CN110184281B - Rice seed storability gene OsGH3-2 and application of molecular marker thereof - Google Patents
Rice seed storability gene OsGH3-2 and application of molecular marker thereof Download PDFInfo
- Publication number
- CN110184281B CN110184281B CN201910554967.7A CN201910554967A CN110184281B CN 110184281 B CN110184281 B CN 110184281B CN 201910554967 A CN201910554967 A CN 201910554967A CN 110184281 B CN110184281 B CN 110184281B
- Authority
- CN
- China
- Prior art keywords
- gene
- osgh3
- rice
- seq
- storage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a rice seed storability gene OsGH3-2 and application of a molecular marker thereof, wherein the rice seed storability gene OsGH3-2 is cloned by a map bit, a nucleotide sequence of the rice seed storability gene OsGH3-2 is shown as SEQ ID No.1, and an amino acid sequence of encoded protein of the rice seed storability gene OsGH3-2 is shown as SEQ ID No. 2. The invention verifies the function of the gene in improving the storage-resistant capability of rice seeds through genetic transformation: the function loss of the OsGH3-2 gene is induced by an RNAi technology, and the expression level of the OsGH3-2 gene is reduced by RNAi, so that the gene can obviously enhance the storage resistance of rice seeds. The invention also provides a molecular marker closely linked with the OsGH3-2 gene, and the molecular marker can be used for detecting the OsGH3-2 haplotype and gene selection, so that the application of the molecular marker in breeding of rice varieties with strong seed storage resistance is realized.
Description
Technical Field
The invention belongs to the field of crop molecular biology, and particularly relates to a rice seed storability gene OsGH3-2 and application of a molecular marker thereof.
Background
The seeds are carriers of plant genetic materials, and are basic material data and main output forms of agricultural production. The crop seeds are inevitably aged after being harvested under the induction of a storage environment, so that the viability is reduced, and the seed value and the crop yield are further influenced (Yamauchi and Winn 1996). Due to seasonal crop rotation arrangements, marketable behavior of seed supplies, and policy requirements for stable agricultural production, a certain amount of seed stock or inventory is required throughout the year. The average stock of seeds of main crops such as rice, corn, wheat and the like in China in recent years is close to 12 hundred million kilograms, and the vitality is reduced during storage, so that huge commercial loss is caused, and the production risk of grains is increased (Gaoyiwei and the like 2016, 2017 of the national statistical bureau). Seed storability refers to the ability of a seed to retain its vigor after long-term storage. The variety with strong seed storage resistance still has higher vitality and sowing value after being stored for a period of time, and the timeliness of the supply of the commercial seeds is prolonged. Therefore, the storage stability of the seeds is an important agronomic trait and commodity characteristic, and is directly related to the production and utilization effects of the seeds. Seeds are metabolically enhanced by the induction of storage environments, and excessive accumulation of reactive oxygen species induces biomacromolecule damage such as lipid membrane peroxidation, protein carbonylation, and nucleic acid strand cleavage, resulting in seed deterioration (Parkhey et al 2012). The plant self-protection mechanism based on the inhibition of active oxygen production or the enhancement of scavenging ability and the oxidative damage repair system are the key to the regulation of seed storability. Rice is an important grain crop, and the humid and hot environment of a production area of the rice is easy to induce the deterioration of seeds, so that the service life of the seeds is shorter, and is only 1-2 years generally. Therefore, the improvement of the rice seed storage tolerance can prolong the seed time, improve the seed quality, keep the original processing and nutritional quality of grains and have great social benefit and economic value (Hujin 2014) for guaranteeing the grain supply safety.
Seed storability is a complex quantitative trait controlled by multiple genes (Bentsink et al 2006). The rice seeds have wide variation in storability, and generally wild rice is stronger than indica rice, and indica rice is stronger than japonica rice (Zhengda et al 2002, Wufangxi et al 2010). Currently, researchers have detected over 50 seed storability-associated QTLs using multiple rice genetic populations (Miuraet al 2002, Zeng et al 2006, Li et al 2012, Hang et al 2014, Dong et al2017, Jinet al 2018, Liu et al 2018). However, the work of digging rice seed storage-resistant genes has been slow, and no report on cloning rice seed storage-resistant genes by using allelic natural variation (Kretzschmar et al 2015) has been reported. Therefore, the method for mining the seed storability gene by utilizing forward genetics is the most economical and effective means for reducing the seed storage cost and improving the seed quality.
Disclosure of Invention
The invention aims to provide a rice seed storage-resistant gene OsGH3-2 and a molecular marker and application thereof.
The map of the invention clones the rice seed storage-resistant gene OsGH3-2, and genetic transformation proves that the gene negatively regulates the seed storage resistance. Through analysis of allele functions and haplotype functions, the gene promoter variation-446 site SNP is proved to cause gene function variation, and further, the invention also develops a molecular marker for detecting the site genotype.
The nucleotide sequence of the rice seed storability gene OsGH3-2 is shown in SEQ ID No.1, or the nucleotide sequence shown in SEQ ID No.1 is substituted, deleted and/or added with one or more nucleotides to code the gene of the same functional protein.
The invention also provides a protein coded by the rice seed storability gene OsGH3-2, which comprises the following components:
1) an amino acid sequence shown as SEQ ID No. 2; or
2) Protein derived from the protein of 2) and with the same activity, wherein the amino acid sequence shown in SEQ ID No.2 is substituted, deleted and/or added with one or more amino acids.
The invention provides a biological material containing an OsGH3-2 gene, which is a vector, a transgenic cell line, an engineering bacterium, a host cell or an expression cassette.
The invention provides the application of the rice seed storage-resistant gene OsGH3-2, or the protein coded by the gene, or the biological material containing the gene in improving the storage-resistant performance of plant seeds.
The invention provides the application of the rice seed storability gene OsGH3-2, or the protein coded by the gene, or the biological material containing the gene in improving the germination rate of plant seeds after storage.
The invention provides the application of the rice seed storability gene OsGH3-2, or the protein coded by the gene, or the biological material containing the gene in prolonging the seed using time of plant seeds and improving the seed quality.
Based on the discovery of the invention, the skilled in the art can understand that the method for knocking out the OsGH3-2 gene, such as CRISPR-Gas9 technology, or the method for reducing the expression quantity of the OsGH3-2 gene, such as RNAi method, is adopted to prevent or reduce the expression of the OsGH3-2 gene, so that the aims of improving the storage resistance of plant seeds, improving the germination rate of the stored plant seeds, prolonging the time for the plant seeds and improving the seed quality can be fulfilled. Therefore, the skilled person can understand that the above applications are all negative regulation applications of the OsGH3-2 gene.
Based on the above, the application provides any one of the following applications of an expression inhibitor of OsGH3-2 gene or a method for inhibiting the expression of the gene:
(1) the application of improving the storage-resistant performance of plant seeds;
(2) the application in improving the germination rate of the stored plant seeds;
(3) the application of prolonging the seed time of plant seeds and improving the seed quality.
The invention provides the application of the rice seed storability gene OsGH3-2, or the protein coded by the gene, or the biological material containing the gene in plant breeding, germplasm resource improvement, or cultivation of transgenic plants with strong seed storability.
In the application, the plant is rice, soybean, wheat, barley, sorghum, millet, sesame, rape, corn and peanut. Preferably, the plant is rice.
The invention also provides a molecular marker of the rice seed storability gene OsGH3-2, which is a base SNP variation of OsGH3-2 promoter-446 bit, namely the nucleotide sequence 155 bit shown in SEQ ID No.3, and the polymorphism is A/G.
Further, the molecular marker of the present invention can be obtained by amplifying the following primer combinations, wherein the primer combinations comprise 3 primers, and the nucleotide sequences of the primers are respectively:
an upstream primer 1: CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
An upstream primer 2: CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
The general primer is as follows: CGTCTCCGGATTAATCAACGGC (SEQ ID NO. 6).
The invention also provides a group of primer combinations for detecting the storage-resistant capability of rice seeds, which comprise 3 primers, wherein the nucleotide sequences of the primers are respectively as follows:
an upstream primer 1: CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
An upstream primer 2: CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
The general primer is as follows: CGTCTCCGGATTAATCAACGGC (SEQ ID NO. 6).
The invention provides any one of the following applications of the molecular marker or the primer combination:
(1) screening rice seeds with strong storage resistance;
(2) eliminating rice seeds with weak storage resistance;
(3) detecting rice seeds with high germination rate or rice seeds with low germination rate in the rice seed storage process;
(4) screening rice seeds with long seed using time and high quality;
(5) cultivating the rice variety with strong storage-resistant capability.
Preferably, in the above application, the primers shown in SEQ ID NO.4-6 are used to detect PCR amplification products based on KASP reaction system platform, and the determination is performed according to the fluorescence signal of the amplification products.
The invention provides a method for detecting the molecular marker, which amplifies the genomic DNA of rice to be detected through the following primer combinations and detects PCR amplification products based on a KASP reaction system platform:
the nucleotide sequence of the primer combination is as follows:
an upstream primer 1: CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
An upstream primer 2: CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
The general primer is as follows: CGTCTCCGGATTAATCAACGGC (SEQ ID NO. 6);
if the PCR product of the sample only detects a fluorescent signal corresponding to the upstream primer 1, determining that the SNP locus to be detected is a base A, and determining that the test sample contains OsGH3-2 haplotype 4, and the storage tolerance of the material seed containing the allele gene is poor; if only the fluorescent signal corresponding to the upstream primer 2 is detected, the SNP locus to be detected is a base G, namely the test sample does not contain OsGH3-2 haplotype 4, and the storage resistance of the material seed containing the allele gene is stronger; if two fluorescent signals are detected simultaneously, the detection site is A: G, and the hybrid OsGH3-2 gene is contained.
The map of the invention clones the rice seed storage-resistant gene OsGH3-2, and verifies the function of the gene through genetic transformation: the function loss of the OsGH3-2 gene is induced by an RNAi technology, and the expression level of the OsGH3-2 gene is reduced by RNAi, so that the gene can obviously enhance the storage resistance of rice seeds. The invention also provides a molecular marker closely linked with the OsGH3-2 gene, and the molecular marker can be used for detecting the OsGH3-2 allele and gene selection, so that the application of the molecular marker in breeding rice varieties with strong seed storage resistance is realized.
Drawings
FIG. 1 is a schematic representation of the qSS1 near isogenic genotype and seed storability phenotype.
FIG. 2 is a diagram of the fine mapping of qSS1 and the sequence variation of candidate gene regions.
FIG. 3 is a graph showing the results of overexpression of OsGH3-2 and storage-tolerant phenotype of RNAi transgenic material seeds. OX5, OX 6 and OX 7 respectively represent positive families with over-expression of OsGH 3-2; RNAi1,2,3 represent OsGH3-2RNAi positive pedigrees, respectively.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.
Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; all reagents used in the examples are commercially available unless otherwise specified.
Example 1 acquisition and phenotypic analysis of Rice seed storability Gene OsGH3-2
1. Digging of rice seed storability site
The invention detects 4 storability QTLs by utilizing the seed life of the backcross recombinant inbred line group constructed by NIP and 9311, wherein the genetic effect of qSS1 is the largest, and the candidate gene region is positioned on the 1 st chromosome 31,849,525-32,274, 465. Through molecular marker assisted selection, the near isogenic line NIL-qSS1 with the NIP replaced by qSS1 and the 9311 genotype at other positions of the genome is obtainedNIPThe genotype is shown in A of FIG. 1. After natural aging and artificial aging (realized by inducing accelerated degradation of seeds at high temperature and high humidity, in this example, the seeds are aged at 43 ℃ and 90% humidity), the germination rates of the seeds are consistent, and NIL-qSS1NIPThe germination rates of the seeds were all significantly lower than 9311 (panel B of fig. 1), i.e. the 9311 allele of qSS1 enhanced the storability of the seeds.
qSS1 Fine positioning
NIL-qSS1 pairs Using flanking markers RM11698 and RM11716NIPThe 6048 isolate constructed by backcrossing with 9311 was genotyped to obtain 145 recombinant individuals (FIG. 2, panel A). The recombinant individual plants are planted into families, the individual plants are harvested, and the storage-resistant phenotype of the seeds is identified by artificial aging. Combining the recombinant pedigree genotype with seed storability analysis, qSS1 was finally mapped finely to the 4.4kb region between RM11709 and Indel2 (FIG. 2, panel B). The candidate gene region contains only 1 annotated gene, LOC _ Os01g55940, which encodes IAA amide synthase, designated OsGH 3-2. Through sequence alignment, NIP and 9311 in the candidate gene region were found to contain only 4 SNPs in the promoter region and only 1 non-synonymous mutation in the gene coding region (FIG. 2, panel C). The Realtime-PCR pair 9311 and NIL-qSS1 were usedNIPThe expression level of OsGH3-2 in the leaves is detected, and the expression level of OsGH3-2 in 9311 is obviously lower than that of NIL-qSS1NIP(diagram D of FIG. 2). The near isogenic lines show: the higher the expression level of OsGH3-2 allele, the worse the seed storability, so the gene is presumed to negatively regulate the seed storability.
TABLE 1 polymorphic molecular markers closely linked to qSS1
Functional analysis of OsGH3-2
In order to verify the gene function of OsGH3-2, the invention clones the coding region 3221bp of OsGH3-2 gene from 9311 genome, constructs the gene into pCambia1301 vector, and carries out overexpression driven by 35S promoter. The overexpression vector is transformed into the middle flower 11 to obtain 56T 0 generation positive transgenic plants, and the growth and development of the positive transgenic plants are normal and do not have the phenomenon of dwarfing and clustering. 3 positive T0 generation individuals with significantly improved expression levels were selected for planting and T1 generation family seeds were harvested (A in FIG. 3). After natural aging (room temperature for one year), the germination rates of the seeds were examined, and it was found that the germination rates of all the 3 independent T1 positive family seeds were significantly reduced (table 2), i.e., the storage stability of the seeds was significantly weaker than that of the wild type (fig. 3B).
TABLE 2 germination percentage of seeds after artificial aging of OsGH3-2 overexpression transgenic material
In addition, the invention selects the 3' 513bp of the coding region of OsGH3-2 as an RNAi target site to construct an RNA interference genetic transformation material. 3T 0 positive families with significantly reduced OsGH3-2 expression levels were selected, and the seed storage-resistant phenotype was investigated (FIG. 3C). After artificial aging, the germination rate of the OsGH3-2RNAi positive pedigree seeds is obviously higher than that of the wild type Zhonghua 11, and the germination rate is shown in table 3, which shows that the OsGH3-2 negatively regulates the storage stability of the rice seeds. The breeder can select the OsGH3-2 non-haplotype 4 allele to enhance rice seed storability.
TABLE 3 germination percentage of seeds after artificial aging of OsGH3-2RNAi transgenic material
Example 2 obtaining of OsGH3-2 molecular marker
By carrying out haplotype analysis on OsGH3-2 by using SNP in a qSS1 fine localization region, the fact that OsGH3-2 mainly has 4 haplotypes in a rice core germplasm is found, and the storage tolerance of haplotype 4 seeds is very obviously lower than that of other 3 haplotypes (Table 2), so that SNP-446 is judged to cause OsGH3-2 allele functional variation which occurs at position 155 in SEQ ID NO. 3.
TABLE 4 OsGH3-2 haplotype analysis results
And (4) supplementary notes: ab identity letters indicate that there was no significant difference in rice seed longevity over multiple comparisons (LSD Duncan).
The invention develops SNP-446, a single-base variation, into a KASP (Kompetitive Allle specific PCR) marker for gene selection. The sequence of the developed marker K _ OsGH3-2-446 was as follows:
an upstream primer 1: CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
An upstream primer 2: CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
The general primer is as follows: CGTCTCCGGATTAATCAACGGC (SEQ ID NO.6)
The two specific primers are 5' connected with FAM or HEX linker sequences of LGC company respectively. The KASP reaction system refers to KASP Master Mix reagent instruction, and the result detection utilizes the matched LGC SNP line genotyping platform.
If the PCR product of the sample only detects the fluorescent signal corresponding to the upstream primer 1, the detection site is a base A, and the test sample is judged to contain OsGH3-2 haplotype 4, namely the allele seed has poor storage stability; if only the fluorescent signal corresponding to the upstream primer 2 is detected, the detection site is a base G, namely the OsGH3-2 non-haplotype 4 in the test sample, namely the allele seed has stronger storage resistance; if two fluorescent signals are detected simultaneously, the detection site is A: G, and the hybrid OsGH3-2 gene is contained.
23 rice OsGH3-2 gene promoter-446 nucleotides were detected by using a marker K _ OsGH 3-2-446. The analysis result of the marker K _ OsGH3-2-446 is shown in Table 5, and is completely consistent with the sequencing result of the site, which indicates that the marker can accurately detect OsGH3-2 haplotype in rice material. In addition, analysis of K _ OsGH3-2-446 showed that: the rice material seed storage resistance of the locus G is generally stronger than that of the rice material of the locus A, so that the marker can be judged to analyze the OsGH3-2 allele genotype and predict the material seed storage resistance.
TABLE 5 marker K _ OsGH3-2-446 test genotyping data
The longer the seed life, the stronger the storage stability, using the seed life as an index. The marker not only can accurately distinguish the site genotype, but also can better judge the storage stability of the rice material seeds.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of agriculture in Huazhong
<120> rice seed storability gene OsGH3-2 and application of molecular marker thereof
<130>KHP191113235.6
<160>38
<170>SIPOSequenceListing 1.0
<210>1
<211>1845
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggctccgg cggcggtggc tgcggcggag gcggggtcga aggcggcggc ggtggcgggg 60
aaggccgtgg cggcgtgcga gcgcgacgcg gagaagctgg agttcatcga ggagatgacg 120
agggggttcg acgcggtgca ggagcgggtg ctggcggcga tcctggcgcg gaacaacggc 180
gccgagtacc tccgccgcca cggcatggaa gggcgcaccg accgggaggc gttcaaggcg 240
cgcgtccccg tcgtcaccta cgaggacctc cgcccggaga tcgagcgcat cgccaacggc 300
gaccgctcca acatcatctc ctcccacccc atcaccgagt tcctcaccag ctcggggact 360
tcggcggggg agaggaagct aatgccgacg atagaagatg agctggacag gaggcagatg 420
ctctacagcc tcctcatgcc cgtcatgaac ttgtacgtgc cagggctgga caagggcaag 480
gggctctact tcctgttcat caagtcggag acgaagacgc ccggcgggct gccggcgagg 540
ccggtgctga ccagctacta caagagcgat cacttcaagc accgcccctt cgacccctac 600
aacgtgtaca cgagcccgac ggcggccatc ctgtgcaccg acgcgttcca gtccatgtac 660
gcgcagatgc tgtgcggcct cgtggcgcgc gccgaggtgc tccgcgtcgg cgccgtcttc 720
gcctcgggcc tcctccgcgc catccgcttc ctccagctcc actggaggga gctcgcccac 780
gacatcagga ccgggacgct gagcgccaag gtgacggagc cgtccatccg cgacgccgtg 840
gcggaggtgc tcgcggcgcc cgacgccgag ctcgccgcgt tcgtggaggc cgagtgcggg 900
aaggacaagt gggaggggat catcaccagg atgtggccca acaccaagta cctcgacgtg 960
atcgtcacgg gcgccatggc gcagtacatc cccacgctca agttctacag cggtgggctc 1020
cccatggcgt gcaccatgta cgcgtcgtcc gagtgctact tcggcctcaa cctgcgcccc 1080
atgtgcgacc cgtcggaggt gtcgtacacc atcatgccca acatgggcta cttcgagctt 1140
atgccgcacg acccggacgc gccgccgctg ccccgcgacg cgccgccgcc gcggctcgtc 1200
gacctggccg acgccgaggt cgggagggag tacgagctgg tgatcaccac ctacgcgggg 1260
ctctgccgct accgcgtggg cgacatcctg caggtgaccg ggttccacaa cgcggcgccg 1320
cagttccggt tcgtccgccg caagaacgtg ctcctcagca tcgactccga caagacggac 1380
gaggcggagc tgcaggccgc ggtggagcgc gcgtccgcgc tgctgtcccc ctacggcgcc 1440
agcatcgtgg agtacacgag ccaggcggac gcgaccacca tcccggggca ctacgtggtg 1500
tactgggagc tgatggtgcg ggagggcggc gcgtggccgc cgccggcgga ggaggagggc 1560
cgcggcgtgt tcgaacggtg ctgcctcgag atggaggagg cgctcaacgc cgtgtacagg 1620
cagggacgca acggcgaggc catcgggccg ctcgagatcc gggtggtgcg cgccggcacg 1680
ttcgaggagg tgatggacta cgccatctcc cgcggcgcct ccatcaacca gtacaaggcg 1740
ccgcgctgcg tctccttcgg ccccatcatc gagctgctca actcgcgcgt catctccaag 1800
cacttcagcc cggcttgccc caaatacagc ccgcacaaga agtga 1845
<210>2
<211>614
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>2
Met Ala Pro Ala Ala Val Ala Ala Ala Glu Ala Gly Ser Lys Ala Ala
1 5 10 15
Ala Val Ala Gly Lys Ala Val Ala Ala Cys Glu Arg Asp Ala Glu Lys
20 25 30
Leu Glu Phe Ile Glu Glu Met Thr Arg Gly Phe Asp Ala Val Gln Glu
35 40 45
Arg Val Leu Ala Ala Ile Leu Ala Arg Asn Asn Gly Ala Glu Tyr Leu
50 55 60
Arg Arg His Gly Met Glu Gly Arg Thr Asp Arg Glu Ala Phe Lys Ala
65 70 75 80
Arg Val Pro Val Val Thr Tyr Glu Asp Leu Arg Pro Glu Ile Glu Arg
85 90 95
Ile Ala Asn Gly Asp Arg Ser Asn Ile Ile Ser Ser His Pro Ile Thr
100 105 110
Glu Phe Leu Thr Ser Ser Gly Thr Ser Ala Gly Glu Arg Lys Leu Met
115 120 125
Pro Thr Ile Glu Asp Glu Leu Asp Arg Arg Gln Met Leu Tyr Ser Leu
130 135 140
Leu Met Pro Val Met Asn Leu Tyr Val Pro Gly Leu Asp Lys Gly Lys
145 150 155 160
Gly Leu Tyr Phe Leu Phe Ile Lys Ser Glu Thr Lys Thr Pro Gly Gly
165 170 175
Leu Pro Ala Arg Pro Val Leu Thr Ser Tyr Tyr Lys Ser Asp His Phe
180 185 190
Lys His Arg Pro Phe Asp Pro Tyr Asn Val Tyr Thr Ser Pro Thr Ala
195 200 205
Ala Ile Leu Cys Thr Asp Ala Phe Gln Ser Met Tyr Ala Gln Met Leu
210 215 220
Cys Gly Leu Val Ala Arg Ala Glu Val Leu Arg Val Gly Ala Val Phe
225 230 235 240
Ala Ser Gly Leu Leu Arg Ala Ile Arg Phe Leu Gln Leu His Trp Arg
245 250 255
Glu Leu Ala His Asp Ile Arg Thr Gly Thr Leu Ser Ala Lys Val Thr
260 265 270
Glu Pro Ser Ile Arg Asp Ala Val Ala Glu Val Leu Ala Ala Pro Asp
275 280 285
Ala Glu Leu Ala Ala Phe Val Glu Ala Glu Cys Gly Lys Asp Lys Trp
290 295 300
Glu Gly Ile Ile Thr Arg Met Trp Pro Asn Thr Lys Tyr Leu Asp Val
305 310 315 320
Ile Val Thr Gly Ala Met Ala Gln Tyr Ile Pro Thr Leu Lys Phe Tyr
325 330 335
Ser Gly Gly Leu Pro Met Ala Cys Thr Met Tyr Ala Ser Ser Glu Cys
340 345 350
Tyr Phe Gly Leu Asn Leu Arg Pro Met Cys Asp Pro Ser Glu Val Ser
355 360 365
Tyr Thr Ile Met Pro Asn Met Gly Tyr Phe Glu Leu Met Pro His Asp
370 375 380
Pro Asp Ala Pro Pro Leu Pro Arg Asp Ala Pro Pro Pro Arg Leu Val
385 390 395 400
Asp Leu Ala Asp Ala Glu Val Gly Arg Glu Tyr Glu Leu Val Ile Thr
405 410 415
Thr Tyr Ala Gly Leu Cys Arg Tyr Arg Val Gly Asp Ile Leu Gln Val
420 425 430
Thr Gly Phe His Asn Ala Ala Pro Gln Phe Arg Phe Val Arg Arg Lys
435 440 445
Asn Val Leu Leu Ser Ile Asp Ser Asp Lys Thr Asp Glu Ala Glu Leu
450 455 460
Gln Ala Ala Val Glu Arg Ala Ser Ala Leu Leu Ser Pro Tyr Gly Ala
465 470 475 480
Ser Ile Val Glu Tyr Thr Ser Gln Ala Asp Ala Thr Thr Ile Pro Gly
485 490 495
His Tyr Val Val Tyr Trp Glu Leu Met Val Arg Glu Gly Gly Ala Trp
500 505 510
Pro Pro Pro Ala Glu Glu Glu Gly Arg Gly Val Phe Glu Arg Cys Cys
515 520 525
Leu Glu Met Glu Glu Ala Leu Asn Ala Val Tyr Arg Gln Gly Arg Asn
530 535 540
Gly Glu Ala Ile Gly Pro Leu Glu Ile Arg Val Val Arg Ala Gly Thr
545 550 555 560
Phe Glu Glu Val Met Asp Tyr Ala Ile Ser Arg Gly Ala Ser Ile Asn
565 570 575
Gln Tyr Lys Ala Pro Arg Cys Val Ser Phe Gly Pro Ile Ile Glu Leu
580 585 590
Leu Asn Ser Arg Val Ile Ser Lys His Phe Ser Pro Ala Cys Pro Lys
595 600 605
Tyr Ser Pro His Lys Lys
610
<210>3
<211>600
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tggcgctgca cactactgtg tcgacacata cccaagcagc aacaaaacac cccctctcct 60
ggatttccat tttcttttcg tccaaccttg ataatacatt tttataaacc tattcatgtc 120
gtatattact tattaatttc tccatcagat gagagattgc cgttgattaa tccggagatg 180
aacaactaca caacccgacc ggtcgggtaa ttaaaaccaa tttagctctc gttcgtcagc 240
gccgatggct aagctcgctg ccggggcgcg ccggccgcgc gtcccgtcgc ggggcccggg 300
cgtccgacgt ggccgaccag gcgggcccac gtgccccctc ctcgctcggg cagtgacgcc 360
cgcgtgggcc acgccctgcc tccccagtcc ccaccctcac cggcccgcct cgctcgcccg 420
cgcgcgcgcg cgcgacgtgc atggcgcgcg gcctcctccc cccctcccgc cgctatatat 480
acccctccct tgcaaccgcc tcctctcatc gcacactcca agctaagcct aagcgagcga 540
gaaaaaatag caaaagctag ccggcaagca acgccaacta attaggggag agagatattc 600
<210>4
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cttattaatt tctccatcag atgagaa 27
<210>5
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
cttattaatt tctccatcag atgagag 27
<210>6
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
cgtctccgga ttaatcaacg gc 22
<210>7
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
<210>8
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
aaccgtatat tgagggagca agc 23
<210>9
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
ctggtggagt tgcagtgcct ctagc 25
<210>10
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ccttgctgct ttctcattga aactgg 26
<210>11
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
cagcccggca gtctatattt cg 22
<210>12
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
actgacgacg ggctagtgtt cc 22
<210>13
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
cctctacctc gcccaacagc 20
<210>14
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
<210>15
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
atggctccgg cggcggtggc tgcgg 25
<210>16
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
ggccttaaac taatgcatcg atc 23
<210>17
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
gagctagacg acacaacgat atatag 26
<210>18
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
cacgagaaat tacacacgca c 21
<210>19
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
<210>20
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
<210>21
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
tgatagcagt ttctggtcct g 21
<210>22
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>22
gaaatgaact ttatgtttgg atagatg 27
<210>23
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>23
<210>24
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>24
<210>25
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>25
gtctgagaaa cgtggttcca c 21
<210>26
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>26
cacttgactg tgcaagagat g 21
<210>27
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>27
<210>28
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>28
aacccctgtc aaaaccatcc 20
<210>29
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>29
<210>30
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>30
<210>31
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>31
<210>32
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>32
<210>33
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>33
<210>34
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>34
<210>35
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>35
gaactaatca agcatgcacg ag 22
<210>36
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>36
tttcatctca agtttgttca cgt 23
<210>37
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>37
<210>38
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>38
Claims (8)
1. The application of rice seed storage-resistant gene OsGH3-2, or its coded protein, or biological material containing the gene in improving rice seed storage-resistant performance,
the nucleotide sequence of the rice seed storability gene OsGH3-2 is shown in SEQ ID No. 1;
the amino acid sequence of the encoded protein is shown as SEQ ID No. 2;
the biological material is a vector, a host cell or an expression cassette.
2. The application of a rice seed storability gene OsGH3-2, or a protein coded by the gene, or a biological material containing the gene in improving the germination rate of rice seeds after storage, wherein the nucleotide sequence of the rice seed storability gene OsGH3-2 is shown as SEQID No. 1;
the amino acid sequence of the encoded protein is shown as SEQ ID No. 2;
the biological material is a vector, a host cell or an expression cassette.
3. The application of a rice seed storability gene OsGH3-2, or a protein coded by the gene, or a biological material containing the gene in prolonging the time of rice seed seeds is disclosed, wherein the nucleotide sequence of the rice seed storability gene OsGH3-2 is shown as SEQ ID No. 1;
the amino acid sequence of the encoded protein is shown as SEQ ID No. 2;
the biological material is a vector, a host cell or an expression cassette.
4. The application of a rice seed storability gene OsGH3-2, or a protein coded by the gene, or a biological material containing the gene in culturing transgenic rice with strong seed storability, wherein the nucleotide sequence of the rice seed storability gene OsGH3-2 is shown as SEQ ID No. 1;
the amino acid sequence of the encoded protein is shown as SEQ ID No. 2;
the biological material is a vector, a host cell or an expression cassette.
5. The molecular marker of the rice seed storage-resistant gene OsGH3-2 is characterized in that the molecular marker is shown as SEQ ID No.3, and A/G mutation occurs at the 155 th site of the sequence, so that rice seed storage-resistant polymorphism is caused.
6. A group of primer combinations for detecting the storage-resistant capability of rice seeds is characterized by comprising 3 primers, wherein the nucleotide sequences of the primers are respectively as follows:
an upstream primer 1: CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
An upstream primer 2: CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
The general primer is as follows: CGTCTCCGGATTAATCAACGGC (SEQ ID NO. 6).
7. Use of any one of the molecular markers of claim 5 or the primer combinations of claim 6:
(1) screening rice seeds with strong storage resistance;
(2) eliminating rice seeds with weak storage resistance;
(3) detecting rice seeds with high germination rate or rice seeds with low germination rate in the rice seed storage process;
(4) screening rice seeds with long seed using time;
(5) cultivating the rice variety with strong storage-resistant capability.
8. The method for detecting the storage stability of the rice seeds is characterized in that the genomic DNA of the rice to be detected is amplified through the following primer combinations, and PCR amplification products are detected based on a KASP reaction system platform:
the nucleotide sequence of the primer combination is as follows:
an upstream primer 1: CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
An upstream primer 2: CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
The general primer is as follows: CGTCTCCGGATTAATCAACGGC (SEQ ID NO. 6);
if the sample PCR product only detects the fluorescent signal corresponding to the upstream primer 1, the SNP locus to be detected is a base A, and the storage resistance of the seeds containing the allele gene material is poor; if only the fluorescent signal corresponding to the upstream primer 2 is detected, the SNP locus to be detected is a base G, and the storage resistance of the seed containing the allele gene material is stronger; if two fluorescent signals are detected simultaneously, the detection site is A: G, and the hybrid OsGH3-2 gene is contained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910554967.7A CN110184281B (en) | 2019-06-25 | 2019-06-25 | Rice seed storability gene OsGH3-2 and application of molecular marker thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910554967.7A CN110184281B (en) | 2019-06-25 | 2019-06-25 | Rice seed storability gene OsGH3-2 and application of molecular marker thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110184281A CN110184281A (en) | 2019-08-30 |
| CN110184281B true CN110184281B (en) | 2020-10-02 |
Family
ID=67723256
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910554967.7A Active CN110184281B (en) | 2019-06-25 | 2019-06-25 | Rice seed storability gene OsGH3-2 and application of molecular marker thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110184281B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014100525A3 (en) * | 2012-12-21 | 2014-09-04 | Pioneer Hi-Bred International, Inc. | Compositions and methods for auxin-analog conjugation |
| CN104087605A (en) * | 2014-07-11 | 2014-10-08 | 中国农业大学 | Method for cultivating transgenic gramineous plant with increased tiller number and biological material related with method |
| CN107460204A (en) * | 2016-06-03 | 2017-12-12 | 中国科学院上海生命科学研究院 | The upstream and downstream action pathway of OsSPL7 controlling plant type of rice and its application |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6613959B1 (en) * | 1998-08-10 | 2003-09-02 | The General Hospital Corporation | Transgenic plants expressing a MAPKKK protein kinase domain |
| CN101993880B (en) * | 2009-08-24 | 2012-07-04 | 华中农业大学 | Rice disease resistance related gene GH3-2 and application thereof in breeding of broad spectrum disease-resistant rice |
| CN107881179A (en) * | 2017-11-18 | 2018-04-06 | 复旦大学 | Rice heteroauxin amination synthase gene OsGH3.6 coded sequence and its application |
-
2019
- 2019-06-25 CN CN201910554967.7A patent/CN110184281B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014100525A3 (en) * | 2012-12-21 | 2014-09-04 | Pioneer Hi-Bred International, Inc. | Compositions and methods for auxin-analog conjugation |
| CN104087605A (en) * | 2014-07-11 | 2014-10-08 | 中国农业大学 | Method for cultivating transgenic gramineous plant with increased tiller number and biological material related with method |
| CN107460204A (en) * | 2016-06-03 | 2017-12-12 | 中国科学院上海生命科学研究院 | The upstream and downstream action pathway of OsSPL7 controlling plant type of rice and its application |
Non-Patent Citations (4)
| Title |
|---|
| Genetic Dissection of Seed Storability and Validation of Candidate Gene Associated with Antioxidant Capability in Rice (Oryza sativa L.).;Yuan, Zhiyang等;《International Journal of Molecular Sciences》;20190909;第20卷(第18期);4442 * |
| Identification of quantitative trait loci for seed storability in rice (Oryza sativa L.);LINFANG LI等;《Plant Breeding》;20120912;第131卷(第6期);739-743 * |
| 水稻种子耐贮性主效QTL qSS-5~(N22)的挖掘和qSS-9~(Kasalath)的精细定位;林秋云;《中国博士学位论文全文数据库（电子期刊）农业科技辑》;20180516(第06期);D047-4 * |
| 通过分子标记辅助选择将耐储藏主效QTL qSS-9Kas转入宁粳4号提高其种子贮藏能力;张平等;《作物学报》;20190103;第45卷(第3期);335-343 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110184281A (en) | 2019-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10100328B2 (en) | Corn plant event MON87460 and compositions and methods for detection thereof | |
| RU2352638C2 (en) | Plant transformants of pv-zmir13 (mon863) maize and compositions and methods of identifying them | |
| US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
| AU2017203293B2 (en) | Qtls associated with and methods for identifying whole plant field resistance to sclerotinia | |
| US11479784B2 (en) | Modulation of seed vigor | |
| Uttam et al. | Molecular mapping and candidate gene analysis of a new epicuticular wax locus in sorghum (Sorghum bicolor L. Moench) | |
| US20120317676A1 (en) | Method of producing plants having enhanced transpiration efficiency and plants produced therefrom | |
| Cheng et al. | New semi‐dwarfing alleles with increased coleoptile length by gene editing of gibberellin 3‐oxidase 1 using CRISPR‐Cas9 in barley (Hordeum vulgare L.) | |
| CN109111511B (en) | Cultivation method of super-long rice | |
| Yuan et al. | A natural allele of TAW1 contributes to high grain number and grain yield in rice | |
| CN110184281B (en) | Rice seed storability gene OsGH3-2 and application of molecular marker thereof | |
| CN110819638B (en) | Rice FL1 gene and molecular marker and application thereof | |
| CN112457385A (en) | Application of gene LJP1 for controlling rice growth period | |
| CN105132428A (en) | ZmLRT gene related to plant root system characters as well as relevant biological material and application thereof | |
| US10858664B2 (en) | Modifying flowering time in maize | |
| CN114516906B (en) | Corn and mycorrhizal fungi symbiotic related protein, and coding gene and application thereof | |
| CN110358773B (en) | Rice seed storage-resistant gene sd1 and molecular marker and application thereof | |
| Hate et al. | Evaluation of Putative Single Nucleotide Polymorphism (SNP) Markers Associated with Waterlogging Tolerance in Maize (Zea mays L.). | |
| Wang et al. | Identification of a novel D3 allele playing a role in nitrogen utilization | |
| CN117701579A (en) | Rice nitrogen efficient and excellent allele NT1 and breeding application thereof | |
| CN117812999A (en) | Methods for identifying, selecting and producing anthracnose-stem rot resistant crops | |
| CN102498208B (en) | Gene capable of regulating number of primary panicle branches and use thereof | |
| CN117187260A (en) | Corn drought-enduring gene ZmPRX1, functional molecular marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |