CN114854749A - Rice endosperm specific expression promoter pEnd2 and application thereof - Google Patents

Abstract

The invention discloses a rice endosperm specific expression promoter pEnd2 and application thereof, belonging to the technical field of biotechnology and plant genetic engineering. The nucleotide sequence of the promoter is shown as SEQ ID NO 1, the promoter is pEnd2 promoter separated from rice by using PCR method and through designing primer and using rice genome DNA as template, and through the expression specificity in rice, the promoter makes the beta-glucuronidase reporter gene specifically expressed only in rice seed endosperm, so that the promoter can start the specific expression of exogenous gene in plant endosperm, and is suitable for monocotyledon or endosperm type dicotyledon with seed endosperm. The promoter has important theoretical and practical significance for the research related to the rice endosperm, and can be matched with a gene with an improving function on the endosperm to improve various properties of the rice endosperm.

Description

Rice endosperm specific expression promoter pEnd2 and application thereof

Technical Field

The invention relates to the technical field of biotechnology and plant genetic engineering, in particular to a rice endosperm specific expression promoter pEnd2 and application thereof.

Background

Rice is one of the most important grain crops in the world, and the yield of the rice plays a very important role in maintaining national grain safety and social stability, so that the rice is greatly significant in improving the yield per unit and improving the rice quality by various methods. The rice seed is mainly composed of three parts, namely seed coat, embryo and endosperm, wherein the proportion of the endosperm is the largest. Meanwhile, the endosperm is the most important component of the nutrition of the grain crops, and the separation of the endosperm specificity strong expression promoter has important significance for improving the quality of the plants.

The plant seed endosperm is a place for transporting and storing plant nutrients, and can also be used as a bioreactor, and seeds are used as a production space to express a large amount of target proteins and other bioactive substances in the endosperm. Wherein, the rice endosperm is taken as a bioreactor, which has obvious technical advantages, for example, the rice yield is high, the protein content is between 8 and 19 percent, and the large-scale enrichment is facilitated; the rice endosperm can provide relatively stable internal environment, so that the protein is conveniently stored, and the expressed protein has better affinity and low sensitivity; because of strict selfing of rice, the safety of transgenosis in ecological environment is ensured, and the like. However, due to limitations of controlling an ideal expression site, an expression mode, an expression period and an expression level of a foreign gene, there are few endosperm-specific promoters that can be practically applied to research and development and production of species, and thus, the demand cannot be satisfied. In order to control the consistent expression of the exogenous gene in the transgenic rice, a promoter for screening the specific expression in the rice endosperm and a gene sequence for regulating the expression of the exogenous gene are needed, and a new way is provided for screening the specific expression promoter of the rice endosperm by further utilizing the expression mode and the regulation mechanism of the promoter for regulating the exogenous gene specifically through a design experiment.

A DNA sequence comprising cis-acting elements upstream of the transcription start site of a gene is called a promoter, and is an important regulatory element at the transcription level. With the continuous development of molecular biology and genetic transformation technology, promoters with different characteristics become research hotspots correspondingly. Based on functional and property analysis, promoters are classified into three types, constitutive promoters, tissue-specific promoters, and inducible promoters. Wherein, the tissue-specific promoter can accurately control the expression of the target gene according to the timing, positioning and even quantification expected by people. At present, different types of tissue-specific promoters have been isolated from plants, such as the arabidopsis root-specific expression promoter Pyk 10; arabidopsis seed coat specific promoter MUM 4; an arabidopsis alpha-L-arabinosidase gene promoter; lily male gamete specific expression promoter LGC 1; tomato fruit specific expression promoter 2a 11; rice alcohol soluble protein 4a gene promoter; a gluten gene promoter; a 26kDa globin promoter; the paddy prolamin gene Os12g 16890; rice endosperm pENP1 promoter; a p-NF-YB1 promoter of a rice aleurone layer; allergic protein RA5 gene Os07g11510 and the like.

In the prior art, related researches are carried out on the improvement of rice quality by using a gene engineering technology, and the screening of a promoter with tissue specificity and high expression level is a key factor for controlling the efficient and specific expression of an exogenous gene in rice seed endosperm and accumulating a gene product. Although some tissue-specific promoters have been found, the demand for improving rice quality by genetic engineering techniques is still far from being satisfied. Therefore, the separated endosperm-specific expression promoter has important significance for improving the rice quality.

Disclosure of Invention

The invention aims to provide a rice endosperm specific expression promoter pEnd2 and application thereof, aiming at solving the problems in the prior art, the promoter can drive the specific expression of an exogenous gene in rice endosperm, and makes up the defect of insufficient number of tissue specific expression promoters used for rice genetic engineering research in the prior art.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a rice endosperm specific expression promoter, the sequence of which is derived from Nipponbare (Oryza sativa L cv. Nipponbare); the nucleotide sequence is any one of the following:

(1) 1 as shown in SEQ ID NO;

(2) a sequence having at least 70% homology with the sequence shown in SEQ ID NO. 1 and having the same function;

(3) 1, and sequences with the same functions, wherein one or more bases are added, substituted, inserted or deleted in the sequences shown in SEQ ID NO.

The invention also provides a recombinant vector containing the rice endosperm specific expression promoter.

The invention also provides a host cell containing the recombinant vector.

The invention also provides the rice endosperm specific expression promoter, or the recombinant vector, or the application of the host cell in culturing transgenic plants.

Preferably, the transgenic plant specifically expresses the foreign gene in the endosperm of seeds.

Preferably, the foreign gene comprises a GUS gene.

The invention also provides a method for cultivating transgenic plants by using the rice endosperm specific expression promoter, which comprises the following steps: connecting an exogenous gene to the downstream of the rice endosperm specific expression promoter, then transferring the gene into a plant, and screening a plant which specifically expresses the exogenous gene in seed endosperm, namely the transgenic plant.

The downstream of the rice endosperm specificity expression promoter is also connected with a regulating element for regulating gene expression; the exogenous gene is a protein coding gene and/or a non-protein coding gene; the protein coding gene is a quality improvement gene; the non-protein coding gene is a sense RNA gene and/or an antisense RNA gene.

Preferably, the plant includes a monocotyledon and a dicotyledon.

The invention discloses the following technical effects:

the plant endosperm specific expression promoter is obtained by separating pEnd2 promoter from rice by PCR method by designing primer and using rice genome DNA as template. Through an expression specificity experiment of the promoter in rice, the promoter shows that the beta-transglucosidase (GUS) reporter gene is specifically expressed only in rice seed endosperm. Therefore, the promoter of the invention can start the specific expression of the exogenous gene in the endosperm of the plant, and is suitable for any plant with endosperm in seeds, namely monocotyledon or endosperm-type dicotyledon.

The promoter of the invention can improve the expression and accumulation level of exogenous genes in plant endosperm, improve the seed quality, introduce proteins or short peptides with physiological activity into seeds to create new health-care functional varieties, produce useful exogenous proteins or edible vaccines by using the seeds as bioreactors, increase the scientific and technological added value of agricultural products and the like. The promoter lays a foundation for researches on improvement of seed quality, molecular medicine farms and the like by using biotechnology, and has great application prospect.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a technical roadmap for the present invention;

FIG. 2 is a diagram showing the analysis of spatiotemporal expression pattern of the gene driven in the genome by pEnd2 (gene No.: Os01g0276300) by qRT-PCR method, using maize UBQ as the reference gene;

FIG. 3 is a schematic diagram showing the structure of a binary vector pCAMBIA1305.1;

FIG. 4 shows the pCAMBIA1305.1 vector (35S-free-GUS) after cutting out the 35S promoter; LB and RB are the left boundary and the right boundary of T-DNA in pCAMBIA1305.1 respectively; hyg is hygromycin resistance screening gene; GUS is reporter gene GUS; MCS represents multiple cloning site; the direction of the arrow indicates the direction of expression of the gene or promoter;

FIG. 5 is a diagram of a constructed pEnd2-GUS expression vector with pCAMBIA1305.1 as a backbone; LB and RB are the left boundary and the right boundary of T-DNA in pCAMBIA1305.1 respectively; hyg is hygromycin resistance screening gene; GUS is reporter gene GUS; pEnd2 represents a promoter; the direction of the arrow indicates the direction of expression of the gene or promoter;

FIG. 6 shows GUS staining of various tissues of 35S-free-GUS transformed plants; a is root; b is a stem; c is a blade; d is spike; e is seed (containing embryo and endosperm).

FIG. 7 shows GUS staining of various tissues of GUS gene-transformed plants driven by pEnd 2; a is root; b is a stem; c is a blade; d is spike; e is seed (containing embryo and endosperm).

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Example 1

As shown in figure 1, firstly, a candidate gene which is possibly endosperm-specific expression is found from a rice full-growth-period expression profile chip database CREP (http:// CREP. ncpgr. cn) (Wang et al, 2010) in the national key laboratory of China university of agriculture crop genetic improvement, a sequence of the gene is obtained on NCBI (http:// www.ncbi.nlm.nih.gov /) of a national institute of Biotechnology, as shown in SEQ ID No:2, 1069bp in total, and qRT-PCR reaction primers RT-F: 5'-CGGCGACGGAGAACATCTA-3' and RT-R: 5'-CTCCGGCATCGTCATCTTCT-3' are designed according to the 1069bp sequence, and the expression profile is further determined through qRT-PCR analysis, wherein an amplification system and a program are as follows:

a) reaction system:

b) reaction procedure (two-step process): setting the temperature at 96 ℃ for 30s in a fluorescent quantitative PCR instrument; 95 ℃ for 5 s; at 55 ℃, 30s, 40 cycles; 95 ℃ for 5 s; 1 minute at 60 ℃; 95 ℃ for 15 s.

c) The calculation method: by 2 ^-△△CT And (4) calculating. During the experiment and calculation, rice Ubiquitin fusion protein gene Ubiquitin (LOC _ Os03g13170) is used as an internal reference gene.

The qRT-PCR results showed (as shown in FIG. 2) that the gene was expressed only in the endosperm.

On the basis, a promoter candidate fragment named pEnd2 is obtained by PCR amplification from the rice Nipponbare genome by using specific primers, the promoter candidate fragment pEnd2 is loaded on a binary vector pCAMBIA1305.1 (shown in figure 3) to be assembled into a pEnd2-GUS vector (shown in figure 5), the pCAMBIA1305.1 vector with the 35S promoter cut out is named 35S-free-GUS as a negative control (shown in figure 4), and pEnd2-GUS and 35S-free-GUS are transferred into a rice receptor ZH11 by an agrobacterium-mediated genetic transformation method. After obtaining the transgenic plant, the expression change of the promoter in each tissue of the rice is inspected through GUS histochemical staining analysis, and then the promoter is verified and cloned. The detection result shows that: no GUS expression was observed in any of the tissues of rice in the positive 35S-free-GUS-transgenic plants (see FIG. 6), whereas the GUS gene was expressed in the endosperm of the transformed plants in the positive pEnd 2-GUS-transgenic plants, but not in any of the other tissues such as leaf, stem, root and scion (FIG. 7).

﹥SEQ ID No:2

tccaagaagc agagagcgaa gcaagctcga atcgatttcc aacccagagg atttgattag

ctttgacgca gaccaagatc atctgatcaa tggcgtccat gcagaagagc cgcgaggagc

gcgcggaggc ggcggcgcac agggcggccg acgagctcca cgccgccagg cgggacgagc

ctggcggcgg cggaggcggc atgctgggca ccgtgcagga gagcgcgcgg tccctcctcg

gcgccgtccg cgacaagatc cccgggcccg gcagcggcgg cgctggcgca ggcgcagccg

ccggggaggg gaaggccgcc gaggcgaagg gcttcgcggc ggacaaggcg gagggcgcgc

ggcgcgcgct cgcgggatcc gcggcggcga ggaagggcga gacggacgag tccgcgtggc

agcacgggga ggacgtgcgg cggcgcgccg cggagaaggc cgaggaggcg cggcggcgga

gcgagcctca gccgtcgtcg gaggagaagt agccgtcgcc tcggctcgcc gccatttctc

tctgttcttg aaagcttctt cctactcggc tcacctgacc ggagtccggg acgtgtcgtg

ctcgtgcgca gggggaggtc ggcgacggag aacatctacg ggtcggcggc gagcgcggcg

gaggcgttca ggcagaagat gacgatgccg gaggacgtgg tggagcagaa gcgcgccgag

gctgccgccg gcgggaacaa gggaacagcc gccgcgacgg cgacggcgac gaacaccggc

ggggaggcgg cggcggagga ggtgatgatg cgggtgaagg cggcggacca gatgacgggg

caggcgttca acgacgtggg caagatgggg gaggagggca ccggcatggc ggccggagat

ggtgggcgcc gccgctgaga tcgccggagc cgaccgcgcg gcgccacgcc acggtgtttt

tgctcgtcgc gttttgtact aatctcagta taatctgtaa tgtaaatatg taatgcggca

gttaaaagta ataaaatatc ccctaatcac ttgtccaaag cagagaaca。

Example 2 obtaining of promoter

(1) Screening of rice seed endosperm specificity expression gene

The gene specifically expressed in rice seed endosperm is screened by fluorescent quantitative PCR, which comprises the following steps:

selecting roots, stems, leaves and young ears of Nippon rice and rice seed endosperm (5, 10, 15, 20, 25 and 30 days) in different development stages, respectively extracting RNA, carrying out reverse transcription to synthesize cDNA (TOYOBO, Rever Tra Ace, FSK-101), identifying the expression profiles of the rice endosperm specific expression gene (gene number: Os01g0276300) in different tissues and development stages through fluorescent quantitative PCR, and determining the specific expression of the gene in the rice endosperm.

(2) Cloning of rice seed endosperm specific expression promoter fragment

Extracting the genomic DNA of the leaves of Nipponbare (Oryza sativa L. publicly available from the national Rice institute) as a template, and using the primer 1: 5-CCATGATTACGAATTCTATCCTTACAAGTTTGTTT-3' (the underlined part is the linker) and primer 2: 5' -CTCAGATCTACCATGGTGATCAGATGATCTTGGTC-3' (the underlined part is the linker) to obtain a 2250bp PCR product.

PCR amplification System: KOD FX buffer 25. mu.l, dNTP 6. mu.l, genomic DNA (Nipponbare) 4. mu.l, Forward primer 2. mu.l, Reverse primer 2. mu.l, KOD FX 1. mu.l, ddH ₂ O10. mu.l, PCR amplification procedure as follows: 2min at 95 ℃; 30s at 98 ℃, 30s at 58 ℃ and 2.5min at 68 ℃ for 35 cycles; 5min at 68 ℃.

The product was sequenced, and the PCR had the nucleotide shown in SEQ ID No:1 of the sequence Listing, which was named pEnd 2.

﹥SEQ ID No:1

ccatgattac gaattctatc cttacaagtt tgtttcgaca tgtttttaca taaaaatatt

cttaaatatg tatcaaagag ctttcaacat ttaaattcgg tgactattga tctatgtata

gatggcgttc ctctcaaagg ttgctaattg gaacatactc atcaatggga acatgataca

tgtggtcaaa agagataaat ggggcctgat aagtcagagg gtcgagagtc cctgataagt

gaggcccaca cctatgggcc cataagtcag agagacacgt ccctttgacg tacgtgagag

gagccccacc gggacataac ataataatag cactcaaaat cttttttctt cacttggaaa

aatatcaatt gtagtttgat caaattatat tttgaatgtt atgtacttat gaccaaatca

ccgaaggaag ggaggatgac atttcacatt ttgttttgat agcacgtgtt tgttacttta

tatcagacta gatttataaa gtctaataaa tcttaattga ttatgaaagt ttctttaaga

caaatatact aataatattt ttattatttt aactaaaatg tatcattcat caaagtttta

aaattttgat tgatcttacc caaacattga aattttgtga tagaaaggag gaactagctc

acacattggt ttatcttaga aacgtgcatt ttttatcctc aagacgagaa acattttgta

gggtgtttaa gatgctagaa ggatagggag ttgccaatta gtcacaatct gaaaaagcta

aatttcttag cttgctgcta ctagtttgtt ttttacacta tataaatact tatttcaaaa

ccaggaataa aaatcaaggt cgagaatggg tagctgacgg atgttcctta aatataacat

atttggcgtg tttccgaaga taatgccagc gcattgcgaa aaaaaaattc aaaatgctaa

ggaatatatt tacagtttgg ttaattatat caatgccatt ataaatttat caattttgaa

aaataccact actatcacat aattaaaatc atgtgctgca aaacatcaaa attccacatt

atacgtctaa aacacattat gaatcgtttt gtgactactc tattttttat tttttatgga

ctaaaataaa atcgtctctt acaactcaaa gaacaacaac actatccttc ctcctgccaa

ctccacaatt ggatgcttta gttctaatca aaattttcaa tctaacattt gacatcgcta

ccacaacaaa ctgctaccac ttcaccattc ataattcgtg tacaaaataa ttgaatgaat

atcatataaa aaactacata ggaaaaaaag agaaaaataa ttgggtggtg gaggagccag

gtcgccgttc acgaccattg gcatcgctcg tcggcatgga ggggtcgccg tccacgaccg

ctcaagtcgg ctagctggca ctcattgcca gcaccagcac cattagcttg gtgctcatcg

gcgcctagac tgcgtatcgt agctgtcgaa cgtgtcgtcc tagaccttac tgcctccacc

agtgctaggt ctgctcatgt tgagctcgcc gtcgccagaa ccgactttgc gcaacctaga

tcgaaacttc atcgttaccg tgcgccgcca ctgcatatgc ttgtgtcgag agcaagcttt

gtatttagct agtcgtcact tgccgccggc gtcgtcgctg ctgattggcg ctccccacgt

tggcaagatt aggtgatcga tttggctatg gtcgttggat ttgaggttag ggttaaaagg

agacataaaa atacagtagg aaagaaaaat tcaaaacgcg tatatggatc aaattatata

aattgtaaag atatttttta aaacagatga ttttttcaat ttgcaatggc aatgatccca

ttaaccccct cccccgcttt gaggaagaag cgaacacact ccatgcgccc ccgcagcaca

cgtatgcatg gtacgtgtcc gccggcgtca cacgcggcgt gcagcgcgac gcccgcggcg

catctcggcg gccgcccgcg ccgccgcctc atccatctcc agaggattcc tccgatcctc

tcgccgccct cctttttatc ccccaccccc ctcctcctct tcatcctcca agaagcagag

agcgaagcaa gctcgaatcg atttccaacc cagaggattt gattagcttt gacgcagacc

aagatcatct gatcacatgg tagatctgag。

Example 3 functional verification of promoters

1. Obtaining of transgenic Rice pEnd2

(1) Obtaining of recombinant vector

The ligation of the 2250bp PCR product pEnd2 obtained In example 1 to an expression vector pCAMBIA1305.1 (publicly available from the national Rice institute, the structure of which is schematically shown In FIG. 3) was a method relying on In-fusion recombination: the vector pCAMBIA1305.1 was digested with EcoR I and NcoI, the 35S promoter was excised, and the resulting PCR product with a linker and the vector digested with EcoR I and NcoI were subjected to In-fusion recombination at 50 ℃ to obtain a recombinant vector designated pEnd2-GUS (FIG. 5). The expression vector pCAMBIA1305.1 is subjected to double enzyme digestion by EcoR I and Spe I, 35S and catalase intron fragments on the vector are cut off together, the catalase intron fragments are amplified by primers with EcoR I and Spe I linkers, and the recombinant vector which does not contain 35S is obtained by carrying out In-fusion recombination on the catalase intron fragments and the vector subjected to enzyme digestion by the EcoR I and the Spe I at 50 ℃ and is named as 35S-free-GUS (figure 4).

The specific method comprises the following steps:

1) pCAMBIA1305.1 vector was digested with EcoR I and NcoI

EcoR I and NcoI cleavage system (50. mu.l): pCAMBIA1305.1 plasmid 2. mu.g, buffer 10. mu.l, EcoR I2. mu.l, Nco I2. mu.l, ddH ₂ Complementing O to 50 μ l, carrying out enzyme digestion at 37 ℃ for 2 hours, and recovering 11846bp linearpCAMBIA1305.1 was prepared.

2) Amplification of PCR product with adaptor promoter pEnd2

A promoter pEnd2 fragment with EcoR I and NcoI linkers was amplified by PCR using the leaf genomic DNA as a template and primers with linkers.

The amplification system (50. mu.l) and PCR procedure were as described above.

3) In-fusion recombination

The recombination system was as follows (2.5. mu.l): 1 mul of linearized pCAMBIA1305.1 vector, 1 mul of promoter pEnd2PCR product with a linker, 0.5 mul of In-fusion enzyme, and recombining at 50 ℃ for 30min to obtain a recombinant product.

4) pCAMBIA1305.1 vector digested with EcoR I and Spe I

EcoR I and Spe I digestion system (50. mu.l): pCAMBIA1305.1 plasmid 2. mu.g, Buffer 10. mu.l, EcoR I2. mu.l, Spe I2. mu.l, ddH ₂ The amount of O was increased to 50. mu.l, and the linearized pCAMBIA1305.1 was recovered after digestion at 37 ℃ for 2 hours.

5) Amplification of catalase intron PCR product with linker

The catalase intron fragment with EcoR I and Spe I linker was amplified by PCR using empty pCAMBIA1305.1 as template and linker primers.

The amplification system (50. mu.l) and PCR procedure were as described above.

6) In-fusion recombination

The recombination system was as follows (2.5. mu.l): 1 mul of linearized pCAMBIA1305.1 vector, 1 mul of catalase intron PCR product with a linker, 0.5 mul of In-fusion enzyme, and recombining at 50 ℃ for 30min to obtain a recombinant product.

The pEnd2-GUS and 35S-free-GUS plasmids which are correctly sequenced are transformed into Trans10 Escherichia coli competent cells by heat shock, and clones are obtained.

The cloning plasmid is extracted, positive cloning is detected by enzyme digestion, and the result shows that the pEnd2-GUS plasmid is a vector obtained by inserting pEnd2 shown in SEQ ID No. 1 in a sequence table into an expression vector pCAMBIA1305.1, and the inserted position is in front of the GUS gene (replacing a 35S promoter in front of the original GUS gene), namely the recombinant vector.

(2) Obtaining of recombinant bacteria

And (3) carrying out heat shock transformation on the recombinant vectors pEnd2-GUS and 35S-free-GUS to the Agrobacterium tumefaciens EHA105 strain to obtain a recombinant strain.

Extracting plasmids of the recombinant bacteria, sequencing the plasmids to respectively obtain pEnd2-GUS and 35S-free-GUS, and designating the recombinant bacteria containing the plasmids as positive, namely EHA105/pEnd2-GUS and EHA 105/35S-free-GUS.

The specific method of the agrobacterium heat shock transformation method is as follows:

1) putting the agrobacterium tumefaciens taken out of a refrigerator at the temperature of-80 ℃ on ice until the agrobacterium tumefaciens is naturally melted;

2) adding 2 μ l plasmid, gently and uniformly flicking, and standing on ice for 30 min;

3) placing in liquid nitrogen for 5 min;

4) heat shock at 37 deg.C for 5 min;

5) taking out, rapidly inserting on ice for 2min, adding non-antibiotic YEP liquid culture medium, shaking at 28 deg.C and 150rpm for 4 h;

6) 100 mul of the bacterial liquid was pipetted and spread evenly on YEP plates containing kanamycin and rifampicin, and cultured for 3-4 days at 28 ℃ in an inverted manner.

7) The single clones were picked up and cultured in YEP broth supplemented with kanamycin and rifampicin at 28 ℃ for 1 day on a shaker at 200 rpm.

8) From this, 0.2ml was transferred to 20ml (1/100 dilution ratio) of the same YEP-resistant medium and cultured to OD under the same conditions ₆₀₀ When the yield is 0.5, the transformed callus can be obtained.

(3) Obtaining and molecular identification of rice with pEnd2-GUS and 35S-free-GUS

1) Transformation of

a) Selection of transformed receptors

The mature rice variety ZH11 seed is hulled, and after a series of disinfection, callus induction and subculture are carried out, and the vigorous growing callus is selected to be used as a transformation receptor.

b) Genetic transformation

An EHA105 strain containing 35S-free-GUS and a recombinant vector pEnd2-GUS was infected into rice using an Agrobacterium-mediated genetic transformation method (Hiei Y, Ohta S, Komari T, Kumashiro (1994), Efficient transformation of rice (Oryza sativa L.), formulated by Agrobacterium and sequence analysis of the foundations of the T-DNA. the plant Journal,6:271-282), co-cultured in the dark at 25 ℃ for 3 days, cultured in a selection medium containing 120mg/L G418-GUS, and selected for resistant callus. Culturing the screened resistant callus on a pre-differentiation culture medium for 10 days, transferring the pre-differentiation callus to a differentiation culture medium, and culturing under the condition of illumination. Resistant transgenic plants were obtained after 1 month.

And opening the cover to harden the seedlings for 5 days when the root systems grow well and the seedlings grow to 8cm, taking out the transgenic seedlings, washing off residual culture medium on the roots, transplanting the transgenic seedlings into soil, putting the transgenic seedlings into a greenhouse without direct sunlight for proper culture, and then transferring the transgenic seedlings to the outdoor for culture. Transgenic rice of T0 generation was obtained.

2) Identification of transgenic Positive plants

Transferring the T0 generation transgenic rice into a greenhouse, turning green, separating individual plants, taking a small segment of young leaves, extracting genomic DNA of the small segment of young leaves as a template, and detecting transgenic positive plants by a PCR method. The amplified fragment is a partial fragment on the vector pCAMBIA1305.1 and a partial fragment of a promoter pEnd2, and the size is 471 bp. The primer sequence is pEnd 2-F: CTTTGGTCTTCTGAGACTGTATCTT, pEnd 2-R: TGTTCCCATTGATGAGTATG are provided.

The PCR amplification procedure was as follows: 2min at 95 ℃, 30s at 98 ℃, 30s at 58 ℃, 1min at 68 ℃, 35 cycles and 5min at 68 ℃. The PCR product was detected by 0.8% agarose gel electrophoresis. By this method, false positive plants can be eliminated.

Example 4 transformation of pEnd2-GUS and 35S-free-GUS Rice GUS histochemical staining method for verifying promoter function

The roots, stems, leaves, young ears and seeds in the middle filling stage (10 to 15 days after flowering) of positive T0-generation pEnd2-GUS and 35S-free-GUS rice are respectively taken, the tissues are cut into proper sizes, and the seeds are transversely or longitudinally cut. And (3) immersing each cut tissue into GUS dye solution, vacuumizing for 10min, then placing the tissue into an incubator at 37 ℃ for reaction for 1h, observing whether a GUS signal appears or not, and taking a picture.

The rice transformed from T0 generation to 35S-free-GUS was used as a negative control.

GUS histochemical staining results of 35S-free-GUS transgenic rice of the T0 generation are shown in FIG. 6, and it can be seen that the GUS gene is not expressed in each tissue. In FIG. 2, the highest relative expression level in the developing rice seeds, i.e., the relative expression level in the rice seeds 20 days after flowering, reached 718 times, and the expression level of the promoter in endosperm was very high compared to other reported rice endosperm-specific expression promoters.

GUS histochemical staining results of pEnd2-GUS rice transferred from T0 generation are shown in FIG. 7, and it can be seen that GUS gene of pEnd2-GUS rice transferred from T0 generation has expression activity (blue) in endosperm of seeds, but is not expressed in other parts.

Thus, pEnd2 is a promoter that can drive the specific expression of a gene of interest, such as GUS, in the endosperm of seeds.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> institute of Rice research in China

<120> rice endosperm specific expression promoter pEnd2 and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2250

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccatgattac gaattctatc cttacaagtt tgtttcgaca tgtttttaca taaaaatatt 60

cttaaatatg tatcaaagag ctttcaacat ttaaattcgg tgactattga tctatgtata 120

gatggcgttc ctctcaaagg ttgctaattg gaacatactc atcaatggga acatgataca 180

tgtggtcaaa agagataaat ggggcctgat aagtcagagg gtcgagagtc cctgataagt 240

gaggcccaca cctatgggcc cataagtcag agagacacgt ccctttgacg tacgtgagag 300

gagccccacc gggacataac ataataatag cactcaaaat cttttttctt cacttggaaa 360

aatatcaatt gtagtttgat caaattatat tttgaatgtt atgtacttat gaccaaatca 420

ccgaaggaag ggaggatgac atttcacatt ttgttttgat agcacgtgtt tgttacttta 480

tatcagacta gatttataaa gtctaataaa tcttaattga ttatgaaagt ttctttaaga 540

caaatatact aataatattt ttattatttt aactaaaatg tatcattcat caaagtttta 600

aaattttgat tgatcttacc caaacattga aattttgtga tagaaaggag gaactagctc 660

acacattggt ttatcttaga aacgtgcatt ttttatcctc aagacgagaa acattttgta 720

gggtgtttaa gatgctagaa ggatagggag ttgccaatta gtcacaatct gaaaaagcta 780

aatttcttag cttgctgcta ctagtttgtt ttttacacta tataaatact tatttcaaaa 840

ccaggaataa aaatcaaggt cgagaatggg tagctgacgg atgttcctta aatataacat 900

atttggcgtg tttccgaaga taatgccagc gcattgcgaa aaaaaaattc aaaatgctaa 960

ggaatatatt tacagtttgg ttaattatat caatgccatt ataaatttat caattttgaa 1020

aaataccact actatcacat aattaaaatc atgtgctgca aaacatcaaa attccacatt 1080

atacgtctaa aacacattat gaatcgtttt gtgactactc tattttttat tttttatgga 1140

ctaaaataaa atcgtctctt acaactcaaa gaacaacaac actatccttc ctcctgccaa 1200

ctccacaatt ggatgcttta gttctaatca aaattttcaa tctaacattt gacatcgcta 1260

ccacaacaaa ctgctaccac ttcaccattc ataattcgtg tacaaaataa ttgaatgaat 1320

atcatataaa aaactacata ggaaaaaaag agaaaaataa ttgggtggtg gaggagccag 1380

gtcgccgttc acgaccattg gcatcgctcg tcggcatgga ggggtcgccg tccacgaccg 1440

ctcaagtcgg ctagctggca ctcattgcca gcaccagcac cattagcttg gtgctcatcg 1500

gcgcctagac tgcgtatcgt agctgtcgaa cgtgtcgtcc tagaccttac tgcctccacc 1560

agtgctaggt ctgctcatgt tgagctcgcc gtcgccagaa ccgactttgc gcaacctaga 1620

tcgaaacttc atcgttaccg tgcgccgcca ctgcatatgc ttgtgtcgag agcaagcttt 1680

gtatttagct agtcgtcact tgccgccggc gtcgtcgctg ctgattggcg ctccccacgt 1740

tggcaagatt aggtgatcga tttggctatg gtcgttggat ttgaggttag ggttaaaagg 1800

agacataaaa atacagtagg aaagaaaaat tcaaaacgcg tatatggatc aaattatata 1860

aattgtaaag atatttttta aaacagatga ttttttcaat ttgcaatggc aatgatccca 1920

ttaaccccct cccccgcttt gaggaagaag cgaacacact ccatgcgccc ccgcagcaca 1980

cgtatgcatg gtacgtgtcc gccggcgtca cacgcggcgt gcagcgcgac gcccgcggcg 2040

catctcggcg gccgcccgcg ccgccgcctc atccatctcc agaggattcc tccgatcctc 2100

tcgccgccct cctttttatc ccccaccccc ctcctcctct tcatcctcca agaagcagag 2160

agcgaagcaa gctcgaatcg atttccaacc cagaggattt gattagcttt gacgcagacc 2220

aagatcatct gatcacatgg tagatctgag 2250

<210> 2

<211> 1069

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tccaagaagc agagagcgaa gcaagctcga atcgatttcc aacccagagg atttgattag 60

ctttgacgca gaccaagatc atctgatcaa tggcgtccat gcagaagagc cgcgaggagc 120

gcgcggaggc ggcggcgcac agggcggccg acgagctcca cgccgccagg cgggacgagc 180

ctggcggcgg cggaggcggc atgctgggca ccgtgcagga gagcgcgcgg tccctcctcg 240

gcgccgtccg cgacaagatc cccgggcccg gcagcggcgg cgctggcgca ggcgcagccg 300

ccggggaggg gaaggccgcc gaggcgaagg gcttcgcggc ggacaaggcg gagggcgcgc 360

ggcgcgcgct cgcgggatcc gcggcggcga ggaagggcga gacggacgag tccgcgtggc 420

agcacgggga ggacgtgcgg cggcgcgccg cggagaaggc cgaggaggcg cggcggcgga 480

gcgagcctca gccgtcgtcg gaggagaagt agccgtcgcc tcggctcgcc gccatttctc 540

tctgttcttg aaagcttctt cctactcggc tcacctgacc ggagtccggg acgtgtcgtg 600

ctcgtgcgca gggggaggtc ggcgacggag aacatctacg ggtcggcggc gagcgcggcg 660

gaggcgttca ggcagaagat gacgatgccg gaggacgtgg tggagcagaa gcgcgccgag 720

gctgccgccg gcgggaacaa gggaacagcc gccgcgacgg cgacggcgac gaacaccggc 780

ggggaggcgg cggcggagga ggtgatgatg cgggtgaagg cggcggacca gatgacgggg 840

caggcgttca acgacgtggg caagatgggg gaggagggca ccggcatggc ggccggagat 900

ggtgggcgcc gccgctgaga tcgccggagc cgaccgcgcg gcgccacgcc acggtgtttt 960

tgctcgtcgc gttttgtact aatctcagta taatctgtaa tgtaaatatg taatgcggca 1020

gttaaaagta ataaaatatc ccctaatcac ttgtccaaag cagagaaca 1069

Claims (8)

1. A rice endosperm specific expression promoter is characterized in that the nucleotide sequence of the promoter is any one of the following:

(1) 1 as shown in SEQ ID NO;

(2) a sequence which has at least 70 percent of homology with the sequence shown in SEQ ID NO. 1 and has the same function;

(3) 1, and sequences with the same functions, wherein one or more bases are added, substituted, inserted or deleted in the sequences shown in SEQ ID NO.

2. A recombinant vector comprising the rice endosperm-specific expression promoter of claim 1.

3. A host cell comprising the recombinant vector of claim 2.

4. Use of the rice endosperm-specific expression promoter according to claim 1, or the recombinant vector according to claim 2, or the host cell according to claim 3 for breeding transgenic plants.

5. The use of claim 4, wherein the transgenic plant specifically expresses the exogenous gene in the endosperm of seeds.

6. The use of claim 5, wherein the exogenous gene comprises a GUS gene.

7. A method for cultivating transgenic plants by using the rice endosperm-specific expression promoter of claim 1, which comprises: connecting an exogenous gene to the downstream of the rice endosperm specific expression promoter, then transferring the gene into a plant, and screening a plant which specifically expresses the exogenous gene in seed endosperm, namely the transgenic plant.

8. The method of claim 7, wherein the plant comprises a monocot and a dicot.

Images