KR102130550B1 - CYP90D2 gene derived from rice controlling plant seed size, low temperature germinability and tolerance to abiotic stresses and uses thereof - Google Patents

Abstract

The present invention relates to a rice-derived CYP90D2 (cytochrome P450 90D2) gene for controlling the seed size of plants, low temperature germination and resistance to abiotic stress of plants.

Description

CYP90D2 gene derived from rice controlling plant seed size, low temperature germinability and tolerance to abiotic stresses and uses thereof}

The present invention relates to a plant-derived CYP90D2 (cytochrome P450 90D2) gene and its use to control plant seed size, cold germination and resistance to abiotic stress, and more specifically, consisting of the amino acid sequence of SEQ ID NO: 2. CYP90D2 protein from wild rice ( Oryza rufipogon ); Or CYP90D2 protein derived from cultivated rice ( O. sativa ) consisting of the amino acid sequence of SEQ ID NO: 4 and relates to a gene encoding the same and its use.

Rice is a first-year herbaceous plant belonging to the Hwabon family. It has the largest production after wheat, and about 50% of the world's population uses it as its staple food. Wild rice not only has many useful agricultural traits, but also has various genetic diversity, so it can be said to be an important genetic resource report that can introduce useful genes into cultivation rice. Among the wild rice, the important germplasm, Oryza rufipogon , has an AA genome and many successful attempts have been made to deliver useful genes to cultivated rice due to its wide genetic diversity. In a previous study, it was reported that a quantitative trait loci (QTL) derived from Orija lupipogon was associated with increased production (Xiao et al., (1996) Nature 384:223-224). In addition, cytoplasmic male sterility (CMS) and yield trait related QTL introgression from the perennial ectotype of Oriza lupipogon have been reported. In addition, there are a number of fungal disease-resistant genes such as febrile disease and insect-resistant genes such as rice buds, and QTLs that are involved in abiotic stress such as cold resistance and flame resistance are separated and labeled. The development of a near isogenic line (NIL), along with the advancement of the latest technology, provides an important tool for modern rice breeding programs.

Direct-seeding cultivation is a highly cultivated rice cultivation method for water shortage, labor cost increase, and labor saving. It is highly mechanized in Europe, Australia and the United States, develops early mature varieties, improves nutrition management technology, and controls chemical weeds. With the increase in methods, many farmers from the Philippines, Malaysia, Thailand and India are shifting from cultivation to direct cultivation. The area of direct rice cultivation in Korea increased rapidly to 11,760 ha, which is 11.1% of the total rice cultivation area in 1995, and continues to increase. In addition, in order to secure stable production and reduce labor costs and labor in response to rapid climate change, the importance of research on fostering low-temperature germination systems of rice is increasing, but there are no specific research results yet, with the exception of some results. Most of the direct-cultivated varieties that have been developed and distributed are those grown under cultivation conditions, and it is urgent to supplement the related characteristics of direct-property related to the early seedlings in low-temperature germination and germination conditions. There is a need to develop a molecular breeding technique that establishes a method and uses molecular markers and candidate genes closely related to direct traits for selection.

Seed dormancy and germination control in rice are essential for plant adaptability and survival and are regulated through a complex process of many genes and environmental factors. Plants are not motile, so dormancy and germination that continue in the seed play a critical role in plant survival and are regulated through various complex processes such as environmental signals such as light and temperature. In particular, it has been confirmed through various mutation studies that it is regulated by the complex interaction of phytohormones. Abscisic acid (ABA) plays a role in seed dormancy, germination inhibition, and dormancy during embryo maturation, while gibberellins (GA) act to break the dormancy caused by these ABAs. Ethylene is also known to promote germination. Brassinosteroid (BR) plays an important role in plant growth and development, and plays a role in seed dormancy and promotion of germination. BR partially restores germination of GA biosynthesis and GA sensitive mutations, and BR biosynthesis and reaction mutations germinate. It has been reported to increase susceptibility to ABA in the process.

In rice, cytochrome P450 has a total of 10 groups and a total of 45 families. Among them, the CYP90 group is divided into 4 CYP90A (CPD), CYP90B (DWF4), CYP90C (ROT3) and CYP90D subfamily. The cytochrome P450 90D2 (CYP90D2, hereinafter referred to as OsD2 ) gene derived from rice ( Oryza sativa ) is a gene related to the BR biosynthesis pathway and is known as a gene involved in key growth phenotype as well as regulating seed size (Hong et al., (2003) Plant cell. 15:2900-2910; Li et al., (2013) New Phytolosist. 200:1076-1088). In addition, it has recently been reported as a gene that regulates the number of seeds as well as seed size (Fang et al., (2016) Rice. 9:64).

On the other hand, Korean Registered Patent No. 1250870 discloses a method for producing a transgenic plant with improved cold resistance due to overexpression of a Myb4 gene derived from rice, and a plant therefrom. A method for producing a transgenic plant with a controlled production of biomass or seed using the OsPrMC3 gene and a plant therefor' has been disclosed.However, the seed size, low temperature germination and resistance to abiotic stress of the plant of the present invention are controlled. The CYP90D2 gene derived from rice and its use have not been described.

The present invention has been derived by the above-mentioned needs, and the present inventors have obtained BC ₃ F ₇ homogeneous line (NIL, CYP90D2 gene introduction from wild rice) and repeated parent (Hwaseong rice) obtained by crossing between Hwaseong rice and wild rice ( Oryza rufipogon ). ) As a result of examining the agricultural traits of liver, it was confirmed that the seed size of NIL was significantly increased compared to Hwaseong rice, and the resistance to cold germination, osmotic and salt stress was significantly increased. As a result of finding candidate genes involved in the trait difference, fragments of wild rice were detected between RM10313 and CRM37 of chromosome 1 in the genetic background of Hwaseong rice in NIL, and 7 candidate genes in the region between the markers It was confirmed, among these, the variation of amino acid residues was observed in the CYP90D2 (cytochrome P450 90D2) gene according to the base substitution between Hwaseong and wild rice. The present inventor in order to clarify the features of the CYP90D2 gene, dongjinbyeo (Oryza sativa cv. Dongjin) the CYP90D2 gene of T-DNA the inserted and promote the expression of the mutated and CYP90D2 gene expression is suppressed in the CYP90D2 gene mutant plants of the As a result of comparative analysis of resistance to cold germination, osmotic and salt stress, mutant plants with enhanced expression of CYP90D2 gene have increased cold germination and resistance to abiotic stress, similar to wild rice and NIL. The present invention was completed by confirming that the mutant plants whose CYP90D2 gene expression was suppressed were reduced compared to wild rice and NIL, and that germination was reduced and seed size was also reduced.

In order to solve the above problems, the present invention is composed of the amino acid sequence of SEQ ID NO: 2, CYP90D2 (cytochrome P450) that regulates the seed size, cold germination and resistance to abiotic stress of plants derived from wild rice ( Oryza rufipogon ). 90D2) protein and a gene encoding the CYP90D2 protein.

In addition, the present invention provides a recombinant vector containing the gene.

In addition, the present invention provides a host cell transformed with the recombinant vector.

In addition, the present invention comprises the steps of transforming plant cells with a recombinant vector comprising a CYP90D2 protein coding gene derived from rice consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4; And re-differentiating the transformed plant from the transformed plant cell. The present invention provides a method for producing a transformed plant in which the seed size of the plant, cold germination and resistance to abiotic stress are controlled.

In addition, the present invention provides a transformed plant and its transformed seeds whose seed size, cold germination and resistance to abiotic stress prepared by the above manufacturing method are controlled.

In addition, the present invention comprises the steps of transforming plant cells with a recombinant vector containing a CYP90D2 protein coding gene derived from rice consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 to control the expression of the CYP90D2 protein coding gene, a plant body. It provides a method to control the seed size, low temperature germination and resistance to abiotic stress.

In addition, the present invention comprises a composition for controlling the seed size of a plant, cold germination and resistance to abiotic stress, comprising a CYP90D2 protein coding gene derived from wild rice consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 as an active ingredient. to provide.

The CYP90D2 (cytochrome P450 90D2) gene derived from wild rice ( Oryza rufipogon ) of the present invention is involved in the regulation of resistance to cold germination and abiotic stress, as well as seed size, which is an important agricultural trait. It can be useful for breeding new varieties of rice that are resistant to abiotic stress, such as, and can be useful for purifying japonica rice.

1 is a schematic diagram of the development of the BC ₃ F ₇ NIL (TR5) population and the NIL (TR5) population and the Hwaseong rice mating group (F ₃ ).
FIG. 2 is a map of regions introduced into chromosome 1 of BC ₃ F ₇ NIL (TR5), where white and black regions indicate the same type of Hwaseong rice and isozyme oryza rufipogon sequences, respectively. The gray hatch marks the site where the chromosomes cross, and is a picture of the genes included in the region.
3 is a result of a comparison hwaseongbyeo and ducks chair Rs pogon (O. rufipogon) CYP90D2 (cytochrome P450 90D2) between gene sequences. OsD2-00, -01 and -02 are schematic diagrams of three transcripts of OsD2 ( O. sativa CYP90D2) gene, white box means 5'or 3'untranslated region (UTR), black box and black box The solid lines between each represent exons and introns, and the five single nucleotide polymorphisms (SNPs) and arrows indicate base substitutions that caused missense mutations.
FIG. 4 shows O. sativa cv. Hwaseong and O. rufipogon , O. brachyantha , Corn ( Zea mays ), Sorghum bicolor , Capsicum annuum ), Phylogenetic tree (A) and amino acid sequence alignment result (B) of CYP90D2 protein of Arabidopsis ( Solanum tuberosum ) and Arabidopsis CYP90D2 family proteins (AtCYP90C1 and AtCYP90D1).
5(A) shows germination rates of HS (Hwaseong rice), Rufi ( O.rufipogon ), and TR5 (NIL) at 28° C., which are germination temperatures, and (B) is a graph showing germination rates at 13° C. under low temperature conditions. .
6A shows germination rates of HS (Hwaseong rice), Rufi ( O.rufipogon ), and TR5 (NIL) at 500 mM mannitol, and (B) is a graph showing germination rates at 250 mM sodium chloride.
7 is a low-temperature condition (A), 500 mM mannitol (B), 250 mM sodium chloride (C) conditions HS (Hwaseong rice) and Rufi ( O.rufipogon ), TR5 (NIL) of the OsD2 gene expression pattern by time analysis It is a graph.
8 is a graph analyzing the expression of genes related to the pathway of brassinosteroid biosynthesis in HS (Hwaseong rice), Rufi ( O.rufipogon ), and NIL strain TR5.
9 is a graph analyzing OsD2 gene expression of Dongjin rice (DJ), OsD2 gene suppression mutant (D2/KO) and OsD2 gene expression increasing mutant (D2/OE).
10 is a photograph and graph analyzing the grain size of Dongjin rice (DJ), Hwaseong rice (HS), NIL (TR5), OsD2/KO ( OsD2 gene suppression mutant) and OsD2/OE ( OsD2 gene expression increase mutant) to be. n=10, *: P <0.05, **: P <0.01.
11 is a graph showing the germination rate at 13° C. under low temperature conditions of Dongjin rice (DJ), D2/KO ( OsD2 gene suppression mutant) and D2/OE ( OsD2 gene expression increase mutant).
12 and 13 are graphs analyzing the expression of genes related to the brassinosteroid biosynthesis signal transduction pathway of Dongjin rice (DJ), D2/KO ( OsD2 gene suppression mutant) and D2/OE ( OsD2 gene expression increase mutant).

In order to achieve the object of the present invention, the present invention is composed of the amino acid sequence of SEQ ID NO: 2, wild rice ( Oryza rufipogon ) CYP90D2 ( regulating the seed size, cold germination and resistance to abiotic stress) cytochrome P450 90D2) protein.

The range of the wild rice-derived CYP90D2 protein according to the present invention is a protein having an amino acid sequence represented by SEQ ID NO: 2, a CYP90D2 protein derived from O. sativa cv. Hwaseong, a cultivated rice consisting of the amino acid sequence of SEQ ID NO: 4. And 3 amino acid residues, specifically, amino acid glycine (Gly), leucine (Leu) and methionine of the 26th, 268th and 275th residues in the amino acid sequence of SEQ ID NO: 2 (CYP90D2 protein derived from wild rice). (Met) is identified as Serine, Proline and Valine in Hwaseong rice, respectively (FIG. 3).

As used herein, the term "low temperature germability" refers to the ability to germinate even at a slightly lower temperature than germination temperature. In the case of rice, a low temperature germination property is required for a crude or direct-cultivated variety.

The present invention also provides a gene encoding the CYP90D2 protein derived from wild rice. The gene encoding the CYP90D2 protein derived from wild rice of the present invention may include the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a recombinant vector comprising a gene encoding the CYP90D2 protein derived from wild rice.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the natural form of the cells, either in sense or antisense form. Recombinant cells can also express genes found in natural cells, but these genes have been modified and reintroduced into cells by artificial means.

The term "vector" is used to refer to a DNA fragment(s), nucleic acid molecules that are delivered into a cell. The vector replicates DNA and can be reproduced independently in the host cell. The term "carrier" is often used interchangeably with "vector". The term “expression vector” refers to a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence essential to express a coding sequence operably linked in a particular host organism.

Vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of progressing transcription (eg, pLλ promoter, Trp promoter, Lac promoter, T7 promoter, Tac promoter, etc.), It is common to include a ribosome binding site for initiation of translation and a transcription/detox termination sequence. When Escherichia coli is used as a host cell, the promoter and operator site of the E. coli tryptophan biosynthetic pathway, and the leftward promoter of phage λ (pLλ promoter) can be used as a regulatory site.

On the other hand, vectors that can be used in the present invention include plasmids often used in the art (e.g., pSC101, ColE1, pBR322, pUC8/9, pHC79, pGEX series, pET series and pUC19, etc.), phage (e.g., λgt4·λB , λ-Charon, λΔz1 and M13, etc.) or viruses (eg, SV40, etc.). On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is a host, a promoter derived from the genome of a mammalian cell (eg, a metallothionine promoter) or a promoter derived from a mammalian virus (eg, adeno) Late virus promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and HSV's tk promoter) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

The recombinant vector of the present invention is preferably a plant expression vector.

A preferred example of a plant expression vector is a Ti-plasmid vector capable of transferring part of itself, the so-called T-region, to a plant cell when present in a suitable host such as Agrobacterium tumefaciens . Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences into plant cells, or protoplasts, into which new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the gene according to the invention into a plant host are viral vectors, such as those that can be derived from double-stranded plant viruses (e.g. CaMV) and single-stranded viruses, gemini viruses, etc. For example, it can be selected from incomplete plant viral vectors. The use of such vectors can be advantageous, particularly when it is difficult to properly transform plant hosts.

The expression vector preferably contains one or more selectable markers. The marker is a nucleic acid sequence having a property that can be selected by a chemical method, and all genes capable of distinguishing the transformed cell from the non-transformed cell correspond to this. Examples include herbicide resistance genes such as glyphosate or phosphinothricin (phosphinothricin), antibiotics such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol Resistance genes, but are not limited thereto.

In the plant expression vector according to the present invention, the promoter may be a small rubber particle-associated protein (SRPP), CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter" refers to the region of the DNA upstream from the structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. "Plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental status or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit the possibility of selection.

In the plant expression vector according to the present invention, a terminator may be used as a conventional terminator, for example, nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, and agrobacter There are, but are not limited to, terminators of the Octopine gene of Lyum tumeric faciens.

The present invention also provides a host cell transformed with the recombinant vector.

The host cell capable of continuously cloning and expressing the vector of the present invention can be any host cell known in the art, including microalgae, microorganisms, etc., for example, E. coli JM109, E. coli BL21, Bacillus strains such as E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis , B. thuringiensis , And enteric bacteria and strains such as Salmonella typhimurium , Serratia marcescens , and various Pseudomonas species.

In addition, when transforming the vector of the present invention into eukaryotic cells, as host cells, yeast (eg, Saccharomyce cerevisiae ), insect cells, human cells (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7) , 293, HepG2, 3T3, RIN and MDCK cell lines) and plant cells, and the like, preferably plant cells.

The method of transporting the vector of the present invention into a host cell, when the host cell is a prokaryotic cell, CaCl ₂ method, one method (Hanahan, D., J. Mol. Biol., 166: 557-580 (1983)) And electroporation methods. In addition, when the host cell is a eukaryotic cell, the vector is injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene bombardment. Can.

The present invention also

Transforming plant cells with a recombinant vector comprising a CYP90D2 protein coding gene derived from rice consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4; And

Re-differentiating the transformed plant from the transformed plant cells; provides a method for producing a transformed plant having a controlled seed size, low temperature germination and resistance to abiotic stress.

In the production method according to an embodiment of the present invention, the CYP90D2 protein is derived from wild rice ( Oryza rufipogon ) consisting of the amino acid sequence of SEQ ID NO: 2, or cultivated rice ( Oryza sativa ) consisting of the amino acid sequence of SEQ ID NO: 4 It may be derived. The CYP90D2 protein coding gene derived from wild rice may be composed of the nucleotide sequence of SEQ ID NO: 1, and the CYP90D2 protein coding gene derived from cultivated rice may be composed of the nucleotide sequence of SEQ ID NO: 3, but is not limited thereto.

Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have a period of regeneration and/or tissue culture. Transformation of plant species is now common for plant species including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. The methods include calcium/polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection to plant elements, particle impact method (DNA or RNA-coated) particles of various plant elements, infiltration of plants or traits of mature pollen or vesicles. Agrobacterium tumerfaciens mediated gene transfer by conversion may be appropriately selected from infection with (incomplete) virus and the like. A preferred method according to the invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector technology as described in EP A 120 516 and US Pat. No. 4,940,838.

The method of the present invention comprises the step of transforming a plant cell with the recombinant vector according to the present invention, wherein the transformation can be mediated by A. tumefiaciens . In addition, the method of the present invention includes the step of re-differentiating the transformed plant from the transformed plant cell. As a method for re-differentiating a transgenic plant from a transgenic plant cell, any method known in the art can be used.

Any "plant cell" used for transformation of a plant may be any plant cell. The plant cells can be any form of cultured cells, cultured tissue, cultured organs or whole plants, preferably cultured cells, cultured tissue or cultured organs, and more preferably cultured cells. "Plant tissue" is a tissue of a differentiated or undifferentiated plant, including, but not limited to, fruits, stems, leaves, pollen, seeds, various types of cells used for cancer tissue and culture, ie single cells, protoplasts (protoplast), shoots and callus tissue. The plant tissue may be in planta or organ culture, tissue culture or cell culture.

In the method for producing a transgenic plant according to an embodiment of the present invention, when the expression of the CYP90D2 protein coding gene derived from rice is increased in the transfected plant cell, the seed size, cold germination and non-living properties of the non-transformed plant are increased. Transgenic plants with increased resistance to red stress can be produced. The abiotic stress may be salt stress or osmotic stress, but is not limited thereto.

The present invention also provides a transformed plant and its transformed seeds whose seed size, cold germination and resistance to abiotic stress, produced by the above production method are controlled.

As described above, the transgenic plant of the present invention comprises CYP90D2 protein derived from wild rice consisting of the amino acid sequence of SEQ ID NO: 2 that regulates seed size, cold germination and resistance to abiotic stress; Or CYP90D2 protein derived from cultivated rice consisting of the amino acid sequence of SEQ ID NO: 4; When the expression of the coding gene is increased, it is characterized in that the seed size, cold germination and resistance to abiotic stress are increased compared to the non-transformant.

In one embodiment of the present invention, the plant is a monocotyledonous plant such as rice, barley, wheat, rye, corn, sugar cane, oat, onion, or Arabidopsis thaliana, potato, eggplant, tobacco, pepper, tomato, burdock, mugwort, It can be dicotyledonous plants such as lettuce, bellflower, spinach, beetroot, sweet potato, celery, carrot, buttercup, parsley, cabbage, cabbage, fresh radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, green bean, kidney bean, pea , Preferably it may be a rice plant, but is not limited thereto.

The present invention also includes the step of transforming plant cells with a recombinant vector comprising a CYP90D2 protein coding gene derived from rice consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 to control the expression of the CYP90D2 protein coding gene, a plant body. It provides a method to control the seed size, low temperature germination and resistance to abiotic stress.

In the method for regulating seed size, cold germination and resistance to abiotic stress according to an embodiment of the present invention, when the expression of the CYP90D2 protein coding gene derived from rice is increased, seed size, cold germination and non-living Resistance to red stress (salt stress or osmotic stress) can be increased.

The present invention also provides a composition for controlling the seed size, cold germination, and resistance to abiotic stress of a plant, comprising the rice-derived CYP90D2 protein coding gene consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 as an active ingredient. do. The composition of the present invention is CYP90D2 protein derived from wild rice consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient; Or CYP90D2 protein derived from cultivated rice consisting of the amino acid sequence of SEQ ID NO: 4; By transforming plant cells with a gene encoding a recombinant vector containing the gene or the gene, plant seed size, cold germination and resistance to abiotic stress can be controlled.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. Plant material and QTL analysis

The near isogenic line (NIL) used in the present invention was a BC ₃ F ₇ 96 line obtained from cross-breeding between Oryza sativa cv. Hwaseong and O. rufipogon (FIG. One). Among the 96 strains, cold germination-related QTL is detected in chromosomes 1, 3, 4, 10, and 11, and in particular, TR5 strains identified as having cold germination properties such as O. rufipogon are selected. Germination rate at low temperature and genotyping were performed. As a result of analyzing the genotype of TR5, fragment incorporation of O. rufipogon was confirmed. As a result of variance analysis, ltg1 (low temperature growth 1) that regulates low temperature germination at 32.1 Kb between RM10313 and CRM37 was analyzed. , For the detection of candidate genes, the base sequence through the database of RAP (http://rapdb.dna.affrc.go.jp/index.html, http://shigen.nig.ac.jp/rice/oryzabase/) The candidate genes were analyzed by comparison (FIGS. 2 and 3 ).

The DNA of rice was extracted from leaf tissue using the method of Causse et al. (1994, Genetics, 138:1251-1274). Genotyping was performed in 28 F ₃ mating groups of TR5 and Hwaseong rice, using 10 markers based on polymorphism between TR5 and Hwaseong rice sequences. PCR was performed according to the method of Yoon et al. (2006, Theoretical and applied genetics, 112(6), 1052-1062), and the PCR product was separated using 3% Metaphor agarose or 4% polyacrylamide gel.

Single marker set for genotype analysis and phylogenetic selection Marker chromosome Forward primer (SEQ ID NO) Reverse primer (SEQ ID NO) CRM13 One CCAGATACATTGTACTCCCTCCA (33) ATATAAGGCATGCGCACGTT (34) CRM15 One GCTGGTTGGTTGTCAGCTTT (35) CGTCACATCGTCACAATTTC (36) CRM 2-1 One CCATCTGGTTGGAATATTG (37) TCAATCAGTAAACTGTTGTG (38) CRM22 One CCTCTGCAGTCAAAGTCACG (39) TGCATGTGCCAGGTTCTAAA (40) CRM23 One CAACTCGACCGCATTTTACA (41) TCACATGTTACGTGTCACTGATT (42) CRM37 One CACCCAACATCGAGCACTAA (43) ACGGAGGGAGTACGTGACAA (44) RM10284 One TCTGGAGTAGCCATTCAAGAAGC (45) GACAGCAAGAAATCCCGACTAGG (46) RM10313 One ACTTACACAAGGCCGGGAAAGG (47) TGGTAGTGGTAACTCTACTCCGATGG (48) RM220 One GGAAGGTAACTGTTTCCAAC (49) GAAATGCTTCCCACATGTCT (50) RM6277 One TGTCCTTACCCTTGTTTCGC (51) GTGTGTTCCAACAGTGGTGG (52)

Quantitative trait loci (QTL) was analyzed by single-marker analysis, and confirmed by QTL when the phenotype showed significant association with the genotype of the SSR marker by ANOVA (p<0.05). . The observed phenotypic variation was confirmed by the coefficient of determination (R ² ), and statistical analysis was performed using Minitab 16.2.4 software.

2. Field cultivation and characterization

In 2016, 27-day-old seedlings of Hwaseong rice and NIL (TR5) were transferred to the Chungnam National University test packaging. The field experiment was performed 3 times in a randomized block design. Planting and thermal spacing between plants were 15 cm and 30 cm, respectively. Results were collected by selecting 10 plants from the middle of each row and recording the following characteristics: plant height, number of spears, number of spikelets per panicle (SPP), grain length, grain length width) and 10 grain weights/plant. The plant length was measured from the surface to the tip of the inflorescence (panicle tip), the number of mulling was calculated as the number of mulling per plant, SPP was measured as the average of three major inflorescences per plant, and the grain length and width per plant. Twenty grains (brown rice) were measured using a 150 mm Vernier caliper (Mitutoyo Corp., Japan). The weight of 100 seeds (brown rice) harvested from 10 individuals was measured in 3 replicates and the average value was used.

3. Low temperature germination test

In the low temperature germination experiment, Hwaseong rice, Ori rufipogon , and the myotropic system TR5 were germinated, respectively, and treated at 28°C and 13°C for low temperature conditions for 9 days. It was performed in at least 3 repetitions, and treated with 5 ml of sterile water in a 60 mm petri dish to analyze when the roots appeared more than 2 mm as germination.

4. Analysis of transcript levels of candidate genes

Total RNA was used by plant RNA Purification Reagent (Invitrogen, USA) in the treatment of 0, 24, 48, and 72 hours of incubation with parental Hwaseong rice, O. rufipogon , and myogenic system TR5 at 13±2℃. And extracted. The extracted RNA (1 μg) was synthesized by cDNA using PrimeScript High Fidelity RT-PCR Kit (TaKaRa, Japan), and the expression pattern of OsD2 ( O. sativa cytochrome P450 90D2) gene was analyzed. In addition, the T-DNA is inserted in OsD2 gene by inhibiting the expression of OsD2 gene inhibition (suppressor) mutant (hereinafter, OsD2 / KO or D2 / KO) and the T-DNA enhancer (enhancer) into the OsD2 gene OsD2 In the enhancer mutant (hereinafter referred to as OsD2/OE or D2/OE) with increased gene expression, the expression of genes related to brassinosteroid (BR) biosynthesis and signal transduction was analyzed. QRT-PCR was performed using the primer set disclosed in Table 2 and expression change was calculated using the ΔΔCt (Livak and Schmittgen, (2001) Methods 25:402-408) method.

5. Phylogenetic analysis of OsD2 protein based on amino acid sequence

Download the amino acid sequence of OsD2 protein from NCBI (http://www.ncbi.nlm.nih.gov/guide) and RAP (http://rapdb.dna.affrc.go.jp) and align the sequence using ClustalW Was performed, and a phylogenetic tree was prepared using MegAlign (FIG. 4).

6. Brassinosteroid (BR) biosynthesis and signal transduction pathway related gene expression analysis

Genes related to BR signaling in both parent and TR5, T-DNA insertion mutants OsBAK1 ( Oryza sativa BRI1-ASSOCIATED RECEPTOR KINASE1 ), OsBRI ( O. sativa BRASSINOSTEROID-INSENSITIVE1 ), OsILI4 ( O. sativa INCREAE LEAFINCLINATION 4 ), OsBZR1 ( O Expression of sativa BRASSINAZOLE RESISTANT1 ), OsGSK2 ( O. sativa Shaggy-like kinase GSK2 ), OsGSK3 ( O. sativa glycogen synthase kinase 3 ) and OsDLT ( O. sativa DWARF AND LOW-TILLERING ) was analyzed. In addition, BR biosynthesis related genes OsD2 (O. sativa DWARF2; CYP90D2 ), OsBRD1 ( O. sativa BR-DEFICIENT DWARF1 ), OsBr6ox ( O. sativa BRASSINOSTEROID-6-OXIDASE1 ), OsD11 ( O. sativa DWARF11 ) and OsCPD1 ( O The expression of the sativa Constitutive Photomorphogenesis and Dwarf ) gene was also analyzed. All experiments were performed in at least 3 repetitions using 3 samples in each condition, and the primer set information is shown in Table 2. Expression changes were calculated using the ΔΔCt method.

Example 1. Phenotypic analysis of NIL

As a result of phenotype comparison of Hwaseong rice and NIL (TR5), a large difference was observed in 4 of 6 traits as shown in Table 3 below. Plant height was confirmed to be longer than that of Hwaseong rice in NIL, and NIL showed significant difference in number of seeds, seed length, and seed weight. Through this, it was possible to infer that a fragment of O. rufipogon has a gene related to plant growth and development (Table 3).

Comparison of agricultural characteristics between Hwaseong rice and NIL Agriculture Mean ± standard deviation Significance of (A) and (B) Hwaseong Rice (A) NIL (B) Extra long (cm) 96.81±1.40 100.36±1.50 ** Number of minutes 12.18±1.07 14.27±1.42 ** SPP (Spikelet per panicle) 122±10.22 121.38±7.62 NS Seed length (mm) 6.83±0.28 7.28±0.18 * Seed width (mm) 2.96±0.07 2.93±0.06 NS Seed weight (g/plant) 26.50±2.58 28.25.0±2.82 ** *, **: Significance P <0.05, P <0.01, NS: not significant.

Example 2. Low temperature germination assay of myopathic system with parental and low temperature germination

The germination rates of Hwaseong rice, O. rufipogon , both parents, and myogenic strain TR5, which has excellent low-temperature germination, were investigated at low and low temperatures. As a result, the parents, Hwaseong rice (HS), Orija lufipogon (Rufi), and TR5, germinated more than 90% within 2 days after sowing at the proper temperature of rice germination at 28℃, and showed germination rate of 100% on the 3rd day, but at low temperature conditions. At 13℃ phosphorus, Hwaseong rice began to germinate on the 6th day after sowing, and showed a germination rate of 75% only after 9 days, whereas Oriza Rufigon showed a germination rate of 38% on the 4th day of sowing and 98 days on the 9th day after sowing. % Germination (FIG. 5). The NIL strain TR5 also began to germinate on the 4th day after sowing (5%), germinating at least 61% after 6 days and 91% after 9 days of sowing. Through these results, it was inferred that a fragment of O. rufipogon had a gene associated with cold germination at the translocated locus.

Example 3. Analysis of abiotic stress resistance of myogenic system for promoting low temperature germination

NIL of typical low temperature germination qLTG3-1 has been reported to exhibit low temperature germination as well as resistance under high temperature, high salt and high osmotic conditions (Fujino et al, (2008) PNAS 105(34):12623-12628). This shows that low-temperature germination is closely related to various other abiotic stresses. Therefore, the present inventors have investigated whether the TR5 strain shows resistance to these abiotic stresses.

In the stress treatment, the parents, Hwaseong rice (HS), Oriza lupipogon (Rufi), and TR5, were treated with 250 mM sodium chloride or 500 mM mannitol at 28° C., and germination rates for 10 days were examined. As a result, in the treatment with 500 mM mannitol, germinated rice began germinating after 48 hours after invasion, showing a germination rate of 40% on the 4th day, while Oriza lupipogon and TR5 showed germination rates of 90%, resulting in an osmotic stress induced by mannitol. It was confirmed to show resistance (Fig. 6A). Also, in the treatment with 250 mM sodium chloride, Hwaseong rice showed germination rate of 18% on the 3rd day after invasion, whereas Oriza lupipogon showed 89% germination rate, TR5 showed 40% germination rate, and it was confirmed that TR5 improved salt resistance compared to Hwaseong rice. (Fig. 6B).

Example 4. Selection of cold germination candidate genes

Based on data accessible from the sequence annotation database (http://www.gramene.org), 7 genes in QTL defined as 32.1 kb region between RM10313 and CRM37 ( LOC_Os01g10040, LOC_Os01g10050, LOC_Os01g10060, LOC_Os01g10070, LOC_Os01g10080, LOC90 And LOC_Os01g10010 ) were predicted (FIG. 3 ). The functional annotations of the seven candidate genes are as follows: LOC_Os01g10060, LOC_Os01g10070, LOC_Os01g10080 and LOC_Os01g10100 were classified as uncharacterized proteins, and the remaining 3 genes LOC_Os01g10040 are CYP90 D2 (cytochrome P450), LOC_Odependase , LOC_Os01g10090 was shown to encode Pentatricopeptide, respectively.

As a result of comparing the sequences of Hwaseong rice and Oris rufipogon , SNP of C (Hwaseong rice)/T ( Oris rufipogon ) was identified at the 1,485 bp coding sequence of LOC_Os01g10050 , but did not cause amino acid mutation. It was confirmed that LOC_Os01g10090 also could not find the amino acid mutation.

On the other hand, in the LOC_Os01g10040 gene (CYP90 D2, hereinafter, OsD2 ), 5 SNPs were found at the 1,473 bp coding sequence region ('OsD2-00' in FIG. 3), and the 76th base in the first exon was A (Hwaseong rice)/ G (oriza lupipogon) mutation, serine (Ser) was changed to glycine (Gly) amino acid mutation, the 171th base was changed to A/G, but no amino acid residue mutation. In addition, in the 4th exon, the 803th base was mutated to C/T, and the proline (Pro) was transformed into leucine, and the 823th base was mutated to G/A, and valine (Val) was changed to methionine (Met). . And the nucleotide variation from 7th exon to C/T did not cause amino acid change (Fig. 3). In addition, a transcript of known 747 bp ('OsD2-01' in FIG. 3) and a new transcript of 840 bp ('OsD2-02' in FIG. 3) were also isolated. Therefore, the OsD2 gene was selected as a candidate gene involved in the most potent cold germination.

Example 5. Low-temperature germination enhancement in myogenic system OsD2 Gene expression analysis

In order to analyze the expression of the low temperature germination candidate gene, total RNA was isolated using a treatment medium in which both parents and TR5 were incubated at 13°C under low temperature conditions for 0, 24, 48 and 72 hours, and cDNA was synthesized to express the OsD2 gene. Was analyzed (Fig. 7). The OsD2 gene rapidly increased from 24 hours after invasion in Rufi (Orisa lupipogon) and TR5 at 13°C under low temperature conditions, whereas it was confirmed that the expression level of HS (Hwaseong rice) was very low and the expression level did not change. On the other hand, in HS, expression increased after 72 hours, showing different expression patterns from Rufi and TR5 (Fig. 7A). In addition, HS, Rufi, and TR5, both parents, were incubated at 28° C. in 250 mM sodium chloride or 500 mM mannitol, respectively, and then the expression of the OsD2 gene was analyzed for 72 hours. As a result, in the condition of 250 mM sodium chloride, HS increased the expression of the OsD2 gene 72 hours after invasion , whereas in the case of Rufi and TR5, the expression of the OsD2 gene rapidly increased from 24 hours of invasion (FIGS. 7B and 7C). Through this, it was found that OsD2 gene is involved in low temperature germination and resistance to abiotic stress.

Example 6. Analysis of the expression of brassinosteroid-related genes in the homogeneous system for promoting low temperature germination

OsD2 gene is a BR C-3 oxidation step in the biosynthetic pathway of brassinosteroid (BR), namely 6-DeoxoTE (6-deoxoteasterone) to 6-Deoxo3DT (3-Dehydro-6-deoxoteasterone), TE (teasterone) to 3DT ( 3-Dehydroteasterone). Genes related to BR signal transduction in both parents and TR5 OsBAK1, OsBRI, OsILI4, OsBZR1, OsGSK2, OsGSK3, and OsDLT and biosynthetic genes to identify changes in BR signaling and biosynthesis-related genes through the role of C-3 oxidase The expressions of OsD2, OsBRD1, OsBr6ox, OsD11 and OsCPD1 genes were analyzed.

BR signaling is first regulated by the amount of BR in the cytoplasm, which, through several complex steps, regulates gene expression in two major ways. First, when the amount of BR in the cytoplasm is sufficient, phosphorylation occurs by combining two receptor kinase OsBAK1 and OsBRI that detect signals in the cell membrane with BR, which phosphorylates BSU1 and moves to the nucleus, BIN2 such as OsILI4, OsGSK2, OsGSK3 It binds with proteins to induce dephosphorylation. Such dephosphorylation strongly inhibits kinase activity of OsILI4, OsGSK2, OsGSK3, and OsDLT, and thus it is difficult to inhibit BZR1/BZR2 through phosphorylation, resulting in transcription of BR-induced genes such as OsDLT. It is known to regulate cell proliferation, division, differentiation, etc., and consequently to control plant morphogenesis, growth and development. On the other hand, when the amount of BR in the cytoplasm is small, the two kinase functions of BIN2 proteins such as OsILI4, OsGSK2, OsGSK3, and OsDLT are activated because the two OsBAK1 and OsBRI that detect signals cannot bind to BR and BSU1 cannot be phosphorylated. Through the phosphorylation of the transcription factor of BZR1/BZR, transcription of BR-biosynthetic genes is induced as a result, BR biosynthesis occurs, and the amount of BR in the cell is regulated.

As a result of investigating the expression of genes related to BR signaling in both parents and TR5, the expression of OsBAK1 and OsBRI was higher in HS than in HS in Rufi and TR5, and the expression of kinases such as OsGSK2 and OsGSK3 was also high (Fig. 8). However, the expression level of OsILI4 and the transcription factor OsBZR1 did not show a significant difference. However, the representative BR- inducing gene OsDLT was expressed higher than HS in Rufi and TR5. Based on this, it was judged that the content of BR in Rufi and TR5 was higher than that of HS, and that it would show a large difference from Hwaseong rice in controlling growth and development of plants. In particular, the expressions of BR biosynthesis related genes OsD2, OsBRD1, OsBr6ox, OsD11, and OsCPD1 were also expressed higher in Rufi and TR5 than in Hwaseong rice, suggesting that the BR content in Rufi and TR5 was higher.

Example 7. T-DNA mutant OsD2 Gene expression analysis

The T-DNA insertion line of the LOC_Os01g10040 gene was distributed. Through the analysis of gene expression level of pre-distributed strains, the suppressor (suppressor) mutant (D2/KO or OsD2/KO) and OsD2 gene whose expression of OsD2 gene is inhibited by 80% or more compared to control ( Dongjin rice, DJ) By the T-DNA enhancer inserted in the selection, an increase mutant (D2/OE or OsD2/OE) whose expression of the OsD2 gene was increased 96-fold or more compared to the control was selected (FIG. 9). As a result of comparing and analyzing the seed characteristics of the selected D2/KO and D2/OE mutants with the control, it was confirmed that the D2/OE mutants increased in grain length and grain width than D2/KO. Could. Therefore, it was confirmed that the OsD2 gene is also involved in seed size (FIG. 10).

Example 8. OsD2 Cold germination assay of the gene's T-DNA mutant

To confirm whether the OsD2 gene confers low temperature germination, the low temperature germination properties of D2/KO and D2/OE mutants were tested (FIG. 11). As a result, the control (DJ) showed a germination rate of 45% on the 8th day, starting with the germination rate of 14% on the 5th day and 18% on the 6th day, and the D2/KO also began to germinate at around 20% on the 6th day, similar to the control. On day 8, the germination rate was 53%, whereas the D2/OE mutant showed germination rates of 35% on day 5 and 90% on day 8. Through this, it was confirmed that the OsD2 gene is involved in cold germination.

Example 9. OsD2 Analysis of the expression of the brassinosteroid-related gene of the gene's T-DNA mutant

In order to investigate changes in BR signaling and biosynthesis related genes through CD oxidase role of OsD2 , expressions of BR signaling and biosynthesis related genes were analyzed in D2/KO and D2/OE mutants.

As a result of investigating the expression of the gene related to BR signaling in D2/KO, the expression of OsBAK1 and OsBRI was lower than that of Dongjin rice, and the expression levels of OsGSK2 and OsGSK3 were lower than those of Dongjin rice, but the expression of OsILI4 was highest in D2/KO. However, the expression of the transcription factor OsBZR1 did not show a significant difference in the D2/KO and D2/OE mutants. However, the representative BR- induced gene, OsDLT, was the lowest in D2/KO and highly expressed in the D2/OE mutant. In particular, the expressions of BR biosynthesis related genes OsD2 , OsBRD1 , OsBr6ox , OsD11 , and OsCPD1 were also the highest in D2/OE mutants (Figs. 12 and 13).

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> CYP90D2 gene derived from rice controlling plant seed size, low temperature germinability and tolerance to abiotic stresses and uses thereof <130> PN19302 <160> 52 <170> KoPatentIn 3.0 <210> 1 <211> 1473 <212> DNA <213> Oryza rufipogon <400> 1 atggtgtcgg cggccgccgg ttgggcggcg ccggcgtttg cggtcgccgc cgtggttatt 60 tgggtggtgc tgtgtggtga gctcctgcgg aggcggcggc gtggtgcagg cagcggcaag 120 ggggacgcgg cggcggcggc gcgcctcccg ccggggagct tcgggtggcc ggtggtgggc 180 gagacgctgg agttcgtgtc gtgcgcctac tcgccgcgcc ccgaggcgtt cgtcgacaag 240 cgccggaagc tgcacgggag cgcggtgttc aggtcgcacc tgttcgggtc ggcgacggtg 300 gtgacggcgg acgcggaggt gagccggttc gtgctgcaga gcgacgcgcg ggcgttcgtg 360 ccgtggtacc cgcggtcgct gacggagctg atgggcaagt cctccatcct cctcatcaac 420 ggcgcgctcc agcgacgcgt ccacggcctc gtcggcgcct tcttcaagtc ctcccacctc 480 aagtcccagc tcaccgccga catgcgccgc cgcctctccc ccgccctctc ctccttcccc 540 gactcctccc tcctccacgt ccagcacctc gccaagtcgg tggtgttcga aatcctggtg 600 aggggcctga tcgggctgga ggcaggggag gagatgcagc agctgaagca gcaattccag 660 gaatttattg tcggcctcat gtccctcccc attaagctgc ctggcactag gctctacaga 720 tcactccagg ccaagaagaa gatggcgagg ctgatacaga ggatcatccg ggagaagagg 780 gcaaggaggg ccgccgcctc gctgccgcgg gacgccatcg acatgctcat cggagacggc 840 agcgatgagc tcaccgacga gctcatctcc gacaacatga tcgacctcat gatccccgcc 900 gaggactccg tcccggtgct catcacgctc gccgtcaagt tcctcagcga gtgccctctc 960 gccctgcacc aactggaaga ggagaacata cagctcaaga ggcgaaaaac cgacatgggt 1020 gagaccttgc aatggacaga ctacatgtca ttgtcattca cacaacatgt gataacagag 1080 acgctgcggt tgggcaacat catcggtggg atcatgcgca aggcggtgcg cgacgtcgag 1140 gtgaaggggc acctcatccc caaggggtgg tgcgtgtttg tgtacttccg gtcagtccac 1200 ctcgatgata cgctctacga tgagccctac aagttcaacc catggaggtg gaaggagaag 1260 gacatgagca atggcagctt cactcctttt ggtggtgggc agaggctgtg cccaggcctg 1320 gatctggcca ggctggaagc ttccatcttc cttcatcact tggtcaccag cttcaggtgg 1380 gtggcggagg aggaccacat cgtcaacttc cccaccgtgc ggctcaagcg gggcatgccc 1440 atcagggtca ccgccaagga ggacgacgac tag 1473 <210> 2 <211> 490 <212> PRT <213> Oryza rufipogon <400> 2 Met Val Ser Ala Ala Ala Gly Trp Ala Ala Pro Ala Phe Ala Val Ala 1 5 10 15 Ala Val Val Ile Trp Val Val Leu Cys Gly Glu Leu Leu Arg Arg Arg 20 25 30 Arg Arg Gly Ala Gly Ser Gly Lys Gly Asp Ala Ala Ala Ala Ala Arg 35 40 45 Leu Pro Pro Gly Ser Phe Gly Trp Pro Val Val Gly Glu Thr Leu Glu 50 55 60 Phe Val Ser Cys Ala Tyr Ser Pro Arg Pro Glu Ala Phe Val Asp Lys 65 70 75 80 Arg Arg Lys Leu His Gly Ser Ala Val Phe Arg Ser His Leu Phe Gly 85 90 95 Ser Ala Thr Val Val Thr Ala Asp Ala Glu Val Ser Arg Phe Val Leu 100 105 110 Gln Ser Asp Ala Arg Ala Phe Val Pro Trp Tyr Pro Arg Ser Leu Thr 115 120 125 Glu Leu Met Gly Lys Ser Ser Ile Leu Leu Ile Asn Gly Ala Leu Gln 130 135 140 Arg Arg Val His Gly Leu Val Gly Ala Phe Phe Lys Ser Ser His Leu 145 150 155 160 Lys Ser Gln Leu Thr Ala Asp Met Arg Arg Arg Leu Ser Pro Ala Leu 165 170 175 Ser Ser Phe Pro Asp Ser Ser Leu Leu His Val Gln His Leu Ala Lys 180 185 190 Ser Val Val Phe Glu Ile Leu Val Arg Gly Leu Ile Gly Leu Glu Ala 195 200 205 Gly Glu Glu Met Gln Gln Leu Lys Gln Gln Phe Gln Glu Phe Ile Val 210 215 220 Gly Leu Met Ser Leu Pro Ile Lys Leu Pro Gly Thr Arg Leu Tyr Arg 225 230 235 240 Ser Leu Gln Ala Lys Lys Lys Met Ala Arg Leu Ile Gln Arg Ile Ile 245 250 255 Arg Glu Lys Arg Ala Arg Arg Ala Ala Ala Ser Leu Pro Arg Asp Ala 260 265 270 Ile Asp Met Leu Ile Gly Asp Gly Ser Asp Glu Leu Thr Asp Glu Leu 275 280 285 Ile Ser Asp Asn Met Ile Asp Leu Met Ile Pro Ala Glu Asp Ser Val 290 295 300 Pro Val Leu Ile Thr Leu Ala Val Lys Phe Leu Ser Glu Cys Pro Leu 305 310 315 320 Ala Leu His Gln Leu Glu Glu Glu Asn Ile Gln Leu Lys Arg Arg Lys 325 330 335 Thr Asp Met Gly Glu Thr Leu Gln Trp Thr Asp Tyr Met Ser Leu Ser 340 345 350 Phe Thr Gln His Val Ile Thr Glu Thr Leu Arg Leu Gly Asn Ile Ile 355 360 365 Gly Gly Ile Met Arg Lys Ala Val Arg Asp Val Glu Val Lys Gly His 370 375 380 Leu Ile Pro Lys Gly Trp Cys Val Phe Val Tyr Phe Arg Ser Val His 385 390 395 400 Leu Asp Asp Thr Leu Tyr Asp Glu Pro Tyr Lys Phe Asn Pro Trp Arg 405 410 415 Trp Lys Glu Lys Asp Met Ser Asn Gly Ser Phe Thr Pro Phe Gly Gly 420 425 430 Gly Gln Arg Leu Cys Pro Gly Leu Asp Leu Ala Arg Leu Glu Ala Ser 435 440 445 Ile Phe Leu His His Leu Val Thr Ser Phe Arg Trp Val Ala Glu Glu 450 455 460 Asp His Ile Val Asn Phe Pro Thr Val Arg Leu Lys Arg Gly Met Pro 465 470 475 480 Ile Arg Val Thr Ala Lys Glu Asp Asp Asp 485 490 <210> 3 <211> 1473 <212> DNA <213> Oryza sativa <400> 3 atggtgtcgg cggccgccgg ttgggcggcg ccggcgtttg cggtcgccgc cgtggttatt 60 tgggtggtgc tgtgtagtga gctcctgcgg aggcggcggc gtggtgcagg cagcggcaag 120 ggggacgcgg cggcggcggc gcgcctcccg ccggggagct tcgggtggcc agtggtgggc 180 gagacgctgg agttcgtgtc gtgcgcctac tcgccgcgcc ccgaggcgtt cgtcgacaag 240 cgccggaagc tgcacgggag cgcggtgttc aggtcgcacc tgttcgggtc ggcgacggtg 300 gtgacggcgg acgcggaggt gagccggttc gtgctgcaga gcgacgcgcg ggcgttcgtg 360 ccgtggtacc cgcggtcgct gacggagctg atgggcaagt cctccatcct cctcatcaac 420 ggcgcgctcc agcgacgcgt ccacggcctc gtcggcgcct tcttcaagtc ctcccacctc 480 aagtcccagc tcaccgccga catgcgccgc cgcctctccc ccgccctctc ctccttcccc 540 gactcctccc tcctccacgt ccagcacctc gccaagtcgg tggtgttcga aatcctggtg 600 aggggcctga tcgggctgga ggcaggggag gagatgcagc agctgaagca gcaattccag 660 gaatttattg tcggcctcat gtccctcccc attaagctgc ctggcactag gctctacaga 720 tcactccagg ccaagaagaa gatggcgagg ctgatacaga ggatcatccg ggagaagagg 780 gcaaggaggg ccgccgcctc gccgccgcgg gacgccatcg acgtgctcat cggagacggc 840 agcgatgagc tcaccgacga gctcatctcc gacaacatga tcgacctcat gatccccgcc 900 gaggactccg tcccggtgct catcacgctc gccgtcaagt tcctcagcga gtgccctctc 960 gccctgcacc aactggaaga ggagaacata cagctcaaga ggcgaaaaac cgacatgggt 1020 gagaccttgc aatggacaga ctacatgtca ttgtcattca cacaacatgt gataacagag 1080 acgctgcggt tgggcaacat catcggtggg atcatgcgca aggcggtgcg cgacgtcgag 1140 gtgaaggggc acctcatccc caaggggtgg tgcgtgtttg tgtacttccg gtcagtccac 1200 ctcgatgata cgctctacga tgagccctac aagttcaacc catggaggtg gaaggagaag 1260 gacatgagca atggcagctt cactcctttt ggtggtgggc agaggctgtg cccaggcctg 1320 gatctggcca ggctggaagc ttccatcttc cttcaccact tggtcaccag cttcaggtgg 1380 gtggcggagg aggaccacat cgtcaacttc cccaccgtgc ggctcaagcg gggcatgccc 1440 atcagggtca ccgccaagga ggacgacgac tag 1473 <210> 4 <211> 490 <212> PRT <213> Oryza sativa <400> 4 Met Val Ser Ala Ala Ala Gly Trp Ala Ala Pro Ala Phe Ala Val Ala 1 5 10 15 Ala Val Val Ile Trp Val Val Leu Cys Ser Glu Leu Leu Arg Arg Arg 20 25 30 Arg Arg Gly Ala Gly Ser Gly Lys Gly Asp Ala Ala Ala Ala Ala Arg 35 40 45 Leu Pro Pro Gly Ser Phe Gly Trp Pro Val Val Gly Glu Thr Leu Glu 50 55 60 Phe Val Ser Cys Ala Tyr Ser Pro Arg Pro Glu Ala Phe Val Asp Lys 65 70 75 80 Arg Arg Lys Leu His Gly Ser Ala Val Phe Arg Ser His Leu Phe Gly 85 90 95 Ser Ala Thr Val Val Thr Ala Asp Ala Glu Val Ser Arg Phe Val Leu 100 105 110 Gln Ser Asp Ala Arg Ala Phe Val Pro Trp Tyr Pro Arg Ser Leu Thr 115 120 125 Glu Leu Met Gly Lys Ser Ser Ile Leu Leu Ile Asn Gly Ala Leu Gln 130 135 140 Arg Arg Val His Gly Leu Val Gly Ala Phe Phe Lys Ser Ser His Leu 145 150 155 160 Lys Ser Gln Leu Thr Ala Asp Met Arg Arg Arg Leu Ser Pro Ala Leu 165 170 175 Ser Ser Phe Pro Asp Ser Ser Leu Leu His Val Gln His Leu Ala Lys 180 185 190 Ser Val Val Phe Glu Ile Leu Val Arg Gly Leu Ile Gly Leu Glu Ala 195 200 205 Gly Glu Glu Met Gln Gln Leu Lys Gln Gln Phe Gln Glu Phe Ile Val 210 215 220 Gly Leu Met Ser Leu Pro Ile Lys Leu Pro Gly Thr Arg Leu Tyr Arg 225 230 235 240 Ser Leu Gln Ala Lys Lys Lys Met Ala Arg Leu Ile Gln Arg Ile Ile 245 250 255 Arg Glu Lys Arg Ala Arg Arg Ala Ala Ala Ser Pro Pro Arg Asp Ala 260 265 270 Ile Asp Val Leu Ile Gly Asp Gly Ser Asp Glu Leu Thr Asp Glu Leu 275 280 285 Ile Ser Asp Asn Met Ile Asp Leu Met Ile Pro Ala Glu Asp Ser Val 290 295 300 Pro Val Leu Ile Thr Leu Ala Val Lys Phe Leu Ser Glu Cys Pro Leu 305 310 315 320 Ala Leu His Gln Leu Glu Glu Glu Asn Ile Gln Leu Lys Arg Arg Lys 325 330 335 Thr Asp Met Gly Glu Thr Leu Gln Trp Thr Asp Tyr Met Ser Leu Ser 340 345 350 Phe Thr Gln His Val Ile Thr Glu Thr Leu Arg Leu Gly Asn Ile Ile 355 360 365 Gly Gly Ile Met Arg Lys Ala Val Arg Asp Val Glu Val Lys Gly His 370 375 380 Leu Ile Pro Lys Gly Trp Cys Val Phe Val Tyr Phe Arg Ser Val His 385 390 395 400 Leu Asp Asp Thr Leu Tyr Asp Glu Pro Tyr Lys Phe Asn Pro Trp Arg 405 410 415 Trp Lys Glu Lys Asp Met Ser Asn Gly Ser Phe Thr Pro Phe Gly Gly 420 425 430 Gly Gln Arg Leu Cys Pro Gly Leu Asp Leu Ala Arg Leu Glu Ala Ser 435 440 445 Ile Phe Leu His His Leu Val Thr Ser Phe Arg Trp Val Ala Glu Glu 450 455 460 Asp His Ile Val Asn Phe Pro Thr Val Arg Leu Lys Arg Gly Met Pro 465 470 475 480 Ile Arg Val Thr Ala Lys Glu Asp Asp Asp 485 490 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 catcaatcca ttgcagggac gat 23 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 actcgccgac tccggtgatc 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 caggtacggg agcgtgtt 18 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tgaagccttg gtagtagttg gt 22 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ttgggtcatg gcatggcaag agcaagga 28 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ttgttgctgg agccagcatt cctcctct 28 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 agctgcctgg cactaggctc tacagatcac 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 atgttgtcgg agatgagctc gtcggtgagc 30 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ttcttctcca tcccctttcc tctcgcca 28 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 caccctccgc ctcaagaagc tcctcaa 27 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ctccttggtc agccattgtt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gcgaggtcta ttgcttcagg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 tgaaagtgca gtggatcagc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gccatgggtg agctttaatc 20 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 gttggacggc cttacgttta tc 22 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gctggtaaac tccagcaagc 20 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 gagttgatct tgggaatgct gc 22 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 cactaggtat cgttccgctt atgtt 25 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 tcaaccttcc tggaaccaac 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 tctgtgagct tctccctggt 20 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 ctcagcagct gcgttgac 18 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gacaacaacg aggtgctcaa 20 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 gtagccagct tgatctcatc tc 22 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 gggacgactc tactgcatca 20 <210> 29 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 ctcgaggggt agaaaaggat ggtgtcgg 28 <210> 30 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 ggtggctagt ggctagtcgt cgtcctcctt g 31 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 cattggtgcc aacccatc 18 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 aaggaggttg ctcctgaaga 20 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 ccagatacat tgtactccct cca 23 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 atataaggca tgcgcacgtt 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gctggttggt tgtcagcttt 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 cgtcacatcg tcacaatttc 20 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 ccatctggtt ggaatattg 19 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 tcaatcagta aactgttgtg 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 cctctgcagt caaagtcacg 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 tgcatgtgcc aggttctaaa 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 caactcgacc gcattttaca 20 <210> 42 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 tcacatgtta cgtgtcactg att 23 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 cacccaacat cgagcactaa 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 acggagggag tacgtgacaa 20 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 tctggagtag ccattcaaga agc 23 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 gacagcaaga aatcccgact agg 23 <210> 47 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 acttacacaa ggccgggaaa gg 22 <210> 48 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 tggtagtggt aactctactc cgatgg 26 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 ggaaggtaac tgtttccaac 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 gaaatgcttc ccacatgtct 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 tgtccttacc cttgtttcgc 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 gtgtgttcca acagtggtgg 20

Claims (12)

delete delete delete delete delete Transforming plant cells with a recombinant vector comprising a CYP90D2 (cytochrome P450 90D2) protein coding gene derived from rice consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4; And
Re-differentiating the transformed plant from the transformed plant cells; Seed size of the plant comprising, low temperature germination, and salt stress or osmotic stress resistance is a method for producing a transformed plant. delete The transgenic plant of claim 6, wherein the expression of the CYP90D2 protein-derived gene derived from rice is increased to increase seed size, cold germination, and resistance to salt stress or osmotic stress compared to non-transgenic plants. Method of manufacturing. A transformed plant in which the seed size, cold germination and resistance to salt stress or osmotic stress of the plant produced by the method of claim 6 or 8 are regulated. A transformed seed of a plant according to claim 9. A plant comprising transforming plant cells with a recombinant vector comprising a CYP90D2 (cytochrome P450 90D2) protein-derived gene derived from rice consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, and controlling the expression of the CYP90D2 protein-coding gene. How to regulate the seed size, low temperature germination and resistance to salt stress or osmotic stress. A composition for regulating the seed size, low temperature germination and resistance to salt stress or osmotic stress of a plant comprising a rice-derived CYP90D2 (cytochrome P450 90D2) protein coding gene consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 as an active ingredient .

Images