 of SEQ ID NO: 14.

SEQ ID NO: 14 is 959 nucleotides in length. It contains 506 nucleotides of the T-DNA insert (position 1-506) and 453 nucleotides of the 3' flanking genomic region (positions 507-959). Position 1 of SEQ ID NO: 14 corresponds to position 19,199 of the T-DNA insertion sequence (SEQ ID NO: 53). Position 506 of SEQ ID NO: 14 corresponds to position 19,704 of the T-DNA insertion sequence (SEQ ID NO: 53).

The invention also provides a transgenic detection method and a composition thereof for detecting a plant transgenic/genomic junction region of a plant or seed from a rice event SPT-7R-1425D, or a product derived from a part or seed of the transgenic plant Detection. Transformation event SPT-7R-1425D, the complete exogenous insertion sequence thereof is set forth in SEQ ID NO: 54, and the ligation sequence consisting of the exogenous insertion T-DNA sequence and the 5' flanking sequence of the insertion site is SEQ ID NO: 19 As shown, the nucleotide sequence of position 1-10 is the endogenous genomic DNA of rice, and the nucleotide sequence of positions 11-20 is the exogenous inserted T-DNA sequence; exogenous insertion of T-DNA sequence and insertion The ligation sequence consisting of the 3' flanking sequence of the site is set forth in SEQ ID NO: 20, wherein the nucleotide sequence at positions 1-10 is an exogenously inserted T-DNA sequence, and the nucleosides at positions 11-20 The acid sequence is the endogenous genomic DNA of rice. In the present invention, the above-described ligation sequence may further comprise a longer genomic DNA sequence and an exogenously inserted T-DNA sequence based on SEQ ID NO: 19 and 20, more specifically, said exogenous insertion T The ligation sequence consisting of the DNA sequence and the 5' flanking sequence of the insertion site can be as set forth in SEQ ID NO: 15, wherein the nucleotide sequence 817-836 of SEQ ID NO: 15 is SEQ ID NO: NO: 19; the ligation sequence consisting of the exogenous insertion T-DNA sequence and the 3' flanking sequence of the insertion site is shown in SEQ ID NO: 16, wherein the nucleus 398-417 of SEQ ID NO: The nucleotide sequence is shown in SEQ ID NO: 20. All of these sequences, as well as plants and seeds comprising these sequences, form an aspect of the invention. Thus, the present invention provides a novel DNA sequence derived from SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 54 of the DNA transgene/genomic region of transformation event SPT-7R-1425D Complementary DNA molecule. Rice plants and seeds comprising SEQ ID NO: 15 or SEQ ID NO: 16 or SEQ ID NO: 54 or its complementary DNA molecule in its genome are within the scope of the present invention.

The invention also provides a set of PCR primers for DNA detection of the transformation event SPT-7R-1425D, the set of PCR primers comprising a third PCR primer and a fourth PCR primer. Wherein the third PCR primer comprises at least 11 or more contiguous polynucleotides of any portion of the T-DNA region of SEQ ID NO: 15, and the fourth PCR primer is derived from the 5' flanking rice genomic DNA region of SEQ ID NO: 15. Any portion of a contiguous polynucleotide of similar length that is effective as a primer molecule for PCR amplification. Or the third PCR primer comprises at least 11 or more contiguous polynucleotides of any portion of the T-DNA region of SEQ ID NO: 16, and the fourth PCR primer is derived from the 3' flanking rice genomic DNA of SEQ ID NO: A contiguous polynucleotide of similar length for any portion of the region, which is effective as a primer molecule for PCR amplification. Or the third PCR primer and the fourth PCR primer are both from SEQ ID NO: 54, comprising at least 11 or more contiguous polynucleotides of any portion of SEQ ID NO: 54, the PCR primers are used together for PCR It is effective at the time of amplification. The amplification product obtained by PCR using the above primers can be used to detect rice transformation event SPT-7R-1425D. The amplification product contains part or all of the DNA sequence shown in SEQ ID NO: 15, 16, 19, 20 or 54.

SEQ ID NOS: 15 and 19 cover the 5' junction between the genomic flanking DNA and the inserted T-DNA. SEQ ID NO: 19 corresponds to position 817-836 of SEQ ID NO: 15.

SEQ ID NO: 15 is 1259 nucleotides in length. It contains 826 nucleotides of the 5' flanking genomic region (position 1-826) and 433 nucleotides of the T-DNA insert (position 827 - 1259) o position 827 of SEQ ID NO: 15 corresponds to T-DNA Position 1 of the insertion sequence (SEQ ID NO: 54). Position 1259 of SEQ ID NO: 15 corresponds to position 433 of the T-DNA insertion sequence (SEQ ID NO: 54).

SEQ ID NOS: 16 and 20 cover the 3' junction between the genomic flanking DNA and the inserted T-DNA. SEQ ID NO: 20 corresponds to positions 398-417 of SEQ ID NO: 16.

SEQ ID NO: 16 is 1280 nucleotides in length. It contains 407 nucleotides of the T-DNA insert (position 1-407) and 873 nucleotides of the 3' flanking genomic region (position 408 - 1280). Position 1 of SEQ ID NO: 16 corresponds to position 10, 530 of the T-DNA insertion sequence (SEQ ID NO: 54). Position 407 of SEQ ID NO: 16 corresponds to position 10,936 of the T-DNA insertion sequence (SEQ ID NO: 54).

The term "primer" as used herein is an isolated polynucleic acid which anneals to a complementary target polynucleic acid strand by nucleic acid hybridization to form a hybrid of a primer and a target polynucleic acid strand, and then passes through a polymerase, such as a DNA polymerase, along the target. Polynucleic acid chain extension. Primer pairs of the invention are directed to their use for amplification of amplification of a target polynucleotide molecule, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

The primer of the present invention can hybridize to a target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from the SPT-7R-949D event or SPT-7R-1425D in the sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules in some cases. As used herein, two nucleic acid molecules are said to hybridize specifically to each other if they are capable of forming an anti-parallel double-stranded nucleic acid structure and of sufficient length to maintain such a structure under high stringency conditions. A nucleic acid molecule is said to be a "complement" of another nucleic acid molecule if it exhibits complete complementarity. As used herein, when each nucleotide of one molecule is complementary to the nucleotide of another molecule, the molecule is said to exhibit "complete complementarity." Two molecules are said to be "minimally complementary" if they hybridize to each other with sufficient stability to allow them to remain annealed to each other under at least conventional "low stringency" conditions. Similarly, molecules are said to be "complementary" if they hybridize to each other with sufficient stability to allow them to remain annealed to one another under conventional "high stringency" conditions. Conventional stringent conditions are described by Sambrook et al., 1989, and by Haymes et al. (1985). Thus deviation from complete complementarity is permissible as long as such deviation does not completely exclude the ability of the molecule to form a double-stranded structure. In order for a nucleic acid molecule to act as a primer or probe, only sufficient complementarity in the sequence is required to form a stable double-stranded structure at the particular solvent and salt concentration employed.

As used herein, a substantially homologous sequence is a nucleic acid sequence that specifically hybridizes to the complement of a nucleic acid sequence compared thereto under highly stringent conditions. Suitable stringent conditions to promote DNA hybridization, for example, 6.0 X sodium chloride/sodium citrate (SSC) at about 45 ° C, followed by washing with 2.0 x SSC at 50 ° C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from a low severity of about 2.0 X. SSC, 50 ° C to a highly stringent 0.2 x SSC, 50 ° C. Further, the temperature in the washing step can be raised from about 22 ° C at room temperature under low stringency conditions to about 65 at high stringency conditions. C. Both temperature and salinity can vary, or the temperature or salt concentration remains the same while the other variable changes. In a preferred embodiment, the nucleic acids of the invention will specifically hybridize to nucleic acid molecules that require amplification under moderately stringent conditions, such as at about 2.0 X SSC and about 65 °C.

Regarding the amplification of a target nucleic acid sequence using a particular amplification primer pair (eg, by PCR), "stringent conditions" are conditions that allow the primer pair to hybridize only to the target nucleic acid sequence, with corresponding wild-type sequences (or complements thereof) The primers will bind to the target nucleic acid sequence, preferably in the DNA thermal amplification reaction to produce a unique amplification product, an amplicon.

The term "specific to (target sequence)" is that the primer hybridizes only to the target sequence in the sample containing the target sequence under stringent hybridization conditions.

As used herein, "amplified DNA" or "amplicon" refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a plant produced by sexual crossing contains the transgenic event SPT-7R-949D, or whether the sample collected from the field contains SPT-7R-949D, or whether the plant extract contains SPT-7R-949D. A nucleic acid PCR amplification method using a primer pair, which includes a first primer derived from a genomic region adjacent to an insertion site of the inserted heterologous transgenic DNA, may be performed using DNA extracted from a plant tissue sample or extract. And a second primer derived from the inserted heterologous transgenic DNA to generate an amplicon that is diagnostic for the presence of the event DNA. The amplicon is of a certain length and has a sequence which is also diagnostic for the event. The length of the amplicon may be based on a primer pair plus one nucleotide base pair, or plus about fifty nucleotide base pairs, or about two hundred and fifty nucleotide base pairs, or It is varied by the combined length of about three hundred and fifty nucleotide base pairs or more.

Alternatively, the primer pair may be derived from flanking genomic sequences flanking the inserted T-DNA to obtain an amplicon comprising the entire T-DNA insertion nucleotide sequence. The members of the primer pair from the plant genome sequence can be selected from a distance from the inserted transgenic T-DNA molecule, which can vary from one nucleotide base pair to about 20,000 nucleotide base pairs. The term "amplicon" is used to specifically exclude primer dimers which can be formed in DNA thermal amplification reactions.

Nucleic acid amplification can be achieved by any of a variety of nucleic acid amplification reaction methods known in the art, including polymerase chain reaction (PCR). Various amplification methods are known in the art, and these methods, as well as other DNA amplification methods in the art, can be used in the practice of the present invention. Can provide a variety of techniques to detect this Amplicon produced by these methods. One such method is Genetic Bit Ananlysis (Nikiforov, et al., 1994), in which a DNA oligonucleotide is designed that covers adjacent flanking genomic DNA sequences and inserted DNA transgene sequences. Oligonucleotides were immobilized in wells of a microwell plate. After performing PCR on the target region (using one primer in the T-DNA insert and one primer in the adjacent flanking genomic sequence), the single-stranded PCR product can hybridize to the immobilized oligonucleotide and serve as a template for The single base extension reaction was carried out using a DNA polymerase and a labeled ddNTP specific for the next base expected. The readout process can be a fluorescence based or ELISA based signal. The signal indicates the presence of an insert/flank genomic sequence due to successful amplification, hybridization, and single base extension.

Another method is the Pyrosequencing technique described by Winge (2000). In this method an oligonucleotide is designed which covers the adjacent genomic DNA and the insert DNA junction. Hybridization of the oligonucleotide with a single-stranded PCR product from the target region (one primer in the inserted sequence, one in the flanking genomic sequence), in the presence of DNA polymerase, ATP, sulfatase, luciferase, adenosine triphosphate Incubation with phosphatase, adenyl 5' phosphate and luciferin. DNTPs were separately added to measure the incorporation of the generated optical signal. Light signals indicate the presence of transgene inserts/flanking sequences due to successful amplification, hybridization, and single or multiple base extensions.

The fluorescence polarization described by Chen et al. (1999) is a method that can be used to detect the amplicons of the present invention. Using this approach, an oligonucleotide is designed that covers the genomic flanks and inserted DNA contacts. The oligonucleotide is hybridized with a single-stranded PCR product from the target region (one primer in the inserted DNA sequence, one in the flanking genomic DNA sequence), incubated in the presence of DNA polymerase and fluorescently labeled ddNTP. Single base extension results in the incorporation of ddNTPs. Incorporation can be measured by measuring the change in polarization using a fluorometer. The change in polarization is indicative of the presence of the transgenic insert/flanking genomic sequence due to successful amplification, hybridization, and single base extension.

Taqman® (PE Applied Biosystems, Foster City, CA) is described as a method for the detection and quantification of the presence of DNA sequences, which can be fully understood according to the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe was designed which covers the genomic flanks and inserted DNA contacts. In the presence of a thermostable polymerase and dNTPs, the FRET probe and PCR primers (one primer in the inserted DNA sequence and one in the flanking genomic sequence) are cycled. Hybridization of the FRET probe causes the fluorescent moiety on the FRET probe to cleave and release from the quenching moiety. Fluorescent signals indicate the presence of flanking genomic/transgenic insert sequences due to successful amplification and hybridization. Molecular Beacons have been used in sequence detection as described in Tyangi et al. (1996). Briefly, a FRET oligonucleotide probe was designed which covers the flanking genome and the insert DNA junction. The unique structure of the FRET probe results in a secondary structure that keeps the fluorescent and quenching moieties in close proximity. In the presence of a thermostable polymerase and dNTPs, the FRET probe and PCR primers (one primer in the inserted DNA sequence and one in the flanking genomic sequence) are cycled. Following successful PCR amplification, hybridization of the FRET probe to the target sequence results in the elimination of the secondary structure of the probe and the spatial separation of the fluorescent moiety from the quenching moiety, producing a fluorescent signal. Fluorescent signals indicate the presence of flanking genomic/transgenic insert sequences due to successful amplification and hybridization.

Other described methods, such as microfluidics, provide methods and equipment for isolating and amplifying DNA samples. Light dyes are used to detect and measure specific DNA molecules. A nanotube device (WO/06024023) comprising an electron sensor for detecting a DNA molecule or a nanobead that binds to a specific DNA molecule and thus can be detected is also useful for detecting the DNA molecule of the present invention.

Thus, in a ninth aspect of the invention, the invention proposes a primer for detecting a rice transformation event. According to an embodiment of the invention, the primer comprises at least one selected from the group consisting of SEQ ID NOs: 13, 14, 15, 16 and their complements. Thus, rice transformation events can be effectively detected by PCR reaction, and in particular, at least one of rice transformation events SPT-7R-949D and SPT-7R-1425D can be effectively detected. In a tenth aspect of the invention, the invention provides a kit for detecting a rice transformation event. According to an embodiment of the invention, the kit comprises the primers described above.

In an eleventh aspect of the invention, the invention provides a method for preparing hybrid rice. According to an embodiment of the present invention, the method employs a rice male sterile line constructed by a method of constructing a rice male sterile line. Thus, the rice male sterile line of the present invention can be further utilized for rice hybridization to improve the efficiency of rice hybridization. The features and advantages described above with respect to the constructs also apply to the method and will not be described again.

In a twelfth aspect of the invention, the invention proposes the use of a rice male sterile line in the preparation of hybrid rice. According to an embodiment of the present invention, the rice male sterile line is constructed by the method of constructing a rice male sterile line in the foregoing. Thus, the rice male sterile line of the present invention can be further utilized for rice hybridization to improve the efficiency of rice hybridization. The features and advantages described above with respect to the constructs also apply to this use and will not be described again.

In yet another aspect of the invention, the invention also provides a method of constructing a rice male sterile line. Root According to an embodiment of the present invention, the method comprises using a rice homozygous recessive male sterile plant as a female parent, the rice homozygous recessive male sterile plant comprising a homozygous recessive allele of the Ms26 gene; Backcrossing is carried out with the recurrent parent to obtain a rice male sterile line having the recurrent parental trait, wherein the recurrent parent does not have a homozygous recessive allele of the Ms26 gene. Thus, using the method of the present invention, more sterile lines of different genetic backgrounds can be developed based on the MS26 homozygous recessive male rice sterile line. According to an embodiment of the present invention, by using the conventional backcross breeding method, all different types of rice can be created into corresponding intelligent male sterile lines (that is, the corresponding sterile line varieties can be continuously produced), and the heterosis resources can be utilized. More than 95%.

The present invention also proposes a transgenic rice containing a specific exogenous DNA sequence which is introduced into a recipient plant by a rice transformation method and is obtained herein as "Event SPT-7R-949D" " or "SPT-7R-949D" or "949D" or "Event 949D" event. The transformed plant or seed may also be referred to as "rice SPT-7R-949D" or "rice 949D". The invention also provides materials and methods for identifying progeny derived from event SPT-7R-949D or plants containing the event DNA.

The present invention proposes transgenic rice containing a specific exogenous DNA sequence which is introduced into a recipient plant by rice transformation and is referred to herein as "event SPT-7R-1425D" or Event of "SPT-7R-1425D" or "1425D" or "Event 1425D". The transformed plant or seed may also be referred to as "rice SPT-7R-1425D" or "rice 1425D". The invention also provides materials and methods for identifying progeny derived from event SPT-7R-1425D or plants containing the event DNA.

Also disclosed in the embodiments of the present invention is a specific flanking sequence, which is also referred to as a "flanking sequence". In the present invention, the flanking sequence can be used to develop an event SPT in a biological sample. Specific identification methods for 7R-949D and SPT-7R-1425D. In some embodiments, sequences of flanking regions of the left and right borders of SPT-7R-949D and SPT-7R-1425D are also disclosed, and these flanking sequences can be used to design specific primers and probes. The present invention also provides a method for identifying whether a biological sample contains a specific exogenous DNA sequence of SPT-7R-949D and SPT-7R-1425D based on the above specific primers and probes.

According to an embodiment of the present invention, the present invention also provides a method of detecting the presence or absence of DNA corresponding to the events SPT-7R-949D and SPT-7R-1425D in a sample. Specifically, the party The method comprises: (a) contacting a sample comprising DNA with a DNA primer for nucleotide amplification reaction with genomic DNA extracted from a plant comprising the event SPT-7R-949D or SPT-7R-1425D At that time, a specific amplicon for identifying the event SPT-7R-949D or SPT-7R-1425D can be generated; (b) performing a nucleic acid amplification reaction to generate an amplicon; (c) detecting and identifying the amplicon.

a DNA molecule comprising a ligation sequence consisting of a specific exogenous insertion sequence of the event SPT-7R-949D or SPT-7R-1425D and a flanking sequence at the insertion site, and homologous or complementary to the DNA molecule Sequences are all within the scope of the invention.

Also provided in an embodiment of the invention is a DNA molecule comprising a specific flanking sequence or ligation sequence in event SPT-7R-949D, specifically as set forth in SEQ ID NO: 13, 14, 17 or 18, and comprising an event SPT- A specific flanking sequence or ligation sequence in 7R-1425D, specifically a DNA molecule as set forth in SEQ ID NO: 15, 16, 19 or 20. The present invention includes a DNA sequence consisting of a transgene insert and a flanking rice genomic DNA from the insertion site, the DNA sequence being useful for designing primers which can be amplified for use in The plant or plant material is tested for the presence of the amplicon product of event SPT-7R-949D or SPT-7R-1425D.

Further embodiments of the invention further provide at least 11 or more nuclei comprising an exogenously inserted T-DNA region of event SPT-7R-949D (the nucleotide sequence of which is set forth in SEQ ID NO: 53) DNA sequence of the nucleoside, and DNA of at least 11 or more nucleotides containing the exogenously inserted T-DNA region of event SPT-7R-1425D (the nucleotide sequence of which is shown in SEQ ID NO: 54) a sequence I", or a complement of the above DNA sequence, and a DNA sequence of the same length as the flanking rice genomic DNA sequence shown in SEQ ID NO: 13, 14, 17 or 18 of SPT-7R-949D or a complementary sequence thereof Or a DNA sequence of a similar length or a complement thereof to the flanking rice genomic DNA sequence set forth in SEQ ID NO: 15, 16, 19 or 20 of SPT-7R-1425D. The above DNA sequence can be used as a primer sequence in DNA amplification. The amplicon produced by the above primers can be used to detect the event SPT-7R-949D or SPT-YR-MSSDc, respectively. Therefore, embodiments of the present invention also include an amplicon produced by a DNA primer, the DNA primer and SPT The transgenic T-DNA region of -7R-949D or SPT-7R-1425D or its specific flanking sequence is homologous or complementary.

Also disclosed in an embodiment of the invention is a method of detecting a DNA molecule corresponding to event SPT-7R-949D or SPT-7R-1425D in a sample, the method comprising: (a) DNA extracted from a plant The sample is contacted with a DNA probe that is capable of interacting with the event under stringent hybridization conditions a molecule that hybridizes in SPT-7R-949D or SPT-7R-1425D but does not hybridize to the control plant DNA under stringent hybridization conditions; (b) subjects the sample and probe to stringent hybridization conditions; (c) detection probe Hybridization with DNA. More specifically, the present invention also provides a method for detecting a specific DNA molecule corresponding to SPT-7R-949D or SPT-7R-1425D in a sample, the method comprising: (a) contacting the probe with the sample, The sample is DNA extracted from a rice plant, the DNA probe molecule being selected from a specific sequence in an event such as a partial sequence of a ligation sequence, and the DNA probe molecule can be associated with the event SPT-7R under stringent hybridization conditions. DNA hybridization of 949D or SPT-7R-1425D, and cannot hybridize to the DNA of control rice plants under stringent hybridization conditions; (b) subject the sample and probe to stringent hybridization conditions; (c) detect hybridization of probe and DNA Happening.

An embodiment of the present invention further provides a test kit for DNA of the event SPT-7R-949D or SPT-7R-1425D in a biological sample. The kit comprises a first primer and a second primer that can be used in a PCR identification program, the first primer specifically recognizing a left or right border flanking sequence of the event SPT-7R-949D or SPT-7R-1425D, The second primer can specifically recognize the exogenous insertion DNA sequence in the event SPT-7R-949D or SPT-7R-1425D. Another embodiment of the present invention also provides a kit for detecting an event SPT-7R-949D or SPT-7R-1425D in a biological sample, the kit comprising a specific probe having a corresponding probe The following sequence or sequence complementary to the sequence: a sequence having 80%-100% similarity to the specific region of event SPT-7R-949D or SPT-7R-1425D. The probe sequence corresponding to the specific region comprises a portion of the 5' or 3' flanking portion of the event SPT-7R-949D or SPT-7R-M25D.

Embodiments of the present invention also propose a method and kit for use in other embodiments of the present invention for other purposes, including but not limited to the following: identifying an event SPT in a plant, plant material or product -7R-949D or SPT-7R-1425D, including but not limited to food or servo products (fresh or processed) containing or derived from plants; distinguishing between genetically modified materials and genetically modified materials in non-GM materials And determine the quality of the plant material containing the rice event SPT-7R-949D or SPT-7R-1425D. The kit may also contain other reagents and materials necessary to carry out the assay.

In another aspect, the invention also provides a method of producing a progeny plant comprising the event SPT-7R-949D or SPT-7R-1425D. The progeny plants can be selfed or crossed plants. In other embodiments, the invention proposes a standard for event SPT-7R-949D or SPT-7R-1425D Record the method of assisted breeding. In another aspect, the invention also contemplates a stably transformed rice plant comprising the event SPT-7R-949D or SPT-7R-1425D.

The polynucleotide sequences of the created seed production technology events SPT-7R-949D and SPT-7R-1425D were ligated to the same DNA vector, and the polynucleotide sequence was inserted into a specific position of the rice genome to obtain the event SPT-7R-949D. And SPT-7R-1425D. A plant carrying an SPT-7R-949D event at a chromosomal location as described contains a ligated/transgene insertion sequence as set forth in SEQ ID NO: 13, 14, 17 or 18, carrying SPT- at the chromosomal location already described. The 7R-1425D event plant contains a linker sequence consisting of the genomic/transgene insertion sequence set forth in SEQ ID NO: 15, 16, 19 or 20. The genomic insertion site with event SPT-7R-949D or SPT-7R-1425D is characterized by enhanced breeding efficiency and makes it possible to track transgene insertion sequences in the breeding population and its progeny using molecular markers. The present invention also provides various methods and compositions for the identification, detection and use of plant, plant parts, seeds and cereal products for the rice event SPT-7R-949D or SPT-7R-1425D.

In some embodiments, polynucleotide sequences that create rice SPT-7R-949D or SPT-7R-1425D events can also be subjected to molecular stacking by genetic engineering methods. In other embodiments, the molecular aggregates may further comprise at least one additional transgenic polynucleotide sequence. The polynucleotide sequence may confer additional properties to the seed making technique or confer other plant traits on the transformed plant.

In certain embodiments, the polynucleotide sequences of interest can be arbitrarily combined to create molecular aggregates, and the plants transformed to create plants having the desired combination of traits to achieve aggregation of plant traits. The "trait" as used in the present invention refers to a phenotype exhibited by a specific DNA sequence or a group of DNA sequences. The resulting combination may also include multiple copies of any one or more polynucleotide sequences of interest. The trait aggregation combination can be created by any method including, but not limited to, plant breeding by conventional methods, or by genetic transformation. If the sequences are aggregated by plant genetic transformation, the polynucleotides of interest can be combined in any direction at any time. The trait can be introduced in the co-transformation step by the polynucleotide sequence of interest provided by the transformation expression cassette. For example, if two sequences are to be introduced, the two sequences can be contained in different transformation expression cassettes (trans) or in the same transformation expression cassette (cis). Expression of the sequences can be driven by the same or a different promoter. In certain instances, it may be desirable to introduce a transformed expression cassette that inhibits expression of a polynucleotide sequence of interest. It is also possible to produce any combination of desired traits by arbitrarily combining the expression cassette or the overexpression cassette. Plant. Those skilled in the art will also appreciate that polynucleotide sequences can also be aggregated at a desired genomic location by a site-specific recombination system. The above-mentioned techniques are described in the patents WO 99/25821, WO 99/25854, WO 99/25840, W099/25855 and WO 99/25853, all of which are incorporated herein by reference. It should be noted that the construct according to the embodiment of the present invention and its use are completed by the inventor of the present application through arduous creative labor and optimization work. DETAILED DESCRIPTION OF THE INVENTION In the description, "multiple" means two or more unless otherwise stated.

Detailed ways

The invention will now be described in accordance with specific embodiments. It is to be understood that the examples are merely illustrative of the invention and are not to be construed as limiting the invention in any way. Further, unless otherwise specified, the method involved in the following examples is a conventional method, and can be carried out by referring to the third edition of the Molecular Cloning Experiment Guide or related literature. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained commercially.

Example 1: Carrier Construction

An expression vector called PSPT7R as shown in Figure 1 was constructed by assembling the following DNA elements:

1) The hygromycin resistance gene and the cauliflower mosaic virus 35S promoter sequence on the pCAMBIA1300 plasmid were digested with Xmn I and Bgl I I based on the pCAMBIA1300 vector;

2) Gene expression cassette END2: DsRedir) -PINI I , the open reading frame of the gene (SEQ ID NO: 1) is linked to the END2 promoter (SEQ ID NO: 2) and the PINI I terminator (SEQ ID NO: 3) Between, reconstituted gene expression cassettes (END2: DsRed(r): PINI I);

3) The full-length nucleotide sequence of the ftsi / W^? gene, the target gene ftsi /^W^? and its promoter and terminator is shown in SEQ ID NO: 4, wherein the promoter sequence of the ftsi iM^ gene is as SEQ ID NO: 7, the terminator sequence thereof is shown in SEQ ID NO: 8, and the genomic DNA sequence of the ftsi iM^ gene is shown in SEQ ID NO: 5, and the amino acid sequence of the protein encoded by the nucleotide sequence is SEQ. ID NO: 6;

4) The gene expression cassette PG47: ZM-BT1: ZM-AA1-. IN2-1, the open reading frame of the target gene (the nucleotide sequence of which is shown in SEQ ID NO: 9) is ligated to the promoter PG47 (the nucleus thereof) a nucleotide sequence as shown in SEQ ID NO: 10), a transit peptide ZM-BT1 (the nucleotide sequence of which is shown in SEQ ID NO: 11) Downstream, the terminator IN2-1 (its nucleotide sequence is shown as SEQ ID NO: 12) is upstream.

Specifically, the construction process of the carrier PSPT7R is specifically described as follows:

In the first step, the pollen inactivating gene and the ZM-BT1 encoding the peptide are amplified from the cDNA of the maize callus, and the PG47 promoter is amplified from the maize genomic DNA. Among them, the amplification primers used for amplification are:

F3: CGGTACCCGGGGATC^VGATCT|CAAGGAAAAGACGTTATGCAG (SEQ ID NO: 37), which is a Bgl II restriction site,

R3: AAGGTCGTCCGGGCGGCCTGCGGCCTGGTCCAGGCAC (SEQ ID NO: 38), wherein the underlined nucleotide sequence is a 15 bp overlapping sequence;

The amplification primers used to amplify ZM-TP are:

F4: CGCCCGGACGACCTTGGGATCG (SEQ ID NO: 39);

R4: ATGGCGGCGACAATGGCAGTGAC (SEQ ID NO: 40);

The primers used to amplify the PG47 promoter are:

F5: CATTGTCGCCGCCATGGTGTCGTGATCGATGCTTTAT (SEQ ID NO: 41),

R5: CGACTCTAGAGGATCTGCACCGGACACTGTCTGGTGG (SEQ ID NO: 42), wherein the underlined nucleotide sequence is a 15 bp overlapping sequence).

The amplified gene, ZM-BT1 peptide and PG47 promoter were ligated into BamHI-digested binary vector pCAMBIA1300 by In-Fusion method to obtain intermediate vector A.

In the second step, the artificially synthesized red fluorescent protein gene PINII- 3⁄47fet ^ sequence is PCR-amplified, wherein the synthetic PINII- 3⁄47fec ^ sequence is as shown in SEQ ID NO: 43, and the amplification primer is: Fl: A TTAACGCCGAA JJ6GCCGCATTCGCAAAACACACC (SEQ ID NO: 44),

Rl: ^4 A4m3⁄440: ATGGCCTCCTCCGAGAACGTGA (SEQ ID NO: 45), wherein the nucleotide sequence underlined in italics is a 15 bp overlapping sequence.

The END 2 sequence was amplified from maize genomic DNA and its amplification primers were:

F2: CTCGGAGGAGGCCA 7GGTTACTAGTTCTTGGGGGACG (SEQ ID NO: 46),

R2:

NO: 47), wherein the nucleotide sequence underlined in italics is a 15 bp overlapping sequence.

The amplified PIN fragment was obtained from the corn using the In-Fusion method. The callus and seed (embryo and endosperm) specific promoter END 2 fragments were ligated into Xmn I and Bgl II digested intermediate vector A to obtain intermediate vector B.

In the third step, the nucleotide sequence of IN2-1 is artificially synthesized, and the sequence thereof is shown in SEQ ID NO: 48. The artificially synthesized IN2-1 sequence was digested with EcoR I and Bgl l l , wherein the synthetic IN2-1 sequence was as follows:

| Agatct | gacaaagcagcattagtccgttgatcggtggaagaccactcgtcagtgttgagttgaat actgt tcagttgttgaactctatttcttagccatgccaagtgcttttcttattttgaataacattacagcaaaa cgt gtcacatcagcgttctctttcccctata tctccacgtcgacgcggccaaatcctgaggatctggtcttcctaaggacccgggatatcggacggggga tccactagttctagagcggccgggtaccgagctcgaattaattggcgcgccgtttaaactcgcgatcg atAagggcaattccagcacactggcggccgttactagcga | ^ gaattc (SEQ ID N0: 48), where the underlined sequence is IN2-1 sequences, vector sequence is connected to the remaining region sequence, sequence boxed sequences respectively: Bgl II , Asc I, Nru I and EcoR I restriction sites, wherein the five bases after the Bgl II restriction site are on the IN2-1 sequence, and the other three cleavage sites of Asc I, Nru I and EcoR I are The vector is joined to the sequence. The plasmid in which the artificially synthesized IN2-1 sequence was placed was digested with an intermediate vector B which was digested with EcoR I and Bgl I I simultaneously to obtain an intermediate vector (:.

In the fourth step, the ftsi / W^ gene is divided into two segments, CYP1 and CYP2, respectively, and the nucleotide sequences thereof are shown in SEQ ID NO: 60 and SEQ ID NO: 61, respectively. CYP1 and CYP2 were amplified from rice genomic DNA, respectively.

Among them, the amplification primers of CYP1 are:

F6: CGA|TCGCGA|TTGGTCGAACACGAGGTAGGCG (SEQ ID NO: 49), the Nru I restriction site in the box;

R6: TCGAAGGACCGCACCGTGACCGTCGAC^TG (SEQ ID NO: 50), the Sal I restriction site is shown in the box, and the underlined base is used to distinguish the endogenous ftsi ^iM^ gene sequence in rice, and the expression efficiency is specifically introduced. Three SNPs; The amplification primers for CYP2 are:

F7: CAT|GTCGAC|GGTCACGGTGCGGTCCTTCGA (SEQ ID NO: 51), the Sal I restriction site is indicated in the box, and the three SNPs deliberately introduced to distinguish the endogenous CYP sequence of rice and improve the expression efficiency are underlined;

R7: ATT|GGCGCGCC|GTTTAAACAGGTGGAAGACAAGGTGGTGAGG (SEQ ID NO: 52), within the box is the Asc I restriction site

The two amplified products obtained were sequenced correctly with the T-vector, and then digested with Nru I and Sal I, and Sal I and Asc I, respectively, and ligated with Nru I and Asc I. The intermediate vector C, i.e., the SPT7R vector, is also referred to as pSPT7R.

Example 2: Rice Transformation

The plasmid PSPT7R was transferred to the Agrobacterium AGL0 strain by heat shock method, and the rice was co-transformed by Agrobacterium and mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. (1994) a/7 i JB (2): 271-282, which is incorporated herein by reference. The specific transforming receptor material is rice ms26 complete male sterile homozygous mutant, which is induced by radiation, and the mutation is caused by 3103 bp deletion (including most fragments of 0sCYP704B2) (missing segment physical location: ensembl plants Oryza japonica group version 64. 6 (MSU6) chromosome 3: 3, 701, 319 -3, 704, 421 ). The large fragment deletion mutation has a very low probability of back mutation, so the infertility trait is stable, thereby ensuring the stability of the sterile line and reducing the risk of hybrid seed production. The plasmid PSPT7R was transformed into rice receptor material by Agrobacterium, and the red fluorescent protein encoded by DsRed (r) gene in the vector was used as a selection marker. After 3-4 rounds of callus fluorescent screening and cleavage, the transgenic plants were differentiated to obtain a transgenic plant. More than 1000 positive transgenic materials were obtained by transformation of rice, and further analyzed by insertion site, copy number, and vector skeleton contamination, combined with results of pollen inactivation, seed setting rate, and seed separation ratio observed in the field. Two transgenic events SPT-7R-949D and SPT_7R_1425D.

Example 3: Pollen fertility testing for transformation events

Observation and analysis of the two transgenic events SPT-7R-949D and SPT-7R-1425D obtained in Example 2 revealed that no obvious morphological observation was observed between the transgenic plants and the non-transgenic control plants obtained in the present invention. different. The wild-type non-transgenic rice variety Wuyunjing No. 7 ( fertile, hereinafter referred to as CK1) and the non-transgenic rice line of the transgenic rice, Wuyunjing 7 ms26 mutant (infertility, referred to as For CK2), the pollen staining rate was tested.

In the late flowering stage of rice, a single plant was randomly selected from the transgenic rice, CK1 and CK2 plots in Daejeon. Each flower was taken from each plant. One flower was taken from each flower, placed in the center of the slide, and a drop of 1% I2 was added dropwise. - IK solution, release the pollen with tweezers and anatomic needle, cover with a cover slip, observe under the microscope, count the number of pollen pollen and the total number of pollen (Figure 2 shows the fertile pollen grains and sterile pollen grains after dyeing) . The standard deviation of the average of 3 replicates of each material in the transgenic rice, CK1 and CK2 pollen susceptibility was calculated. Under the premise of CK1 normal fertility and CK2 normal infertility, the χ2 test was used to analyze whether the pollen susceptibility rate of transgenic rice was significantly different from the theoretical value (50%).

The results showed that the staining rate of pollen (Τ3 genotype) on the SPT-7R-949D strain on the Τ2 generation plants is shown in Table 1 below. In this experiment, the ratio of pollen separation (average of 3 replicates) of 17 randomly selected plants was investigated by Ι2-ΚΙ staining method. It can be seen from Table 1 that the fertility rate of fertile control (CK1) is 98.6%~100%; Infertility control (CK2) fertility rate is 0; By χ2-test (degree of freedom is 1), among the 17 SPT-7R-949D plants, except for the chi-square value of single plant 9 (7.454) slightly higher than the critical value (3.81), the ratio of fertile pollen to sterile pollen in the other 16 flowers was at the level of !^ ≤ 0.05, which was in accordance with the ratio of 1:1.

The staining rate of pollen (Τ3 genotype) on the SPT-7R-1425D strain on the Τ2 generation plants is shown in Table 2. Seventeen plants were randomly selected and the average of 3 replicates was calculated. As can be seen from Table 2, the fertility rate of the fertile control (CK1) is between 95.01% and 99.8%; the fertility rate of the sterile control (CK2) is 0; by the χ2-test (degree of freedom is 1), Among the 17 SPT-7R-1425D plants, except for the chi-square value (6.426) of single plant 3, which was higher than the critical value (3.81), the ratio of fertile pollen to sterile pollen in 16 other flowers was Ρ≤0.05. Level, in accordance with the ratio of 1:1.

The results indicated that the T-DNA foreign genes in the transformation events SPT-7R-949D and SPT-7R-1425D were heterozygous in each generation, so half of the pollen contained no foreign genes ( fertile), and half contained The exogenous gene (sterile), and the ZM-AA1 expression cassette can effectively decompose the starch in the pollen, thereby depriving the pollen containing the foreign gene, losing the ability to fertilize, and inactivating the transgenic pollen. This design makes all the transgenic pollen containing ZM-AA1 gene inactivated in the above two transformation events. The inability to insemination can also strictly prevent biosafety problems such as gene drift. Inactivated pollen cannot be given with other plants or weeds around. Therefore, transgenes cannot drift through the pollen into the environment.

Table 1: Pollen I ₂ -KI on transformants SPT-7R-949D T ₂ plants

Note: x ² a. ₅ (1) = 3.81, * indicates a significant level of 0.05 that is considered to be in compliance with a 1:1 ratio. Table 2: Analysis of pollen Ι2-ΚΙ staining on transformants SPT-7R-1425D Τ ₂ generation plants

88 1 98. 9 0 0 0 219 192 1. 774*

5500 48 99. 1 0 0 0 4072 3902 1. 04

Note: x ² a ₅ ( 1 ) = 3. 81, * indicates a significant level of 0. 05 is considered to be in accordance with the 1 1 ratio.

Example 4: Separation ratio of fluorescent seeds to non-fluorescent seeds The 24 Τ2 generation plants of SPT-7R-949D and SPT-7R-1425D obtained in Example 2 were randomly selected and the fluorescence of the cells was analyzed. The separation ratio of non-fluorescent seeds was investigated, and the results are shown in Table 3 below. Among them, the χ2 value (df=l) was lower than the critical value of 3.81, indicating that the seeds of each of the two transformants met the 1:1 separation ratio. It is indicated that the elements of the expression vector provided in the present invention are well expressed as a whole, that is, the transformation site is always in a heterozygous state in each generation of the transformation event, so that half of the pollen does not contain the foreign gene, and half of the foreign gene contains the exogenous gene. Half of the pollen of the source gene is inactivated (ie, the ability to insemination is lost), so the foreign gene is transmitted to the next generation only through the female gametes, and the other half of the pollen that does not contain the foreign gene can make the transformant self-sufficient, and the fluorescent fertile seeds are The ratio with non-fluorescent sterile seeds is 1: 1, fertile plants (with exogenous genes) are used as maintainer lines, and sterile lines and maintainer lines can be easily and continuously produced by selfing, sterile plants ( Contains no genetically modified ingredients) is used as a parent for hybrid seed production. Table 3: Proportion of fluorescent seeds and non-fluorescent seeds in self-crossing lines on strains SPT-7R-949D and SPT-7R-1425D

13 106 112 0. 95 0. 165* 134 118 1. 14 1. 016*

14 54 65 0. 83 1. 017* 67 73 0. 92 0. 257*

15 131 126 1. 04 0. 097* 109 96 1. 14 0. 824*

16 111 111 1. 00 0. 000* 145 144 1. 01 0. 003*

17 101 106 0. 95 0. 121* 183 188 0. 97 0. 067*

18 29 40 0. 73 1. 754* 135 136 0. 99 0. 004*

19 152 149 1. 02 0. 030* 62 45 1. 38 2. 701*

20 74 91 0. 81 1. 752* 257 291 0. 88 2. 109*

21 206 207 1. 00 0. 002* 46 54 0. 85 0. 640*

22 185 158 1. 17 2. 125* 29 32 0. 91 0. 148*

23 97 73 1. 33 3. 388* 186 214 0. 87 1. 960*

24 63 74 0. 85 0. 883* 255 292 0. 87 2. 503* Note: x ² . . . . ₅ ( 1 ) = 3. 81, * indicates that the level of significance is below 0.05, which is considered to be in proportion to 1:1. As can be seen from the above-described Example 3 and Example 4, the present invention achieves the object of its invention for stably creating a rice male sterile line and a maintainer line.

Example 5: Flanking sequence analysis of transformation events

Using the genomic DNA of the transgenic rice lines SPT-7R-949D and SPT-7R-1425D obtained in Example 2 as a template, the pSPT7R vector and the rice transformation receptor Wuyunjing 7 ms26 mutant (sterile) plants were used as In the negative control, the T-DNA flanking sequence was amplified by TAIL-PCR to obtain the T-DNA flanking sequences of the transformation events SPT-7R-949D and SPT-7R-1425D, and the integration of T-DNA was verified. The putative T-DNA integration method was verified by ordinary PCR, and it was analyzed whether the foreign gene was inserted into the known endogenous gene of rice.

The primer information used in the experimental analysis is shown in Table 4.

Primer information used in PCR amplification

A949B-R TTCCACCACACACCAAAACCA (33)

A1425LB-2 TAAAGAAGGCTCGCAAGTGTG (34)

A1425RB-2 CATCCTAGTCATTGGGTTGGG (35) The extracted rice genomic DNA was appropriately diluted, and the UV absorbance at 260 nm and 280 nm was measured and recorded, and the purified DNA concentration was calculated with an OD260 value equivalent to 50 μ _§ /ηΛ DNA concentration. The ratio of DNA solution OD260/OD280 is between 1.7 and 2.0. Store at 4 ° C for one week.

According to the modified thermal asymmetric interdigitation PCR (THERMAL ASYMMETRIC INTERLACED PCR TAIL-PCR) designed by Liu Yaoguang et al. (Liu et al., Efficient amplification of insert end sequences from bacterial artificial chromosome clones by thermal asym-metric interlaced PCR, 1998) Plant Molecular Biology Reporter

16(2): 175-181, which is incorporated herein by reference, to design three nested specific primers (SPECIALPRIMER, SP1, SP2, SP3) on exogenously inserted T-DNA, SP1 and random A combination of degenerate primers (LONG ARBITRARYDEGENERATE PRIMER, LAD), and SP2 and B SP3 were combined with anchor primer AC l respectively, using genomic DNA as a template to design asymmetric temperature cycles based on primer length and specificity, and performing TAIL-PCR . The reaction scheme is shown in Table 5.

TAIL-PCR experimental procedure

1 4 °C ti ll end

1 94 °C 5 min

2 94 °C 30s, 60 °C 30s, 72 °C 2 min30s

94 °C 20s, 63 °C 30s, 72 °C 2 min30s Third round 14 94 °C 20s, 63 °C 30s, 72 °C 2 min30s

94 °C 20s, 50 °C 30s, 72 °C 2 min30s

1 72 °C 10 min

1 4 °C ti l l end

Prepare a 1% agarose gel, place the products of the second and third rounds of TAIL-PCR into the sample tank, perform electrophoresis at 120V for 20 minutes, observe the gel under UV light, and cut the size of the nested product. Next, the PCR product was recovered using an agarose gel recovery kit (TIANGEN, Beijing). The purified PCR product was ligated to T-vector (Promega, USA) using T4 ligase (New England Biolabs, USA) and the system was reacted overnight at 16 °C. The connection system is shown in Table 6. Table 6 T-carrier linkage system

The above-mentioned ligation solution which was reacted overnight at 16 ° C was transformed into Escherichia coli, and the obtained single colony was picked out, and cultured in an LB medium containing ampicillin at 37 ° C for 5 hours with shaking (150 rpm), and DNA sequencing was performed.

Based on the results of TAIL-PCR, primers were designed based on the flanking sequence of the T-DNA insertion position, combined with primers in the T-DNA, and PCR amplification was carried out using genomic DNA as a template. The PCR reaction system is shown in Table 7. Table 7 PCR reaction system (20 μl system)

10 mM dNTP 0. 5 μ 1

DMSO 0. 133 μ 1

Taq enzyme 0. 25 μ 1

DNA template 1 μ 1 Deionized water 16. 117 μ 1 PCR amplification conditions were set according to different primers, and the PCR product was run on agarose gel. The obtained flanking sequences were sequenced and analyzed with the database (MSU Rice Genome Annotation Project Release 7, released on October 31, 2011,

Alignment of rice genome sequences in ftp://ftp.plantbiology.msu.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/ pseudomolecules/version_7.0/), found in the SPT-7R-949D transformation event, T- The DNA is inserted into the short arm of the chromosome 3 of the rice near the centromere. The physical position is Chr3: 14,746,015-14,746,027. The inserted rice endogenous gene coding region is not inserted, and the upstream gene is inserted.

The start codon of LOC_Os03g25760 is 4411 bp, and the stop codon 5804 bp from the downstream gene LOC_Os03g25770 (Fig. 3, Fig. 4). T-DNA integration results in the deletion of 11 bases in the genomic sequence at the integration site, and the deletion sequence, as shown in SEQ ID NO: 63, is 5' GGGGGTCGGTG 3', which does not disrupt the rice coding region of the endogenous gene.

In the SPT-7R-1425D transformation event, T-DNA was inserted at the distal end of the long arm of chromosome 1 of rice, and the physical position was Chrl: 42,215,016-42, 215,095, and no known endogenous rice was inserted. The gene coding region is 1343 bp from the upstream gene LOC_Os01g72760 stop codon and 1953 bp from the downstream gene LOC_Os01g72780 start codon (Fig. 5, Fig. 6). T-DNA integration results in a deletion of 78 bases in the genomic sequence, as shown in SEQ ID NO: 62, which does not disrupt the rice coding region of the endogenous gene.

In both transformation events, none of the T-DNA was inserted inside the known rice endogenous gene. The junction region of the genomic DNA of the foreign T-DNA and the insertion site is subjected to PCR amplification to verify the insertion position of the foreign T-DNA and to speculate the T-DNA integration mode, that is, to target between the flanking sequence and the T-DNA insertion sequence. The sequence was subjected to PCR amplification, and the result further confirmed the correctness of the T-DNA insertion site, and showed that SPT-7R-949D was a reverse tandem double-copy single-site integration, and the result is shown in Fig. 4, which was inserted outside. The specific nucleotide sequences of the 5' and 3' flanking sequences of the source T-DNA are shown in SEQ ID NO: 13 and SEQ ID NO: 14, respectively; and the T-DNA of SPT-7R-1425D is a single copy. Insertion, the result is shown in Figure 6. The specific nucleotide sequences of the 5' and 3' flanking sequences of the inserted exogenous T-DNA are as follows. ID NO: 15 and SEQ ID NO: 16.

Further, the complete exogenous T-DNA sequences inserted into the transformation events SPT-7R-949D and SPT-7R-1425D were obtained by sequencing analysis, and the specific sequences are shown in SEQ ID NO: 53 and SEQ ID NO: 54, respectively. By analyzing the sequencing results of the exogenous T-DNA fragments in the two transformation events, it was confirmed that the transformation event SPT-7R-949D has two copies of the exogenous T-DNA integrated in the genome, and the reverse tandem, one of which is identical to the vector. The PG47 promoter in the other copy lacks 1965 bp. This deletion does not affect the normal biological function of each element and expression cassette. Only one complete copy of T-DNA is integrated into the genome of the transformation event SPT-7R-1425D.

Example 6: Analysis of integration stability of foreign genes in transformation events

In order to verify the copy number and integrity of the foreign gene insert in the above transformation event, the present invention analyzes the above transformation event by Southern blot analysis.

The probe is designed based on the T-DNA sequence in the vector, wherein the probe sequence for detecting the target gene (including the OsCYP704B2 and ZM-AA1 expression cassettes) in the transformation event SPT-7R-949D is as shown in SEQ ID NO: 55, detection The probe sequence of the color selection gene DsRed (r) is shown in SEQ ID NO:56. The probe binding site and restriction site on the exogenous T-DNA in the transformation event SPT-7R-949D are shown in Figure 7, wherein Figure 7A shows the location of the probe sequence and the Hind III restriction site on the target gene; 7B shows the position of the probe sequence on the color-selective gene and the EcoR I restriction site.

The probe sequence for detecting OsCYP704B2 in the transformation event SPT-7R-1425D is shown in SEQ ID NO: 57, and the probe sequence for detecting the pollen inactivating gene ZM-AAl is shown in SEQ ID NO: 58, and the color selection gene is detected. The probe sequence of DsRed(r) is set forth in SEQ ID NO:59. The probe binding sites and restriction sites on the exogenous T-DNA in the transformation event SPT-7R-1425D are shown in Figure 8 and Figure 9, wherein Figure 8 shows that the transformation event SPT-7R-1425D uses OsCYP704B2 as a probe. After Hindlll digestion, the expected fragment size was generated by Southern blot. Figure 9 shows that the transformation event SPT-7R-1425D was probed by Zm-AAl and DsRed(r), respectively. After EcoR I digestion, Southern blot was performed. The expected fragment size produced.

The T2, Τ3 and Τ4 generation plants of transgenic rice lines SPT-7R-949D and SPT-7R-1425D, and the transforming receptor material Wuyunjing 7 ms26/ms26 mutant were used as experimental materials, and the following experimental procedures were carried out. Southern blot analysis.

1, DNA extraction

Rice genomic DNA was extracted according to the agricultural industry standard NY/T674 of the People's Republic of China. will The DNA was appropriately diluted, and the ultraviolet absorbance at 260 nm and 280 nm was measured and recorded, and the purified DNA concentration was calculated with an OD260 value equivalent to 50 g/mL DNA concentration. The ratio of DNA solution OD260/OD280 is between 1.7 and 2.0. The DNA solution was diluted to 100 ng^L according to the measured concentration, and stored at 4 ° C for one week.

2. Digoxin labeled probe (random primer method)

Lμ (at least 300 ng) of template DNA, diluted to 16 L with sterile ddH20;

Boil in a boiling water bath for 10 minutes, immediately put in ice;

Mix DIG-High Prime (bottle 1), add 4 ul to denatured DNA, mix well, and centrifuge slightly; 37 reaction overnight (about 20 hours);

The reaction was stopped by adding 2 ul of 0.2 M EDTA (Ph 8.0) or 65 °C lOmin.

3, detection probe efficiency

After the control probe and the labeled probe are subjected to a series of dilutions, they are directly spotted on the membrane, and the labeling efficiency of the target probe is determined by standard detection.

4, electrophoresis and transfer film

(1) Preparation of 1% agarose gel, constant voltage 45V electrophoresis overnight;

(2) Stop electrophoresis when the bromophenol blue distance is about 6-8 cm. Cut off the sample hole and excess glue, and cut off the lower left corner for marking;

(3) The gel is immersed in 200ml, 0. 25M HC1 for about 5-10 minutes of depurination;

(4) After removing the gel and rinsing it in deionized water, it is immersed in the denaturing solution for 2 X 15 min _;

(5) Remove the gel, rinse it in deionized water, and then immerse it in the neutralizing solution for 2 X 15 min _;

(6) After the gel is taken out and rinsed in deionized water, capillary transfer is performed;

(7) Capillary transfer of DNA: in a large petri dish 20 X SSC → shelf glass plate → glass plate thick filter paper → catch bubbles → place the gel sample hole down on the filter paper bridge → use around

Cover the Parafi lm film → Put a large nylon film on the glue → Crush the bubble → Put four layers of filter paper on the film and the film → Bubbles → Put a 10 cm thick paper towel → Put the glass plate → Press 500 g Object

(8) Capillary transfer for 24 h, remove the membrane and wash it in 2 X SSC, clamp it in filter paper, clamp it in filter paper, 254 nm UV, UV cross-link for 3 min.

5, hybrid (1) Pre-hybridization: The membrane was immersed in DIGEasy Hyb (10 ml / 100 cm ² membrane) preheated to the hybridization temperature (52 ° C), pre-hybridized for 1 h in a hybridization box at 52 ° C, 60 rpm _;

(2) After denaturation of the DNA probe (about 25 ng/ml DIG Easy Hyb) at 100 ° C for 10 min, immediately put it on ice and cool for 10 min;

(3) Add the denatured DNA probe to the preheated (52 ° C) DIG Easy Hyb (3.5 ml / 100 cm ² membrane), gently mix to avoid foam;

(4) Pour off the pre-hybridization solution, pour the hybridization solution into a hybridization flask, and hybridize at 52 ° C, 60 rpm for 12-16 hours;

(5) After the end of the hybridization, the hybridization solution is recovered, and can be stored for one year at 20 ° C, and re-denatured by heating at 68 ° C for 10 minutes.

6, wash the film

1) Low stringency (high salt, low temperature): sufficient 2XSSC + 0.1% SDS, washing at room temperature 60 rpm 2 X 15min;

2) High stringency (low salt, high temperature): 0.5XSSC + 0.1% SDS (preheating to washing temperature), washing at 60 rpm for 2X15min.

Note: If the probe is > 150 bp and the G/C% is high, the membrane should be washed at 68 °C; when it is shorter than 100 bp, the washing temperature is the same as the hybridization temperature.

7, testing

Using chemiluminescence detection, all operations were carried out at room temperature.

1) After the hybridization is completed and the membrane is washed, the membrane is briefly washed in the Washing buffer for about 1-5 min;

2) Block in the 80ml Blocking solution for 30 min (light shake);

3) Reaction in 20ml Antibody solution for 40 min;

4) Transfer the film into a new container and wash twice with Washing buffer for 15 min each time;

5) Balance 2_5min in 20ml Detection buffer.

6) Carefully put the membrane DNA face up into the hybrid bag, pipette 1ml CSPD ready-to-use (Kit bottle 5) and apply it evenly to the membrane. Immediately cover the upper layer of the hybrid bag on the membrane to make the substrate evenly spread. Fully film surface, and avoid bubble generation, react at room temperature for 5 min _;

7) Extrude excess liquid and seal the edges of the hybrid bag (to prevent the film from drying);

8) Place the film at 37 ° C for 10 min to enhance the luminescence reaction;

9) Expose X-film for 15_25min and observe the result. Conclusion 1. Southern blot analysis of the integration stability of exogenous genes in T ₂ , Τ ₃ and Τ ₄ plants of transformant SPT-7R-949D was performed using the transforming receptor wuyun 粳7 ms26/ms26 mutant DNA as a negative control. The plasmid DNA was added to the wild type genomic DNA of Wuyunjing 7 as a positive control, and the probe was able to bind smoothly to the target sequence under the hybridization conditions. Analysis of the results of integration stability of target genes

The transformant SPT-7R-949D T2, Τ3 and Τ4 generation genomic DNA were digested with Hind III, and Southern blot was performed according to the designed gene design probe. The results showed that the strains of T2, Τ3 and Τ4 plants had signal bands of ~5.6 kb and ~7.9 kb (Fig. 10), and the expected fragment size on the actual observed fragments and transformants (ie 5574 bp and 7921 bp). The match (Table 8) indicates that both are 2 copies. The intergenerational bands were the same size and the copy number was consistent, indicating that the target gene of the transformant SPT-7R-949D was stably inherited between T2, Τ3 and Τ4 generations. Analysis of results of integration stability of color selection genes

The transformant SPT-7R-949D T2, Τ3 and Τ4 generation genomic DNA were digested with EcoR I, and probes were designed according to the color selection gene sequence for Southern blot analysis. The results showed that the three strains of T2, Τ3 and Τ4 plants of this strain had signal bands of ~18 kb and ~8.4 kb (Fig. 11). The actual observed fragment was consistent with the expected fragment size on the transformants (ie 18184 bp and 8425 bp) (Table 8). The number of hybrid signal lines in the 3rd generation was the same, and the size of the bands was consistent, indicating that the color selection gene of the transformant SPT-7R-949D was stably inherited between T2, Τ3 and Τ4 generations.

In summary, the size of the hybridized fragment can be predicted based on the T-DNA sequence, the insertion site flanking sequence, the probe position, and the restriction site on the transformant SPT-7R-949D. The actual observation is compared with the prediction to confirm the copy number of the foreign gene. As can be seen from Table 8, the actual observed fragments of all hybridizations corresponded to the corresponding predicted fragment size. Therefore, the foreign gene was stably integrated between the Τ2, Τ3, and Τ4 generations of SPT-7R-949D, and remained unchanged for 2 copies.

Table 8 Southern blot predicted fragments and actual observed fragment size of exogenous genes in Τ2, Τ3 and Τ4 generation plants of SPT-7R-949D

Pre-actual observation of the transformant on which the probe is located

Gene size fragment size fragment size

SPT-7R-949D target gene 5574 bp _5.__6kb__.

7_921bjD, 8. Okb T ₃ 5_57_4 _ bp_ 5.__6kb __.

7921bp Z. 8:. kb

T ₄ 5574 _ bp_ _3⁄4_ 6kb__.

7921bp : .

T ₂ 8— 4— 25 — bp — — 8 — · — 4 — k — b — —

18184bp ~ 18kb color selection gene. _R j T ₃ 8425bp _l8..4kb...

Ϊ8 Ϊ83⁄4Ε) ϋ—

T ₄ _8425bp_ — :8— ·— :4 :—

18184bp ~ 18k- b According to the target gene sequence and color-selective gene sequence design probe, Southern blot was performed on the genomic DNA of T2, Τ3 and Τ4 generation plants of transformant SPT-7R-949D, and the results showed that the 3rd generation exogenous gene All

2 copies, the number of hybrid bands was the same, and the size of the bands was consistent, indicating that the foreign gene of the transformant was stably inherited between the three generations.

Conclusion 2. Southern blot analysis of the integration stability of exogenous genes in T ₂ , Τ ₃ and Τ ₄ generation plants of transformant SPT-7R-1425D

The transformant receptor Wuyunjing 7 ms26/ms26 mutant DNA was used as a negative control, and the plasmid DNA was added to the wild type genomic DNA of Wuyunjing 7 as a positive control. The probe was able to successfully communicate with the target sequence under this hybridization condition. Combine. Analysis of the results of integration stability of genes

The genomic DNA of the transformants SPT-7R-1425D T2, Τ3 and Τ4 plants was digested with Hind III, and Southern blot was performed according to the design probe of OsCYP704B2 gene. The results showed that there were ~ 8.3 kb signal bands in the T2, Τ3 and Τ4 generation plants of this line (Fig. 12). The actual observed fragment was consistent with the expected fragment size (ie, 8348 bp) on the transformants (Table 9), indicating that both were 1 copy. Intergenerational bands were identical in size and consistent in copy number, indicating that the OsCYP704B2 gene of the transformant SPT-7R-1425D was stably inherited between T2, Τ3 and Τ4 generations.

Analysis of the results of integration stability of ZM-AA1 gene

The genomic DNA of the transformants SPT-7R-1425D T2, Τ3 and Τ4 plants were digested with EcoR I and subjected to Southern blot detection according to the ZM-AA1 gene design probe. The results showed that there were ~ 5.9 kb signal bands in the three individuals of the T2, Τ3 and Τ4 generation plants of this line (Fig. 13), and the actual observed fragments were consistent with the expected fragment size on the transformants (ie 5934 bp) (Table) 9), indicating that they are all 1 copy. Intergenerational hybridization The number of signal bars was the same and the size of the bands was consistent, indicating that the ZM-AA1 gene of the transformant SPT-7R-1425D was stably inherited between T2, Τ3 and Τ4 generations.

ζ3⁄4Λ3⁄4ί >> Analysis of the results of integration stability of genes

The transformant SPT-7R-1425D T2, Τ3 and Τ4 generation genomic DNA were digested with EcoR I, and probes were designed according to the DsRed(r) gene sequence for Southern blot analysis. The results showed that there were ~4.8 kb signal bands in the three individuals of the T2, Τ3 and Τ4 generation plants of this line (Fig. 14). The actual observed fragment was consistent with the expected fragment size (i.e., 4824 bp) on the transformants (Table 9), both of which were 1 copy. The number of signal bands in the 3rd generation hybridization was the same, and the size of the bands was consistent, indicating that the DsRed(r) gene of the transformant SPT-7R-1425D was stably inherited between T2, Τ3 and Τ4 generations.

In summary, the size of the hybridization fragment was predicted based on the T-DNA sequence, the insertion site flanking sequence, the probe position and the restriction site on the transformant SPT-7R-1425D. The actual observation is compared with the prediction to confirm the copy number of the foreign gene. As can be seen from Table 9 below, the actual observed fragments of all crosses correspond to the corresponding predicted fragment sizes. Therefore, the foreign gene is stably integrated between the Τ2, Τ3, and Τ4 generations of SPT-7R-1425D, and remains unchanged for one copy. Table 9 Southern blot predicted fragments and actual observed fragment size of exogenous genes in Τ2, Τ3 and Τ4 generation plants of SPT-7R-1425D

Probe endonuclease Pre-actual observation on transformants Transformants

Genetically determined fragment size fragment size τ ₂ 8348bp ~ 8. 3kb

0sCYP704B2 Ηίηά III τ ₃ 8348bp ~ 8. 3kb τ ₄ 8348bp ~ 8. 3kb τ ₂ 5934 bp ~6. Okb

SPT-7R-1425D Zm-AAl EcoR I τ ₃ 5934 bp ~6. Okb τ ₄ 5934 bp ~6. Okb

T ₂ 4824bp

DsRed(r) EcoR IT ₃ 4824bp ~4. 8kb

T ₄ 4824 bp ~4. 8 kb According to the OsCYP704B2, Zm-AAl and DsRed(r) gene sequences, Southern blot was performed on the genomic DNA of T2, Τ3 and Τ4 plants of transformant SPT-7R-1425.

The exogenous genes were all 1 copy in the 3rd generation, the number of hybrid bands was the same, and the size of the bands was consistent, indicating that the foreign gene of the transformant was stably inherited between the three generations. Example 7: Expression analysis of foreign genes in transformation events (RT-PCR detection)

Transgenic rice lines T2 generation seedling stage roots, seedling stage stems, seedling stage leaves, spikelet primordium differentiation stage young ears (P3 stage), pollen mother cells meiosis stage young ears (P6 stage), pollen mature stage The cDNA of the ear (P8 stage) and the seed mature stage was used as a template to amplify the target genes OsCYP704B2, Zm-AAl and DsRed(r), respectively, to study the expression level of the target gene in different tissues of different growth stages of rice.

The time of collection, organization and detection of target genes are shown in Table 10.

Take 100 mg of sample and add liquid nitrogen to the powder in a mortar. Add Trizol (1 ml per lOOmg of force) and grind again to the tissue. Then transfer the slurry to a centrifuge tube (1 ml per tube). Add 0.2 ml per tube. Chloroform, violently shaken until mixed. Centrifuge for 6 min, 14000 rpm, take 400 ul of supernatant to a new centrifuge tube, add 500 ul of isopropanol, shake gently up and down, stand at room temperature for 2 min, centrifuge at room temperature for 5 min, 14000 rpm, remove supernatant, force B 500ul 75% ethanol (DEPC treatment) The precipitate was washed twice, centrifuged at room temperature for 2 min, 12000 rpm, and air-dried (about 15 min), and then 40 μl of deionized water (DEPC treatment) was added to dissolve the RA precipitate. Finally, it was digested with DNase for half an hour. Reverse transcription The RNA was reverse transcribed into cDNA according to the procedure of Fermentas' RevertAidTM First Strand cDNA Synthesis Kit.

DsRed(r) primers and amplification products

The expression sequences of OsCYP704B2 gene, DsRed(r) gene, Zm-AAl gene and Actin gene were used as templates. Primers were designed (Table 11). Primers of the Actin gene and the OsCYP704B2 gene are designed across introns, and the cDNA of these two genes is theoretically smaller than the length of the amplified product using genomic DNA (gDNA) as a template. Table 11 Qualitative PCR primer information for target genes and reference genes

Detection gene Primer name Primer sequence (5 ' -3 ' , SEQ ID NO: ) Amplification product size

RT-CYP-F TGACATCATTCTTCCCAGTAGCA (64)

0sCYP704B2 cDNA (344bp) /gDNA (432bp)

RT-CYP-R ATCACCGAGCAGCACATCCA (65)

RT-ZMAA-F GACAATGGCAGTGACGACGAT (66)

Zm-AAl

RT-ZMAA-R CCGCTGTAGCTCAGCGAGTT (67) cDNA (882bp)

RT-DsRed-F CTCGTACTGCTCCACGATGGT (68)

DsRed(r)

RT-DsRed-R AGCGCGTGATGAACTTCGA (69) cDNA (365bp)

Ac t in - F ACCTTCAACACCCCTGCTATG (70)

Actin cDNA (554bp) /gDNA (803bp)

Ac t in - R GCAATGCCAGGGAACATAGTG (71)

Q- Act in-F TGGCATCTCTCAGCACATTCC (72)

Actin

Q- Act in-R TGCACAATGGATGGGTCAGA (73) DNA (157bp) Note: The number of bases in parentheses is the corresponding primer and template PCR amplification product size

PCR amplification

The PCR system was established according to the system provided by the Taq enzyme specification (Table 12). The amplification procedures were: 94 ° C 5 min _; 94 ° C 0.5 min, 60 ° C 0.5 min, 72 ° C lmin, 30 cycles; 72 ° C 10 min. After PCR amplification, each reaction system was subjected to 1.5% agarose gel electrophoresis.

PCR amplification system

Reagent final concentration single sample volume dd 0 28. 75 μΐ

10 X PCR buffer I X 5 μΐ

25 mmol/L MgCl ₂ 2. 5 mmol/L 5 μΐ

dNTPs 0. 2 mmol/L 4 μΐ

10 μπιοΙ/L Primer 1 0. 5 ol/l 2. 5 μΐ

10 μπιοΙ/L Primer 2 0. 5 ol/l 2. 5 μΐ

5 V/μΙ Taq enzyme o. 025 υ/μΐ 0. 25 μΐ

25 ng/μΐ DNA template 1 ng/μΐ 2. ο μΐ

Total volume 50 μΐ

Expression pattern of three target genes in SPT-7R-949D transformation event

The SPT-7R-949D Τ2 generation plants and the control Wuyunjing 7 ms26/ms26 (mutant), Wuyunjing 7 (wild type) seedling roots, seedling stage stems, seedling stage leaves, P3 stage, Seeds of P6, P8 and grain maturity RA was reverse transcribed to obtain cDNA, and the target genes OsCYP704B2, Zm-AAl, DsRed(r) and the internal reference gene Actin were amplified by using these cDNAs as templates (Fig. 15).

(1) There is no amplified band in the blank control, indicating that the PCR amplification system has no target sequence contamination;

(2) The positive control can use the genomic DNA of the transgenic line as a template to amplify the target band, and the size is consistent with the expected, indicating that the PCR amplification system can effectively amplify the target sequence;

(3) Using the cDNA of the above transgenic strain as a template, a 554 bp internal reference gene Actin fragment and a 344 bp target gene OsCYP704B2 fragment were amplified, which were smaller than the PCR amplification products using genomic DNA as a template (sizes 803 bp and 432 bp, respectively). ), indicating that RA extraction and reverse transcription are successful and there is no DNA contamination.

(4) The cDNA of different tissues of different periods of Wuyunjing 7 (wild type) was used as a template, and only the OsCYP704B2 fragment of about 344 bp was amplified from the P6 panicle cDNA. It indicated that the rice endogenous gene OsCYP704B2 was specifically expressed in P6 phase.

(5) The cDNA of different tissues of different periods of msun/ms26 (mutant) of Wuyunjing 7 was used as a template, and the OsCYP704B2 gene product was not amplified, indicating that the mutation caused the loss of endogenous OsCYP704B2 gene expression in rice.

(6) The target gene was amplified by using the cDNA of different tissues of SPT-7R-949D at different stages, and the OsCYP704B2 fragment of about 344 bp was amplified from the P6 panicle cDNA, and the cDNA of P8 stage was amplified. A 882 bp ZmAAl fragment amplified a DsRed(r) fragment of approximately 365 bp in the seed mature stage. The results showed that the OsCYP704B2 gene was specifically expressed in the P6 phase and the Zm-AAl gene was specifically expressed in the P8 phase, DsRed. (r) The gene is specifically expressed in the seed.

Expression pattern of three target genes in SPT-7R-1425D transformant

SPT-7R-1425D T2 plants and control materials were extracted separately from the seedling stage ms26/ms26 (mutant), Wuyunjing 7 (wild type), seedling stage stem, seedling stage leaf, P3 stage In the P6, P8 and grain maturity stages, RA was reverse transcribed to obtain cDNA, and these cDNAs were used as templates to amplify the target genes OsCYP704B2, Zm-AAl, DsRed(r) and the internal reference gene Actin (Fig. 16). .

(3) Using the cDNA of the above transgenic strain as a template, a 554 bp internal reference gene Actin fragment and a 344 bp target gene OsCYP704B2 fragment were amplified, which were smaller than the PCR amplification products using genomic DNA as a template (sizes 803 bp and 432 bp, respectively). ), indicating that RA extraction and reverse transcription are successful and there is no DNA contamination. (4) The cDNA of different tissues of different periods of Wuyunjing 7 (wild type) was used as a template, and only the OsCYP704B2 fragment of about 344 bp was amplified from the P6 panicle cDNA. It indicated that the rice endogenous gene OsCYP704B2 was specifically expressed in rice P6 phase.

(5) The cDNA of different tissues in different periods of ms26/ms26 (mutant) of Wuyunjing 7 was used as a template, and the OsCYP704B2 gene product was not amplified, indicating that the mutation caused the loss of endogenous OsCYP704B2 gene expression in rice.

(6) The target gene was amplified by using the cDNA of different tissues of SPT-7R-1425D as a template, and the OsCYP704B2 fragment of about 344 bp was amplified in the P6 panicle cDNA, and the P8 cDNA was amplified in the P8 stage. A ZmAAl fragment of about 882 bp is amplified, which is about 365 bp in the seed mature stage.

The DsRed(r) fragment; the experimental results show that the OsCYP704B2 gene is specifically expressed in the P6 phase, the Zm-AAl gene is specifically expressed in the P8 phase, and the DsRed(r) gene is specifically expressed in the seed.

Industrial applicability

The construct of the present invention can be effectively applied to the construction of a rice male sterile line and a maintainer line, and the fertility-stable rice male-sterile line and maintainer line obtained thereby can be efficiently applied to the production of hybrid seeds, thereby being able to obtain Safe, quality hybrid rice seeds.

Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and alterations of those details are possible in light of the teachings of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

In the description of the present specification, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiment", "example", "specific example", or "some examples", etc. Particular features, structures, materials or features described in the examples or examples are included in at least one embodiment or example of the invention. In the present specification, the schematic representation of the above terms does not necessarily mean the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in a suitable manner in any one or more embodiments or examples.

Claims

Claim

A plant or a DNA-containing portion thereof comprising the DNA sequence of SEQ ID NO: 13, 14, 17 or 18.

A plant or a DNA-containing portion thereof comprising the DNA sequence of SEQ ID NO: 15, 16, 6, or 20.

3. Primer pairs or probe pairs for identifying events in biological samples SPT-7R-949D or SPT-7R-1425D, including:

a) a first probe or first primer that specifically targets a first sequence, wherein the targeted first sequence is located in the T-DNA insert of SEQ ID NO: 53 or 54;

b) a second probe or a second primer that specifically targets the second sequence, wherein the targeted second sequence is comprised from SEQ ID N: 13 , 14, 15, 16, 17, 18 Flank regions in the sequence of 19, 20;

Wherein the first and second target sequences are detected in a single nucleic acid fragment of less than 100,000 base pairs.

4. The primer pair of claim 3, comprising a primer pair for identifying event SPT-7R-949D, wherein said targeted first sequence is in a T-DNA insertion sequence of SEQ ID NO: 53 and said The second sequence to be targeted is a flanking region comprised in a sequence selected from the group consisting of SEQ ID N: 13, 14, 17 and 18.

5. The primer pair of claim 4, wherein the targeted second sequence comprises a region located at positions 1 - 893 of SEQ ID NO: 13 or a region located at positions 507-959 of SEQ ID NO: 14.

6. The primer pair of claim 3, comprising a primer pair for identifying event SPT-7R-1425D, wherein said targeted first sequence is located in the T-DNA insertion sequence of SEQ ID NO: 54, and said The second sequence to be targeted is a flanking region comprised in a sequence selected from the group consisting of SEQ ID N: 15, 16, 19 and 20.

7. The primer set of claim 6, wherein the targeted second sequence comprises a region located at positions 1-826 of SEQ ID NO: 15 or a region located at positions 408-1280 of SEQ ID NO: 16. .

8. A method of detecting the presence of an event SPT-7R-949D or a progeny thereof in a biological sample, comprising:

a) extracting a DNA sample from the biological sample;

b) providing a DNA primer pair, wherein

(i) a primer of said primer pair targets a sequence located in the T-DNA insert of SEQ ID NO: 53;

(ii) the second primer of the primer pair targets a sequence located in the flanking sequence of event SPT-7R-949D, wherein the flanking sequence is comprised at a SEQ ID N: 13 , 14, 17, and 18 In the sequence;

C) providing DNA amplification reaction conditions; d) performing a DNA amplification reaction to produce a DNA amplicon molecule;

e) detecting the DNA amplicon molecule, wherein the DNA amplicon molecule is detected in the DNA amplification reaction to indicate the presence of the event SPT-7R-949D.

9. The method of claim 8, wherein said second primer targets a sequence comprising a region located at positions 1 - 893 of SEQ ID NO: 13 or a sequence comprising positions 1 - 10 comprising SEQ ID NO: 17. .

10. The method of claim 8, wherein said second primer targeting comprises a position at SEQ ID NO: 14.

The sequence of the region in 507-959 or the sequence comprising position 10-20 of SEQ ID NO: 18.

1 1. A method for detecting the presence of an event SPT-7R-1425D or a progeny thereof in a biological sample, comprising:

a) extracting a DNA sample from the biological sample;

b) providing a DNA primer pair, wherein

(i) a primer of said primer pair targets a sequence located in the T-DNA insert of SEQ ID NO: 54;

(ii) a second primer of the primer pair targets a sequence located in a flanking sequence of event SPT-7R-1425D, wherein the flanking sequence is selected from the group consisting of SEQ ID N: 15, 16, 19 and 20 In the sequence;

C) providing DNA amplification reaction conditions;

d) performing a DNA amplification reaction to produce a DNA amplicon molecule;

e) detecting the DNA amplicon molecule, wherein the DNA amplicon is detected in the DNA amplification reaction to indicate the presence of the event SPT-7R-1425D.

12. The method of claim 11, wherein the second primer targets a sequence comprising a region located at positions 1 - 826 of SEQ ID NO: 15 or a sequence comprising positions 1 - 10 comprising SEQ ID NO: 19 .

13. The method of claim 11, wherein the second primer targets a sequence comprising a region located at positions 408-1280 of SEQ ID NO: 16 or targeting a position 10-20 comprising SEQ ID NO: 20. sequence.

14. An amplicon produced by the method of claim 9, wherein the amplicon comprises the sequence of SEQ ID NO: 17.

15. The amplicon of claim 14 having the sequence of SEQ ID NO:74.

1 6. An amplicon produced by the method of claim 10, wherein the amplicon comprises the sequence of SEQ ID NO: 18.

17. The amplicon of claim 16 having the sequence of SEQ ID NO:75.

18. An amplicon produced by the method of claim 12, wherein said amplicon comprises the sequence of SEQ ID NO: 19.

19. The amplicon of claim 18 having the sequence of SEQ ID NO:76.

20. An amplicon produced by the method of claim 13, wherein the amplicon comprises the sequence of SEQ ID NO: 20.

21. The amplicon of claim 20 having the sequence of SEQ ID NO:77.

22. A DNA molecule that contains:

a polynucleotide molecule having a sequence selected from the group consisting of SEQ ID NOS: 13, 14, 17 and 18;

b. A polynucleotide molecule having the sequence of at least 11 contiguous nucleotides of SEQ ID NO: 17 or 18; c a sequence complementary to (a) or (b).

23. A DNA molecule that contains:

a polynucleotide molecule having a sequence selected from the group consisting of SEQ ID NOS: 15, 16, 19 and 20;

b. A polynucleotide molecule having the sequence of at least 11 contiguous nucleotides of SEQ ID NO: 19 or 20; c a sequence complementary to (a) or (b).

The DNA molecule according to claim 22 or 23, wherein the DNA molecule is contained in a rice plant, a plant cell, a seed, a progeny plant, a plant part or a commodity.

25. A polynucleotide probe for use in the diagnostic event SPT-7R-949D, wherein the probe is of sufficient length to bind to the sequence of at least 11 contiguous nucleotides of the sequence of SEQ ID NO: 17 or 18.

26. A polynucleotide probe for use in the diagnostic event SPT-7R-1425D, wherein said probe is of sufficient length to bind to the sequence of at least 11 contiguous nucleotides of the sequence of SEQ ID NO: 19 or 20.

27. Rice plants containing the event SPT-7R-949D or SPT-7R-1425D.

28. The plant-produced seed of claim 27, wherein the seed comprises the event.

29. A rice line having the OsCV 704S2 gene at or about the physical location of the short arm of chromosome 3 14,746,015-14,746,027.

30. A rice line having the OsCV 704S2 gene at or about the physical location of the long arm of chromosome #42,215,01 6-42,215,095.