CN110358773B

CN110358773B - Rice seed storage-resistant gene sd1 and molecular marker and application thereof

Info

Publication number: CN110358773B
Application number: CN201910629321.0A
Authority: CN
Inventors: 余四斌; 田莉; 袁志阳; 凡凯
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2019-07-12
Filing date: 2019-07-12
Publication date: 2021-02-09
Anticipated expiration: 2039-07-12
Also published as: CN110358773A

Abstract

The invention provides a rice seed storage-resistant gene sd1, a molecular marker and application thereof. The allele nucleotide sequence capable of enhancing the storability sd1 of the rice seeds provided by the invention is shown as SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 3. The invention establishes a ZS97 background near isogenic line of NIP of SD1 and ZS97, and proves that the premature termination of the non-functional semi-dwarf mutant gene SD1 protein in ZS97 can increase the seed storage resistance and regulate and control the seed oxidation resistance. The invention induces the semi-dwarf gene SD1 loss-of-function mutant plants in normal rice varieties by using the Crispr technology, so that the protein is terminated in advance, and the SD1 mutant is found to enhance the seed storage resistance, thereby proving that the gene has important application value. The invention provides a new path for improving and breeding the rice seed storability by utilizing the sd1 gene.

Description

Rice seed storage-resistant gene sd1 and molecular marker and application thereof

Technical Field

The invention belongs to the field of crop molecular biology, and particularly relates to a rice seed storability gene sd1, a molecular marker thereof and application thereof.

Background

The rice is an important grain crop, the vitality of the seeds is reduced in the storage process, the agricultural production is seriously influenced, the rice aging and deterioration not only reduces the edible value, but also increases the food safety risk. The grain crop seed storage resistance comprises two aspects: maintain the vitality of the seeds and keep the original edible quality of the grains. The storage property of the seeds is influenced by the genotype, the storage environment and the like, and the seed protection regulated by genetic factors and the biological macromolecular damage repair mechanism play a decisive role (Rajjou and Debeaujou 2008, Song Songquan 2008 and the like). The crop seeds are inevitably aged after being harvested under the induction of a storage environment, so that the viability is reduced, and the seed value and the crop yield are further influenced (Yamauchi and Winn 1996). The variety with strong seed storage resistance still has higher vitality and sowing value after being stored for a period of time, and the timeliness of the supply of the commercial seeds is prolonged. Therefore, the seed storability is an important agronomic trait and commodity characteristic, and is directly related to the seed production and utilization effect in agricultural production. Secondly, in the period of grain overproduction, more than 10000 million tons of wheat, rice and the like are transferred to various grain enterprises for long-term storage every year in agricultural production in China (national statistics bureau 2017). The life of rice seeds is generally 1-2 years, and the seeds are easy to deteriorate and have shorter life in wet tropical regions. The reduction of the vitality is also accompanied with the reduction of the grain quality, and the storage loss rate is increased sharply.

The metabolism of the seeds is enhanced under the induction of a storage environment, and the excessive accumulation of active oxygen induces biomacromolecule damage, such as lipid membrane peroxidation, protein carbonylation and nucleic acid chain breakage, so that the seeds are deteriorated. The plant self-protection mechanism based on the inhibition of active oxygen production or the enhancement of scavenging ability and the oxidative damage repair system are the key to the regulation of seed storability. Rice is an important grain crop, and the humid and hot environment of a production area of the rice is easy to induce the deterioration of seeds, so that the service life of the seeds is shorter, and is only 1-2 years generally. Therefore, the rice seed storage resistance is improved, the original processing and nutrition quality of grains is kept, the grain supply timeliness is prolonged, and the rice seed storage method has great social benefit and economic value for guaranteeing the grain supply safety. At present, researchers detect more than 50 QTLs related to seed storage tolerance by utilizing a plurality of rice genetic groups, but the genetic and physiological bases and the molecular regulation mechanism of the QTLs lack deep research, still more seed storage tolerance genes need to be excavated, and scientific guidance is provided for improving the storage tolerance, keeping the food quality of the food and guiding the scientific storage of the food.

Disclosure of Invention

The invention aims to provide a rice seed storage-resistant gene sd1, a molecular marker and application thereof.

The invention constructs NIL-SD1 by continuous multi-generation backcross with rice ZS97 as background^NIPThe near-isogenic line of ZS97 proves that the non-functional semi-dwarf mutant gene sd1 in ZS97 can increase the storability of seeds.

The rice seed storability gene sd1 provided by the invention is any one of the following genes:

(1) the full-length sequence of the sd1 is shown as SEQ ID No. 2; or

(2) The nucleotide sequence shown as SEQ ID No.2 is substituted, deleted and/or added with one or more nucleotides to code the gene of the same functional protein, or

(3) The full-length sequence of the sd1 is a T inserted into the 139 th site of the sequence shown in SEQ ID NO. 4; or

(4) The full-length sequence of the sd1 is the deletion of 4 bases at the 134-137 th position of the sequence shown in SEQ ID NO.4, namely the deletion of CATT;

(5) the full-length sequence of the sd1 is 18 base deletions at positions 127 and 144 of the sequence shown in SEQ ID NO.4, namely, a deletion CCGGAGCCATTCGTGTGG.

In the above (1), the gene functions in that the 2599 th C base of the wild type SD1 sequence (SEQ ID NO.4) is mutated to G, which results in premature termination of the protein and loss of function. The CDS sequence is shown in SEQ ID NO. 5.

The invention also provides a protein coded by the rice seed storability gene sd1, which has the following components:

1) an amino acid sequence shown as SEQ ID No. 3; or

2) Protein derived from the protein of 2) and with the same activity, wherein the amino acid sequence shown in SEQ ID No.3 is substituted, deleted and/or added with one or more amino acids.

The invention provides a biomaterial containing sd1 gene, which is a vector, a transgenic cell line, an engineering bacterium, a host cell or an expression cassette.

The invention provides the application of the rice seed storage-resistant gene sd1, or the protein coded by the gene, or the biological material containing the gene in improving the storage-resistant performance of plant seeds.

The invention provides the application of the rice seed storability gene sd1, or the protein coded by the gene, or the biological material containing the gene in prolonging the time of plant seed and improving the seed quality.

The invention discovers that the tolerance of the seeds containing the sd1 gene to oxidative stress is obviously enhanced (figure 1), the germination rate of the seeds is obviously improved after artificial aging (figure 1), and the germination rate of the seeds after oxidative stress and artificial aging can be increased by inducing the mutant plants with the sd1 gene loss through the Crispr technology (figure 2). The application of the functional semi-dwarf gene SD1 of the rice in the first green revolution greatly reduces the plant height and increases the grain yield, and the research finds that the recessive allele SD1 can increase the oxidation resistance and the storage resistance of seeds, thereby providing a new thought for how to utilize the SD1 gene.

Based on the gene, the invention provides the application of the rice seed storage-resistant gene sd1, the protein coded by the gene and the biological material containing the gene in plant breeding, germplasm resource improvement, seed production or transgenic plant cultivation.

In the application, the plant is rice, soybean, wheat, barley, sorghum, millet, sesame, rape, corn and peanut. Preferably, the plant is rice.

The invention provides the application of the rice seed storage-resistant gene sd1, the protein coded by the gene and the biological material containing the gene in the cultivation of new varieties of storage-resistant rice.

The invention provides the rice seed storage-resistant gene sd1, the protein coded by the gene, and the application of the biological material containing the gene in regulating the storage-resistant state of rice seeds and improving the storage-resistant property of rice seeds.

Further, the invention provides application of the rice SD1 gene in negative regulation of rice seed storability, wherein the nucleotide sequence of the rice SD1 gene is shown as SEQ ID No. 4. The CDS sequence of the rice SD1 gene is shown in SEQ ID NO. 1.

The invention provides application of a rice SD1 gene in negative regulation of rice seed antioxidant stress, wherein the nucleotide sequence of the rice SD1 gene is shown as SEQ ID No. 4.

The invention provides a molecular marker of a rice storage-resistant gene SD1, which is an Indel molecular marker, compared with a semi-dwarf gene SD1, a 25bp deletion exists in a second intron of a nucleotide sequence shown by the Indel molecular marker, namely, a 25bp fragment deletion of 1262 th to 1286 th wild type SD1 gene shown by SEQ ID No. 4.

The molecular marker can be obtained by PCR amplification of a primer pair with a nucleotide sequence shown as SEQ ID NO. 6-7.

The invention also provides a primer pair for detecting the rice storage-resistant gene sd1, which comprises the following steps: sd1-f: CGGGAAGAAACCGACCTGA (SEQ ID NO.6)

sd1-r：CGTGGCTGTTGGCACCTCT(SEQ ID NO.7)

The invention provides any one of the following applications of the molecular marker,

(1) the application in plant breeding, germplasm resource improvement, seed production or transgenic plant cultivation;

(2) the application in breeding new rice varieties with storability or strong anti-oxidative stress capability;

(3) the application in the rice seed storage-resistant improvement breeding;

(4) screening rice seeds with strong storage resistance or rice seeds with strong oxidation stress resistance, or eliminating the rice seeds with weak storage resistance or rice seeds with weak oxidation stress resistance;

(5) the application in screening rice seeds with long seed using time and high quality;

(6) the application in detecting the genotype of the molecular marker of the invention.

The application specifically comprises the steps of carrying out PCR amplification on sample genome DNA by using a primer with a nucleotide sequence shown as SEQ ID NO.6-7, detecting a PCR amplification product in a full-automatic capillary electrophoresis apparatus, and if a characteristic strip with the size of 468bp appears in an electrophoresis result, determining that the rice to be detected contains wild type SD1 and the rice seed has low storage tolerance; if a characteristic band with the size of 443bp appears in the electrophoresis result, the storage resistance of the rice containing mutant sd1 seeds to be detected is high; and if the electrophoresis result shows the two characteristic bands, the rice to be detected is in a heterozygous type.

20 μ l PCR reaction system: DNA template 100ng, 10 XPCR buffer 2. mu.l, 2mM dNTP mix 2. mu.l, 10. mu.M primers sd1-f and sd1-r each 0.3. mu.l, rTaq DNA polymerase 0.1. mu.l, ddH₂Supplementing O to 20 μ l;

the PCR amplification program is set as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, and circulation for 32 times; the reaction was terminated by extension at 72 ℃ for 7 minutes.

The invention proves that the non-functional semi-dwarf mutant gene SD1 in ZS97 can increase the storage property of seeds and regulate and control the oxidation resistance of the seeds by constructing a ZS97 background near isogenic line of NIP of SD1 and ZS 97. The invention utilizes Crispr technology to induce semi-dwarf gene SD1 loss-of-function mutant plants in normal rice varieties, finds that SD1 mutant enhances seed storage resistance, and proves that the gene has important application value. The invention provides a new path for improving and breeding the rice seed storability by utilizing the sd1 gene. The invention also provides a molecular marker for detecting the sd1 gene, and the molecular marker can be used for detecting the sd1 allele and gene selection, so that the application of the molecular marker in breeding rice varieties with strong seed storage resistance is realized.

Drawings

FIG. 1 is a graph comparing the germination rates of seeds of the SD1 near isogenic line after oxidative stress (left panel) and artificial aging (right panel).

FIG. 2 shows sd1 mutant genotype (top panel) and germination after oxidative stress (bottom left panel) and artificial aging (bottom right panel).

FIG. 3 shows the germination rates of sd1 mutants after oxidative stress (left panel) and artificial aging (right panel).

FIG. 4 shows the sequence differences of sd1 in the second intron of NIP and ZS97, wherein ZS97 is a mutant rice.

FIG. 5 is a graph showing the effect of detecting molecular markers.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; all reagents used in the examples are commercially available unless otherwise specified.

The rice (Oryza sativa) varieties NIP, ZS97 used in the examples were standard varieties.

Example 1 verification of sd1 Regulation of Rice seed storage tolerance by near isogenic lines

To verify the genetic effect of SD1, sequencing comparisons were performed on SD1 genes in NIP and ZS 97. The sd1 of ZS97 was found to have a 25bp deletion at the two introns 1262-1286 compared to NIP; the presence of 4 SNP mutations in the coding region leads to amino acid changes. Wherein the SNP (C/G) at position 2599 (the position in the sequence of SEQ ID NO.4) causes the ZS97 protein to terminate early and lose function. Construction of NIL-SD1 by sequential multiple generations of backcrossing^NIPThe genetic background is ZS97, and the whole genome only contains NIP fragments (less than 2Mb) at SD 1. Under oxidative stress conditions: plump and mature uniform seeds NIL-SD1^NIPAnd ZS97 were dispensed into glass petri dishes (diameter 9cm) filled with 3 pieces of filter paper, and 15ml of 260mMH was added₂O₂The solution is cultured at a constant temperature of 25 ℃ in a dark place, and the germinated seeds are counted after 7 days. The result shows that NIL-SD1 is determined by using embryo bud or radicle breaking seed coat more than 2mm as seed germination standard^NIPThe germination rate of the seeds was 78% which was significantly lower than the germination rate of ZS97 (fig. 1).

Under artificial aging conditions: 150 full and consistent mature seeds are selected and loaded into a10 ml PE tube, then the batch of seeds are uniformly placed into a seed aging box to be aged at the temperature of 44 ℃ and the humidity of 95 percent, and the aging time (6-8 days) is correspondingly adjusted according to different seed batches. Taking out the seeds from the aging box after the aging is finished, uniformly mixing each tube of seeds, and performing a germination test, wherein the result shows that NIL-SD1^NIPThe germination rate of the seeds is 63 percent remarkablyThe germination rate is lower than 98 percent of ZS97 (figure 1).

The previous experiments show that the ZS97 protein early termination mutant has stronger storability and oxidation stress resistance compared with the wild type.

Example 2 acquisition and phenotypic analysis of Rice seed storage-resistant Gene sd1

1. Construction of genetic transformation vector and sd1 rice mutant plant

The function of the gene is further determined by adopting a manner of constructing the sd1 mutant by adopting a Crispr technology. The Crispr vector is provided by professor Zhao Yun De of university of agriculture in Huazhong, the Crispr target site is designed on the first exon according to CRISPER 2.0, the target site sequence is AGATCCCGGAGCCATTCGTG, PCXUN empty vector, after being digested and linearized by KpnI, the vector and OsU3-F/R amplification PCR product are subjected to homologous recombination, the ligation product is transformed into DH5 alpha escherichia coli, and the recovered bacterial liquid is coated on a Kana resistant LA culture dish and cultured for 14h at 37 ℃. Selecting a monoclonal propagation extracted plasmid, sequencing by using OsU3-F, and obtaining the final vector without mutation of a target site. The correct vector constructed was transformed into Agrobacterium EHA105 and the strain introduced into calli of Mesembryanthemum 11 with reference (Hiei et al 1994). The transgenic plant is obtained by preculture, infection, co-culture, selection of hygromycin-resistant callus, differentiation, rooting and finally transfer to the field.

2. Phenotypic analysis 3 SD1 frame-shift mutants without Cas protein were obtained by sequencing T1 transgenic plants, the frame-shift mutation is shown in FIG. 2, MT1 terminates in advance at position 300, MT2 terminates in advance at position 194, MT1 performs frame-shift mutation, the germination rate of unaged seeds of the mutant material is above 95%, which indicates that SD1 does not affect the original viability of the seeds. After the oxidative stress treatment similar to that of example 1, the tolerance of the mutant to the oxidative stress is obviously enhanced (figure 3), the germination rate of the wild type is 78%, the germination rates of the three mutants are respectively 95%, 95% and 98%, after the artificial aging test similar to that of example 1, the germination rates of the mutants after the artificial aging are obviously improved (figure 3), the germination rate of the wild type is 64%, and the germination rates of the three mutants are 95%, 95% and 90%. It is proved that the sd1 mutant protein is terminated early, so that the antioxidant capacity of the seeds is improved, and the storage stability is enhanced. This example demonstrates that mutation in the SD1 gene (SEQ ID NO.4) leads to premature termination of the SD1 protein coding, which can improve seed storage stability and resistance to oxidative stress.

Example 3 acquisition of sd1 molecular marker

In order to distinguish the semi-dwarf gene SD1 from the mutant SD1 in the experiment, the NIP and ZSS97 were subjected to comparative sequencing, and a 25bp insertion deletion in the second intron region was found: the SD1 gene of ZS97 was deleted by 25bp relative to the second intron of SD1 gene (see fig. 4). Downloading the gene sequence of SD1 at MSU website (http:// rice. plant biology. MSU. edu /), intercepting the upstream and downstream 400bp sequences with the 25bp insertion-deletion variation as the center, designing a primer by using software primer 5 to amplify the fragment containing the 25bp insertion-deletion site, wherein the designed gene marker is SD1, and the sequences of the corresponding primers are SD1-f: 5'-CGGGAAGAAACCGACCTGA-3' (SEQ ID NO.6)

sd1-r:5′-CGTGGCTGTTGGCACCTCT-3′(SEQ ID NO.7)

The primers were synthesized by Shanghai Biopsis, Inc.

The sample DNA was subjected to PCR amplification using the designed gene marker sd1-f/r, and the polymorphism of sd1 was detected using the gene marker.

And (3) PCR reaction system: the total volume of 20. mu.l included: DNA template 100ng, 2. mu.l 10 XPCRbuffer, 2. mu.l 2mM dNTP mix, 0.3. mu.l each of primers OSFA3F and OSFA3R of 10. mu. lM, 0.1. mu.l rTaq DNA polymerase. The PCR reaction was performed on a PCR thermal cycler. The PCR amplification program is set as follows: the reaction was terminated by pre-denaturation at 94 ℃ for 4 min, followed by denaturation at 94 ℃ for 30 sec, annealing at 55 ℃ for 30 sec, extension at 72 ℃ for 30 sec, and cycling for 32 cycles, and final extension at 72 ℃ for 7 min.

The PCR product is used in automatic capillary electrophoresis instrument to read the genotype band type. The results are shown in FIG. 5, the gene sd1 has polymorphism in NIP and ZS97, the gene marker sd1 is successfully amplified, the banding pattern is clear, the polymorphism is obvious, the amplified fragment size is moderate, and the developed marker can successfully detect the gene variation of sd1 in different varieties of rice.

A characteristic strip with the size of 468bp appears in the electrophoresis result, and the storage resistance of the corresponding rice seeds to be detected is low; a characteristic band with the size of 443bp appears in the electrophoresis result, and the storage tolerance of the corresponding rice seeds to be detected is high; and if the electrophoresis result shows the two characteristic bands, the rice to be detected is in a heterozygous type.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> rice seed storability gene sd1, molecular marker and application thereof

<130> KHP191113351.5

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1170

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggtggccg agcaccccac gccaccacag ccgcaccaac caccgcccat ggactccacc 60

gccggctctg gcattgccgc cccggcggcg gcggcggtgt gcgacctgag gatggagccc 120

aagatcccgg agccattcgt gtggccgaac ggcgacgcga ggccggcgtc ggcggcggag 180

ctggacatgc ccgtggtcga cgtgggcgtg ctccgcgacg gcgacgccga ggggctgcgc 240

cgcgccgcgg cgcaggtggc cgccgcgtgc gccacgcacg ggttcttcca ggtgtccgag 300

cacggcgtcg acgccgctct ggcgcgcgcc gcgctcgacg gcgccagcga cttcttccgc 360

ctcccgctcg ccgagaagcg ccgcgcgcgc cgcgtcccgg gcaccgtgtc cggctacacc 420

agcgcccacg ccgaccgctt cgcctccaag ctcccatgga aggagaccct ctccttcggc 480

ttccacgacc gcgccgccgc ccccgtcgtc gccgactact tctccagcac cctcggcccc 540

gacttcgcgc caatggggag ggtgtaccag aagtactgcg aggagatgaa ggagctgtcg 600

ctgacgatca tggaactcct ggagctgagc ctgggcgtgg agcgaggcta ctacagggag 660

ttcttcgcgg acagcagctc aatcatgcgg tgcaactact acccgccatg cccggagccg 720

gagcggacgc tcggcacggg cccgcactgc gaccccaccg ccctcaccat cctcctccag 780

gacgacgtcg gcggcctcga ggtcctcgtc gacggcgaat ggcgccccgt cagccccgtc 840

cccggcgcca tggtcatcaa catcggcgac accttcatgg cgctgtcgaa cgggaggtat 900

aagagctgcc tgcacagggc ggtggtgaac cagcggcggg agcggcggtc gctggcgttc 960

ttcctgtgcc cgcgggagga cagggtggtg cggccgccgc cgagcgccgc cacgccgcag 1020

cactacccgg acttcacctg ggccgacctc atgcgcttca cgcagcgcca ctaccgcgcc 1080

gacacccgca cgctcgacgc cttcacgcgc tggctcgcgc cgccggccgc cgacgccgcc 1140

gcgacggcgc aggtcgaggc ggccagctga 1170

<210> 2

<211> 2575

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggtggccg agcaccccac gccaccacag ccgcaccaac caccgcccat ggactccacc 60

gccggctctg gcattgccgc cccggcggcg gcggcggtgt gcgacctgag gatggagccc 120

aagatcccgg agccattcgt gtggccgaac ggcgacgcga ggccggcgtc ggcggcggag 180

ctggacatgc ccgtggtcga cgtgggcgtg ctccgcgacg gcgacgccga ggggctgcgc 240

cgcgccgcgg cgcaggtggc cgccgcgtgc gccacgcacg ggttcttcca ggtgtccggg 300

cacggcgtcg acgccgctct ggcgcgcgcc gcgctcgacg gcgccagcga cttcttccgc 360

ctcccgctcg ccgagaagcg ccgcgcgcgc cgcgtcccgg gcaccgtgtc cggctacacc 420

agcgcccacg ccgaccgctt cgcctccaag ctcccatgga aggagaccct ctccttcggc 480

ttccacgacc gcgccgccgc ccccgtcgtc gccgactact tctccagcac cctcggcccc 540

gacttcgcgc caatggggta attaaaacga tggtggacga cattgcattt caaattcaaa 600

acaaattcaa aacacaccga ccgagattat gctgaattca aacgcgtttg tgcgcgcagg 660

agggtgtacc agaagtactg cgaggagatg aaggagctgt cgctgacgat catggaactc 720

ctggagctga gcctgggcgt ggagcgaggc tactataggg agttcttcgc ggacagcagc 780

tcaatcatgc ggtgcaacta ctacccgcca tgcccggagc cggagcggac gctcggcacg 840

ggcccgcact gcgaccccac cgccctcacc atcctcctcc aggacgacgt cggcggcctc 900

gaggtcctcg tcgacggcga atggcgcccc gtcagccccg tccccggcgc catggtcatc 960

aacatcggcg acaccttcat ggtaaaccat ctcctattct cctctcctct gttctcctct 1020

gcttcgaagc aacagaacaa gtaattcaag cttttttttc tctcgcgcgc gaaattgacg 1080

agaaaaataa gatcgtggta ggggcggggc tttcagctga aagcgggaag aaaccgacct 1140

gacgtgattt ctctgttcca atcacaaaca atggaatgcc ccactcctcc atgtgttatg 1200

atttatctca catcttatag ttaataggag taagtaacaa gctattgatt tttttttgtt 1260

aaagtttttt tagtttatcc aaatttattg aaaaacttag caacgtttat aataccaaat 1320

tagtctcatt tagtttaata ttgtatatat tttgataata tatttatgtt atattaaaaa 1380

tattactata ttttactata aacattatta aaagccattt ataatataaa atggaaggag 1440

taattaatat ggatctcccc cgacatgaga atattttccg atggtgtgac gacgccatgt 1500

aagcttcggt gggcctggac ggccagaggt gccaacagcc acgtccaaca acccctgggt 1560

ccccccctaa cactccaaac agtagtgagt agtgtctcgt cgcgttttag tatttgatga 1620

caaacaaagt gtgagttgag ttagccacca ccaacttgca cacgagcaca tacatttgtg 1680

tccattctcg ccagtcattt ccatctctac tcctaactcc tatctaacga tgtaagcgga 1740

taatttcatc atccgtatat aaacctgttt gttatagtta atttcctata taatactata 1800

acagtataca ttttaaaaga aaacaaaatt aggataaaca ggccctgctc ctatccatcc 1860

atggcacttg gaaggaccag actcggtcat gccatgccaa gccaagatat ggattatgga 1920

agagtagaga agaggagaga tgagagataa gcatgcgttc tcctcctcgt tggatgtgta 1980

ttttggaggg atttgtgtag tagtagcagc ggcgccgcgg ggacggatgc ggatggtggc 2040

gctttcggtg gcgttttcct gggggggttt tggtttggcg cttggggggg atggcatggc 2100

gcggcgtgcg gctgcacgcc acacacgcgc gcgcacgcac gtacgtcgtc gtcgccgcgg 2160

gcggacggta gcttagggtg gtgtgttccg cgcgcgggcg cggattgttc catgccgatc 2220

gatttggcgc caccctcgcc gcggctcttg tcgcgtcgtg cgcctctctc gcgcggtttg 2280

tccttgtcgc gttgctcagc cggcgacggg ggcacggaca ttggcgatgt agccctgcac 2340

gtgtcggcct ctccgttgat gaatgatgat gtatgtatgt attttttttt tgtctgaagg 2400

aatttgtggg gaattgttgt gtgtgcaggc gctgtcgaac gggaggtata agagctgcct 2460

gcacagggcg gtggtgaacc agcggcggga gcggcggtcg ctggcgttct tcctgtgccc 2520

gcgggaggac agggtggtgc ggccgccgcc gagcgccgcc acgccgcggc actag 2575

<210> 3

<211> 388

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Val Ala Glu His Pro Thr Pro Pro Gln Pro His Gln Pro Pro Pro

1 5 10 15

Met Asp Ser Thr Ala Gly Ser Gly Ile Ala Ala Pro Ala Ala Ala Ala

20 25 30

Val Cys Asp Leu Arg Met Glu Pro Lys Ile Pro Glu Pro Phe Val Trp

35 40 45

Pro Asn Gly Asp Ala Arg Pro Ala Ser Ala Ala Glu Leu Asp Met Pro

50 55 60

Val Val Asp Val Gly Val Leu Arg Asp Gly Asp Ala Glu Gly Leu Arg

65 70 75 80

Arg Ala Ala Ala Gln Val Ala Ala Ala Cys Ala Thr His Gly Phe Phe

85 90 95

Gln Val Ser Gly His Gly Val Asp Ala Ala Leu Ala Arg Ala Ala Leu

100 105 110

Asp Gly Ala Ser Asp Phe Phe Arg Leu Pro Leu Ala Glu Lys Arg Arg

115 120 125

Ala Arg Arg Val Pro Gly Thr Val Ser Gly Tyr Thr Ser Ala His Ala

130 135 140

Asp Arg Phe Ala Ser Lys Leu Pro Trp Lys Glu Thr Leu Ser Phe Gly

145 150 155 160

Phe His Asp Arg Ala Ala Ala Pro Val Val Ala Asp Tyr Phe Ser Ser

165 170 175

Thr Leu Gly Pro Asp Phe Ala Pro Met Gly Arg Val Tyr Gln Lys Tyr

180 185 190

Cys Glu Glu Met Lys Glu Leu Ser Leu Thr Ile Met Glu Leu Leu Glu

195 200 205

Leu Ser Leu Gly Val Glu Arg Gly Tyr Tyr Arg Glu Phe Phe Ala Asp

210 215 220

Ser Ser Ser Ile Met Arg Cys Asn Tyr Tyr Pro Pro Cys Pro Glu Pro

225 230 235 240

Glu Arg Thr Leu Gly Thr Gly Pro His Cys Asp Pro Thr Ala Leu Thr

245 250 255

Ile Leu Leu Gln Asp Asp Val Gly Gly Leu Glu Val Leu Val Asp Gly

260 265 270

Glu Trp Arg Pro Val Ser Pro Val Pro Gly Ala Met Val Ile Asn Ile

275 280 285

Gly Asp Thr Phe Met Ala Leu Ser Asn Gly Arg Tyr Lys Ser Cys Leu

290 295 300

His Arg Ala Val Val Asn Gln Arg Arg Glu Arg Arg Ser Leu Ala Phe

305 310 315 320

Phe Leu Cys Pro Arg Glu Asp Arg Val Val Arg Pro Pro Pro Ser Ala

325 330 335

Ala Thr Pro Arg His Pro Asp Phe Thr Trp Ala Asp Leu Met Arg Phe

340 345 350

Thr Gln Arg His Tyr Arg Ala Asp Thr Arg Thr Leu Asp Ala Phe Thr

355 360 365

Arg Trp Leu Ala Pro Pro Ala Ala Asp Ala Ala Ala Thr Ala Gln Val

370 375 380

Glu Ala Ala Ser

385

<210> 4

<211> 2743

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atggtggccg agcaccccac gccaccacag ccgcaccaac caccgcccat ggactccacc 60

gccggctctg gcattgccgc cccggcggcg gcggcggtgt gcgacctgag gatggagccc 120

aagatcccgg agccattcgt gtggccgaac ggcgacgcga ggccggcgtc ggcggcggag 180

ctggacatgc ccgtggtcga cgtgggcgtg ctccgcgacg gcgacgccga ggggctgcgc 240

cgcgccgcgg cgcaggtggc cgccgcgtgc gccacgcacg ggttcttcca ggtgtccgag 300

cacggcgtcg acgccgctct ggcgcgcgcc gcgctcgacg gcgccagcga cttcttccgc 360

ctcccgctcg ccgagaagcg ccgcgcgcgc cgcgtcccgg gcaccgtgtc cggctacacc 420

agcgcccacg ccgaccgctt cgcctccaag ctcccatgga aggagaccct ctccttcggc 480

ttccacgacc gcgccgccgc ccccgtcgtc gccgactact tctccagcac cctcggcccc 540

gacttcgcgc caatggggta attaaaacga tggtggacga cattgcattt caaattcaaa 600

acaaattcaa aacacaccga ccgagattat gctgaattca aacgcgtttg tgcgcgcagg 660

agggtgtacc agaagtactg cgaggagatg aaggagctgt cgctgacgat catggaactc 720

ctggagctga gcctgggcgt ggagcgaggc tactacaggg agttcttcgc ggacagcagc 780

tcaatcatgc ggtgcaacta ctacccgcca tgcccggagc cggagcggac gctcggcacg 840

ggcccgcact gcgaccccac cgccctcacc atcctcctcc aggacgacgt cggcggcctc 900

gaggtcctcg tcgacggcga atggcgcccc gtcagccccg tccccggcgc catggtcatc 960

aacatcggcg acaccttcat ggtaaaccat ctcctattct cctctcctct gttctcctct 1020

gcttcgaagc aacagaacaa gtaattcaag cttttttttc tctctcgcgc gaaattgacg 1080

agaaaaataa gatcgtggta ggggcggggc tttcagctga aagcgggaag aaaccgacct 1140

gacgtgattt ctctgttcca atcacaaaca atggaatgcc ccactcctcc atgtgttatg 1200

atttatctca catcttatag ttaataggag taagtaacaa gctacttttt tcatattata 1260

gttcgtttga tttttttttt ttaaagtttt tttagtttta tccaaattta ttgaaaaact 1320

tagcaacgtt tataatacca aattagtctc atttagttta atattgtata tattttgata 1380

atatatttat gttatattaa aaatattact atatttttct ataaacatta ttaaaagcca 1440

tttataatat aaaatggaag gagtaattaa tatggatctc ccccgacatg agaatatttt 1500

ccgatggtgt gacgacgcca tgtaagcttc ggtgggcctg gacggccaga ggtgccaaca 1560

gccacgtcca acaacccctg ggtccccccc taacactcca aacagtagtg agtagtgtct 1620

cgtcgcgttt tagtatttga tgacaaacaa agtgtgagtt gagttagcca ccaccaactt 1680

gcacacgagc acatacattt gtgtccattc tcgccagtca cttccatctc tagtcctaac 1740

tcctatctag cgatgtaagc ggataatttc atcatccgta tataaacctg tttgttatag 1800

ttaatttcct atataatact ataacagtat acattttaaa agaaaacaaa attaggataa 1860

acaggccctg ctcctatcca tccatggcac ttggaaggac cagactcggt catgccatgc 1920

caagccaaga tatgggttat ggaagagtag agaagaggag agatgagaga taagcatgcg 1980

ttctcctcct cgttggatgt gtattttgga gggatttgtg tagtagtagc agcggcgccg 2040

cggggacgga tgcggatggt ggcgctttcg gtggcgtttt cccggggggg ttttggtttg 2100

gcgcttgggg gggatggcat ggcgcggcgt gcggctgcac gccacacaca cgcgcgcgca 2160

cgcacgtacg tcgtcgtcgc cgcgggcgga cggtagctta gggtggtgtg ttccgcgcgc 2220

gggcgcggat tgttccatgc cgatcgattt ggcgccaccc tcgccgcggc tcttgtcgcg 2280

tcgtgcgcct ctctcgcgcg gtttgtcctt gtcgcgttgc tcagccggcg acgggggcac 2340

ggacattggc gatgtagccc tgcacgtgtc ggcctctccg ttgatgaatg atgatgtatg 2400

tatgtatttt tttttgtctg aaggaatttg tggggaattg ttgtgtgtgc aggcgctgtc 2460

gaacgggagg tataagagct gcctgcacag ggcggtggtg aaccagcggc gggagcggcg 2520

gtcgctggcg ttcttcctgt gcccgcggga ggacagggtg gtgcggccgc cgccgagcgc 2580

cgccacgccg cagcactacc cggacttcac ctgggccgac ctcatgcgct tcacgcagcg 2640

ccactaccgc gccgacaccc gcacgctcga cgccttcacg cgctggctcg cgccgccggc 2700

cgccgacgcc gccgcgacgg cgcaggtcga ggcggccagc tga 2743

<210> 5

<211> 1026

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggtggccg agcaccccac gccaccacag ccgcaccaac caccgcccat ggactccacc 60

gccggctctg gcattgccgc cccggcggcg gcggcggtgt gcgacctgag gatggagccc 120

aagatcccgg agccattcgt gtggccgaac ggcgacgcga ggccggcgtc ggcggcggag 180

ctggacatgc ccgtggtcga cgtgggcgtg ctccgcgacg gcgacgccga ggggctgcgc 240

cgcgccgcgg cgcaggtggc cgccgcgtgc gccacgcacg ggttcttcca ggtgtccggg 300

cacggcgtcg acgccgctct ggcgcgcgcc gcgctcgacg gcgccagcga cttcttccgc 360

ctcccgctcg ccgagaagcg ccgcgcgcgc cgcgtcccgg gcaccgtgtc cggctacacc 420

agcgcccacg ccgaccgctt cgcctccaag ctcccatgga aggagaccct ctccttcggc 480

ttccacgacc gcgccgccgc ccccgtcgtc gccgactact tctccagcac cctcggcccc 540

gacttcgcgc caatggggag ggtgtaccag aagtactgcg aggagatgaa ggagctgtcg 600

ctgacgatca tggaactcct ggagctgagc ctgggcgtgg agcgaggcta ctatagggag 660

ttcttcgcgg acagcagctc aatcatgcgg tgcaactact acccgccatg cccggagccg 720

gagcggacgc tcggcacggg cccgcactgc gaccccaccg ccctcaccat cctcctccag 780

gacgacgtcg gcggcctcga ggtcctcgtc gacggcgaat ggcgccccgt cagccccgtc 840

cccggcgcca tggtcatcaa catcggcgac accttcatgg cgctgtcgaa cgggaggtat 900

aagagctgcc tgcacagggc ggtggtgaac cagcggcggg agcggcggtc gctggcgttc 960

ttcctgtgcc cgcgggagga cagggtggtg cggccgccgc cgagcgccgc cacgccgcgg 1020

cactag 1026

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgggaagaaa ccgacctga 19

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgtggctgtt ggcacctct 19

Claims

1. A rice seed storage-resistant gene sd1 is characterized in that it is any one of the following:

(1) the full-length sequence of the sd1 is shown as SEQ ID No. 2; or

(2) The full-length sequence of the sd1 is a T inserted into the 139 th site of the sequence shown in SEQ ID NO. 4; or

(3) The full-length sequence of the sd1 is the deletion of 4 bases at the 134 th and 137 th positions of the sequence shown in SEQ ID NO. 4; or

(4) The full-length sequence of the sd1 is 18 base deletions at 127-144 of the sequence shown in SEQ ID NO. 4.

2. The rice seed storage-tolerant gene sd1 protein of claim 1, wherein the amino acid sequence is as shown in SEQ ID No. 3.

3. The biological material containing the rice seed storage-resistant gene sd1 of claim 1, wherein the biological material is a vector, a transgenic cell line, an engineering bacterium, a host cell or an expression cassette.

4. The use of the rice seed storage-resistant gene sd1 of claim 1, the protein of claim 2, or the biomaterial of claim 3 for any one of the following applications:

(1) the application in breeding new varieties of storable rice;

(2) the application in regulating and controlling the storage-resistant state of rice seeds, improving the storage-resistant property of rice seeds or providing the rice seeds with the capability of resisting oxidative stress.

5. The application of the rice SD1 gene in negative regulation of rice seed storability is disclosed, wherein the nucleotide sequence of the rice SD1 gene is shown as SEQ ID No. 4.

6. The application of the rice SD1 gene in negative regulation of rice seed antioxidant stress is disclosed, wherein the nucleotide sequence of the rice SD1 gene is shown in SEQ ID No. 4.

7. The molecular marker of the rice storage-resistant gene SD1 is characterized in that compared with a wild-type gene SD1, a 25bp deletion exists in the second intron of the nucleotide sequence shown in the gene SD1, namely a 25bp fragment deletion of 1262 th to 1286 th wild-type SD1 gene shown in SEQ ID No. 4.

8. The molecular marker of claim 7, which is obtained by PCR amplification of a primer pair having a nucleotide sequence shown in SEQ ID nos. 6 to 7.

9. The use of the molecular marker of claim 7 or 8,

(1) the application in breeding new rice varieties with storability or strong anti-oxidative stress capability;

(2) the application in the rice seed storage-resistant improvement breeding;

(3) screening rice seeds with strong storage resistance or rice seeds with strong oxidation stress resistance, or eliminating the rice seeds with weak storage resistance or rice seeds with weak oxidation stress resistance;

(4) use in the detection of the genotype of a molecular marker according to claim 7 or 8.

10. The application of claim 9, wherein the sample genomic DNA is subjected to PCR amplification by a primer with a nucleotide sequence shown as SEQ ID No.6-7, a PCR amplification product is detected in a full-automatic capillary electrophoresis apparatus, if a characteristic band with a size of 468bp appears in an electrophoresis result, the rice to be detected contains wild type SD1, and the rice seed storage resistance is low; if a characteristic band with the size of 443bp appears in the electrophoresis result, the storage resistance of the rice containing mutant sd1 seeds to be detected is high; and if the electrophoresis result shows the two characteristic bands, the rice to be detected is in a heterozygous type.