CN110184281A - A kind of application of rice paddy seed keeping quality gene OsGH3-2 and its molecular labeling - Google Patents
A kind of application of rice paddy seed keeping quality gene OsGH3-2 and its molecular labeling Download PDFInfo
- Publication number
- CN110184281A CN110184281A CN201910554967.7A CN201910554967A CN110184281A CN 110184281 A CN110184281 A CN 110184281A CN 201910554967 A CN201910554967 A CN 201910554967A CN 110184281 A CN110184281 A CN 110184281A
- Authority
- CN
- China
- Prior art keywords
- seq
- gene
- osgh3
- rice paddy
- paddy seed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the applications of a kind of rice paddy seed keeping quality gene OsGH3-2 and its molecular labeling, map based cloning of the present invention rice paddy seed keeping quality gene OsGH3-2, its nucleotide sequence is as shown in SEQ ID NO.1, and the amino acid sequence of coding protein is as shown in SEQ ID NO.2.The present invention demonstrates the gene by genetic transformation and is improving the function in rice paddy seed long keeping ability: inducing the forfeiture of OsGH3-2 gene function and RNAi to reduce OsGH3-2 gene expression amount using RNAi technology, it was confirmed that the gene can enhance the keeping quality of rice paddy seed significantly.The present invention also provides the molecular labelings with OsGH3-2 gene close linkage, can detecte OsGH3-2 haplotype and gene selects using the molecular labeling, realize that it is cultivating the application in the strong rice varieties of seed keeping quality.
Description
Technical field
The invention belongs to crop molecular biology fields, specifically, being related to a kind of rice paddy seed keeping quality gene
The application of OsGH3-2 and its molecular labeling.
Background technique
Seed is plant genetic material carrier or the basic material goods and main occurrence of agricultural production.Crop
Aging is inevitably occurred by storage environment induction after seed harvest, causes viability to decline, and then influence its Seed practical value
With crop yield (Yamauchi and Winn 1996).Due to the marketability row of the arrangement of crops seasonal crop rotation, seed supply
For and stablize agricultural production policy need, require certain amount seed stock or inventory throughout the year.China staple crops
Such as rice, corn, wheat are averaged seed quantity in stock close to 1,200,000,000 kilograms in recent years, and the decline of storage period viability does not only result in huge
Big business loss, more increase grain-production risk (usury is big to wait 2016, State Statistics Bureau 2017).Seed keeping quality refers to
The ability of seed vitality is kept after Long-term storage.The strong kind of seed keeping quality, still has after storing after a period of time
There are higher viability and sowing to be worth, extends commodity kind of a supply timeliness.Therefore, seed keeping quality is important agronomy
Character and product characteristics are directly related to seed Commercial cultivation effect.Seed is enhanced by storage environment inducible metabolism, active oxygen mistake
Degree accumulation induction large biological molecule damage leads to seed deterioration if lipid peroxdation, protein carbonyl and nucleic acid chains are broken
(Parkhey et al 2012).By inhibitory activity oxygen generate or enhance Scavenging activity based on plant autoprotection mechanism with
And oxidative damage repair system is the key that regulation seed keeping quality.Rice is important cereal crops, the damp and hot ring in producing region
Border is easy induction seed deterioration, causes its seed longeivity also shorter, generally only 1-2.Therefore, rice paddy seed storage tolerance is improved
Property be able to extend kind with the time, improve seed quality, retain the original processing of grain and nutritional quality, to ensureing staple food supply safety
With great social benefit and economic value (Hu Jin 2014).
Seed keeping quality is the complicated quantitative character (Bentsink et al 2006) by controlled by multiple genes.Rice seed
There is variation extensively in sub- keeping quality, general wild rice is better than long-grained nonglutinous rice, and long-grained nonglutinous rice is better than japonica rice and (once waits 2002, Wu Fangxi etc. energetically
2010).Currently, researcher utilizes multiple rice genetic crowd surveillances to more than 50 seed keeping quality correlation QTLs (Miura
et al 2002,Zeng et al 2006,Li et al 2012,Hang et al 2014,Dong et al2017,Jin
et al 2018,Liu et al 2018).However, rice paddy seed keeping quality gene excavating work progress is slow, at present not yet
Utilize the report (Kretzschmar et al 2015) of natural allelic variation cloning rice seed keeping quality gene.Cause
This, excavating seed keeping quality gene using forward genetics is to reduce the storage of seeds cost, and it is the most economical to improve seed quality
Effective means.
Summary of the invention
It is an object of the present invention to provide a kind of rice paddy seed storage tolerance gene OsGH3-2 and its molecular labeling and applications.
Map based cloning of the present invention rice paddy seed storage tolerance gene OsGH3-2, confirms the negative gene by genetic transformation
Regulate and control seed keeping quality.Pass through allele function and haplotype functional analysis, it was confirmed that the core promoter mutation -446
Site SNP causes gene function to make a variation, and then the present invention also develops a molecular labeling for detecting the loci gene type.
The nucleotide sequence of rice paddy seed keeping quality gene OsGH3-2 provided by the invention as shown in SEQ ID No.1,
Or nucleotide sequence shown in SEQ ID No.1 is substituted, lacks and/or increases one or several nucleotide coding identical function eggs
White gene.
The present invention also provides the albumen of rice paddy seed keeping quality gene OsGH3-2 coding, include
1) amino acid sequence as shown in SEQ ID No.2；Or
2) amino acid sequence shown in SEQ ID No.2 is substituted, lacks and/or increases one or more amino acid and tool
There is the same active protein as derived from 2).
The present invention provides the biomaterial containing OsGH3-2 gene, the biomaterial is carrier, transgenic cell
System, engineering bacteria, host cell or expression cassette.
The present invention provides above-mentioned rice paddy seed keeping quality gene OsGH3-2 or its albumen encoded or contain the base
The biomaterial of cause is improving the application in vegetable seeds keeping quality energy.
The present invention provides above-mentioned rice paddy seed keeping quality gene OsGH3-2 or its albumen encoded or contain the base
Application of the biomaterial of cause after improving storage in plant seed germination rate.
The present invention provides above-mentioned rice paddy seed keeping quality gene OsGH3-2 or its albumen encoded or contain the base
The biomaterial of cause is extending application of the vegetable seeds kind in time, raising seed quality.
Present invention demonstrates the keeping quality negative regulator genes that gene OsGH3-2 is rice paddy seed, based on hair of the invention
It is existing, it will be appreciated by those skilled in the art that using the method well known in the art for knocking out OsGH3-2 gene, such as CRISPR-Gas9
Technology or the method for reducing OsGH3-2 gene expression amount prevent or reduce the expression of OsGH3-2 gene, such as RNAi method
Can be realized improve vegetable seeds keeping quality, improve storage after plant seed germination rate, extend vegetable seeds kind with the time, mention
The purpose of high seed quality.Therefore, skilled artisans appreciate that above-mentioned application is the negative sense tune of OsGH3-2 gene
Control application.
Based on this, this application provides the expression inhibiting agent of OsGH3-2 gene or the method for inhibiting the gene expression with
Under any application:
(1) application in vegetable seeds keeping quality energy is improved；
(2) application after storing in plant seed germination rate is improved；
(3) extend application of the vegetable seeds kind in time, raising seed quality.
The present invention provides above-mentioned rice paddy seed keeping quality gene OsGH3-2 or its albumen encoded or contain the base
Application of the biomaterial of cause in plant breeding, germ plasm resource improvement or the strong seed keeping quality genetically modified plants of cultivation.
In above-mentioned application, the plant be rice, soybean, wheat, barley, sorghum, millet, sesame, rape, corn,
Peanut.Preferably, the plant is rice.
The present invention also provides the molecular labelings of rice paddy seed keeping quality gene OsGH3-2, start for OsGH3-2
- 446 bit base SNP of son variation is located at the 155th of nucleotide sequence shown in SEQ ID No.3, polymorphism A/G.
Further, molecular labeling of the present invention can be combined amplification by following primer and be obtained, the primer combination
Containing 3 primers, nucleotide sequence is respectively as follows:
Upstream primer 1:CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
Upstream primer 2:CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
Universal primer: CGTCTCCGGATTAATCAACGGC (SEQ ID NO.6).
The primer combination that the present invention also provides one group for detecting rice paddy seed long keeping ability, contains 3 primers,
Nucleotide sequence is respectively as follows:
Upstream primer 1:CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
Upstream primer 2:CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
Universal primer: CGTCTCCGGATTAATCAACGGC (SEQ ID NO.6).
The present invention provides following any applications that above-mentioned molecular labeling or primer combine:
(1) the strong rice paddy seed of screening long keeping ability；
(2) the weak rice paddy seed of long keeping ability is eliminated；
(3) it detects in rice paddy seed storage, the high rice paddy seed of germination percentage or the low rice paddy seed of germination percentage；
(4) screening kind, quality high rice paddy seed long with the time；
(5) the strong rice varieties of long keeping ability are cultivated.
It preferably, is to be examined using primer shown in SEQ ID NO.4-6 based on KASP reaction system platform in above-mentioned application
Pcr amplification product is surveyed to be judged according to the fluorescence signal of amplified production.
The present invention provides the methods for detecting above-mentioned molecular labeling, expand rice genome to be checked by following primer combination
DNA is based on KASP reaction system detection of platform pcr amplification product:
The nucleotide sequence of the primer combination are as follows:
Upstream primer 1:CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
Upstream primer 2:CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
Universal primer: CGTCTCCGGATTAATCAACGGC (SEQ ID NO.6)；
If sample P CR product only detects the corresponding fluorescence signal of upstream primer 1, SNP site to be detected is base
A, discriminating test sample contain OsGH3-2 haplotype 4, poor containing the allele material seed keeping quality；If only detecting
The corresponding fluorescence signal of upstream primer 2, then SNP site to be detected is bases G, i.e. test sample is free of OsGH3-2 haplotype 4,
It is stronger containing the allele material seed keeping quality；Detection site is A:G if being detected simultaneously by two kinds of fluorescence signals, is contained
There is the OsGH3-2 gene of heterozygosis.
Map based cloning of the present invention rice paddy seed storage tolerance gene OsGH3-2, and the gene is demonstrated by genetic transformation
Function: using RNAi technology induction OsGH3-2 gene function lose and RNAi reduce OsGH3-2 gene expression amount, it was demonstrated that
The gene can enhance the keeping quality of rice paddy seed significantly.The present invention also provides with OsGH3-2 gene close linkage
Molecular labeling, can detecte OsGH3-2 allele and gene selects using the molecular labeling, realize that it is cultivating strong seed
Application in the rice varieties of keeping quality.
Detailed description of the invention
Fig. 1 is qSS1 near isogenic lines genotype and seed keeping quality phenotype schematic diagram.
Fig. 2 is qSS1 finely positioning and candidate region sequence variations schematic diagram.
Fig. 3 is OsGH3-2 overexpression and RNAi transgenic line seed keeping quality phenotypic results figure.OX5,6,7 points
It Biao Shi not OsGH3-2 overexpression positive family；RNAi1,2,3 respectively indicates OsGH3-2RNAi positive family.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Without departing substantially from spirit of that invention
In the case where essence, to modifications or substitutions made by the method for the present invention, step or condition, all belong to the scope of the present invention.
Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art；
Unless otherwise specified, agents useful for same is commercially available in embodiment.
The acquisition of 1 rice paddy seed keeping quality gene OsGH3-2 of embodiment and phenotypic analysis
1. rice paddy seed keeping quality site is excavated
The present invention detects 4 keeping qualities using the Backcross inbred lines population seed longeivity that NIP and 9311 is constructed
QTLs, wherein qSS1 hereditary effect is maximum, and candidate region is located at the 1st chromosome 31,849,525-32, and 274,465.Pass through
Molecular marker assisted selection obtains qSS1 and replaces with NIP and genome other positions are the near isogenic lines of 9311 genotype
NIL-qSS1NIP, the A figure of genotype such as Fig. 1.Natural aging and artificial ageing (induce seed to accelerate by high temperature, high humidity
Deterioration realizes that the present embodiment is that seed is accelerated Seed Aging in 43 DEG C, 90% environment of humidity) after, the two percentage of seedgermination
Trend is consistent, NIL-qSS1NIPPercentage of seedgermination is significantly lower than 9311 (B of Fig. 1 schemes), i.e. 9311 allele of qSS1
Enhance the keeping quality of seed.
2.qSS1 finely positioning
Using flanking marker RM11698 and RM11716 to NIL-qSS1NIPGroup is separated with 6048 plants of 9311 backcrossing buildings
Body carries out genotype identification, and 145 recombination single plants are obtained (A of Fig. 2 schemes).It is that single plant is received that recombination single plant kind plantation, which is got married,
Kind, seed keeping quality phenotype is identified by artificial ageing.It is analyzed in conjunction with recombination family genotype and seed keeping quality, finally
By qSS1 finely positioning to the region 4.4kb between RM11709 and Indel2 (B of Fig. 2 schemes).Candidate region only includes 1
A annotation gene LOC_Os01g55940 encodes IAA amide synthetase, is named as OsGH3-2.Pass through sequence alignment, discovery
NIP and 9311 only contains 4 SNP in promoter region in candidate region, and gene coding region only contain 1 it is non-synonymous
Mutation (C of Fig. 2 schemes).Using Realtime-PCR to 9311 and NIL-qSS1NIPBlade OsGH3-2 expression quantity is detected, hair
Existing OsGH3-2 expression quantity in 9311 is lower than NIL-qSS1 significantlyNIP(D of Fig. 2 schemes).Near isogenic lines is shown: OsGH3-2
Allele expression quantity is higher, and seed keeping quality is poorer, therefore speculates that the gene is negative regulation seed keeping quality.
The polymorphic molecular marker of table 1 and qSS1 close linkage
3.OsGH3-2 functional analysis
In order to verify the gene function of OsGH3-2, the present invention is from the 9311 genomic clones gene coding region OsGH3-2
3221bp is building up to pCambia1301 carrier, the overexpression driven by 35S promoter.Above-mentioned overexpression carrier is converted
In spend 11, obtain 56 plants of T0 for positive transgenic plant, its growth and development does not occur normally downgrading phenomenon of growing thickly.Choose 3 tables
The positive T0 significantly improved up to amount is for single-strain planting and harvests T1 for family seed (A of Fig. 3).Natural aging (normal temperature laboratory one
Year) after, investigate percentage of seedgermination, discovery 3 independent T1 positive family percentages of seedgermination reduce (table 2) significantly, i.e., its
Seed keeping quality is weaker than wild type (B of Fig. 3) extremely significantly.
Percentage of seedgermination after 2 OsGH3-2 overexpression transgenic line artificial ageing of table
In addition, the present invention chooses 3 ' 513bp of the code area OsGH3-2 as RNAi target site, RNA interference genetic transformation is constructed
Material.The significantly reduced T0 generation positive family of expression quantity of 3 OsGH3-2 is chosen, investigation seed keeping quality phenotype be (Fig. 3's
C).After artificial ageing, OsGH3-2RNAi positive family percentage of seedgermination is higher than in wild type significantly spends 11, is shown in Table 3, shows
OsGH3-2 negative regulation rice paddy seed keeping quality.Breeder can choose the allele of the non-haplotype 4 of OsGH3-2, with enhancing
Rice paddy seed keeping quality.
Percentage of seedgermination after 3 OsGH3-2RNAi transgenic line artificial ageing of table
The acquisition of 2 OsGH3-2 molecular labeling of embodiment
Haplotype analysis is carried out to OsGH3-2 using SNP in qSS1 finely positioning region, finds OsGH3-2 in rice core
4 kinds of haplotypes are primarily present in heart germplasm, 4 seed keeping quality of haplotype is lower than other 3 kinds of haplotypes (table 2) extremely significantly,
Thus judge that SNP-446 causes OsGH3-2 allele function to make a variation, which occurs the 155th in SEQ ID NO.3.
4 OsGH3-2 haplotype analysis result of table
Note: ab same letter indicates that the rice paddy seed service life, there is no conspicuousness is poor by Multiple range test (LSD Duncan)
It is different.
The present invention is by the variation exploitation of this single base of SNP-446 at KASP (Kompetitive Allele Specific
PCR) label is used for gene selects.The sequence of the label K_OsGH3-2-446 developed is as follows:
Upstream primer 1:CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
Upstream primer 2:CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
Universal primer: CGTCTCCGGATTAATCAACGGC (SEQ ID NO.6)
Two specific primers 5 ' are separately connected FAM the or HEX joint sequence of LGC company.KASP reaction system reference
KASP Master Mix reagent specification, as a result detection utilizes its matched LGC SNP line genotyping platform.
If sample P CR product only detects the corresponding fluorescence signal of upstream primer 1, detection site is base A, is determined
Test sample contains OsGH3-2 haplotype 4, i.e., the allele seed keeping quality is poor；If it is right to only detect upstream primer 2
The fluorescence signal answered, then detection site is bases G, i.e., the non-haplotype 4 of OsGH3-2 in test sample, i.e. the allele seed
Keeping quality is stronger；Detection site is A:G, the OsGH3-2 gene containing heterozygosis if being detected simultaneously by two kinds of fluorescence signals.
23 parts of rice Os GH3-2-446 nucleotide of gene promoter are detected using label K_OsGH3-2-446.
K_OsGH3-2-446 is marked to analyze result such as table 5, it is completely the same with the site sequencing result, illustrate that the label can be examined accurately
Survey OsGH3-2 haplotype in rice material.In addition, K_OsGH3-2-446 analysis shows that: the site be G rice material seed
It is A rice material that keeping quality, which is generally better than site, can analyze OsGH3-2 allele it is possible thereby to judge the label not only
Genotype, it is also predicted that material seed keeping quality.
Table 5 marks K_OsGH3-2-446 test cdna typing data
Using seed longeivity as index, seed longeivity is longer, and keeping quality is also stronger.The label can not only accurately distinguish
Loci gene type also can preferably judge rice material seed keeping quality.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, without departing from the technical principles of the invention, several improvements and modifications can also be made, these improvements and modifications
Also it should be regarded as protection scope of the present invention.
Sequence table
<110>Hua Zhong Agriculture University
<120>application of a kind of rice paddy seed keeping quality gene OsGH3-2 and its molecular labeling
<130> KHP191113235.6
<160> 38
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1845
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atggctccgg cggcggtggc tgcggcggag gcggggtcga aggcggcggc ggtggcgggg 60
aaggccgtgg cggcgtgcga gcgcgacgcg gagaagctgg agttcatcga ggagatgacg 120
agggggttcg acgcggtgca ggagcgggtg ctggcggcga tcctggcgcg gaacaacggc 180
gccgagtacc tccgccgcca cggcatggaa gggcgcaccg accgggaggc gttcaaggcg 240
cgcgtccccg tcgtcaccta cgaggacctc cgcccggaga tcgagcgcat cgccaacggc 300
gaccgctcca acatcatctc ctcccacccc atcaccgagt tcctcaccag ctcggggact 360
tcggcggggg agaggaagct aatgccgacg atagaagatg agctggacag gaggcagatg 420
ctctacagcc tcctcatgcc cgtcatgaac ttgtacgtgc cagggctgga caagggcaag 480
gggctctact tcctgttcat caagtcggag acgaagacgc ccggcgggct gccggcgagg 540
ccggtgctga ccagctacta caagagcgat cacttcaagc accgcccctt cgacccctac 600
aacgtgtaca cgagcccgac ggcggccatc ctgtgcaccg acgcgttcca gtccatgtac 660
gcgcagatgc tgtgcggcct cgtggcgcgc gccgaggtgc tccgcgtcgg cgccgtcttc 720
gcctcgggcc tcctccgcgc catccgcttc ctccagctcc actggaggga gctcgcccac 780
gacatcagga ccgggacgct gagcgccaag gtgacggagc cgtccatccg cgacgccgtg 840
gcggaggtgc tcgcggcgcc cgacgccgag ctcgccgcgt tcgtggaggc cgagtgcggg 900
aaggacaagt gggaggggat catcaccagg atgtggccca acaccaagta cctcgacgtg 960
atcgtcacgg gcgccatggc gcagtacatc cccacgctca agttctacag cggtgggctc 1020
cccatggcgt gcaccatgta cgcgtcgtcc gagtgctact tcggcctcaa cctgcgcccc 1080
atgtgcgacc cgtcggaggt gtcgtacacc atcatgccca acatgggcta cttcgagctt 1140
atgccgcacg acccggacgc gccgccgctg ccccgcgacg cgccgccgcc gcggctcgtc 1200
gacctggccg acgccgaggt cgggagggag tacgagctgg tgatcaccac ctacgcgggg 1260
ctctgccgct accgcgtggg cgacatcctg caggtgaccg ggttccacaa cgcggcgccg 1320
cagttccggt tcgtccgccg caagaacgtg ctcctcagca tcgactccga caagacggac 1380
gaggcggagc tgcaggccgc ggtggagcgc gcgtccgcgc tgctgtcccc ctacggcgcc 1440
agcatcgtgg agtacacgag ccaggcggac gcgaccacca tcccggggca ctacgtggtg 1500
tactgggagc tgatggtgcg ggagggcggc gcgtggccgc cgccggcgga ggaggagggc 1560
cgcggcgtgt tcgaacggtg ctgcctcgag atggaggagg cgctcaacgc cgtgtacagg 1620
cagggacgca acggcgaggc catcgggccg ctcgagatcc gggtggtgcg cgccggcacg 1680
ttcgaggagg tgatggacta cgccatctcc cgcggcgcct ccatcaacca gtacaaggcg 1740
ccgcgctgcg tctccttcgg ccccatcatc gagctgctca actcgcgcgt catctccaag 1800
cacttcagcc cggcttgccc caaatacagc ccgcacaaga agtga 1845
<210> 2
<211> 614
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 2
Met Ala Pro Ala Ala Val Ala Ala Ala Glu Ala Gly Ser Lys Ala Ala
1 5 10 15
Ala Val Ala Gly Lys Ala Val Ala Ala Cys Glu Arg Asp Ala Glu Lys
20 25 30
Leu Glu Phe Ile Glu Glu Met Thr Arg Gly Phe Asp Ala Val Gln Glu
35 40 45
Arg Val Leu Ala Ala Ile Leu Ala Arg Asn Asn Gly Ala Glu Tyr Leu
50 55 60
Arg Arg His Gly Met Glu Gly Arg Thr Asp Arg Glu Ala Phe Lys Ala
65 70 75 80
Arg Val Pro Val Val Thr Tyr Glu Asp Leu Arg Pro Glu Ile Glu Arg
85 90 95
Ile Ala Asn Gly Asp Arg Ser Asn Ile Ile Ser Ser His Pro Ile Thr
100 105 110
Glu Phe Leu Thr Ser Ser Gly Thr Ser Ala Gly Glu Arg Lys Leu Met
115 120 125
Pro Thr Ile Glu Asp Glu Leu Asp Arg Arg Gln Met Leu Tyr Ser Leu
130 135 140
Leu Met Pro Val Met Asn Leu Tyr Val Pro Gly Leu Asp Lys Gly Lys
145 150 155 160
Gly Leu Tyr Phe Leu Phe Ile Lys Ser Glu Thr Lys Thr Pro Gly Gly
165 170 175
Leu Pro Ala Arg Pro Val Leu Thr Ser Tyr Tyr Lys Ser Asp His Phe
180 185 190
Lys His Arg Pro Phe Asp Pro Tyr Asn Val Tyr Thr Ser Pro Thr Ala
195 200 205
Ala Ile Leu Cys Thr Asp Ala Phe Gln Ser Met Tyr Ala Gln Met Leu
210 215 220
Cys Gly Leu Val Ala Arg Ala Glu Val Leu Arg Val Gly Ala Val Phe
225 230 235 240
Ala Ser Gly Leu Leu Arg Ala Ile Arg Phe Leu Gln Leu His Trp Arg
245 250 255
Glu Leu Ala His Asp Ile Arg Thr Gly Thr Leu Ser Ala Lys Val Thr
260 265 270
Glu Pro Ser Ile Arg Asp Ala Val Ala Glu Val Leu Ala Ala Pro Asp
275 280 285
Ala Glu Leu Ala Ala Phe Val Glu Ala Glu Cys Gly Lys Asp Lys Trp
290 295 300
Glu Gly Ile Ile Thr Arg Met Trp Pro Asn Thr Lys Tyr Leu Asp Val
305 310 315 320
Ile Val Thr Gly Ala Met Ala Gln Tyr Ile Pro Thr Leu Lys Phe Tyr
325 330 335
Ser Gly Gly Leu Pro Met Ala Cys Thr Met Tyr Ala Ser Ser Glu Cys
340 345 350
Tyr Phe Gly Leu Asn Leu Arg Pro Met Cys Asp Pro Ser Glu Val Ser
355 360 365
Tyr Thr Ile Met Pro Asn Met Gly Tyr Phe Glu Leu Met Pro His Asp
370 375 380
Pro Asp Ala Pro Pro Leu Pro Arg Asp Ala Pro Pro Pro Arg Leu Val
385 390 395 400
Asp Leu Ala Asp Ala Glu Val Gly Arg Glu Tyr Glu Leu Val Ile Thr
405 410 415
Thr Tyr Ala Gly Leu Cys Arg Tyr Arg Val Gly Asp Ile Leu Gln Val
420 425 430
Thr Gly Phe His Asn Ala Ala Pro Gln Phe Arg Phe Val Arg Arg Lys
435 440 445
Asn Val Leu Leu Ser Ile Asp Ser Asp Lys Thr Asp Glu Ala Glu Leu
450 455 460
Gln Ala Ala Val Glu Arg Ala Ser Ala Leu Leu Ser Pro Tyr Gly Ala
465 470 475 480
Ser Ile Val Glu Tyr Thr Ser Gln Ala Asp Ala Thr Thr Ile Pro Gly
485 490 495
His Tyr Val Val Tyr Trp Glu Leu Met Val Arg Glu Gly Gly Ala Trp
500 505 510
Pro Pro Pro Ala Glu Glu Glu Gly Arg Gly Val Phe Glu Arg Cys Cys
515 520 525
Leu Glu Met Glu Glu Ala Leu Asn Ala Val Tyr Arg Gln Gly Arg Asn
530 535 540
Gly Glu Ala Ile Gly Pro Leu Glu Ile Arg Val Val Arg Ala Gly Thr
545 550 555 560
Phe Glu Glu Val Met Asp Tyr Ala Ile Ser Arg Gly Ala Ser Ile Asn
565 570 575
Gln Tyr Lys Ala Pro Arg Cys Val Ser Phe Gly Pro Ile Ile Glu Leu
580 585 590
Leu Asn Ser Arg Val Ile Ser Lys His Phe Ser Pro Ala Cys Pro Lys
595 600 605
Tyr Ser Pro His Lys Lys
610
<210> 3
<211> 600
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tggcgctgca cactactgtg tcgacacata cccaagcagc aacaaaacac cccctctcct 60
ggatttccat tttcttttcg tccaaccttg ataatacatt tttataaacc tattcatgtc 120
gtatattact tattaatttc tccatcagat gagagattgc cgttgattaa tccggagatg 180
aacaactaca caacccgacc ggtcgggtaa ttaaaaccaa tttagctctc gttcgtcagc 240
gccgatggct aagctcgctg ccggggcgcg ccggccgcgc gtcccgtcgc ggggcccggg 300
cgtccgacgt ggccgaccag gcgggcccac gtgccccctc ctcgctcggg cagtgacgcc 360
cgcgtgggcc acgccctgcc tccccagtcc ccaccctcac cggcccgcct cgctcgcccg 420
cgcgcgcgcg cgcgacgtgc atggcgcgcg gcctcctccc cccctcccgc cgctatatat 480
acccctccct tgcaaccgcc tcctctcatc gcacactcca agctaagcct aagcgagcga 540
gaaaaaatag caaaagctag ccggcaagca acgccaacta attaggggag agagatattc 600
<210> 4
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cttattaatt tctccatcag atgagaa 27
<210> 5
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cttattaatt tctccatcag atgagag 27
<210> 6
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cgtctccgga ttaatcaacg gc 22
<210> 7
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
atcagcatcc caaagctaga acc 23
<210> 8
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
aaccgtatat tgagggagca agc 23
<210> 9
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
ctggtggagt tgcagtgcct ctagc 25
<210> 10
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
ccttgctgct ttctcattga aactgg 26
<210> 11
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
cagcccggca gtctatattt cg 22
<210> 12
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
actgacgacg ggctagtgtt cc 22
<210> 13
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
cctctacctc gcccaacagc 20
<210> 14
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
gaggaccgac tccctgatcg 20
<210> 15
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
atggctccgg cggcggtggc tgcgg 25
<210> 16
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
ggccttaaac taatgcatcg atc 23
<210> 17
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
gagctagacg acacaacgat atatag 26
<210> 18
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
cacgagaaat tacacacgca c 21
<210> 19
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
ctcagaagtt gccagggaac 20
<210> 20
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
ctgatgcgtg acacagcc 18
<210> 21
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
tgatagcagt ttctggtcct g 21
<210> 22
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
gaaatgaact ttatgtttgg atagatg 27
<210> 23
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
ttcgatgggt tgatgtggta 20
<210> 24
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 24
agaagggctg aatctctcca 20
<210> 25
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 25
gtctgagaaa cgtggttcca c 21
<210> 26
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 26
cacttgactg tgcaagagat g 21
<210> 27
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 27
gtccatcacg acgaaccaac 20
<210> 28
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 28
aacccctgtc aaaaccatcc 20
<210> 29
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 29
actggagaag aaaggccgaa 20
<210> 30
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 30
gtcttgcatg cttgtggagt 20
<210> 31
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 31
atgaattgtg tcgtcggcag 20
<210> 32
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 32
acatcgctga gttttgaggc 20
<210> 33
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 33
gtgattgcga agtcatgcgt 20
<210> 34
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 34
ccgccactac acaaacacat 20
<210> 35
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 35
gaactaatca agcatgcacg ag 22
<210> 36
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 36
tttcatctca agtttgttca cgt 23
<210> 37
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 37
gctatttccc attccaggcc 20
<210> 38
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 38
ctgggtttga ggttgtgtcg 20
Claims (10)
1. rice paddy seed keeping quality gene OsGH3-2 or its albumen encoded or the biomaterial containing the gene are improving
Application in vegetable seeds keeping quality energy,
The nucleotide sequence of the rice paddy seed keeping quality gene OsGH3-2 is as shown in SEQ ID No.1 or SEQ ID
Nucleotide sequence shown in No.1 is substituted, lacks and/or increases the gene of one or several nucleotide coding identical function albumen；
The albumen of the coding its include
1) amino acid sequence as shown in SEQ ID No.2；Or
2) amino acid sequence shown in SEQ ID No.2 is substituted, lacks and/or increases one or more amino acid and has same
The protein as derived from 2) of isoreactivity；
The biomaterial is carrier, transgenic cell line, engineering bacteria, host cell or expression cassette.
2. rice paddy seed keeping quality gene OsGH3-2 or its albumen encoded or the biomaterial containing the gene are improving
Application after storage in plant seed germination rate, the nucleotide sequence such as SEQ of the rice paddy seed keeping quality gene OsGH3-2
Shown in ID No.1 or nucleotide sequence shown in SEQ ID No.1 is substituted, lacks and/or increases one or several nucleotide and compiles
The gene of code identical function albumen；
The albumen of the coding its include
1) amino acid sequence as shown in SEQ ID No.2；Or
2) amino acid sequence shown in SEQ ID No.2 is substituted, lacks and/or increases one or more amino acid and has same
The protein as derived from 2) of isoreactivity；
The biomaterial is carrier, transgenic cell line, engineering bacteria, host cell or expression cassette.
3. rice paddy seed keeping quality gene OsGH3-2 or its albumen encoded or the biomaterial containing the gene are extending
Application of the vegetable seeds kind in time, raising seed quality, the nucleotide of the rice paddy seed keeping quality gene OsGH3-2
Sequence is as shown in SEQ ID No.1 or nucleotide sequence shown in SEQ ID No.1 is substituted, lacks and/or increases by one or several
The gene of a nucleotide coding identical function albumen；
The albumen of the coding its include
1) amino acid sequence as shown in SEQ ID No.2；Or
2) amino acid sequence shown in SEQ ID No.2 is substituted, lacks and/or increases one or more amino acid and has same
The protein as derived from 2) of isoreactivity；
The biomaterial is carrier, transgenic cell line, engineering bacteria, host cell or expression cassette.
4. rice paddy seed keeping quality gene OsGH3-2 or its albumen encoded or the biomaterial containing the gene are in plant
Application in the genetically modified plants of breeding, germ plasm resource improvement or the strong seed keeping quality of cultivation, the rice paddy seed storage tolerance
The nucleotide sequence of property gene OsGH3-2 as shown in SEQ ID No.1 or nucleotide sequence shown in SEQ ID No.1 be substituted,
Lack and/or increase the gene of one or several nucleotide coding identical function albumen；
The albumen of the coding its include
1) amino acid sequence as shown in SEQ ID No.2；Or
2) amino acid sequence shown in SEQ ID No.2 is substituted, lacks and/or increases one or more amino acid and has same
The protein as derived from 2) of isoreactivity；
The biomaterial is carrier, transgenic cell line, engineering bacteria, host cell or expression cassette.
5. any application of claim 1-4, which is characterized in that the plant is rice, soybean, wheat, barley, height
Fine strain of millet, millet, sesame, rape, corn, peanut.
6. the molecular labeling of rice paddy seed keeping quality gene OsGH3-2, which is characterized in that it is OsGH3-2 promoter -446
Bit base SNP variation is located at the 155th of nucleotide sequence shown in SEQ ID No.3, polymorphism A/G.
7. molecular labeling as claimed in claim 6, which is characterized in that it can be combined amplification by following primer and obtained, the primer
Combination contains 3 primers, and nucleotide sequence is respectively as follows:
Upstream primer 1:CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
Upstream primer 2:CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5) universal primer:
CGTCTCCGGATTAATCAACGGC(SEQ ID NO.6)。
8. one group of primer combination for detecting rice paddy seed long keeping ability, which is characterized in that contain 3 primers, nucleosides
Acid sequence is respectively as follows:
Upstream primer 1:CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
Upstream primer 2:CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
Universal primer: CGTCTCCGGATTAATCAACGGC (SEQ ID NO.6).
9. following any application of molecular labeling described in claim 6 or 7 or primer according to any one of claims 8 combination:
(1) the strong rice paddy seed of screening long keeping ability；
(2) the weak rice paddy seed of long keeping ability is eliminated；
(3) it detects in rice paddy seed storage, the high rice paddy seed of germination percentage or the low rice paddy seed of germination percentage；
(4) screening kind, quality high rice paddy seed long with the time；
(5) the strong rice varieties of long keeping ability are cultivated.
10. detect claim 6 or 7 described in molecular labeling method, which is characterized in that by following primer combine amplification to
Oryza sativa genomic dna is examined, KASP reaction system detection of platform pcr amplification product is based on:
The nucleotide sequence of the primer combination are as follows:
Upstream primer 1:CTTATTAATTTCTCCATCAGATGAGAA (SEQ ID NO.4)
Upstream primer 2:CTTATTAATTTCTCCATCAGATGAGAG (SEQ ID NO.5)
Universal primer: CGTCTCCGGATTAATCAACGGC (SEQ ID NO.6)；
If sample P CR product only detects the corresponding fluorescence signal of upstream primer 1, SNP site to be detected is base A, is sentenced
Determine test sample and contains 4 allele of OsGH3-2 haplotype, it is poor containing the allele material seed keeping quality；If only examining
The corresponding fluorescence signal of upstream primer 2 is measured, then SNP site to be detected is bases G, i.e., test sample is without mono- times of OsGH3-2
Type 4 is stronger containing the allele material seed keeping quality；Detection site is A:G if being detected simultaneously by two kinds of fluorescence signals,
The then OsGH3-2 gene containing heterozygosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910554967.7A CN110184281B (en) | 2019-06-25 | 2019-06-25 | Rice seed storability gene OsGH3-2 and application of molecular marker thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910554967.7A CN110184281B (en) | 2019-06-25 | 2019-06-25 | Rice seed storability gene OsGH3-2 and application of molecular marker thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110184281A true CN110184281A (en) | 2019-08-30 |
| CN110184281B CN110184281B (en) | 2020-10-02 |
Family
ID=67723256
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910554967.7A Active CN110184281B (en) | 2019-06-25 | 2019-06-25 | Rice seed storability gene OsGH3-2 and application of molecular marker thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110184281B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000009724A1 (en) * | 1998-08-10 | 2000-02-24 | The General Hospital Corporation | Transgenic plants expressing a mapkkk protein kinase domain |
| CN101993880A (en) * | 2009-08-24 | 2011-03-30 | 华中农业大学 | Rice disease resistance related gene GH3-2 and application thereof in breeding of broad spectrum disease-resistant rice |
| WO2014100525A2 (en) * | 2012-12-21 | 2014-06-26 | Pioneer Hi-Bred International, Inc. | Compositions and methods for auxin-analog conjugation |
| CN104087605A (en) * | 2014-07-11 | 2014-10-08 | 中国农业大学 | Method for cultivating transgenic gramineous plant with increased tiller number and biological material related with method |
| CN107460204A (en) * | 2016-06-03 | 2017-12-12 | 中国科学院上海生命科学研究院 | The upstream and downstream action pathway of OsSPL7 controlling plant type of rice and its application |
| CN107881179A (en) * | 2017-11-18 | 2018-04-06 | 复旦大学 | Rice heteroauxin amination synthase gene OsGH3.6 coded sequence and its application |
-
2019
- 2019-06-25 CN CN201910554967.7A patent/CN110184281B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000009724A1 (en) * | 1998-08-10 | 2000-02-24 | The General Hospital Corporation | Transgenic plants expressing a mapkkk protein kinase domain |
| CN101993880A (en) * | 2009-08-24 | 2011-03-30 | 华中农业大学 | Rice disease resistance related gene GH3-2 and application thereof in breeding of broad spectrum disease-resistant rice |
| WO2014100525A2 (en) * | 2012-12-21 | 2014-06-26 | Pioneer Hi-Bred International, Inc. | Compositions and methods for auxin-analog conjugation |
| CN104087605A (en) * | 2014-07-11 | 2014-10-08 | 中国农业大学 | Method for cultivating transgenic gramineous plant with increased tiller number and biological material related with method |
| CN107460204A (en) * | 2016-06-03 | 2017-12-12 | 中国科学院上海生命科学研究院 | The upstream and downstream action pathway of OsSPL7 controlling plant type of rice and its application |
| CN107881179A (en) * | 2017-11-18 | 2018-04-06 | 复旦大学 | Rice heteroauxin amination synthase gene OsGH3.6 coded sequence and its application |
Non-Patent Citations (11)
Also Published As
| Publication number | Publication date |
|---|---|
| CN110184281B (en) | 2020-10-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jiang et al. | The genetic basis of stay-green in rice analyzed in a population of doubled haploid lines derived from an indica by japonica cross | |
| Khalid et al. | Molecular characterization of 87 functional genes in wheat diversity panel and their association with phenotypes under well-watered and water-limited conditions | |
| Liu et al. | Quantitative trait locus analysis for deep-sowing germination ability in the maize IBM Syn10 DH population | |
| US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
| US20100037342A1 (en) | Methods and compositions for breeding plants with enhanced yield | |
| Ahmad et al. | Identification of QTLs for Drought Tolerance Traits on Wheat Chromosome 2A Using Association Mapping. | |
| Hu et al. | Identification of loci and candidate genes responsible for pod dehiscence in soybean via genome-wide association analysis across multiple environments | |
| CN106148353A (en) | Brown planthopper resistant gene in rice Bph6 and closely linked molecular marker thereof | |
| US11219174B2 (en) | Methods for producing corn plants with northern leaf blight resistance and compositions thereof | |
| Martinez et al. | Exome sequencing of bulked segregants identified a novel TaMKK3-A allele linked to the wheat ERA8 ABA-hypersensitive germination phenotype | |
| Miyahara et al. | Detection and validation of QTLs for milky-white grains caused by high temperature during the ripening period in Japonica rice | |
| Nakamura et al. | Quantitative trait loci and maternal effects affecting the strong grain dormancy of wild barley (Hordeum vulgare ssp. spontaneum) | |
| AU2016308049A1 (en) | Methods for producing cotton plants with enhanced drought tolerance and compositions thereof | |
| CN102766697B (en) | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape | |
| Ali et al. | Drought tolerance in some field crops: State of the art review | |
| Jin et al. | TaAAP6-3B, a regulator of grain protein content selected during wheat improvement | |
| Chegdali et al. | Distribution of alleles related to grain weight and quality in Moroccan and North American wheat landraces and cultivars | |
| Nguyen et al. | Identification of QTL for seed dormancy from weedy rice and its application to elite rice cultivar ‘Ninggeng 4’ | |
| Barrero et al. | Identifying genes associated with abiotic stress tolerance suitable for CRISPR/Cas9 editing in upland rice cultivars adapted to acid soils | |
| CN110819638B (en) | Rice FL1 gene and molecular marker and application thereof | |
| EP4111855A1 (en) | Snp based panel for mediterranean wheat plant selection and breeding | |
| CN110184281A (en) | A kind of application of rice paddy seed keeping quality gene OsGH3-2 and its molecular labeling | |
| Lin et al. | Association analysis of candidate quantitative trait loci for resistance to banded leaf and sheath blight in maize | |
| Wang et al. | Markers associated with culm length and elongated internode length in Japonica rice | |
| CN105506147A (en) | Functional molecular marker for corn germination potential gene ZmGLP and application of functional molecular marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |