CN104087605B - Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases - Google Patents
Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases Download PDFInfo
- Publication number
- CN104087605B CN104087605B CN201410329309.5A CN201410329309A CN104087605B CN 104087605 B CN104087605 B CN 104087605B CN 201410329309 A CN201410329309 A CN 201410329309A CN 104087605 B CN104087605 B CN 104087605B
- Authority
- CN
- China
- Prior art keywords
- ipt
- plant
- dna molecular
- grass
- receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of method cultivating the transgenic graminaceous plant that tiller number increases and relevant biological material thereof.The method includes importing entitled P in receptor grassGH3The DNA molecular of IPT, obtains compared with described receptor grass, the transgenic graminaceous plant that tiller number increases and/or spike number increases and/or plant height reduces.Compared with receptor grass, in receptor grass, import entitled PGH3Transgenic graminaceous plant available tillering and plant height appropriateness that the DNA molecular of IPT obtains become short, are not result in excessively changing and causing deformity of plant forms.Entitled P is imported in receptor grassGH3The transgenic graminaceous plant that the DNA molecular of IPT obtains is compared with receptor grass, and grain number per spike and grain are heavily not significantly different from, thus increases individual plant grass yield, and other forms of plant, growth developmental characteristic do not occur significant change.
Description
Technical field
The present invention relates in biological technical field a kind of cultivate tiller number increase transgenic graminaceous plant method and
Its relevant biological material.
Background technology
The target improving always breeder's pursuit of rice yield, and the constituent element of rice yield includes fringe
Number, grain number per spike and grain weight, wherein spike number particularly number of productive ear depends on tiller number and rational Biomass.In paddy gene
There is many tillers gene, but often due to tiller is too much, total biomass is less, and each tiller is thin and delicate, short and small, it is difficult to formed effectively
Fringe.Along with the development of molecular biology, utilizing transgenic technology is to improve crop breeding effect by external source excellent genes importing plant
The important channel of rate.Expression to exogenous gene to have reasonably control simultaneously, and appropriateness is expressed and could be obtained required for us
Character.
IPT full name prenyltransferase, is the key enzyme in activated cell mitogen biosynthesis pathway, is also cell
The most important rate-limiting enzyme of mitogen biosynthesis.Barry etc. (1984) have cloned this enzyme of coding from the plasmid of Agrobacterium tumefaciems
Gene i.e. ipt gene, and to confirm the albumen of this gene code by the expression analysis in escherichia coli be exactly iso-amylene
Based transferase.
Utilizing the ipt gene separated from Agrobacterium, people have carried out substantial amounts of work in plant genetic engineering is studied.
Result of study shows, the transfer-gen plant of composing type overexpression ipt all shows as Cytokinin Contents to be increased, leaf senile
Postpone, the growth promoter form of plant also there occurs many abnormal changes simultaneously, as blade diminish, blade profile becomes round, top
Advantage is lost, it is impossible to the root forming root or formation can not extend, and some meetings form the little short strain of many tillers, and total biomass reduces,
Yield can not be formed.
Summary of the invention
The technical problem to be solved is that render transgenic grass tiller number appropriateness increases, and/or plant height
Appropriateness becomes short, and/or grain number per spike and grain weight are not significantly different from receptor grass, thus increases individual plant grass
Seed production.
For solving above-mentioned technical problem, present invention firstly provides a kind of available tillering of cultivating increases and/or number of productive ear
The method of the transgenic graminaceous plant that increase and/or plant height appropriateness reduce.
Cultivation available tillering provided by the present invention increase and/or number of productive ear increase and/or plant height appropriateness reduce
The method of transgenic graminaceous plant, described method includes importing entitled P in receptor grassGH3The DNA of-IPT divides
Son, obtains compared with described receptor grass, and available tillering increases and/or number of productive ear increases and/or plant height appropriateness
The transgenic graminaceous plant reduced；
Described entitled PGH3The DNA molecular of-IPT is by IPT gene and promoter P of the described IPT genetic transcription of startupGH3Even
Connect and form；Described IPT gene is the gene of sequences encoding isopentenyl transferase IPT；
Described promoter PGH3It is following DNA molecular a), b) or c):
A) nucleotide sequence is SEQ ID No.1 the 7th to 1896；
B) nucleotide sequence and a) limited has 75% or more than 75% concordance, and has the DNA of promoter function
Molecule；
C) under high high stringency conditions with nucleotide sequence hybridization a) or b) limited, and the DNA with promoter function divides
Son.
Wherein, SEQ ID No.1 is made up of 2625 nucleotide, and the 7th to 1896 is promoter PGH3Nucleotides sequence
Row, 1897-2619 position is the encoding gene of prenyltransferase (IPT).
In said method, described tiller number concretely available tillering.
Those of ordinary skill in the art can use the side of known method, such as orthogenesis and point mutation easily
Method, to promoter PGH3Nucleotide sequence suddenly change.Have and promoter PGH3Nucleotide sequence 75% or higher with
The nucleotide of one property, as long as having identical promoter function, being all derived from the nucleotide sequence of the present invention and being equal to
The sequence of the present invention.
Term used herein " homogeneity " refers to the sequence similarity with native sequence nucleic acid." homogeneity of more than 75% "
Including with promoter PGH3Nucleotide sequence there is 75% or higher, or 85% or higher, or 90% or higher, or 95% or
Higher, or 97% or higher, or the nucleotide sequence of 99% or higher homogeneity.Homogeneity can with the naked eye or computer software
It is evaluated.Using computer software, the homogeneity between two or more sequences can use percentage ratio (%) to represent, it is permissible
It is used for evaluating the homogeneity between correlated series.
In said method, described high high stringency conditions is at 2 × SSC, in the solution of 0.1%SDS, hybridizes and wash at 68 DEG C
Film 2 times, each 5min, again in 0.5 × SSC, in the solution of 0.1%SDS, hybridize at 68 DEG C and wash film 2 times, each 15min.
Above-mentioned prenyltransferase IPT is following A1) or protein A2):
A1) aminoacid sequence protein as shown in SEQ ID No.2；
A2) aminoacid sequence shown in SEQ ID No.2 through replacement and/or the disappearance of amino acid residue and/or is added
Add and have the protein of identical function.
Wherein, SEQ ID No.2 is made up of 240 amino acid residues.
Described entitled PGH3The nucleotide sequence of the DNA molecular of-IPT is SEQ ID No.1 the 7 to 2619th.
Above-mentioned PGH3The DNA molecular of-IPT is by containing described entitled PGH3The recombinant expression carrier of the DNA molecular of-IPT
Import in described receptor grass.
In said method, containing described entitled PGH3The recombinant expression carrier of the DNA molecular of-IPT concretely uses sequence
In table, the DNA molecular shown in 7-2619 position of sequence 1 replaces HindIII and the KpnI enzyme knowledge of pCambia-1301-PMI-nos
The recombinant expression carrier that fragment between other site obtains, named pCambi a-1301-PMI-nos-PGH3-IPT。
Described recombinant expression carrier includes double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.Described heavy
Group expression vector also can comprise 3 ' end untranslated regions of exogenous gene, i.e. comprises polyadenylation signals and any other participates in
MRNA processing or the DNA fragmentation of gene expression.The bootable polyadenylic acid of described polyadenylation signals joins the 3 ' of mRNA precursor
End, if Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as rouge alkali synthetase gene Nos), plant gene are (such as soybean storage
Protein gene) 3 ' untranslated regions transcribed of end are respectively provided with similar functions.Described recombinant expression carrier also can contain enhancer, including
Translational enhancer or transcriptional enhancer, these enhancer regions can be ATG initiation codon or neighboring region start codon
Deng, but must be identical with the reading frame of coded sequence, to ensure the correct translation of whole sequence.Described translation control signal and rise
The source of beginning codon is widely, can be natural, it is also possible to be synthesis.Translation initiation region can come from having transcribed
Beginning region or structural gene.For the ease of transgenic plant cells or plant being identified and screening, can be to plant table used
Reach carrier to be processed, enzyme or the gene of luminophor of color change can be produced as added the coding can expressed in plant
The marker gene of (gus gene, luciferase genes etc.), antibiotic is (as given kanamycin and associated antibiotic resistance
NptII gene, gives the bar gene to herbicide phosphinothricin resistance, gives the hph gene to antibiotic hygromycin resistance,
With the dhfr gene given methotrexate resistance, give the EPSPS gene to glyphosate) or anti-chemical reagent labelling
Gene etc. (such as anti-herbicide gene), the mannose-6-phosphate isomerase gene of offer metabolism mannose ability.Plant from transgenic
The security consideration of thing, can be not added with any selected marker, directly screen transformed plant with adverse circumstance.
Above-mentioned receptor grass and described transgenic graminaceous plant can be Oryza sativa L. (as bright in rice varieties extensive 86).
The transgenic graminaceous plant that said method is cultivated is fitted in cultivation tiller number increase and/or plant height as hybrid strain
Application in the transgenic graminaceous plant that degree reduces.
The biomaterial relevant to said method falls within protection scope of the present invention；
Above-mentioned biomaterial is D1) or D2) or D3) D4) or D5):
D1) entitled P in said methodGH3The DNA molecular of-IPT；
D2) containing D1) expression cassette of described DNA molecular；
D3) containing D1) recombinant vector of described DNA molecular or containing D2) recombinant vector of described expression cassette；
D4) containing D1) recombinant microorganism of described DNA molecular or containing D2) recombinant microorganism of described expression cassette or
Containing D3) recombinant microorganism of described recombinant vector；
D5) containing D1) the transgenic plant cells system of described DNA molecular or containing D2) transgenic of described expression cassette plants
Thing cell line or containing D3) the transgenic plant cells system of described recombinant vector.
In above-mentioned biomaterial, D4) described in recombinant microorganism concretely yeast, antibacterial, algae and fungus.D5) described
Transgenic cell line do not include the propagating materials of plant.
Above-mentioned entitled PGH3The DNA molecular of-IPT cultivate available tillering increase and/or number of productive ear increase and/
Or the application in the transgenic graminaceous plant of plant height reduction falls within protection scope of the present invention.
Above-mentioned transgenic graminaceous plant can be transgenic paddy rice (as bright in transgenic extensive 86).
It is demonstrated experimentally that import entitled P in receptor grassGH3The transgenic standing grain that the DNA molecular of-IPT obtains is originally
The bright extensive 86/pCambia-1301-PMI-nos-P of section plantGH3-IPT, compared with bright extensive 86 (receptor grasses), effectively divides
Tiller number (i.e. number of productive ear) increases by 39.6%, plant height reduces by 33.9%.Illustrate compared with receptor grass, to receptor standing grain originally
Section plant imports entitled PGH3Transgenic graminaceous plant available tillering (the i.e. effectively fringe that the DNA molecular of-IPT obtains
Number) increase, plant height appropriateness becomes short, is not result in excessively changing and causing deformity of plant forms.In receptor grass
Import entitled PGH3The transgenic graminaceous plant that the DNA molecular of-IPT obtains compared with receptor grass, grain number per spike and
Grain is heavily not significantly different from, thus increases individual plant grass yield, and other forms of plant, growth developmental characteristic do not occur
Significant change.
Accompanying drawing explanation
Fig. 1 is pCambia-1301-PMI-nos-PGH3-IPT expression vector schematic diagram.
Fig. 2 is the PCR testing result electrophoretogram of each strain plant IPT gene, M be MarkerIII, 1-13 be T0In generation, turns
pCambia-1301-PMI-nos-PGH3-IPT rice plant, 14 is bright extensive 86,15 to be pCambia-1301-PMI-nos-PGH3-
IPT plasmid, in figure, arrow show purpose fragment.
Fig. 3 is T0For bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT plant and T1For bright extensive 86/pCambia-
1301-PMI-nos-PGH3-IPT plant phenotype figure；(A) in, left figure is bright extensive plant, and in (A), right figure is T0For bright extensive 86/
pCambia-1301-PMI-nos-PGH3-IPT plant, in (B), left figure is bright extensive 86, and in (B), right figure is T1For bright extensive 86/
pCambia-1301-PMI-nos-PGH3-IPT plant.
Fig. 4 is T1For bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT strain and bright extensive 86 available tillerings
Statistical analysis；MH86 is the statistical result of bright extensive 86 available tillerings, and 1-13 is 13 T1For bright extensive 86/pCambia-1301-
PMI-nos-PGH3The statistical result of-IPT strain available tillering.
Detailed description of the invention
Being further described in detail the present invention below in conjunction with detailed description of the invention, the embodiment be given is only for explaining
The bright present invention rather than in order to limit the scope of the present invention.Experimental technique in following embodiment, if no special instructions, is
Conventional method.Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
(structure of three SSR electronics genetic maps based on Oryza sativa L. bright extensive 86, molecule is planted in following embodiment bright extensive 86
Thing breeding, 2008,6 (4): 655-663) public can obtain from China Agricultural University, to repeat the application experiment.
Agrobacterium tumefaciems EHA105 in following embodiment (affects Agrobacterium tumefaciems EHA105 competent cell transformation efficiency
The research of factor, the biological journal in the torrid zone, 2012,3 (1): 22-27) public can obtain from China Agricultural University, to repeat this Shen
Please test.
PCambia-1301-UbiN (planting of Rhizoma Coptidis p-hydroxybenzene acetone acid dioxygenase gene in following embodiment
Thing expression vector establishment, biotechnology, 2011,21 (1): 10-13) public can obtain from China Agricultural University, to repeat this
Application experiment.
Embodiment 1, the transgenic paddy rice that cultivation available tillering increases and plant height reduces
The structure of 1.1pCambia-1301-PMI-nos carrier
Two ends shown in synthetic SEQ ID No.3 are all with the PMI gene C Ds sequence of XhoI enzyme recognition site.
Hpt gene order between two XhoI enzyme recognition sites on pCambia-1301-UbiN carrier is replaced to SEQ
(5 ' hold first after XhoI enzyme recognition sites and first before 3 ' end XhoI enzyme recognition sites in the 11-1186 position of ID No.3
Position) PMI gene order, keep other sequence constant, the named pCambia-1301-PMI of recombinant expression carrier obtained, so
With EcoRI and KpnI restriction endonuclease no terminator scaled off from pCambia-1301-UbiN carrier afterwards and be connected to pCambia-
Between EcoRI and the KpnI site of 1301-PMI carrier, keep other sequence on pCambia-1301-PMI carrier constant, obtain
The named pCambia-1301-PMI-nos of recombinant expression carrier.
1.2 contain entitled PGH3The recombinant expression carrier pCambia-1301-PMI-nos-P of the DNA molecular of-IPTGH3-
The structure of IPT
Entitled P shown in synthetic SEQ ID No.1GH3The DNA molecular of-IPT.In SEQ ID No.1,7-
1896 is promoter PGH3；The 1897-2619 position of SEQ ID No.1 is the encoding gene of prenyltransferase (IPT),
Encoding amino acid sequence IPT as shown in SEQ ID No.2.
Specifically comprise the following steps that
1) preparation of linearization plasmid: use HindIII and KpnI enzyme action pCambia-1301-PMI-nos vector plasmid,
1% agarose gel electrophoresis, agarose gel DNA purification reclaims test kit and reclaims linearisation pCambia-1301-PMI-nos load
Body frame.
2) by the entitled P shown in SEQ ID No.1GH3The DNA molecular of-IPT is connected with cloning vehicle pMD18-T carrier,
It is transformed in Top10 competent cell and checks order, choose the correct positive monoclonal of order-checking and extract pMD-18T-PGH3-IPT matter
Grain.With restricted enzyme HindIII and KpnI double digestion pMD-18T-PGH3-IPT, it is thus achieved that the P of both sides band restriction enzyme siteGH3-
The DNA molecular fragment of IPT.With restricted enzyme HindIII and KpnI double digestion pCambia-1301-PMI-nos, obtain line
Property plasmid DNA.P by both sides band restriction enzyme siteGH3The DNA molecular fragment of-IPT and linearization plasmid DNA are attached instead
Should, product will be connected heat-shock transformed in escherichia coli Top10 bacterial strain competent cell, cultivate picking monoclonal after 8h for 37 DEG C,
By bacterium colony PCR screening positive clone, a step sequence verification of going forward side by side.Sequencing result shows, with the 7-of sequence in sequence table 1
2619 shown DNA moleculars replace the fragment between HindIII and the KpnI enzyme recognition site of pCambia-1301-PMI-nos
The named pCambia-1301-PMI-nos-P of recombinant expression carrier obtainedGH3-IPT。pCambia-1301-PMI-nos-
PGH3The structure of-IPT is as it is shown in figure 1, pCambia-1301-PMI-nos-PGH3Containing prenyltransferase IPT base in-IPT
Because of expression cassette, this expression cassette is by IPT gene and promoter P of startup IPT genetic transcriptionGH3It is formed by connecting with Nos terminator,
pCambia-1301-PMI-nos-PGH3-IPT also has 1 PMI expression casette controlled by 35S promoter, after can being
Continuous work utilize mannose screening transformation tissue culture plant provide resistance marker.This expression vector, using PMI as selection markers, carries
The high biological safety of transfer-gen plant.
By pCambia-1301-PMI-nos-PGH3-IPT proceeds to Agrobacterium tumefaciems EHA105 and obtains EHA105/pCambia-
1301-PMI-nos-PGH3-IPT。
1.3 containing entitled PGH3The bright extensive 86/pCambia-1301-PMI-nos-P of the DNA molecular of-IPTGH3-IPT's
Obtain
The brightest extensive 86CC culture medium prescription:
Minimal medium: CC minimal medium a great number of elements, CC minimal medium trace element, CC minimal medium is organic
Composition, CC minimal medium iron salt, 100mg/L inositol, 300mg/L caseinhydrolysate, 2.878g/L proline, 500mg/L paddy
Glutamine, 36.43g/L mannitol, 20g/L maltose, 3g/L plant gel, remaining is water.Wherein, CC minimal medium see as
Publication about Document: Cailus formation from cell culture protoplasts of corn (Zea maysL.)
.Theor Appl Genet, 1997,54:209-214.
Inducing culture: minimal medium+2mg/L2,4-D, remaining is water, and pH is 5.8-5.9.
Subculture medium isogeneous induction culture medium.
Co-culture culture medium: minimal medium+2mg/L2,4-D+20mg/L acetosyringone (AS)+10g/L glucose,
Remaining is water, and pH is 5.2.
Recovery media: minimal medium+2mg/L2,4-D+200mg/L Ticarcillin/Clavulanate Acid+200mg/L cephamycin, remaining is
Water, pH is 5.8-5.9.
Mannose screening culture medium: minimal medium (without maltose)+2mg/L2,4-D+5g/L sucrose+25g/L manna
Sugar+200mg/L Ticarcillin/Clavulanate Acid+200mg/L cephamycin, remaining is water, and pH is 5.8-5.9.
Hygromycin selection culture medium: minimal medium+2mg/L2,4-D+200mg/L Ticarcillin/Clavulanate Acid+200mg/L cephamycin+
30mg/L hygromycin, remaining is water, and pH is 5.8-5.9.
Pre-division culture medium: minimal medium+2mg/L NAA+1mg/L6-BA+5mg/L ABA, remaining is water, and pH is
5.8-5.9。
Division culture medium: minimal medium+1mg/L NAA+2mg/L6-BA+1mg/L KT, remaining is water, and pH is 5.8-
5.9。
Root media: 1/2MS a great number of elements, 1/2MS trace element, MS organic principle, iron salt, 100mg/L inositol,
30g/L sucrose, 3g/L plant gel, remaining is water, and pH is 5.8-5.9.
AAM culture fluid: AA minimal medium a great number of elements+AA minimal medium trace element+AA minimal medium is organic
Composition+AA minimal medium iron salt+500mg/L caseinhydrolysate+68.5g/L sucrose+176.7mg/L L-arginine+900mg/
L Pidolidone+300mg/L L-Aspartic acid ,+adding 20mg/L acetosyringone (AS)+36g/L glucose, remaining is water, pH
It is 5.2.
1.3.2 the acquisition of mature embryo callus
The bright mature seed of extensive 86 is removed grain husk shell, with 70% ethanol sterilizing 1-2 minute, then goes out with the sodium hypochlorite of 20%
Bacterium about 30 minutes, the most constantly shakes, with aseptic water washing twice；Seed is transferred to dry on aseptic filter paper, inoculation
On inducing culture, light culture, after 7-10 days, when scultellum becomes big, during endosperm deliquescing, removes embryo and bud, the seed embryo peeled
Callus is transferred to recover after two to three days as receptor on new subculture medium.
1.3.3 containing entitled PGH3The EHAi05/pCambia-1301-PMI-nos-P of the DNA molecular of-IPTGH3-IPT
Convert bright extensive 86
(1) EHA105/pCambia-1301-PMI-nos-PGH3-IPT preservation bacterium solution, from-80 DEG C of taking-ups, carries out first
Secondary little shake: take a certain amount of (5-10 μ l) bacterium solution to 5ml YEB (containing 10mg/L rifampicin, 50mg/L kanamycin), 28 DEG C
250rpm shakes cultivation, until OD600For 0.5-0.6, obtain little shaking bacterium solution.Second time is shaken greatly: take that a certain amount of (50 μ l) is little shakes bacterium
Liquid is to 50ml YEB (containing 10mg/L rifampicin, 50mg/L kanamycin), and 28 DEG C of 250rpm concussions are cultivated, until OD600For
0.8-1.0, is shaken greatly bacterium solution.
(2) being placed on shaking greatly bacterium solution in 50ml centrifuge tube, 4 DEG C of 6000rpm are centrifuged 10min, outwell supernatant.Train with AAM
Nutrient solution (containing 20mg/L acetosyringone) is washed once and (has first been blown and beaten truffle with 1-2ml AAM culture fluid, added 30ml AAM
Culture fluid mixes), 4 DEG C of 6000rpm are centrifuged 10min, outwell supernatant.
(3) dilution bacterium solution: dilute bacterium solution with 50ml AAM culture fluid, be subsequently poured into the culture dish putting callus well
In, infect 20min, the most constantly shake.Then outwell bacterium solution, with the filter paper of sterilizing, the bacterium solution in wound healing is blotted, use tweezers
Callus is transferred to co-culture culture medium, and 25 DEG C stand light culture 3 days.
(4) callus co-cultured on base is put in the sterilizing triangular flask of 100ml, (special containing 200mg/L with sterilized water
Mei Ting and 200mg/L cephamycin) clean 5-6 time, until water is the most muddy.
(5) water is outwelled, callus transfers to be placed with to dry up 2-3 in super-clean bench in the culture dish of sterilizing filter paper little
Time.
(6) callus dried is transferred in recovery media 28 DEG C and stand light culture 3 days.
(7) three-wheel screening and culturing, often wheel about 15 days are carried out during callus transfers to Agrobacterium screening culture medium altogether.
(8) resistant calli filtered out is carried out pre-differentiation, differentiation and root culture.
(9) Seedling length rear seedling exercising a period of time to a certain extent, it is transplanted in soil, obtains T0In generation, turns pCambia-1301-
PMI-nos-PGH3-IPT Oryza sativa L..
1.3.4 containing entitled PGH3The bright extensive 86/pCambia-1301-PMI-nos-P of the DNA molecular of-IPTGH3-IPT
Detection
Take the T of step 1.3.30In generation, turns pCambia-1301-PMI-nos-PGH3-IPT rice plant blade extracts genome
DNA, using genomic DNA as template, utilize the primer of IPT gene specific to (IPT-p1:GTCCAATGCTGTCCTCAACT,
IPT-p2:ACCTTCGAATCCGTCGAAAG) PCR amplification is carried out, with recombinant expression plasmid pCambia-1301-PMI-nos-
PGH3-IPT is positive control, and the bright genomic DNA of extensive 86 is negative control, it is contemplated that amplified production fragment is 600bp.
PCR response procedures is as follows:
First 95 DEG C of 5min；95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, totally 35 circulations, last 72 DEG C of 10min；4 DEG C of preservations.
Pcr amplification product carries out 2% agarose gel electrophoresis detection, and ultraviolet is taken pictures, and record result is shown in Fig. 2.
Result shows T0In generation, turns pCambia-1301-PMI-nos-PGH3In-IPT Oryza sativa L., there are 13 strain PCR positive plants (i.e.
PCR primer has 600bp fragment).By named for this PCR positive plant bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT。
1.4 bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT phenotype analytical
Effective tillering refers to finally to form effective fringe solid tiller.In the application, available tillering is effective fringe
Number.
T0For bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT plant is compared with bright extensive 86, and plant height appropriateness becomes short
And tiller number dramatically increases (see (A) in Fig. 3).T1For bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT plant and T0Generation
Bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT plant phenotype similar (see (B) in Fig. 3), has illustrated this exogenous gene
Through entailing offspring.Phenotypic Observation also finds that deformity and death does not occur in transfer-gen plant, it was demonstrated that PGH3IPT table under Qu Donging
Reaching appropriateness, the normal growth not affecting transfer-gen plant is grown.
In order to compare bright extensive 86/pCambia-1301-PMI-nos-P more intuitivelyGH3-IPT plant and bright extensive 86 effective
Tiller number and the difference of plant height, to T1For bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT plant and and bright extensive 86 entering
Go statistics, 13 bright extensive 86/pCambia-1301-PMI-nos-PGH3The each strain of-IPT strain is chosen 15 strains and is analyzed,
Bright extensive 86 choose 15 strains is analyzed.Result shows T1For bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT strain
Available tillering is 8.1 ± 0.9 (individual/strains), and the bright available tillering of extensive 86 is 5.8 ± 0.5 (individual/strains)；T1For bright extensive 86/
pCambia-1301-PMI-nos-PGH3The plant height of-IPT strain is 76.1 ± 2.9 (cm), the bright plant height of extensive 86 is 115.0 ±
1.2 (cm) (table 1).T assay shows, bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT plant and bright extensive 86 it
Between available tillering, plant height be respectively provided with significant difference.Bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT (transgenic
Grass) compared with bright extensive 86 (receptor grasses), available tillering increase by 39.6%, plant height reduce by 33.9%.
Weigh and add up bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT plant and bright extensive 86 grain number per spikes and grain weight, t assay
Show bright extensive 86/pCambia-1301-PMI-nos-PGH3-IPT plant does not heavily have significance difference with the bright grain number per spike of extensive 86 and grain
Different.Bright extensive 86/pCambia-1301-PMI-nos-P is describedGH3-IPT plant single plant yield is higher than bright extensive 86.
This example demonstrates that compared with receptor grass, in receptor grass, import entitled PGH3-IPT
The transgenic graminaceous plant available tillering that obtains of DNA molecular increase, plant height appropriateness becomes short, is not result in plant forms
Excessively change and cause deformity.Entitled P is imported in receptor grassGH3The transgenic standing grain that the DNA molecular of-IPT obtains
Graminaceous plant is compared with receptor grass, and grain number per spike and grain are heavily not significantly different from, thus increases individual plant grass
Yield, and there is not significant change in other forms of plant, growth developmental characteristic.
Table 1, the available tillering of each strain and plant height
Claims (9)
1. the method cultivating the transgenic graminaceous plant that tiller number increases and spike number increases and plant height reduces, described method includes
Entitled P is imported in receptor grassGH3The DNA molecular of-IPT, obtains compared with described receptor grass, point
The transgenic graminaceous plant that tiller number increases and/or spike number increases and/or plant height reduces；
Described entitled PGH3The DNA molecular of-IPT is by IPT gene and promoter P of the described IPT genetic transcription of startupGH3Connect and
Become；Described IPT gene is the gene of sequences encoding isopentenyl transferase IPT；
Described promoter PGH3Be nucleotide sequence be the DNA molecular of SEQ ID No.1 the 7th to 1896.
Method the most according to claim 1, it is characterised in that: described prenyltransferase IPT be aminoacid sequence such as
Protein shown in SEQ ID No.2.
Method the most according to claim 1 and 2, it is characterised in that: described entitled PGH3The nucleoside of the DNA molecular of-IPT
Acid sequence is SEQ ID No.1 the 7th to 2619.
Method the most according to claim 1 and 2, it is characterised in that: described PGH3The DNA molecular of-IPT is by containing described
Entitled PGH3The recombinant expression carrier of the DNA molecular of-IPT imports in described receptor grass.
Method the most according to claim 1 and 2, it is characterised in that: described receptor grass and described transgenic standing grain
Graminaceous plant is Oryza sativa L..
6. the transgenic graminaceous plant cultivated by arbitrary described method in claim 1-5 is cultivating tiller as hybrid strain
Application in the transgenic graminaceous plant that number increases and spike number increases and plant height reduces.
7. the biomaterial that described method arbitrary to claim 1-5 is relevant, described biomaterial is D1) or D2) or D3) or
D4):
D1) the entitled P described in arbitrary described method in claim 1-5GH3The DNA molecular of-IPT；
D2) containing D1) expression cassette of described DNA molecular；
D3) containing D1) recombinant vector of described DNA molecular or containing D2) recombinant vector of described expression cassette；
D4) containing D1) recombinant microorganism of described DNA molecular or containing D2) recombinant microorganism of described expression cassette or contain
D3) recombinant microorganism of described recombinant vector.
8. the entitled P described in claim 1GH3The DNA molecular of-IPT is turning that cultivation tiller number increase and/or plant height reduce
Application in gene grass.
Application the most according to claim 8, it is characterised in that: described transgenic graminaceous plant is transgenic paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410329309.5A CN104087605B (en) | 2014-07-11 | 2014-07-11 | Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410329309.5A CN104087605B (en) | 2014-07-11 | 2014-07-11 | Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104087605A CN104087605A (en) | 2014-10-08 |
| CN104087605B true CN104087605B (en) | 2016-10-26 |
Family
ID=51635364
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410329309.5A Expired - Fee Related CN104087605B (en) | 2014-07-11 | 2014-07-11 | Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104087605B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713076B (en) * | 2014-12-01 | 2019-07-09 | 中国农业大学 | One kind CAD1 albumen relevant to plant tip advantage and its relevant biological material and application |
| CN106434666B (en) * | 2016-10-20 | 2019-10-29 | 武汉生物工程学院 | A kind of application in rice tillering bastem portion and the specifically expressed promoter of fringe |
| CN110184281B (en) * | 2019-06-25 | 2020-10-02 | 华中农业大学 | Rice seed storability gene OsGH3-2 and application of molecular marker thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6268552B1 (en) * | 1997-05-06 | 2001-07-31 | Kansas State University Research Foundation | Transgenic seedless fruit comprising AGL or GH3 promoter operably linked to isopentenyl transferase or tryptophan monooxygenase coding DNA |
-
2014
- 2014-07-11 CN CN201410329309.5A patent/CN104087605B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6268552B1 (en) * | 1997-05-06 | 2001-07-31 | Kansas State University Research Foundation | Transgenic seedless fruit comprising AGL or GH3 promoter operably linked to isopentenyl transferase or tryptophan monooxygenase coding DNA |
Non-Patent Citations (3)
| Title |
|---|
| ipt基因表达载体的构建及其水稻遗传转化研究;钱秋芳;《中国优秀硕士学位论文全文数据库农业科技辑》;20090615(第6期);D047-6页 * |
| Rice GH3 gene family;Jing Fu等;《Plant Signaling & Behavior》;20110401;第6卷(第4期);第573页第1栏第2段 * |
| 农杆菌介导的水稻转基因研究;林拥军;《中国博士学位论文全文数据库农业科技辑》;20040915(第3期);摘要第1页最后一段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104087605A (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102634522B (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| CN105755021A (en) | Rice cadmium-tolerant gene OsGSTU37 and application thereof | |
| CN111593058B (en) | Bna-miR169n gene and application thereof in controlling drought resistance of brassica napus | |
| CN102757487B (en) | Plant dwarfing related protein GA2ox, and encoding gene and application thereof | |
| CN102719433B (en) | Application of osa-MIR167a gene for regulating and controlling plant type of paddy rice | |
| CN104087605B (en) | Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases | |
| CN107805632A (en) | OsMKK6 albumen and encoding gene are in the regulation and control developmental application of vegetable seeds | |
| CN103421828A (en) | Cloning and application of gene OsAP65 controlling development of paddy rice pollen tube | |
| CN110819602B (en) | Application of rice tRNA isopentenyl transferase gene OsIPT9 in resisting brown planthopper | |
| CN108866080B (en) | Tomato stress response gene, recombinant expression vector thereof and application thereof in cultivation of salt-tolerant tomatoes | |
| CN107805633A (en) | OsMPK4 albumen and encoding gene are in the regulation and control developmental application of vegetable seeds | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers | |
| CN115851821A (en) | Application of BBX16 gene in improvement of plant salt tolerance | |
| CN102559676B (en) | Rice root specific promoter and application thereof | |
| CN101942451B (en) | Application of rice OsAPI5 gene in fertility control | |
| CN107417783A (en) | Genes For Plant Tolerance mosaic virus GAP-associated protein GAP GmGR1 and its encoding gene and application | |
| CN104805093B (en) | Applications of the paddy gene OsLOL3 in delaying plant leaf blade aging and improving drought resistance in plants | |
| CN104650204B (en) | The albumen related to rice ATP transports and Development of Chloroplasts and its encoding gene and application | |
| CN105001317B (en) | TuVIPP1 albumen and its encoding gene and application | |
| WO2013010368A1 (en) | Use of rice aerenchyma formation key gene oslsd2 | |
| CN101993484B (en) | Stress tolerance associated protein and coded gene and application thereof | |
| CN102558321B (en) | Protein AtLPT4 related to deficient-phosphorus stress tolerance of plants, and coding gene and application thereof | |
| CN106011105B (en) | Rice ribonuclease H large subunit A coding gene OsRNaseH 2A and application thereof | |
| CN105734064B (en) | OsCCT6 gene is in control rice yield, the application in florescence and plant height | |
| CN110734911B (en) | Application of miR159b in regulation and control of rice bacterial leaf blight resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20161026 Termination date: 20190711 |