CN115247184B - Grain type and yield control gene and application thereof - Google Patents

Grain type and yield control gene and application thereof Download PDF

Info

Publication number
CN115247184B
CN115247184B CN202110388561.3A CN202110388561A CN115247184B CN 115247184 B CN115247184 B CN 115247184B CN 202110388561 A CN202110388561 A CN 202110388561A CN 115247184 B CN115247184 B CN 115247184B
Authority
CN
China
Prior art keywords
plants
gene
plant
auxin
gibberellin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110388561.3A
Other languages
Chinese (zh)
Other versions
CN115247184A (en
Inventor
林鸿宣
张逸慜
单军祥
叶汪薇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Center for Excellence in Molecular Plant Sciences of CAS
Original Assignee
Center for Excellence in Molecular Plant Sciences of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Center for Excellence in Molecular Plant Sciences of CAS filed Critical Center for Excellence in Molecular Plant Sciences of CAS
Priority to CN202110388561.3A priority Critical patent/CN115247184B/en
Publication of CN115247184A publication Critical patent/CN115247184A/en
Application granted granted Critical
Publication of CN115247184B publication Critical patent/CN115247184B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8255—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8291—Hormone-influenced development
    • C12N15/8294—Auxins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8291—Hormone-influenced development
    • C12N15/8297—Gibberellins; GA3
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/415—Assays involving biological materials from specific organisms or of a specific nature from plants
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Abstract

The invention provides a grain type and yield control gene and application thereof. The invention discloses a novel plant regulation gene called GS3.1 gene for the first time, which can regulate plant grain type, tiller number or yield, and can also regulate phenylpropane metabolic pathway so as to regulate synthesis of flavone, lignin, auxin or gibberellin. The invention also provides application of the GS3.1 gene or the coded protein thereof as a plant character regulation target.

Description

Grain type and yield control gene and application thereof
Technical Field
The invention belongs to the fields of botanic and molecular biology, and particularly relates to a grain type and yield control gene and application thereof.
Background
With the acceleration of the progress of industrialization informatization and the rise of the level of human medical treatment, the world population is rapidly increasing. At the same time, the level of town is increased and the scale of the industrial construction land is increased, so that the arable land area and the agricultural population are reduced. China is also facing similar problems at present, and in recent years, china is out of the way of a series of policies and measures for maintaining cultivated land and agricultural population, and the repeated proposal of grain yield and excellent germplasm resources is a serious concern for civilian life. The molecular genetic mechanism formed by the crop yield is deeply researched by utilizing the theoretical method of modern molecular genetics, and the molecular design breeding technology is combined, so that the inventor can be helped to better utilize high-quality germplasm resources, and the crop yield is further improved.
Cereal crops are important crops, and how to seed more crops on limited cultivated land has been the focus of research by agricultural workers. Research on means for adjusting the plant type of crops and optimizing the planting of the crops is a very important task. Especially, gramineous rice is an important grain crop all the time, and is also one of main foods on dining tables of Chinese people, and the regulation and control of grains is one of important research contents of breeding specialists. The grain shape is closely related to the appearance quality of the final rice, such as elongated Thailand scented rice, short round northeast rice. How to effectively shorten the traditional breeding time is the effort direction of the molecular breeding scientist at present, and the function of analyzing the grain-shaped regulatory genes is helpful for the breeding salvines to breed the rice with different appearance quality meeting the requirements. At the same time, the high and low yield is also of close concern to those skilled in the art.
The rice yield mainly has three components, namely effective tillering number, grain number per ear and grain weight, and grain type is a main determining factor of grain weight. The development of excellent sites for controlling grain types in rice is helpful for better and faster utilization of the sites to cultivate rice germplasm with higher yield.
In the field of crop breeding, although some genes are closely related to tillering numbers, grain types or yield traits, with the increase of the demand level, the finding of new plant varieties with genes of specific characteristics and further improved development phenotypes is still a goal pursued in the field.
Disclosure of Invention
The invention aims to provide a grain type and yield control gene and application thereof.
In a first aspect of the invention, there is provided the use of the GS3.1 gene or encoded protein thereof or a modulator thereof for: (i) regulating grain size, tillering number or yield of the plant; (ii) Regulating the amount of p-coumaric acid, flavone or lignin synthesis pathway compounds in plants; or (iii) regulating the amount of auxin or gibberellin in a plant; wherein the GS3.1 gene or the encoded protein thereof comprises a homologue thereof.
In a preferred embodiment, the modulator is a down-regulator that down-regulates the expression or activity of the GS3.1 gene or a protein encoded thereby, the down-regulator of the GS3.1 gene being for: increasing the grain size of the plant; preferably, includes increasing grain length, grain width or grain weight; the yield of plants is improved; increasing the tillering number of the plant; reducing transport or amount of p-coumaric acid in plants; reducing the amount of flavonoids (e.g., naringenin, etc.) and compounds of its synthetic pathway in plants (preferably, the process does not reduce plant stress resistance); increasing the amount of lignin and its synthesis pathway compounds (such as caffeic acid, ferulic acid, coniferyl alcohol, largonin-4-O-glucoside, etc.) in plants; promoting the transport or synthesis of auxin in plants, or increasing the amount of auxin in plants; preferably, promotion is by up-regulating auxin synthesis genes, auxin response genes and/or down-regulating auxin inactivation genes; or, promote the transport or synthesis of gibberellin in plants, or increase the amount of gibberellin in plants; preferably, promotion is by up-regulating gibberellin response genes and/or down-regulating gibberellin-inactivating genes.
In another preferred embodiment, the modulator is an up-regulator that up-regulates the expression or activity of the GS3.1 gene or a protein encoded thereby, the GS3.1 gene or a protein encoded thereby or an up-regulator thereof being used for: improving the transport or amount of p-coumaric acid in plants; increasing the amount of flavonoids (e.g., naringenin, etc.) and its synthesis pathway compounds in plants; reducing the amount of lignin and its synthesis pathway compounds (such as caffeic acid, ferulic acid, coniferyl alcohol, largonin-4-O-glucoside, etc.) in plants; inhibiting the transport or synthesis of auxins in plants, or reducing the amount of auxins in plants; preferably, promotion is by down-regulating auxin synthesis genes, auxin response genes and/or up-regulating auxin inactivation genes; or inhibiting gibberellin transport or synthesis in plants, or reducing the amount of gibberellin in plants; preferably, promotion is by downregulating gibberellin response genes and/or upregulating gibberellin-inactivating genes.
In another preferred embodiment, the GS3.1 modulates grain type by modulating (preferably expressing in young ears to effect modulation) the elongation of glume cells such that the glume size is altered.
In another aspect of the invention, there is provided a method of regulating a trait in a plant comprising: modulating expression or activity of a GS3.1 gene or a protein encoded thereby in a plant; the GS3.1 gene or the coded protein thereof comprises a homologue thereof; wherein, the plant traits include: (i) grain size, tillering number or yield of the plant; (ii) The amount of p-coumaric acid, flavone or lignin synthesis pathway compounds in the plant; or (iii) the amount of auxin or gibberellin in the plant.
In a preferred embodiment, the method comprises: down-regulating the expression or activity of the GS3.1 gene or protein encoded thereby: increasing the grain size of the plant; preferably, includes increasing grain length, grain width or grain weight; the yield of plants is improved; increasing the tillering number of the plant; reducing transport or amount of p-coumaric acid in plants; reducing the amount of flavonoids (such as naringenin, etc.) and its synthesis pathway compounds in plants;
increasing the amount of lignin and its synthesis pathway compounds (such as caffeic acid, ferulic acid, coniferyl alcohol, largonin-4-O-glucoside, etc.) in plants; promoting the transport or synthesis of auxin in plants, or increasing the amount of auxin in plants; preferably, promotion is by up-regulating auxin synthesis genes, auxin response genes and/or down-regulating auxin inactivation genes; or, promote the transport or synthesis of gibberellin in plants, or increase the amount of gibberellin in plants; preferably, promotion is by up-regulating gibberellin response genes and/or down-regulating gibberellin-inactivating genes.
In a preferred embodiment, the method comprises: up-regulating the expression or activity of the GS3.1 gene or protein encoded thereby: improving the transport or amount of p-coumaric acid in plants; increasing the amount of flavonoids (e.g., naringenin, etc.) and its synthesis pathway compounds in plants; reducing the amount of lignin and its synthesis pathway compounds (such as caffeic acid, ferulic acid, coniferyl alcohol, largonin-4-O-glucoside, etc.) in plants; inhibiting the transport or synthesis of auxins in plants, or reducing the amount of auxins in plants; preferably, promotion is by down-regulating auxin synthesis genes, auxin response genes and/or up-regulating auxin inactivation genes; or, inhibiting gibberellin transport or synthesis in plants, or reducing the amount of gibberellin in plants; preferably, promotion is by downregulating gibberellin response genes and/or upregulating gibberellin-inactivating genes.
In another preferred embodiment, down-regulating the expression or activity of the GS3.1 gene or protein encoded thereby comprises: knocking out or silencing the gene encoding GS3.1 in plants, or inhibiting the activity of the protein encoded by GS3.1; preferably, it includes: editing the gene by using a CRISPR system to knock out the coding gene of the GS3.1, knocking out the GS3.1 by using a homologous recombination method, carrying out the loss-of-function mutation on the GS3.1 in a plant containing the GS3.1, or silencing the GS3.1 by using an interfering molecule which specifically interferes with the gene expression; preferably, the loss-of-function mutations include (but are not limited to): mutation from N to H at amino acid residues 576 and 577 of the protein encoded by GS3.1, or premature termination of the protein encoded by GS3.1 (e.g., but not limited to, premature termination at/before/after amino acids 63, 38, 160, 241, or 243).
In another preferred embodiment, upregulating expression or activity of the GS3.1 gene or protein encoded thereby includes (but is not limited to): transferring the GS3.1 gene or an expression construct or vector containing the gene into a plant; performing functional gain mutation on GS3.1; promoting GS3.1 expression with an expression-enhanced promoter or a tissue-specific promoter; alternatively, the expression of GS3.1 is promoted with an enhancer.
In another preferred embodiment, the expression construct or vector comprises a promoter of the GS3.1 gene, preferably the promoter has the nucleotide sequence shown in SEQ ID NO. 2 or SEQ ID NO. 3; a polynucleotide which hybridizes with the polynucleotide sequence shown in SEQ ID NO. 2 or SEQ ID NO. 3 under stringent conditions and has a function of promoting the expression of a target gene; or, a polynucleotide having 80% or more (preferably 90% or more, more preferably 95% or more, most preferably 98% or more) identity with the polynucleotide sequence shown in SEQ ID NO. 2 or SEQ ID NO. 3 and having a function of promoting expression of the target gene.
In another preferred embodiment, said down-regulating the expression or activity of the GS3.1 gene or the protein encoded thereby comprises: down-regulation of tissue or organ specificity, or down-regulation of spatiotemporal specificity; preferably, the downregulator (e.g., recombinant construct based on CRISPR technology) is constructed by a tissue or organ specific promoter, a spatiotemporal specific promoter or an inducible promoter.
In another preferred embodiment, said up-regulating the expression or activity of the GS3.1 gene or the protein encoded thereby comprises: tissue-or organ-specific up-regulation, or space-time specific up-regulation; preferably, the up-regulator (e.g., the over-expression recombinant construct) is constructed by a tissue or organ specific promoter, a spatiotemporal specific promoter, or an inducible promoter.
In another preferred embodiment, the tissue or organ specific promoter comprises: ear (e.g., young ear), glume-specific expression promoter, or the spatiotemporal specificity comprises: promoters for young ear stage specific expression.
In another preferred embodiment, the protein encoded by GS3.1 (GS 3.1) or a homologue thereof comprises: (a) LOC_Os03g12790 or polypeptide of the amino acid sequence shown in SEQ ID NO. 6; (b) A polypeptide derived from (a) which is formed by substitution, deletion or addition of one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues to the amino acid sequence shown in LOC_Os03g12790 or SEQ ID NO:6 and has the function of the polypeptide of (a); (c) A polypeptide having an amino acid sequence which is 50% or more (preferably 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, or 85% or more, more preferably 90% or more, still more preferably 95% or more, e.g., 98% or 99% or more) identical to the amino acid sequence defined in (a) and having the function of a polypeptide of (a); or (d) a fragment of LOC_Os03g12790 or SEQ ID NO. 6 having the function of the polypeptide of (a).
In another preferred embodiment, the plant comprises the following group or the GS3.1 or homologue thereof is from the group comprising: including monocotyledonous or dicotyledonous plants; preferably, the plant comprises: a cereal plant; preferably, the plants include (but are not limited to): gramineous plants (such as, but not limited to, rice, wheat, millet, maize, sorghum, millet, barley, rye, oats, brachypodium distachyon, etc.), leguminous plants (such as, but not limited to, soybean).
In another aspect of the present invention, there is provided the use of a plant GS3.1 gene or protein encoded thereby as a molecular marker for identifying a plant trait; the GS3.1 gene or the encoded protein thereof includes homologues thereof; wherein, the plant traits include: (i) grain size, tillering number or yield of the plant; (ii) The amount of p-coumaric acid, flavone or lignin synthesis pathway compounds in the plant; or (iii) the amount of auxin or gibberellin in the plant.
In another aspect of the invention, there is provided a method of identifying a trait in a plant, the method comprising: identifying expression or activity of the GS3.1 gene or a protein encoded thereby in the test plant; if the expression or activity of the GS3.1 gene or protein encoded thereby of the test plant is lower (significantly lower, e.g., 10%, 20%, 30%, more than 50% lower or less) than the average value of the GS3.1 gene or protein encoded thereby of the plant, it is a plant having large grain size, high tiller number or high yield characteristics; if the expression or activity of the GS3.1 gene or protein encoded thereby of the test plant is higher (significantly higher, e.g., 10%, 20%, 30%, 50% or more higher) than the average value of the GS3.1 gene or protein encoded thereby of the plant, it is a plant having the characteristics of small grain size, low tiller number or low yield; wherein the GS3.1 gene or the encoded protein thereof includes homologues thereof.
In a preferred embodiment, the method comprises the steps of: the nucleic acid sequence is identified by sequencing, PCR amplification, restriction analysis, probe, hybridization, chip, and allele polymorphism analysis.
In another aspect of the invention, there is provided a method of screening for a modulator that increases grain size of a plant, increases yield of a plant, increases tiller number of a plant, comprising: (1) Adding a candidate substance to a system comprising the GS3.1 gene or a protein encoded thereby; (2) Detecting the expression or activity of the GS3.1 gene or the protein encoded by the gene in the system of (1); if the candidate substance down-regulates (significantly down-regulates) the GS3.1 gene or the protein encoded by the candidate substance, the candidate substance is a regulator for increasing the grain type of plants, increasing the yield of plants and increasing the tiller number of the plants; wherein the GS3.1 gene or the encoded protein thereof includes homologues thereof.
In a preferred embodiment, the method further comprises the step of setting a control group so as to clearly distinguish the difference between the GS3.1 expression or activity in the test group and the control group.
In another preferred embodiment, the candidate substance includes (but is not limited to): regulatory molecules designed against GS3.1 or its encoded proteins or their upstream or downstream proteins or genes (e.g., modulators, small molecule compound gene editing constructs, etc.).
In another aspect of the invention, an isolated protein is provided which is a protein having the amino acid sequence shown in SEQ ID NO. 7.
In another aspect of the invention, there is provided an isolated polynucleotide encoding said protein; preferably, it is a polynucleotide of the nucleotide sequence shown as SEQ ID NO. 5.
In another aspect of the present invention, there is provided an isolated polynucleotide (promoter) which is a polynucleotide of the nucleotide sequence shown as SEQ ID NO. 2 or SEQ ID NO. 3, which has the function of driving gene-specific expression (including tissue/organ-specific or spatiotemporal-specific expression); preferably, the driver gene is expressed in the screen of vascular tissue of young ears, internodes, glumes or leaves.
In a further aspect of the invention there is provided the use of an isolated protein or an isolated polynucleotide as hereinbefore described as a molecular marker for the specific identification of a plant trait; wherein, the plant traits include: (i) grain size, tillering number or yield of the plant; (ii) The amount of p-coumaric acid, flavone or lignin synthesis pathway compounds in the plant; or (iii) the amount of auxin or gibberellin in the plant.
In another aspect of the present invention, there is provided a plant cell, tissue or organ comprising: down-regulation of exogenous GS3.1 gene or protein encoded thereby; the down-regulator of the GS3.1 gene or the protein encoded by the same comprises: an agent that knocks out or silences the GS3.1 gene, or inhibits GS3.1 protein activity, in a plant; preferably, it includes: interfering molecules that specifically interfere with GS3.1 expression, knock-out gene editing reagents for GS3.1 (e.g., gene editing with CRISPR systems), knock-out homologous recombination reagents for GS3.1, or reagents that mutate GS3.1 for loss-of-function; or, a natural GS3.1 gene variant which encodes a protein having the amino acid sequence shown in SEQ ID NO. 7; preferably, the nucleotide sequence of the variant is shown as SEQ ID NO. 5.
In another preferred embodiment, the down-regulator or the GS3.1 gene variant is constructed in an expression vector, more preferably the expression vector further comprises the isolated polynucleotide (promoter).
In some embodiments, the plant cell, tissue or organ is not reproductive.
Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.
Drawings
Positional cloning of fig. 1, GS 3.1: positioning of GS3.1 and natural mutation site of candidate gene.
Agronomic traits of fig. 2, GS 3.1: (a, b) NIL-GS3.1 HJX And NIL-GS3.1 HP Is a mature grain of (a); (c-h) NIL-GS3.1 HJX And NIL-GS3.1 HP Comparison of thousand kernel weight (c), kernel length (d), kernel width (e), plant height (f), effective tillering number (g) and number of kernels per ear (h) (n=30 plants); (i, j) NIL-GS3.1 HJX And NIL-GS3.1 HP Comparison of individual yield (i) and individual yield (j) (n=30 plants); (k) NIL-GS3.1 HJX And NIL-GS3.1 HP Comparison of cell yields (n=3 cells, each cell area about 2 m) 2 )；(l)NIL-GS3.1 HJX And NIL-GS3.1 HP Comparison of wet weight to dry weight of caryopsis at different days after flowering (n=3 plants, greater than 20 caryopsis per plant). Data for panels c-j and l are mean.+ -. Standard deviation, compared using the two-tailed Student's t test, with column labels representing the values versus control NIL-GS3.1 HJX Is significantly different from the numerical comparison of (1) and represents P<0.05 represents P<0.01, ns indicates no significant difference. Data for panel k are mean ± standard deviation, compared using a two-tailed Student's t test, with column labels representing values versus control NIL-GS3.1 HJX Is significantly different from the numerical comparison of (1) and represents P<0.1。
Fig. 3, GS3.1 are negative regulators of granulocytes: (a-d) GS3.1 transgenic knockout construction was compared with mature grain (a) and thousand kernel weight (b), kernel length (c) and kernel width (d) of control Hua Jingxian (WT) (strain n.gtoreq.7); (e-h) construction of the transgene complement to the control NIL-GS3.1 HP (WT)The comparison of the mature grain (e) with thousand kernel weight (f), kernel length (g) and kernel width (h) (n.gtoreq.7 plants). Data for panels b-d are mean ± standard deviation, and on-column labeling indicates significant differences in values compared to values for control wild-type HJX using a two-tailed Student's t test comparison, x indicates P<0.05 represents P<0.01, ns indicates no significant difference. Data for panels f-h are mean.+ -. Standard deviation, compared using a two-tailed Student's t test, column markers represent values versus control wild-type NIL-GS3.1 HP Is significantly different from the numerical comparison of (1) and represents P<0.05 represents P<0.01, ns indicates no significant difference.
Fig. 4, GS3.1 regulate granule type by regulating glume cell elongation: (a) Scanning the whole outer surface of the glume under an electron microscope (red box indicates the mastoid cell length statistics area); (b, c) NIL-GS3.1 HJX And NIL-GS3.1 HP Comparison of glume outer surface mastoid cell length (b) and granulosa length directional mastoid cell number (c) (n=24 glumes, cell length of 10 cells per glume); (d) Glumes transect the whole under an optical microscope (red boxes indicate mastoid cell width statistic region); (e, f) NIL-GS3.1 HJX And NIL-GS3.1 HP Comparison of the width of the mastoid cells on the outer surface of the glume (b) and the number of mastoid cells in the granulose width direction (c) (n.gtoreq.3 glumes, total cell width of 45 cells). Data for panels b, c, e and f are mean.+ -. Standard deviation, compared using the two-tailed Student's t test, with column labels representing the values versus control NIL-GS3.1 HJX Is significantly different from the numerical comparison of (1) and represents P<0.05 represents P<0.01, ns indicates no significant difference.
FIG. 5, expression pattern of GS3.1 and specific expression differences of near isogenic lines in young ears: (a-e) ProGS3.1 GUS constructs GUS chromosome-view photographs of 1cm young ear (a), internode (b), leaf (c), 8cm young ear (d) and glume (e); (f) Pro GS3.1 GUS construction young leaf transection optical micrograph (red arrow marks the stained Screen section) (g) GS3.1 at NIL-GS3.1 HJX And NIL-GS3.1 HP L represents leaves, R represents roots, C represents internodes, CN represents nodes, P represents young ears, and numerals in parentheses represent young ear lengths (cm, n=3 biological replicates).Data in panel g are mean ± standard deviation, compared using a two-tailed Student's t test, with column labels representing values versus control NIL-GS3.1 HJX Is significantly different from the numerical comparison of (1) and represents P<0.05 represents P<0.01, ns indicates no significant difference.
Fig. 6, GS3.1 is a class of MATE transporter capable of transporting p-coumaric acid: (a) GS3.1 complements its function in the e.coli MATE protein mutant; (b) GS3.1 predicted transmembrane structural schematic; (c) GS3.1 three-dimensional structure schematic and p-coumaric acid molecule docking site analysis, red p-coumaric acid molecule (in box) can bind to purple TM7, 10 and 11 by interaction with yellow-labeled amino acid residues, and transport is achieved by conformational change of TM7 as indicated by red arrows.
FIG. 7, comparison of protein sequences of GS3.1 orthologous genes in different crops or crop-related species: selecting 1, wheat, 2, soybean, 3, millet, 4, corn, 5, sorghum, 6, millet, 7, barley, 8, brachypodium distachyon, 9, and rice (GS 3.1) HJX ) The black cross-line region is the channel transmembrane domain.
Figure 8, GS3.1 is involved in plant phenylpropane metabolism: (a-f) comparison of the relative content of the phenylpropane pathway metabolites p-coumaric acid (a), naringenin (b), caffeic acid (c), ferulic acid (d), coniferyl alcohol (e) and largonin-4-O-glucoside (f) in GS3.1 transgenic knockout plants with control wild type 9522 young ears (n=3 biological replicates); (g) The lignin content of GS3.1 transgenic overexpressing plants was compared to that of control wild type Huajing indica leaves (n=3 plants, WT takes 9 leaf overexpressing plants and 7 leaves). The data for panels a-g are mean ± standard deviation, compared using the two-tailed Student's t test, the on-column label indicates that there is a significant difference in value compared to the value for control wild-type 9522 (panels a-f) or wild-type HJX (g), P <0.05, P <0.01, ns indicates no significant difference.
Figure 9, relative content of total flavonoids and lignin in GS3.1 regulated phenylpropane metabolism (a, b) GS3.1 transgenic knockout plants were heat mapped to the relative content of flavonoids (a) and lignin (b) measured in the young ears of control wild type 9522.
Similar changes in phenylpropane metabolism also exist in the GS3.1 near isogenic lines of fig. 10: (a-e) NIL-GS3.1 HJX And NIL-GS3.1 HP Comparison of the relative content of the phenylpropane pathway metabolites in young ears for coumaric acid (a), naringenin (b), caffeic acid (c), ferulic acid (d) and coniferyl alcohol (e) (n=3 biological replicates); (f) NIL-GS3.1 HJX And NIL-GS3.1 HP Thermal map of the relative content of flavonoids measured in young ears. The data for FIGS. a-e are mean.+ -. Standard deviation, compared using the two-tailed Student's t test, with the column labels representing the values versus the control NIL-GS3.1 HJX Is significantly different from the numerical comparison of (1) and represents P<0.05 represents P<0.01, ns indicates no significant difference.
Figure 11, GS3.1 regulates phenylpropane metabolism and affects granules via the auxin and gibberellin pathways: (a, b) the relative expression levels of the gene for the phenylpropane pathway-related metabolic enzyme, the gene for the auxin pathway (a) and the gene for the gibberellin pathway (b) in the GS3.1 transgenic knockout plants and in the young ears of the control wild type 9522 (n=3 biological replicates). Data for panels a and b are mean ± standard deviation, and the column labels indicate significant differences in values compared to the values of control wild type 9522 using a two-tailed Student's t test, P <0.05, P <0.01, and ns no significant difference.
Similar regulation of phenylpropane metabolism, auxin and gibberellin pathways also exists in the GS3.1 near isogenic lines of fig. 12: (a, b) NIL-GS3.1 HJX And NIL-GS3.1 HP The relative expression levels of the phenylpropane pathway-related metabolic enzyme gene, the auxin pathway-related gene (a), and the gibberellin pathway-related gene (b) in young ears (n=4 biological repeats). Data for panels a and b are mean ± standard deviation, compared using a two-tailed Student's t test, with column labels representing values versus control NIL-GS3.1 HJX Is significantly different from the numerical comparison of (1) and represents P<0.05 represents P<0.01, ns indicates no significant difference.
FIG. 13, NIL-GS3.1 HJX And NIL-GS3.1 HP Thermal map of the relative content of flavonoids determined in leaves, no flavone synthesis was observed in the GS3.1 near isogenic line leavesAnd (3) a change.
Detailed Description
The invention researches and reveals a novel plant regulation gene called GS3.1 gene (Ref: LOC_Os03g12790 (Nippon), the coded protein is called GS3.1 protein, which can regulate plant grain size, tillering number or yield, and can regulate phenylpropane metabolic pathway to regulate synthesis of flavone, lignin, auxin or gibberellin. The invention also provides application of the GS3.1 gene or the coded protein thereof as a plant character regulation target.
Terminology
As used herein, the term "plant" includes plants expressing the GS3.1 protein or plants whose genome has the GS3.1 gene present. According to the knowledge in the art, plants expressing GS3.1, which inherently have the mechanism of action as claimed in the present invention, can achieve the technical effects as claimed in the present invention. The plant may be a monocot or dicot. In some preferred embodiments, the plant is a crop, preferably a cereal crop, which is a crop with kernels (ears). In some preferred embodiments, the "cereal crop" may be a gramineous plant; preferably, the gramineous plants include, but are not limited to: rice, wheat, millet, corn, sorghum, millet, barley, rye, oat, brachypodium distachyon, etc. The plant may be leguminous plant, etc.
As used herein, the terms "up-regulate", "increase", "raise", "increase", "promote", "boost", etc. are interchangeable and shall mean an increase of at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 50%, 80%, 100% or more significant compared to a control as defined herein of a "control plant" or "control gene" or "control protein", etc.
As used herein, the terms "down-regulate", "reduce", "decrease", "inhibit", "attenuate", "block", etc. are interchangeable and shall mean at least a 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 50%, 80%, 100% or more significant decrease compared to a control as defined herein of a "control plant" or "control gene" or "control protein" or the like.
As used herein, the term "kernel" refers to the fruit or seed of a plant, also known as a spike in crops such as rice, maize, wheat, barley, and the like.
With respect to "control plants," selection of appropriate control plants is a routine part of an experimental design and may include corresponding wild-type plants or corresponding transgenic plants without the gene of interest. The control plants are generally of the same plant species or even varieties which are identical to or belong to the same class as the plants to be evaluated. The control plant may also be an individual who has lost the transgenic plant due to isolation. Control plants as used herein refer not only to whole plants, but also to plant parts, including seeds and seed parts.
As used herein, high expression or activity refers to an increase in expression or activity that is statistically significant, such as an increase of 10%, 20%, 40%, 60%, 80%, 90% or more, as compared to the average value of the expression or activity of the same class or species of plant.
As used herein, low expression or activity refers to a statistically significant reduction, such as a reduction of 10%, 20%, 40%, 60%, 80%, 90% or less, in expression or activity compared to the average value of expression or activity of the same class or species of plant.
As used herein, the term "improved trait" refers to characteristics of an improved plant, which in the present invention, primarily include: (i) the grain size, tiller number or yield of the plant, (ii) the amount of p-coumaric acid, flavone or lignin synthesis pathway compounds in the plant, or (iii) the amount of auxin or gibberellin in the plant.
As used herein, "improvement of a plant trait", "improved plant trait", "trait improvement", and the like may be equivalently substituted, meaning that the trait or characteristic described in the upper paragraph of a plant modified by the subject technology is statistically altered, as compared to an unmodified plant (e.g., wild-type plant), to form a beneficial agronomic trait.
As used herein, a "promoter" or "promoter region" refers to a nucleic acid sequence that is typically present upstream (5' to) the coding sequence of a gene of interest, and is capable of directing transcription of the nucleic acid sequence into mRNA. In general, a promoter or promoter region provides a recognition site for RNA polymerase and other factors necessary for proper initiation of transcription. In this context, the promoter or promoter region includes a variant of the promoter, which is obtained by inserting or deleting a regulatory region, performing random or site-directed mutation, or the like.
As used herein, the term "specifically expressed" refers to expression of a gene of interest at a particular time and/or in a particular tissue. "tissue-specific promoters," also known as "organ-specific promoters," under the control of such promoters, genes tend to be expressed only in certain specific organs or tissue sites and exhibit fertility-regulating properties. In general, a promoter is considered tissue or organ specific if mRNA is expressed at a level at least 5-fold, preferably at least 10-fold, more preferably at least 100-fold, and most preferably at least 1000-fold higher in a certain tissue or organ than in other tissues or organs.
As used herein, "isolated" refers to a substance that is separated from its original environment (i.e., the natural environment if it is a natural substance). If the naturally occurring polynucleotide and polypeptide are not isolated or purified in vivo, the same polynucleotide or polypeptide is isolated or purified from other naturally occurring substances.
As used herein, "exogenous" or "heterologous" refers to a relationship between two or more nucleic acid or protein sequences from different sources. For example, if the combination of a promoter and a gene sequence of interest is not normally naturally occurring, the promoter is foreign to the gene of interest. The particular sequence is "exogenous" to the cell or organism into which it is inserted.
GS3.1
As used herein, unless otherwise specified, the term GS3.1 refers to a polypeptide having the sequence LOC-Os 03g12790 or SEQ ID NO. 6 or a gene encoding the same, and includes a variant of the sequence having the same function as the GS3.1 polypeptide. The coding gene can be gDNA or cDNA, and can also comprise a promoter. For example, the gDNA has the nucleotide sequence shown in SEQ ID NO. 1 (HJX source) or LOC_Os03g12790 (Ref), the cDNA has the nucleotide sequence shown in SEQ ID NO. 4, and the promoter has the nucleotide sequence shown in SEQ ID NO. 2 or SEQ ID NO. 3. The sequences of the coding genes also include sequences that are degenerate to the sequences provided herein.
As used in the present invention, loc_os03g12790 is the name of rice Ref genome annotation gene, and Ref sequence is the sequence of japanese variety. GS3.1 in the present invention HJX And GS3.1 HP1 Is a gene from HJX and HP1 located at the same locus.
Variant forms of the GS3.1 polypeptide include (but are not limited to): deletion, insertion and/or substitution of several (usually 1-100 or 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10, still more preferably 1-8, 1-5) amino acids, and addition or deletion of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and/or the N-terminus. Any protein having high homology to the GS3.1 polypeptide (e.g., 50% or more, 60% or more, 70% or more, preferably 80% or more, more preferably 90% or more, e.g., 95%,98% or 99% homologous to the LOC-Os 03g12790 or polypeptide sequence shown in SEQ ID NO: 6) and having the same function as the GS3.1 polypeptide is also included in the present invention. Polypeptides derived from other species than rice that have higher homology to the sequence of LOC-Os 03g12790 or the sequence shown in SEQ ID NO. 6, or that exert the same or similar effect in the same or similar regulatory pathways, are also encompassed by the present invention.
The invention also provides isolated polypeptides that are fragments of the GS3.1 polypeptide or are formed by adding other proteins or tags at both ends, and the like.
In the present invention, the term "GS3.1" also includes homologues thereof. It should be understood that while GS3.1 obtained from rice of a particular species is preferably studied in the present invention, other polypeptides or genes obtained from other species that are highly homologous (e.g., have greater than 50%, greater than 60%, more particularly greater than 70%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, even greater than 98%) to the GS3.1 are also within the contemplation of the present invention.
The invention also includes a mutant form of GS3.1 which corresponds to LOC_Os03g12790 or amino acid residues inserted between positions 576 and 577 of the amino acid sequence of SEQ ID NO. 6, and the N at position 631 being changed to H to form a sequence as shown in SEQ ID NO. 7, whereby the mutant of the GS3.1 polypeptide is mutated. The variant does not have the function of LOC_Os03g12790 or GS3.1 polypeptide of SEQ ID NO:6, and the grain morphology, tiller number and yield traits of the plants with the mutation are remarkably changed.
The polynucleotides (genes) encoding the GS3.1 polypeptides may be natural genes from plants or their degenerate sequences.
Polypeptides derived from other species than rice that have higher homology to the sequence of LOC-Os 03g12790 or the sequence shown in SEQ ID NO. 6, or that exert the same or similar effect in the same or similar signal pathway, are also included in the present invention.
The invention also relates to vectors comprising said polynucleotides, and host cells genetically engineered with said vectors or polypeptide-encoding nucleic acids.
In the present invention, a polynucleotide sequence encoding a polypeptide of the present invention may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In general, any plasmid or vector can be used as long as it replicates and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translational control elements. Preferably, the expression vector may also optionally incorporate a resistance element, a screening (selection) element or a reporter element, such as Bar, GUS.
When expressed in higher eukaryotic cells, the polynucleotide will have enhanced transcription if inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase the transcription of a gene.
Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. The transformed plants may be transformed by Agrobacterium or gene gun, for example, spraying, leaf disc, young embryo transformation, etc.
Method for improving plants
In the specific embodiment of the invention, the inventor digs a new QTL for regulating rice grains by introducing the constructed African cultivated rice HP1 segment into a chromosome segment substitution line of indica rice variety Huajing indica 74. The inventors located and cloned this QTL by means of map-based cloning and named gain Size 3.1 (GS 3.1). GS3.1 encodes a Multidrug And Toxic compound Extrusion (MATE) transporter and, by molecular docking, is thought to regulate the metabolic flux of flavone and lignin metabolism with p-coumaric acid as a transport substrate. The natural mutation site in African rice leads to reduced expression amount of GS3.1 in young ears, reduced synthesis of flavone in young ears, reduced flavone substances, enhanced transportation and synthesis of auxin and signal transduction, further enhanced gibberellin synthesis and signal transduction, increased lignin monomer synthesis, co-influence on glume cell elongation and increased rice grain type. Meanwhile, the inventor found that no obvious difference is seen in the expression amount of GS3.1 in leaves and other tissues among near isogenic lines, and no obvious difference is found in the whole flavonoid substances, and the result suggests that the GS3.1 allele from African cultivated rice can avoid the stress resistance reduction caused by the reduction of the flavonoid content. In summary, the research of the present inventors has discovered an excellent allele GS3.1 derived from oryza sativa, which can positively regulate grain type by regulating phenylpropane metabolism, while improving the yield of oryza sativa without affecting stress resistance.
Based on the new findings of the present inventors, the present invention provides a method of improving a plant, the method comprising: regulating the expression or activity of GS3.1 in the plant body, and further (i) regulating the grain size, tillering number or yield of the plant; (ii) Regulating the amount of p-coumaric acid, flavone or lignin synthesis pathway compounds in plants; or (iii) regulating the amount of auxin or gibberellin in a plant.
The protein coded by the GS3.1 gene is used as a MATE transport protein, p-coumaric acid can be used as a transport substrate to regulate transport and distribution of p-coumaric acid in a phenylpropane metabolic pathway, and the GS3.1 expression is reduced so that flavone synthesis is reduced and lignin synthesis is increased; the expression level or function of the GS3.1 gene can be changed by genetic manipulation of the GS3.1 gene, and the content of flavone and lignin in crops can be regulated, so that the properties of crops can be improved.
In one aspect, the invention provides a method for conferring traits on plants that are increased grain size (including increased grain length, grain width, or grain weight), increased yield, increased tillering number, decreased transport or amount of p-coumaric acid, decreased amount of flavones (e.g., naringenin, etc.) and compounds of the synthetic pathway thereof, increased amount of lignin and compounds of the synthetic pathway thereof (e.g., caffeic acid, ferulic acid, coniferyl alcohol largonin-4-O-glucoside, etc.), increased auxin transport or synthesis, increased auxin amount, increased transport or synthesis of gibberellin, including down-regulating expression or activity of GS 3.1.
In another aspect, the invention provides a method of causing plants, particularly plants that express less (including not expressing) GS3.1, to exhibit increased transport or amounts of p-coumaric acid, increased amounts of flavonoids (e.g., naringenin, etc.) and compounds of their synthetic pathways, decreased amounts of lignin and compounds of its synthetic pathways (e.g., caffeic acid, ferulic acid, coniferyl-largonin-4-O-glucoside, etc.), decreased transport or synthesis of auxins, decreased amounts of auxins, decreased transport or synthesis of gibberellins, including down-regulating expression or activity of GS 3.1.
It will be appreciated that after the function of the GS3.1 is known, various methods well known to those skilled in the art may be employed to modulate the expression or activity of the GS 3.1. For example, various methods well known to those skilled in the art can be used to over-express GS3.1 or to reduce GS3.1 expression or to delete it. Or by methods well known to those skilled in the art to promote or attenuate protein phosphorylation, and to enhance or attenuate the operation of signaling pathways.
In the present invention, the down-regulation of the protein of GS3.1 or the gene encoding the same refers to any substance which can decrease the activity of the protein of GS3.1, decrease the stability of the protein of GS3.1 or the gene encoding the same, down-regulate the expression of GS3.1, decrease the effective action time of GS3.1, inhibit the transcription and translation of GS3.1, or decrease the phosphorylation/activation level of each protein, and these substances can be used in the present invention as useful substances for down-regulating GS 3.1. They may be chemical compounds, chemical small molecules, biological molecules. The biomolecules may be nucleic acid-level (including DNA, RNA) or protein-level. For example, the downregulator is: an interfering RNA molecule or antisense nucleotide that specifically interferes with GS3.1 expression; or a gene editing reagent that specifically edits GS3.1, etc.
In the invention, the up-regulator of the GS3.1 protein or the encoding gene thereof comprises an accelerator, an agonist and an activator. The "up-regulation", "promotion" includes "up-regulation", "promotion" of protein activity or "up-regulation", "promotion" of protein expression, and they are "up-regulation", "promotion" of protein activity in a statistical sense. Any agent that increases the activity of GS3.1, increases the stability of GS3.1, upregulates the expression of GS3.1, increases the effective duration of GS3.1, increases the phosphorylation/activation level of the respective protein may be used in the present invention as an agent useful for upregulating GS 3.1. They may be chemical compounds, chemical small molecules, biological molecules. The biomolecules may be nucleic acid-level (including DNA, RNA) or protein-level.
The invention also provides a method for up-regulating GS3.1 expression in plants, which comprises the following steps: the coding gene of GS3.1 or an expression construct or vector containing the coding gene is transferred into plants.
The invention also provides a method for down-regulating the GS3.1 in the plant, which comprises the steps of targeted mutation, gene editing or gene recombination on the GS3.1, so that the down-regulation is realized. As a more specific example, GS3.1 was converted into its variant by any of the methods described above (SEQ ID NO:7, GS3.1 HP ) Thereby altering the traits of the plant. The present inventors found that the transgenic plants thus transformed have specific expression characteristics that produce expression differences only in young ears from the allele of indica rice HJX, and can exert effects of increasing grain weight (grain type increase) and increasing yield only in young ears without changing the metabolic flows of other tissues, such as without changing the flavone content of leaf tissues without affecting the overall stress resistance. Thus GS3.1 HP The gene locus only increases grain weight and yield without the negative effect of reducing stress resistance, and has application value in breeding.
As another embodiment for down-regulating GS3.1 in plants, gene editing is performed using the CRISPR/Cas9 system, thereby knocking out or down-regulating the target gene. According to the embodiment of the present invention, stress resistance of the genetically edited plant is ideal. Suitable sgRNA target sites will lead to higher gene editing efficiency, so suitable target sites can be designed and found before proceeding with gene editing. After designing specific target sites, in vitro cell activity screening is also required to obtain effective target sites for subsequent experiments.
The promoter region of the GS3.1 gene is modified by using CRISPR/Cas9 and other gene editing technologies to adjust the expression quantity in fruit tissues in early development so as to increase the grain size, and high-yield crop varieties (including but not limited to rice, wheat, corn, sorghum, millet, soybean and the like) can be cultivated.
As another embodiment of the present invention, there is provided a method for down-regulating expression of GS3.1 in a plant, comprising: (1) Transferring an interfering molecule interfering with the expression of the GS3.1 gene into a plant cell, tissue, organ or seed to obtain the plant cell, tissue, organ or seed into which the interfering molecule is transferred; (2) Regenerating a plant from the plant cell, tissue, organ or seed obtained in step (1) into which the interfering molecule has been introduced. Preferably, the method further comprises: (3) Selecting a plant cell, tissue or organ into which the vector has been transferred; and (4) regenerating the plant cells, tissues or organs of step (3) into a plant.
In regulating the expression of GS3.1 in plants, a variety of promoters known in the art or under development can be used. For example, the promoter may be: constitutive promoters, tissue or organ specific promoters, space-time specific expression promoters, and the like. Preferably, the promoter comprises: tissue-or organ-specific promoters, space-time specific expression promoters, inducible promoters. Preferably, the tissue or organ specific promoter comprises: ear (e.g., young ear), glume-specific expression promoter, or the spatiotemporal specificity comprises: promoters for the stage-specific expression of young ears, preferably young ears of 3-5cm length.
As a preferred mode of the present invention, there is provided a specifically expressed promoter which is a promoter of the GS3.1 gene, which is isolated for the first time. Preferably, it is a promoter of the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3, which drives gene expression in the screen of the vascular tissue of young ears, internodes, glumes or leaves. The invention also includes variant promoters or promoter fragments having the same expression-driving function as the promoters having the nucleotide sequences shown in SEQ ID No. 2 or SEQ ID No. 3. Hybridization of polynucleotides is a technique well known to those skilled in the art, and hybridization characteristics of a particular pair of nucleic acids indicate their similarity or identity. The invention also relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the invention. The invention also includes nucleic acids having 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, most preferably 95% or more) identity to any one of the promoter sequences of the invention, which also have the function of directing the specific expression of the gene of interest. "identity" refers to the level of similarity (i.e., sequence homology, similarity, or identity) between two or more nucleic acids in terms of percentage of positional identity.
The promoter and/or the gene sequence of interest that drives expression thereof may be contained in a recombinant vector. The invention also includes recombinant vectors containing the same.
In the invention, the GS3.1 gene can regulate and control the polar transport, signal transduction and synthesis of auxin and the synthesis of downstream gibberellin by influencing the metabolism of flavone, can finely regulate and control the elongation of cells, and finally influences the glume development and grain weight (grain weight) of rice, but has ideal stress resistance.
The technical scheme of the invention can be applied to molecular design breeding for various ways. For example, the CRISPR/Cas9 isogenic editing technology is utilized to edit and modify the OsGS3.1 gene or the promoter region or the intron region thereof, create excellent gene loci, regulate and control the grain size, tillering number, yield and the like of plants; or the excellent allelic variation locus of the OsGS3.1 and the excellent allelic variation locus of different signal components (genes) are screened from the resource varieties, polymerized or combined, and the ideal grain shape and the ideal spike shape are formed, so that the ideal high-yield plant varieties are cultivated. GS3.1 is a gene conserved in the plant evolution process, can be widely used in various crops, and has good application prospect.
Plant directional screening or targeting screening
After the function of GS3.1 was known, it was used as a molecular marker to conduct directional screening of plants. Substances or potential substances which directionally regulate and control the properties such as grain size, tillering number, yield and the like of plants can also be screened by regulating the mechanism based on the novel discovery.
Accordingly, the present invention provides a method of directionally selecting or identifying plants, the method comprising: identifying expression or activity of the GS3.1 gene or a protein encoded thereby in the test plant; if the expression or activity of the GS3.1 gene or the protein encoded by the gene is lower than the average value of the GS3.1 gene or the protein encoded by the gene, the plant is characterized by large grain size, high tiller number or high yield; if the expression or activity of the GS3.1 gene or the protein encoded by the gene is higher than the average value of the GS3.1 gene or the protein encoded by the gene, the plant is a plant with small grain size, low tiller number or low yield; wherein the GS3.1 gene or the encoded protein thereof includes homologues thereof.
The invention provides a method for screening substances (potential substances) for increasing the grain type of plants, increasing the yield of the plants, increasing the tillering number of the plants and other characters, which comprises the following steps: (1) adding a candidate substance to a system expressing GS 3.1; (2) Detecting the system, observing the expression or activity of GS3.1, and if the candidate substance down-regulates (obviously down-regulates) the GS3.1 gene or the protein encoded by the candidate substance, indicating that the candidate substance is a regulator for increasing the grain type of plants, increasing the yield of plants and increasing the tiller number of the plants.
Methods for screening for substances that act on a target site, either on a protein or on a gene or on a specific region thereof, are well known to those skilled in the art and can be used in the present invention. The candidate substance may be selected from: peptides, polymeric peptides, peptidomimetics, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, nucleic acid sequences, and the like. Depending on the kind of substance to be screened, it is clear to the person skilled in the art how to select a suitable screening method.
Through large-scale screening, a potential substance which specifically acts on GS3.1 or a signal path participated in the GS3.1 and has a regulating effect on plant type characters, yield characters, organelles or cell cycle can be obtained.
The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out according to conventional conditions such as those described in J.Sam Brookfield et al, molecular cloning guidelines, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.
Materials and methods
1. Experimental materials and positional cloning
The inventor uses African cultivated rice HP1 as a donor parent and Asian indica rice Hua Jingxian (HJX) as a recurrent parent to construct a set of chromosome fragment substitution systems (CSSLs) for locating the QTLs of the clone regulation grain type. The substitution line HPC078 was identified by particle type investigation to contain a qtL that regulates particle type, designated GS3.1. Backcrossing the strain with recurrent parent HJX, performing preliminary positioning, and positioning GS3.1 on the short arm of chromosome 3The posterior segment of the substitution segment of the end. Then, the inventor selects plants with heterozygous GS3.1 near segments and HJX source in 6552 offspring through molecular marker assisted selection to construct F 2 A population for fine localization of GS3.1, narrowing the GS3.1 candidate segment to a region of 9.45kbp on chromosome 3, which contains 1 candidate gene. At the same time, homozygous offspring individuals containing the fragment carrying the GS3.1 locus of African rice and most of the other individuals with the genetic background of HJX are selected as near isogenic lines, namely NIL-GS3.1 HP The offspring individuals with the same source and the target fragment being HJX source are the control NIL-GS3.1 HJX . The related molecular marker primers are shown in Table 1.
TABLE 1
2. CRISPR/Cas9 gene editing, over-expression, genetic complementation and GUS staining material construction to further verify candidate gene GS3.1 gene (corresponding Ref sequence is loc_os03g 12790), the inventors designed CRISPR/Cas9 gene knockout target (ko#1, resulting in sequence change at amino acid residue 20 and premature termination of protein from position 63) for coding region sequence of GS3.1 gene, and constructed to pYLCRISPR/Cas 9-mhomo; m=monocot; h=hpt, hygromycin resistance gene) for knockout of candidate gene GS3.1. In addition, other gene knockout targets established by the present inventors are as in table 2 (identified as CRISPR/Cas9 mutation types each having a phenotype).
TABLE 2
The inventor constructs GS3.1 coding region sequence from HJX on pCAMBIA1300-proUbi-HA-FLAG over-expression vector (the promoter and terminator of Osubi1 from rice are inserted in the position of multiple cloning site of commercial pCAMBIA 1300), and the GS3.1 gene is over-expressed under the drive of rice Ubiquitin promoter.
The present inventors constructed the entire gene fragment from about 2.7kbp upstream to about 1.5kbp downstream of the GS3.1 gene derived from HJX into pCAMBIA1300 and allowed genetic complementation with respect to the GS3.1 gene.
To investigate the expression pattern of GS3.1, the present inventors constructed the promoter region of GS3.1 (a region of about 2.7kbp upstream of the gene) onto the GUS staining vector of pCAMBIA1300-GUSplus, and used the GS3.1 promoter to drive the GUS reporter gene.
The present inventors transformed CRISPR/Cas9 constructs into HJX and 9522, overexpressed constructs into HJX and genetically complementing constructs into near isogenic lines NIL-GS3.1 by agrobacterium tumefaciens EHA105 mediated transformation of young rice embryos HP In the method, GUS staining construction is transformed into flower 11 (ZH 11) in japonica rice, a transgenic positive strain is screened, sequencing investigation of mutant form is carried out on CRISPR/Cas9 construction plants, and transgenic T is planted in a field 1 And (5) examining the phenotype in a substitution way.
The relevant sequences for performing the above operations are shown in table 3.
TABLE 3 Table 3
3. GS3.1 E.coli mutant complementation growth experiment
To verify that GS3.1 does have MATE transporter activity, the inventors tried to express it in e.coli MATE transporter mutants to test whether it could complement MATE transporter function. The inventor constructs the GS3.1 full-length coding region into a pMAL-c5x (pMAL) vector to obtain pMAL-GS3.1, respectively converts the pMAL-GS3.1 and empty pMAL into mutant escherichia coli BW25113 delta acrb, and selects out strains with good expression. The 2 selected plasmid transformants and the wild type strain BW25113 were inoculated into 3mL of LB medium, and cultured at 37℃in a shaker at 200rpm to OD 600 After more than 1, part of the cells were collected and diluted to OD with sterile water 600 Equal to 0.5. The diluted 3 bacterial solutions were diluted 10 times, and streaked on LB solid medium and LB plate with 0.035. Mu.g/mL norfloxacin and 0.25mM IPTG added, respectively. Growth was observed after overnight incubation in an incubator at 37 ℃.
The 5' end oligonucleotide primer sequence constructed by the pMAL-GS3.1 vector is as follows:
5’-cgggatcgagggaaggatttcacatatgtgcaactccggcaccagctcc-3’(SEQ ID NO:23)；
the 3' end primer sequence is as follows:
5’-agcttatttaattacctgcagggaattcctagacgtggccacctccaccgccg-3’(SEQ ID NO:24)。
4. cytological assays
NIL-GS3.1 HP With NIL-GS3.1 HJX Compared with the traditional Chinese medicine, the grain type is obviously increased. The inventor observes the rice glume outer surface cells through a scanning electron microscope and a resin slice to determine the cytological basis of the grain change. Selecting mature rice glumes before heading, fixing, dehydrating, isoelectric point drying, performing metal spraying treatment, performing scanning electron microscope observation, and counting the length and the number of glume cells in the grain length direction. The glumes at the same time were fixed, dried, gradually infiltrated into the resin and embedded in the resin, and then cut into 8 μm slices using a hand microtome and observed under an optical microscope.
5. Lignin determination
The effect of GS3.1 on lignin synthesis may affect the lignin content of the final product, since only young ears are metabolically differentiated between near isogenic lines, the inventors selected over-expressed lines that over-expressed GS3.1 globally in plants, and used them with control leaves to determine lignin content. Grinding leaf tissue sample into powder in liquid nitrogen, adding 70% ethanol, extracting at 70deg.C for 1 hr, centrifuging at 13000rpm for 5min to remove supernatant, and repeating for 3 times; drying the extracted precipitate in a 50 ℃ oven to constant weight; weighing about 10mg of precipitate (recording accurate mass), adding 0.3mL of thioglycollic acid and 2mol/L of HCl, incubating for 4 hours at 95 ℃, centrifuging at 15000rpm for 15min after the sample is naturally cooled to room temperature, and discarding the supernatant; will last Washing the precipitate with ultrapure water, centrifuging at 15000rpm for 15min, discarding supernatant, and repeating for 3 times; adding 1.5mL of NaOH (0.5 mol/L) into the precipitate, shaking for 16h at 20 ℃, extracting lignin thioglycollic acid, centrifuging at 15000rpm for 15min, collecting the supernatant, adding 0.4mL of NaOH into the precipitate for extraction once again, centrifuging at 15000rpm for 15min, and mixing the supernatant with the previous extracted supernatant; adding 0.3mL of concentrated hydrochloric acid into the mixed supernatant, uniformly mixing, acidizing at 4 ℃ for 4 hours, centrifuging at 15000rpm for 20 minutes, and discarding the supernatant; the precipitate was dissolved in 1mL NaOH, and the absorbance at 280nm was measured with a spectrophotometer using NaOH as a blank, and OD was calculated 280 ·mg -1 The value is the relative content of lignin.
6. Extensive targeted metabolome detection
The inventors studied the effect of GS3.1 on plant metabolism by a broad targeted metabonomics assay. Freezing and drying each tissue sample of rice at low temperature by liquid nitrogen, grinding to powder by a grinder, weighing 100mg of powder, dissolving in 1.0mL of extracting solution, extracting the dissolved sample at 4 ℃ for overnight by a refrigerator, and swirling for three times during the period to improve the extraction rate. After centrifugation, the supernatant was aspirated, the sample was filtered with a millipore filter and stored in a sample bottle for analysis using LC-MS/MS. The liquid phase conditions are as follows: the sample injection amount is 2 μl; the column was Waters ACQUITY UPLC HSS T C18.1.8 μm,2.1mm x 100mm; the flow rate is 0.4ml/min; the mobile phase water phase is ultrapure water (0.04% formic acid is added), and the organic phase is acetonitrile (0.04% formic acid is added); the elution gradient was water/acetonitrile (95:5V/V) for 0min, 5:95V/V for 11.0min, 5:95V/V for 12.0min, 95:5V/V for 12.1min, and 95:5V/V for 15.0min, respectively; the flow rate is 0.35mL/min; column temperature 40 ℃; curtain gas (CUR) 25psi; the collision-induced ionization parameter is set high. The conditions of the triple quadrupole mass spectrum are as follows: electrospray ion source (electrospray ionization, ESI) temperature 500 ℃; mass spectrum voltage 5500V; the curtain gas was 35psi and the impact induced ionization parameter was set to medium. In Q-Trap 6500+, each ion pair is scan detected based on optimized declustering voltage and collision energy.
Example 1, positioning and function of GS3.1
In earlier work, the inventor constructs a set of chromosome segment substitution lines by taking Huajing indica 74 (HJX) as a recurrent parent and African cultivated rice HP1 (HP) as a donor parent, and identifies a plurality of lines with obviously changed grain types compared with the recurrent parent HJX. The inventors selected a QTL located on the short arm end of chromosome 3 that could significantly increase the granulometry for localization and named GS3.1. Preliminary localization GS3.1 found that it was able to reach LOD values of 17.514 at thousand kernel weight, and that both the grain length and grain width phenotypes were computationally identified as QTL presence. Analysis of the effects of the grain type revealed that the GS3.1 locus interpreted 33.2% variation in thousand grain weight, 23.6% variation in grain length, and 23.5% variation in grain width (as shown in Table 4). Fine localization was performed by a large number of screening exchanges, and the inventors localized GS3.1 within a range of 9.45kbp (as shown in FIG. 1).
Tables 4 and GS3.1 are QTL for controlling grain type
LOD value Contribution rate Additive effects
Thousand grain weight 17.514 33.2％ 0.608
Grain length 11.684 23.6％ 0.090
Grain width 11.609 23.5％ 0.026
To further investigate the regulatory effect of GS3.1 on granulocytes, the inventors constructed the near isogenic line NIL-GS3.1 HP And its control NIL-GS3.1 HJX . It was found that with NIL-GS3.1 HJX In contrast, NIL-GS3.1 HP The grain weight increased by 6.2%, the grain length increased by 1.9%, and the grain width increased by 2.5% (FIGS. 2 a-e). In addition NIL-GS3.1 HP The effective tillering number increased, but there was no significant difference in both plant height and grain number per ear (fig. 2 f-h). Further examining the yield-related character findings, compared with NIL-GS3.1 HJX ，NIL-GS3.1 HP The single plant yield (+16.7%), single spike yield (+11.5%) and cell yield (+8.7%) are all obviously improved (figure 2 i-k), so that the gene has breeding application value. Detection of NIL-GS3.1 HJX With NIL-GS3.1 HP The inventors found that there was no significant difference in wet and dry glumes weights at the early stage (within 10 days after flowering) and significant difference was produced gradually as the grouting proceeded to the later stage (fig. 2 l), suggesting that GS3.1 did not affect the grouting process, and grain type was controlled by adjusting the glume size.
The inventors further analyzed this interval and found that there were only 1 predicted transcripts GS3.1, and found by sequencing that there were 6 sequence difference sites from the allele of HP1 compared with that from HJX, resulting in 4 synonymous mutations with 2 mutations, resulting in amino acid sequence changes, 3 amino acid residues of CGC being inserted between amino acid residues 576 and 577, and N at position 631 being H (as shown in FIG. 1).
To further confirm the genes regulating the granulocyte colony within the GS3.1 segment, the inventors used CRISPR/Cas9 technology to edit the gene of GS3.1 such that its protein translation was prematurely terminated (ko#1, resulting in a sequence change from amino acid residue 20 and premature termination of the protein from 63). Transgenic GS3.1 knockout (Ko) plants of HJX increased thousand kernel weight by 33.36%, grain length by 11.59% and grain width by 14.47% compared to control wild-type HJX (fig. 3 a-d). The other HJX transgenic GS3.1 knockout (ko) lines identified in table 2 all have this phenotype.
At the same time, the GS3.1 coding region and the fragment thereof of about 2.7kbp upstream and 1.5kbp downstream were introduced into NIL-GS3.1 HP Constructed genomic fragment complementation transgenic plants exhibited significant reductions in thousand kernel weight and kernel length (FIGS. 3 f-g). Therefore, GS3.1 is indeed a gene controlling the granulocyte type.
In summary, the present inventors selected a substitution line of a chromosome fragment, and mapped a QTL-GS 3.1 located at the short arm end of chromosome 3 of rice by a map-based cloning method, regulated the grain type, and cloned the GS3.1 gene controlling the phenotype.
GS3.1 Gene sequence (HJX Source; SEQ ID NO: 1)
atgtgcaactccggcaccagctcctcgccgtcggcgcctgcgccgccgccgccgccgctcacctcgttcaagcactcctcccacctcctccgcctcgtcgacgatgacgccgacgacggccatgcgctgctgctctccaaggtaaaacacgcggtacatatgctgtagtaatacttacccgcggcttggtaattttgatggcgtgaacagaacatgtaggccattatatcaaagagctaatgcaagaagcacgcatagcgacatagctggctggctggctggttgtttaatgcttatttactagtagctaggcatcactggcagtaacagtaacgagaaagaaaaggaaagctccagctgttgggaaatggcagagctgatcaatacgtccatgcacacgaacagctgatcgagacgacgacgacgttgctttgcttgttggtttctaacatgcgtgagtgcgtgtgtctcccaggtggccggcgaggcgcaggcgatcgggcgggtgtcggtgccgatggcggtgacggggctcgtcatgtactcgcgggcgctcatctcgatgctgttccttggccggctcggcgagctggccctcgccggagggtcgctagcgctcggcttcgccaacatcaccggctactcggtgctctccgggctggcgctcgggatggagcccatctgcggccaggcgttcggcgcgcgccgcgggaagctgctggcgctggcgctccaccgcaccgtgctgctgctgctcgccgtcgcgctgcccatctccctcctgtgggtgacgtccacggggtacatactgaagcagctcggccaggacgagggcgtggcggacgcggcgcagacgttcgcggcgtacgcgtcggccgacctggcggtgctcgccgtgctgcacccgctccgcgtctacctccggtcgcagaacctgacgctgcccatcaccgcctgctcgctcttctccgtgctgctgcacgggcccatcaactacctcctcgtcgtgcgcctccgcatgggcgtcgccggcgtcgcgctcgccgtcgcgctcaccgaccttaacctgctcctcgcgctcctctgcttcctcgccatctccggggcccacagggactcgtgggtggggcccacctccgactgcctccgcgggtggccggcgctgctccgcctcgccgtgccgaccgccaccgcggtgtgcctcgagtggtggtggtacgagctcatgatcgtgctgtcgggcctcctcgccaacccgcgcgccaccgtggcgtccatgggcatcctcatccaggccacgtcgctcgtctacgtgttcccgtcctccctcggccagggcgcgtccacgcgcgtcagccaccagctcggcgcgggcaggcccgcgggggcgcgccgcgcggccggcgccgccctctccatcggcctcgtcgtcggcgcggcggccgccaccttcatggtgtcggtccgcagccactggggccgcatgttcacgtcggacggcgagatcctccgcctcacggccgtggcgctccccatcgcggggctctgcgagctcggcaactgcccgcagacggccgggtgcggcgtcctccgcggcagcgcccgcccggccagcggcgcgcgcatcaacctcgcctccttctacctggtcggcatgccggtcggcgtggcgctggcattcggcgcccgcctaggcttcgccgggctgtggctgggcctccttgccgcgcaggctgcctgcgcggtgtggatggcgcgcgccgtggccgccaccgactgggacgtcgaggtggcgcgtgccaaggagctgaccaaggcgtccactacaggcagcggcaccaaccaccagcacgagtgcaacaacagcaacaccaacaccgccaacgcaaaggctaacaccaaaacgacaacgtctcccgccgccagtaacatcaatgccggtggcggcggcagcagcgacaaccgcggttacgtgcccatcagcgagagcggccacaacgacggcagcgacgacctggagaagctggaggaagggctcatggtggccacgagtggcggctgcggcgacgcgttaggcgtcgacacgaaggctggggacaagcagcagtgcagcaacggtggtgccggtacggcggagggaaatgcggggcagaggaggggctcggcgtcgtcggagagggccccgctgatcagtgtgggggacgacgaggaggccggggaggagaacgacggcgacggcggtggaggtggccacgtctagctagctgctaatcaaccagcgtggtcgatccatccatcgattaattctggagaggttttgatcgtacgtacgtaggctatgtttgacactgatcggccggtctccatttcatctttctctccatcttgatttgggggtgaggtttagttttgtctgtataaccaagctgagcagctaattaatgagagtattcaggaaaaaaaaagagggagaaaaaaacatatatattcttcccttatttttcttaattaattatacttctatgtacaaatactaattagtttgggtgtaaattataattaaatcaattgatggtgattaattaag
GS3.1 Gene sequence (HP Source; SEQ ID NO: 8)
atgtgcaactccggcaccagctcctcgccgtcggcgcctgcgccgccgccgccgccgctcacctcgttcaagcactcctcccacctcctccgcctcgtcgacgatgacgccgacgacggccatgcgctgctgctctccaaggtaaaacacgcggtacatatgctgtagtaatacttacccgcggcttggtaattttgatggcgtgaacagaacatgtaggccattatatcaaagagctaatgcaagaagcacgcatagcgacatagctggctggctggctggttgtttaatgcttatttactagtagctaggcatcactggcagtaacagtaacgagaaagaaaaggaaagctccagctgttgggaaatggcagagctgatcaatacgtccatgcacacgaacagctgatcgagacgacgacgacgttgctttgcttgctttgcttgttggtttctaacatgcgtgagtgcgtgtgtctcccaggtggccggcgaggcgcaggcgatcgggcgggtgtcggtgccgatggcggtgactgggctcgtcatgtactcgcgggcgctcatctcgatgctgttccttggccggctcggcgagctggccctcgccggagggtcgctggcgctcggcttcgccaacatcaccggctactcggtgctctccgggctggcgctcgggatggagcccatctgcggccaggcgttcggcgcgcgccgcgggaagctgctggcgctggcgctccaccgcaccgtgctgctgctgctcgccgtcgcgctgcccatctccctcctgtgggtgacgtccacggggtacatactgaagcagctcggccaggacgagggcgtggcggacgcggcgcagacgttcgcggcgtacgcgtcggccgacctggcggtgctcgccgtgctgcacccgctccgcgtctacctccggtcgcagaacctgacgctgcccatcaccgcctgctcgctcttctccgtgctgctgcacgggcccatcaactacctcctcgtcgtgcgcctccgcatgggcgtcgccggcgtcgcgctcgccgtcgcgctcaccgaccttaacctgctcctcgcgctcctctgcttcctcgccatctccggggcccacagggactcgtgggtggggcccacctccgactgcctccgcgggtggccggcgctgctccgcctcgccgtgccgaccgccaccgcggtgtgcctcgagtggtggtggtacgagctcatgatcgtgctgtcgggcctcctcgccaaTccgcgcgccaccgtggcgtccatgggcatcctcatccaggccacgtcgctcgtctacgtgttcccgtcctccctcggccagggcgcgtccacgcgcgtcagccaccagctcggcgcgggcaggcccgcgggggcgcgccgcgcggccggcgccgccctctccatcggcctcgtcgtcggcgcggcggccgccaccttcatggtgtcggtccgcagccactggggccgcatgttcacgtcggacggcgagatcctccgcctcacggccgtggcgctccccatcgcggggctctgcgagctcggcaactgcccgcagacggccgggtgcggcgtcctccgcggcagcgcccgcccggccagcggcgcgcgcatcaacctcgcctccttctacctggtcggcatgccggtcggcgtggcgctggcattcggcgcccgcctaggcttcgccgggctgtggctgggcctccttgccgcgcaggctgcctgcgcggtgtggatggcgcgcgccgtggccgccaccgactgggacgtcgaggtggcgcgtgccaaggagctgaccaaggcgtccactacaggcagcggcaccaaccaccagcacgagtgcaacaacagcaacaccaacaccgccaacgcaaaggctaacaccaaaacgacaacgtctcccgccgccagtaacatcaatgccggtggcggcggcagcagcgacaaccgcggttacgtgcccatcagcgagagcggccacaacgacggcagcgacgacctggagaagctggaggaagggctcatggtggccacgagtggcggctgcTGCGGCTGCggcgacgcgttaggcgtcgacacgaaggctggggacaagcagcagtgcagcaacggtggtgccggtacggcggagggaaatgcggggcagaggaggggctcggcgtcgtcggagagggccccgctgatcagtgtgggggacgacgaggaggctggggaggagcacgacggcgacggcggtggaggtggccacgtctagctagctgctaatcaaccagcgtggtcgatccatccatcgattaattctggagaggttttgatcgtacgtacgtaggctatgtttgacactgatcggccggtctccatttcatctttctctccatcttgatttgggggtgaggtttagttttgtctgtataaccaagctgagcagctaattaatgagagtattcaggaaaaaaaaagagggagaaaaaaacatatatattcttcccttatttttcttaattaattatacttctatgtacaaatactaattagtttgggtgtaaattataattaaatcaattgatggtgattaattaag
GS3.1 HJX Promoter sequence (SEQ ID NO: 2) (HJX source):
>tgtagctgtgcgatatcctagcttaaatatgtagttccgggataaatttggtgtttaagctgtagtgttgtaatacatcatcttaaatatgtaattttgtattagtttgatcaaaatatctgttgttttgtgaaatttactcttatatatatataatgtgtacaaaatcattgtatttatataaacaggagctataattgtatatcaaatacaaagatacttttagataaactttaatttagctcagtacaagattgtgctggaattttggctagttaaaaataaaatttaatgaccaaagttgtacctggagatcatgttggtatccaaaacttactgtgactagagagggaacaatttgatagaatctcaactctggtttaaagaaaaaaaaaagggtaattggtactccagctagcattccaattcatcccagagattgtattacttgagacatgtgaaacatttttgttgtgcataatttgactactgtataatttaatattaattgtattggttttctttgacatggagattgtgtcttagttatgagaaaatttaattaattgcgcagatatttttggaacgacagctagctatttcagcacagagagatactagctagcattacacaataagctgctgcagcttaagtgggaggcactgaaatgctacacgttagacctgatactctttagctggaggattcctcctgaacgccgcaaagaaggccacctggataaaaaagggcaatggaggtgactcagtcaagttgagcaaggaacaaattcagtatgcagctgcatatatcgggcaatcttacggccagggaagcaaatgcaaagtccaccccaaaactgttgaggatgctttgggcgtttgcagcagaactgtagaaggaacagatactactactacaactactgaaaagctttgctccagaatgcaagagaatgaaaaaggtacaacgaagttagatggggagcaacaaggtgaaaggttggtggattgtacttgtaaggacgggaaaatcaatcagctacctcaactgtaccattgccatcttcagattaaaatggcagagaatttcttcttaagaaaaatagtactagtaaccaaattcctgcaggcttgcaggtaaggacaacagggcaaagagtaaataagagtacatgcatgcatttttctgcacagatcaggggcacagggtcgcaggatgcgcatggtgtttaattcgaacaaataaatcagctctagctagatcgcaaaatcctgtactggccatcagaattcagaactaaggatcaatgctagctgccactctgaaaagagggggaggaaaagttattctcctcatttctttcacagggaccaccatcagctgctgtgctcgagtagcagtgaacaatggagcgagagacaaagctataggcagcagcgaggagtgagctagcactgatactactgggcgtatatgatcagctcgccattgtcatcgagcatttgagctgagctgaagctgaagctgaacttaattctctcctctctccgtgctgttttggtattgaatgtaggatcaaccgatcgatgcatcaattaagctcgcacaggcgcagggccctgacgaacgaacgaactaacgagtaacgatgcttatcctagcctcgctcctgtcattctgtgcgtgaactcaatgcagtacacttcaccagtacagccatcatttctgggtgcccctggctgctgtgcatatcatgtaaatgcttgcctagattagcccccctcactgacgtccatccaacgtcgacagcttagcccatgcacgtatgtagtagcccgtcctacacctagcagtagtcacccccacaagcaatcaaaagtaaaagtgaaaacaacagttcacacaaattatactcgatcgtaatagtagcactactcgccatgtcccgacctcagattgatctttccgtccgtccattcgtccatccattctaatccggcaatcgcatcaagttcgccggatggtggtggtgcagttaaatcaggcatactagtggtggtgaatgttggcgatagaggtaaggtttaactccactggagcgggatagtagctagccgctggacccgttggttccgacagtggcgaaaaatatgccattccgcggggggcgaagagataggggaattttcagacagccgcatatatcccccgcttgggctggcgagaggcgatcgatcgatcgatcgggcgagatatattccgttccaccccccggccatggccgggaaattcccccaccggcagacacgccctcgtctccctcccccacgcacccactcgtgcgcgcgcgcgcgtgtatatatatataggcagaggaggccacaccctccagggcaacccaaatcaccaacaccactacactacacacaccactgcgacctgacctgaacctgatcacacacacacacacacacacactctctctctttctctgtgctcagtgctcacctctctggaaggagaccaaaaggccaaagagaaacacgagcaccaaccaacacagctgagccagagcccagagcgctagagccagcgggagatagccagtcaaatgtacttgtagcgctctctcgcacagcccggcgaccaatctccagaggacagcgagcgagctgcttccttcaagctttgtttcttctcctccaaacagcgcgcgctttttgtgtactccccgagagttgacagccgtcgtcgtcgtcacc
GS3.1 HP Promoter sequence (SEQ ID NO: 3) (HP 1 source):
>tgtagctgtgcgatatcctagcttaaatatgtagttccgggataaatttggtgtttaagctgtagtgttgtaatacatcatcttaaatatgtaattttgtattagtttgatcaaaatatctgttgttttgtgaaatttactcttatatatatatatatatatatatatatataatgtgtacaaaatcattgtatttatataaacaggagctataattgtatatcaaatacaaagatacttttagataaactttaatttagctcagtacaagattgtgctggaattttggctagttaaaaataaaatttaatgaccaaagttgtacctggagatcatgttggtatccaaaacttactgtgactagagagggaacaatttgatagaatcacaactctggtttaaagaaaaaaaaaaaagggtaattggtactccagctagcattccaattcatccctgagattgtattacttgagacatgtgaaacatttttgttgtgcataatttgactactgtataatttaatattaattgtattggttttctttgacatggagattttgtcttagttatgagaaaatttaattaattgcgcagatatttttggaacgacagctagctatttcagcacagagagatgctagctagcattacacaataagctgctgcagcttaagtgggaggcactgaaatcctacacgttagacctgatactctttagctggaggattcctcctgaacgccgcaaagaaggccacctggataaaaaagggcaatggaggtgactcagtcaagttgagcaaggaacaaattcagtatgcagctgcatatatcgggcaatcttacggccagggaagcaaatgcaaagtccaccccaaaactgttgaggatgctttgggcgtttgcagcagaactgtagaaggaacagatactactactacaactactgaaaagctttgctccagaatgcaagagaatgaaaaaggtacaacgaagttacatggggagcaacaaggtgaaaggttggtggattgtacttgtaaggacgggaaaatcaatcagctacctcaactgtaccattgccatcttcagattaaaatggcagagaatttcttcttaagaaaaatagtactagtaaccaaattcctgcaggcttgcaggtaaggacgacagggcaaagagtaaataagagtacatgcatgcatttttctgcacagatcaggggcacagggtcgcaggatgcgcatggtgtttaattcgaacaaataaatcagctctagctagatcgcaaaatcctgtactggccatcagaattcagaactaaggatcaatgctagctgccactctgaaaagagggagaggaaaagttattctcctcatttctttcacagggaccaccatcagctgctgtgctcgagtagcagtgaacaatggagcgagagacaaagctataggcagcagcgaggagtgagctagcactgatactactgggcgtgatcagctcgccattgtcatcgagcatttgagctgagctgaagctgaagctgaacttaattctctcctctctccgtgctgttttggtattgaatgtaggatcaaccgatcgatgcatcaattaagctcgcacaggcgcagggccctgacgaacgaacgaactaacgagtaacgatgcttatcctagcctcgctcctgtcattctctgcgtgaactcaatgcagtacacttcaccagtacagccatcatttctgggtgcccctggctgctgtgcatatcatgtaaatgcttgcctagattagcccccctcactgacgtccatccaacgtcgacagcttagcccatgcacgtatgtagtagcccgtccaacacctagcagtagtcacccccacaagcaatcaaaagtaaaagtgaaaacaacagttcacacaaattatactcgatcgtaatagtagcactactcgccatgtcccgacctcagattgatctttccgtccgtccattcgtccatccattctaatccggcaatcgcatcaagttcgccggatggtggtggtgcagttaaatcaggcatactagtggtggtgaatgttggcgatagaggtaaggtttaactccactggagcgggatagtagctagccgctggacccgttggttccgacagtggcgaaaaatatgccattccgcggggggcgaagagataggggaattttcagacagccgcatatatcccccgcttgggctggcgagaggcgatcgatcgatcgatcgggcgagatatattccgttccaccccccggccatggccgggaaattcccccaccggcagacacgctctcgtctccctcccccacgcacccactcgtgcgcgcgcgcgcgtgtatatatatataggcagaggaggccacaccctccagggcaacccaaatcaccaacaccactacactacacacaccactgcgacctgacctgaacctgatcacacacacacactctctctctttctctgtgctcagtgctcacctctctggaaggagaccaaaaggccaaagagaaacacgagcaccaaccaacacagctgagccagagcccagagcgctagagccagcgggagatagccagtcaaatgtacttgtagcgctctctcgcacagcccggcgaccaatctccagaggacagcgagcgagctgcttccttcaagctttgtttcttctcctccaaacagcgcgcgctttttgtgtactccccgagagttgacagccgtcgtcgtcgtcacc
GS3.1 HJX coding region sequence (SEQ ID NO: 4) (HJX source):
>atgtgcaactccggcaccagctcctcgccgtcggcgcctgcgccgccgccgccgccgctcacctcgttcaagcactcctcccacctcctccgcctcgtcgacgatgacgccgacgacggccatgcgctgctgctctccaaggtggccggcgaggcgcaggcgatcgggcgggtgtcggtgccgatggcggtgacggggctcgtcatgtactcgcgggcgctcatctcgatgctgttccttggccggctcggcgagctggccctcgccggagggtcgctagcgctcggcttcgccaacatcaccggctactcggtgctctccgggctggcgctcgggatggagcccatctgcggccaggcgttcggcgcgcgccgcgggaagctgctggcgctggcgctccaccgcaccgtgctgctgctgctcgccgtcgcgctgcccatctccctcctgtgggtgacgtccacggggtacatactgaagcagctcggccaggacgagggcgtggcggacgcggcgcagacgttcgcggcgtacgcgtcggccgacctggcggtgctcgccgtgctgcacccgctccgcgtctacctccggtcgcagaacctgacgctgcccatcaccgcctgctcgctcttctccgtgctgctgcacgggcccatcaactacctcctcgtcgtgcgcctccgcatgggcgtcgccggcgtcgcgctcgccgtcgcgctcaccgaccttaacctgctcctcgcgctcctctgcttcctcgccatctccggggcccacagggactcgtgggtggggcccacctccgactgcctccgcgggtggccggcgctgctccgcctcgccgtgccgaccgccaccgcggtgtgcctcgagtggtggtggtacgagctcatgatcgtgctgtcgggcctcctcgccaacccgcgcgccaccgtggcgtccatgggcatcctcatccaggccacgtcgctcgtctacgtgttcccgtcctccctcggccagggcgcgtccacgcgcgtcagccaccagctcggcgcgggcaggcccgcgggggcgcgccgcgcggccggcgccgccctctccatcggcctcgtcgtcggcgcggcggccgccaccttcatggtgtcggtccgcagccactggggccgcatgttcacgtcggacggcgagatcctccgcctcacggccgtggcgctccccatcgcggggctctgcgagctcggcaactgcccgcagacggccgggtgcggcgtcctccgcggcagcgcccgcccggccagcggcgcgcgcatcaacctcgcctccttctacctggtcggcatgccggtcggcgtggcgctggcattcggcgcccgcctaggcttcgccgggctgtggctgggcctccttgccgcgcaggctgcctgcgcggtgtggatggcgcgcgccgtggccgccaccgactgggacgtcgaggtggcgcgtgccaaggagctgaccaaggcgtccactacaggcagcggcaccaaccaccagcacgagtgcaacaacagcaacaccaacaccgccaacgcaaaggctaacaccaaaacgacaacgtctcccgccgccagtaacatcaatgccggtggcggcggcagcagcgacaaccgcggttacgtgcccatcagcgagagcggccacaacgacggcagcgacgacctggagaagctggaggaagggctcatggtggccacgagtggcggctgcggcgacgcgttaggcgtcgacacgaaggctggggacaagcagcagtgcagcaacggtggtgccggtacggcggagggaaatgcggggcagaggaggggctcggcgtcgtcggagagggccccgctgatcagtgtgggggacgacgaggaggccggggaggagaacgacggcgacggcggtggaggtggccacgtctag
GS3.1 HP coding region sequence (SEQ ID NO: 5) (HP 1 source, 6 sequence difference sites compared to HJX, the natural mutation site is shown underlined):
>atgtgcaactccggcaccagctcctcgccgtcggcgcctgcgccgccgccgccgccgctcacctcgttcaagcactcctcccacctcctccgcctcgtcgacgatgacgccgacgacggccatgcgctgctgctctccaaggtggccggcgaggcgcaggcgatcgggcgggtgtcggtgccgatggcggtgactgggctcgtcatgtactcgcgggcgctcatctcgatgctgttccttggccggctcggcgagctggccctcgccggagggtcgctggcgctcggcttcgccaacatcaccggctactcggtgctctccgggctggcgctcgggatggagcccatctgcggccaggcgttcggcgcgcgccgcgggaagctgctggcgctggcgctccaccgcaccgtgctgctgctgctcgccgtcgcgctgcccatctccctcctgtgggtgacgtccacggggtacatactgaagcagctcggccaggacgagggcgtggcggacgcggcgcagacgttcgcggcgtacgcgtcggccgacctggcggtgctcgccgtgctgcacccgctccgcgtctacctccggtcgcagaacctgacgctgcccatcaccgcctgctcgctcttctccgtgctgctgcacgggcccatcaactacctcctcgtcgtgcgcctccgcatgggcgtcgccggcgtcgcgctcgccgtcgcgctcaccgaccttaacctgctcctcgcgctcctctgcttcctcgccatctccggggcccacagggactcgtgggtggggcccacctccgactgcctccgcgggtggccggcgctgctccgcctcgccgtgccgaccgccaccgcggtgtgcctcgagtggtggtggtacgagctcatgatcgtgctgtcgggcctcctcgccaatccgcgcgccaccgtggcgtccatgggcatcctcatccaggccacgtcgctcgtctacgtgttcccgtcctccctcggccagggcgcgtccacgcgcgtcagccaccagctcggcgcgggcaggcccgcgggggcgcgccgcgcggccggcgccgccctctccatcggcctcgtcgtcggcgcggcggccgccaccttcatggtgtcggtccgcagccactggggccgcatgttcacgtcggacggcgagatcctccgcctcacggccgtggcgctccccatcgcggggctctgcgagctcggcaactgcccgcagacggccgggtgcggcgtcctccgcggcagcgcccgcccggccagcggcgcgcgcatcaacctcgcctccttctacctggtcggcatgccggtcggcgtggcgctggcattcggcgcccgcctaggcttcgccgggctgtggctgggcctccttgccgcgcaggctgcctgcgcggtgtggatggcgcgcgccgtggccgccaccgactgggacgtcgaggtggcgcgtgccaaggagctgaccaaggcgtccactacaggcagcggcaccaaccaccagcacgagtgcaacaacagcaacaccaacaccgccaacgcaaaggctaacaccaaaacgacaacgtctcccgccgccagtaacatcaatgccggtggcggcggcagcagcgacaaccgcggttacgtgcccatcagcgagagcggccacaacgacggcagcgacgacctggagaagctggaggaagggctcatggtggccacgagtggcggctgctgcggctgcggcgacgcgttaggcgtcgacacgaaggctggggacaagcagcagtgcagcaacggtggtgccggtacggcggagggaaatgcggggcagaggaggggctcggcgtcgtcggagagggccccgctgatcagtgtgggggacgacgaggaggctggggaggagcacgacggcgacggcggtggaggtggccacgtctag
GS3.1 HJX is of protein sequence (SEQ ID NO: 6) (HJX origin)
>MCNSGTSSSPSAPAPPPPPLTSFKHSSHLLRLVDDDADDGHALLLSKVAGEAQAIGRVSVPMAVTGLVMYSRALISMLFLGRLGELALAGGSLALGFANITGYSVLSGLALGMEPICGQAFGARRGKLLALALHRTVLLLLAVALPISLLWVTSTGYILKQLGQDEGVADAAQTFAAYASADLAVLAVLHPLRVYLRSQNLTLPITACSLFSVLLHGPINYLLVVRLRMGVAGVALAVALTDLNLLLALLCFLAISGAHRDSWVGPTSDCLRGWPALLRLAVPTATAVCLEWWWYELMIVLSGLLANPRATVASMGILIQATSLVYVFPSSLGQGASTRVSHQLGAGRPAGARRAAGAALSIGLVVGAAAATFMVSVRSHWGRMFTSDGEILRLTAVALPIAGLCELGNCPQTAGCGVLRGSARPASGARINLASFYLVGMPVGVALAFGARLGFAGLWLGLLAAQAACAVWMARAVAATDWDVEVARAKELTKASTTGSGTNHQHECNNSNTNTANAKANTKTTTSPAASNINAGGGGSSDNRGYVPISESGHNDGSDDLEKLEEGLMVATSGGCGDALGVDTKAGDKQQCSNGGAGTAEGNAGQRRGSASSERAPLISVGDDEEAGEENDGDGGGGGHV
GS3.1HP (SEQ ID NO: 7) (HP 1 source, compared to HJX, CGC 3 amino acid residues inserted between positions 576 and 577, position 631N to H, underlined to present the natural variant amino acid site):
>MCNSGTSSSPSAPAPPPPPLTSFKHSSHLLRLVDDDADDGHALLLSKVAGEAQAIGRVSVPMAVTGLVMYSRALISMLFLGRLGELALAGGSLALGFANITGYSVLSGLALGMEPICGQAFGARRGKLLALALHRTVLLLLAVALPISLLWVTSTGYILKQLGQDEGVADAAQTFAAYASADLAVLAVLHPLRVYLRSQNLTLPITACSLFSVLLHGPINYLLVVRLRMGVAGVALAVALTDLNLLLALLCFLAISGAHRDSWVGPTSDCLRGWPALLRLAVPTATAVCLEWWWYELMIVLSGLLANPRATVASMGILIQATSLVYVFPSSLGQGASTRVSHQLGAGRPAGARRAAGAALSIGLVVGAAAATFMVSVRSHWGRMFTSDGEILRLTAVALPIAGLCELGNCPQTAGCGVLRGSARPASGARINLASFYLVGMPVGVALAFGARLGFAGLWLGLLAAQAACAVWMARAVAATDWDVEVARAKELTKASTTGSGTNHQHECNNSNTNTANAKANTKTTTSPAASNINAGGGGSSDNRGYVPISESGHNDGSDDLEKLEEGLMVATSGGCCGCGDALGVDTKAGDKQQCSNGGAGTAEGNAGQRRGSASSERAPLISVGDDEEAGEEHDGDGGGGGHV
example 2, GS3.1 influencing glume development by its expression in young ears to regulate cell elongation
The present inventors observed the size and number of exoglume mastoid cells in the mature glume grain length direction by scanning electron microscopy. Observations showed that the papilla cell length of NIL-GS3.1HP was significantly increased compared to NIL-GS3.1HJX without significant change in number (fig. 4 a-c). By observing the number and width of mastoid cells in the cross section where the mature glumes were statistically widest, an increase in cell width was found without significant change in cell number (fig. 4 d-f).
The inventors then constructed a transgenic construction of the GS3.1 promoter (a fragment of about 2.7 kbp upstream of the gene) driving GUS and explored the tissue differential expression pattern of GS3.1 by GUS staining on different tissues of the constructed positive plants. The staining results showed that GS3.1 was expressed in young ears, internodes, leaves and glumes (FIGS. 5 a-e). Meanwhile, the inventors observed that the expression site of GS3.1 in mature tissues such as leaf and vascular bundles were highly overlapped, and thus the inventors performed resin slicing on the young leaves after staining, and found that GS3.1 was mainly expressed in the sieve tube in vascular tissues (FIG. 5 c).
The inventors also analyzed the relative expression levels of GS3.1 in young ear, root, node, internode and leaf tissues using qRT-RCP technology. The results showed that, compared to NIL-GS3.1HJX, NIL-GS3.1HP was expressed in roots, leaves and slightly larger young ears with a slight decrease in internodes and a decrease to 57.6% in 3-5 cm young ears (fig. 5 g), suggesting that GS3.1 caused a grain-type difference between near isogenic lines due to its difference in expression in 3-5 cm young ears.
By combining the demonstration, GS3.1 is expressed in young ears so as to regulate and control the extension of glume cells, so that the glume size is changed, and the grain type is regulated and controlled.
Example 3, GS3.1 encoding a very conserved MATE transporter capable of transporting p-coumaric acid in crops
The inventors first verified whether GS3.1 has the essential function of MATE transporter by complementation of the function of MATE transporter gene acrB in E.coli. The acrB-knocked strain BW 25113. DELTA. AcrB in E.coli BW25113 lost the ability to grow normally on the plates of the antibiotic norfloxacin, and after GS3.1 expression therein with the vector pMAL-c5x, its growth on the plates of the antibiotic norfloxacin was restored under the conditions induced with IPTG, while the strain transformed only into empty pMAL-c5x did not exhibit this phenomenon of growth restoration (FIG. 6 a). Thus, it is thought that GS3.1 can function as a MATE transporter similar to acrB as MATE protein in E.coli.
The inventors then studied the protein conformation of GS3.1 by structural comparison, and similar to other MATE proteins, GS3.1 also had a 12 transmembrane alpha helix architecture (TM 1-12, FIG. 6 b). The three-dimensional structure of GS3.1 shows that the 12 alpha helical structures form a V-shaped transmembrane channel, and TM1-6 and TM7-12 are respectively arranged at two sides of the V-shape. Molecular docking calculations of some predicted candidate small molecules with this structural model found that p-coumaric acid, a small molecule, could bind to the interior of this channel structure, to the TM7-12 side of this structure and to TM7, the key alpha helix that determines the channel switch conformation (fig. 6 c).
In addition, the inventor selects the protein sequence and GS3.1 of the GS3.1 ortholog gene of common crops such as wheat, soybean, millet, corn, sorghum, millet and barley and wheat near-source species brachypodium distachyon HJX The protein sequences of (a) were aligned and found to have very high similarity (similarity: wheat= 77.4295%, soybean= 52.0073%, millet= 78.673%, corn= 80.7356%, sorghum= 77.1875%, millet= 78.6207%, barley= 78.2677%, brachypodium distachyon= 76.252%), especially GS3.1, played a very critical channel transmembrane domain (fig. 7).
Based on these results, GS3.1, a MATE transporter, was suggested to function to transport p-coumaric acid in young ears of rice and other crops.
Example 4, involvement of GS3.1 in the phenylpropane metabolic pathway, modulation of flavone and lignin synthesis
The GS 3.1-based transport of p-coumaric acid is possible and thus involved in plant metabolic processes. The inventors performed extensive targeted metabonomic detection of GS3.1 on knockout lines of japonica rice WYJ (9522) and young ears of control wild type 9522. First, a significant change in some major metabolites in the phenylpropane pathway, including p-coumaric acid, was observed between the two, summarizing that p-coumaric acid and an important class of flavones, naringenin, were significantly lower in GS3.1 knockout plants than in 9522 plants (fig. 8 a-b). While the other metabolic pathway, lignin synthesis pathway, with p-coumaric acid as substrate, contains a series of substances such as caffeic acid, ferulic acid, coniferyl alcohol and one class of monolignol larch-4-O-glucoside with significantly increased content (FIG. 8 c-f). Meanwhile, the inventors examined the lignin content in the leaves of GS3.1 plants overexpressed in HJX background, and found that lignin content in the overexpressed plants was reduced compared to control HJX (fig. 8 g).
The inventors further analyzed all flavonoids detected and found that the flavonoids detected showed a trend of reduced content in GS3.1 knockout plants compared to control 9522 (fig. 9 a). Thermographic analysis of all lignin species detected found that lignin showed an opposite trend of increasing content of flavonoids in GS3.1 knockout plants compared to control 9522 (fig. 9 b).
Meanwhile, the inventor regards near isogenic line NIL-GS3.1 HP And its control NIL-GS3.1 HJX The same measurement was performed on young ears of (E) and found to be larger in the form of NIL-GS3.1 HP Similar trends were also shown in young ears of (a) such as reduced content of the flavonoid naringenin and increased content of the lignin precursor coniferyl alcohol (fig. 10 a-f).
The result suggests that GS3.1 regulates grain type by regulating biosynthesis of flavone and lignin in young ears.
Example 5 GS3.1 Regulation of phenylpropane metabolism, regulation of auxin and gibberellin passage and thus Regulation of granulization
The inventors further examined the expression level of the gene involved in the metabolism of phenylpropane in the knock-out line of japonica rice WYJ (9522) and in the young ear of control wild type 9522 by qRT-PCR technique, and found that gene 4CL catalyzing p-coumaric acid to p-coumaric acid coa in the GS3.1 knock-out mutant, gene CHS responsible for catalyzing p-coumaric acid coa to naringin, and that both important hydroxylases F3H and F3' H were down-regulated in flavone synthesis (fig. 11 a). The inventors examined two important plant hormones, auxin and gibberellin, related genes simultaneously that regulate glume development, found that the auxin transport channel gene PIN1b was up-regulated in the knockout mutant, the auxin synthesis gene YUCCA7, the auxin response genes ARF15 and ARF24 were also up-regulated, and the auxin inactivation gene GH3.8 was down-regulated (FIG. 11 a); it can be seen that auxin transport or synthesis in plants is promoted. Gibberellin inactivation gene GA20x10 in gibberellin pathway is down-regulated and two granule-related gibberellin response genes GRF1 and GRF6 are up-regulated (FIG. 11 b); it can be seen that gibberellin transport or synthesis is promoted in plants.
The present inventors have found that the near isogenic line NIL-GS3.1 HP And its control NIL-GS3.1 HJX The same test was performed on young ears of (C), and it was found that it also had a similar tendency, i.e., in NIL-GS3.1 with a larger grain size HP When the genes involved in the synthesis of medium flavonoids were down-regulated and the auxin and gibberellin pathways were activated (FIGS. 12 a-b).
This result shows that GS3.1 controls the synthesis of flavones, thereby affecting the transport and synthesis of auxins and gibberellin synthesis, and further altering the expression of auxins and gibberellin response genes, thereby controlling the grain type.
Example 6 GS3.1 allele of African rice HP1 did not affect leaf tissue metabolism
Because GS3.1 can affect the phenylpropane metabolic pathway, its african rice allele will reduce the flavone content in young ears. Flavone is a small molecular compound with stress resistance, and the reduction of the flavone content in plants possibly affects the stress resistance of the plants. By the method for near isogenic line NIL-GS3.1 HP And its control NIL-GS3.1 HJX The analysis of the expression level of GS3.1 in (2) shows that the expression of the gene mainly has obvious difference in young ears with the length of 3-5cm, namely NIL-GS3.1 HP The expression level of (C) is obviously lower than that of NIL-GS3.1 HJX While other tissues, including the leaves, are less diverse (fig. 5). Thus, it was suggested that the allele of GS3.1 african rice HP1 did not affect the flavone metabolism in the leaves.
To verify this conjecture, the inventors performed on NIL-GS3.1 HP And NIL-GS3.1 HJX The leaves of (2) were subjected to metabonomics measurements in which the heat map drawn from the relative amounts of all flavonoids measured showed that GS3.1 between near isogenic lines did not cause the amount of flavonoids in the leavesIt was further assumed that the GS3.1 allele of African rice HP1 increased grain size and increased yield, and did not cause a decrease in plant resistance to stress (FIG. 13).
All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.
Sequence listing
<110> molecular plant science Excellent innovation center of China academy of sciences
<120> a grain type and yield control gene and use thereof
<130> 211333
<160> 44
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2587
<212> DNA
<213> Oryza sativa L.
<400> 1
atgtgcaact ccggcaccag ctcctcgccg tcggcgcctg cgccgccgcc gccgccgctc 60
acctcgttca agcactcctc ccacctcctc cgcctcgtcg acgatgacgc cgacgacggc 120
catgcgctgc tgctctccaa ggtaaaacac gcggtacata tgctgtagta atacttaccc 180
gcggcttggt aattttgatg gcgtgaacag aacatgtagg ccattatatc aaagagctaa 240
tgcaagaagc acgcatagcg acatagctgg ctggctggct ggttgtttaa tgcttattta 300
ctagtagcta ggcatcactg gcagtaacag taacgagaaa gaaaaggaaa gctccagctg 360
ttgggaaatg gcagagctga tcaatacgtc catgcacacg aacagctgat cgagacgacg 420
acgacgttgc tttgcttgtt ggtttctaac atgcgtgagt gcgtgtgtct cccaggtggc 480
cggcgaggcg caggcgatcg ggcgggtgtc ggtgccgatg gcggtgacgg ggctcgtcat 540
gtactcgcgg gcgctcatct cgatgctgtt ccttggccgg ctcggcgagc tggccctcgc 600
cggagggtcg ctagcgctcg gcttcgccaa catcaccggc tactcggtgc tctccgggct 660
ggcgctcggg atggagccca tctgcggcca ggcgttcggc gcgcgccgcg ggaagctgct 720
ggcgctggcg ctccaccgca ccgtgctgct gctgctcgcc gtcgcgctgc ccatctccct 780
cctgtgggtg acgtccacgg ggtacatact gaagcagctc ggccaggacg agggcgtggc 840
ggacgcggcg cagacgttcg cggcgtacgc gtcggccgac ctggcggtgc tcgccgtgct 900
gcacccgctc cgcgtctacc tccggtcgca gaacctgacg ctgcccatca ccgcctgctc 960
gctcttctcc gtgctgctgc acgggcccat caactacctc ctcgtcgtgc gcctccgcat 1020
gggcgtcgcc ggcgtcgcgc tcgccgtcgc gctcaccgac cttaacctgc tcctcgcgct 1080
cctctgcttc ctcgccatct ccggggccca cagggactcg tgggtggggc ccacctccga 1140
ctgcctccgc gggtggccgg cgctgctccg cctcgccgtg ccgaccgcca ccgcggtgtg 1200
cctcgagtgg tggtggtacg agctcatgat cgtgctgtcg ggcctcctcg ccaacccgcg 1260
cgccaccgtg gcgtccatgg gcatcctcat ccaggccacg tcgctcgtct acgtgttccc 1320
gtcctccctc ggccagggcg cgtccacgcg cgtcagccac cagctcggcg cgggcaggcc 1380
cgcgggggcg cgccgcgcgg ccggcgccgc cctctccatc ggcctcgtcg tcggcgcggc 1440
ggccgccacc ttcatggtgt cggtccgcag ccactggggc cgcatgttca cgtcggacgg 1500
cgagatcctc cgcctcacgg ccgtggcgct ccccatcgcg gggctctgcg agctcggcaa 1560
ctgcccgcag acggccgggt gcggcgtcct ccgcggcagc gcccgcccgg ccagcggcgc 1620
gcgcatcaac ctcgcctcct tctacctggt cggcatgccg gtcggcgtgg cgctggcatt 1680
cggcgcccgc ctaggcttcg ccgggctgtg gctgggcctc cttgccgcgc aggctgcctg 1740
cgcggtgtgg atggcgcgcg ccgtggccgc caccgactgg gacgtcgagg tggcgcgtgc 1800
caaggagctg accaaggcgt ccactacagg cagcggcacc aaccaccagc acgagtgcaa 1860
caacagcaac accaacaccg ccaacgcaaa ggctaacacc aaaacgacaa cgtctcccgc 1920
cgccagtaac atcaatgccg gtggcggcgg cagcagcgac aaccgcggtt acgtgcccat 1980
cagcgagagc ggccacaacg acggcagcga cgacctggag aagctggagg aagggctcat 2040
ggtggccacg agtggcggct gcggcgacgc gttaggcgtc gacacgaagg ctggggacaa 2100
gcagcagtgc agcaacggtg gtgccggtac ggcggaggga aatgcggggc agaggagggg 2160
ctcggcgtcg tcggagaggg ccccgctgat cagtgtgggg gacgacgagg aggccgggga 2220
ggagaacgac ggcgacggcg gtggaggtgg ccacgtctag ctagctgcta atcaaccagc 2280
gtggtcgatc catccatcga ttaattctgg agaggttttg atcgtacgta cgtaggctat 2340
gtttgacact gatcggccgg tctccatttc atctttctct ccatcttgat ttgggggtga 2400
ggtttagttt tgtctgtata accaagctga gcagctaatt aatgagagta ttcaggaaaa 2460
aaaaagaggg agaaaaaaac atatatattc ttcccttatt tttcttaatt aattatactt 2520
ctatgtacaa atactaatta gtttgggtgt aaattataat taaatcaatt gatggtgatt 2580
aattaag 2587
<210> 2
<211> 2763
<212> DNA
<213> Oryza sativa L.
<400> 2
tgtagctgtg cgatatccta gcttaaatat gtagttccgg gataaatttg gtgtttaagc 60
tgtagtgttg taatacatca tcttaaatat gtaattttgt attagtttga tcaaaatatc 120
tgttgttttg tgaaatttac tcttatatat atataatgtg tacaaaatca ttgtatttat 180
ataaacagga gctataattg tatatcaaat acaaagatac ttttagataa actttaattt 240
agctcagtac aagattgtgc tggaattttg gctagttaaa aataaaattt aatgaccaaa 300
gttgtacctg gagatcatgt tggtatccaa aacttactgt gactagagag ggaacaattt 360
gatagaatct caactctggt ttaaagaaaa aaaaaagggt aattggtact ccagctagca 420
ttccaattca tcccagagat tgtattactt gagacatgtg aaacattttt gttgtgcata 480
atttgactac tgtataattt aatattaatt gtattggttt tctttgacat ggagattgtg 540
tcttagttat gagaaaattt aattaattgc gcagatattt ttggaacgac agctagctat 600
ttcagcacag agagatacta gctagcatta cacaataagc tgctgcagct taagtgggag 660
gcactgaaat gctacacgtt agacctgata ctctttagct ggaggattcc tcctgaacgc 720
cgcaaagaag gccacctgga taaaaaaggg caatggaggt gactcagtca agttgagcaa 780
ggaacaaatt cagtatgcag ctgcatatat cgggcaatct tacggccagg gaagcaaatg 840
caaagtccac cccaaaactg ttgaggatgc tttgggcgtt tgcagcagaa ctgtagaagg 900
aacagatact actactacaa ctactgaaaa gctttgctcc agaatgcaag agaatgaaaa 960
aggtacaacg aagttagatg gggagcaaca aggtgaaagg ttggtggatt gtacttgtaa 1020
ggacgggaaa atcaatcagc tacctcaact gtaccattgc catcttcaga ttaaaatggc 1080
agagaatttc ttcttaagaa aaatagtact agtaaccaaa ttcctgcagg cttgcaggta 1140
aggacaacag ggcaaagagt aaataagagt acatgcatgc atttttctgc acagatcagg 1200
ggcacagggt cgcaggatgc gcatggtgtt taattcgaac aaataaatca gctctagcta 1260
gatcgcaaaa tcctgtactg gccatcagaa ttcagaacta aggatcaatg ctagctgcca 1320
ctctgaaaag agggggagga aaagttattc tcctcatttc tttcacaggg accaccatca 1380
gctgctgtgc tcgagtagca gtgaacaatg gagcgagaga caaagctata ggcagcagcg 1440
aggagtgagc tagcactgat actactgggc gtatatgatc agctcgccat tgtcatcgag 1500
catttgagct gagctgaagc tgaagctgaa cttaattctc tcctctctcc gtgctgtttt 1560
ggtattgaat gtaggatcaa ccgatcgatg catcaattaa gctcgcacag gcgcagggcc 1620
ctgacgaacg aacgaactaa cgagtaacga tgcttatcct agcctcgctc ctgtcattct 1680
gtgcgtgaac tcaatgcagt acacttcacc agtacagcca tcatttctgg gtgcccctgg 1740
ctgctgtgca tatcatgtaa atgcttgcct agattagccc ccctcactga cgtccatcca 1800
acgtcgacag cttagcccat gcacgtatgt agtagcccgt cctacaccta gcagtagtca 1860
cccccacaag caatcaaaag taaaagtgaa aacaacagtt cacacaaatt atactcgatc 1920
gtaatagtag cactactcgc catgtcccga cctcagattg atctttccgt ccgtccattc 1980
gtccatccat tctaatccgg caatcgcatc aagttcgccg gatggtggtg gtgcagttaa 2040
atcaggcata ctagtggtgg tgaatgttgg cgatagaggt aaggtttaac tccactggag 2100
cgggatagta gctagccgct ggacccgttg gttccgacag tggcgaaaaa tatgccattc 2160
cgcggggggc gaagagatag gggaattttc agacagccgc atatatcccc cgcttgggct 2220
ggcgagaggc gatcgatcga tcgatcgggc gagatatatt ccgttccacc ccccggccat 2280
ggccgggaaa ttcccccacc ggcagacacg ccctcgtctc cctcccccac gcacccactc 2340
gtgcgcgcgc gcgcgtgtat atatatatag gcagaggagg ccacaccctc cagggcaacc 2400
caaatcacca acaccactac actacacaca ccactgcgac ctgacctgaa cctgatcaca 2460
cacacacaca cacacacact ctctctcttt ctctgtgctc agtgctcacc tctctggaag 2520
gagaccaaaa ggccaaagag aaacacgagc accaaccaac acagctgagc cagagcccag 2580
agcgctagag ccagcgggag atagccagtc aaatgtactt gtagcgctct ctcgcacagc 2640
ccggcgacca atctccagag gacagcgagc gagctgcttc cttcaagctt tgtttcttct 2700
cctccaaaca gcgcgcgctt tttgtgtact ccccgagagt tgacagccgt cgtcgtcgtc 2760
acc 2763
<210> 3
<211> 2769
<212> DNA
<213> Oryza sativa L.
<400> 3
tgtagctgtg cgatatccta gcttaaatat gtagttccgg gataaatttg gtgtttaagc 60
tgtagtgttg taatacatca tcttaaatat gtaattttgt attagtttga tcaaaatatc 120
tgttgttttg tgaaatttac tcttatatat atatatatat atatatatat ataatgtgta 180
caaaatcatt gtatttatat aaacaggagc tataattgta tatcaaatac aaagatactt 240
ttagataaac tttaatttag ctcagtacaa gattgtgctg gaattttggc tagttaaaaa 300
taaaatttaa tgaccaaagt tgtacctgga gatcatgttg gtatccaaaa cttactgtga 360
ctagagaggg aacaatttga tagaatcaca actctggttt aaagaaaaaa aaaaaagggt 420
aattggtact ccagctagca ttccaattca tccctgagat tgtattactt gagacatgtg 480
aaacattttt gttgtgcata atttgactac tgtataattt aatattaatt gtattggttt 540
tctttgacat ggagattttg tcttagttat gagaaaattt aattaattgc gcagatattt 600
ttggaacgac agctagctat ttcagcacag agagatgcta gctagcatta cacaataagc 660
tgctgcagct taagtgggag gcactgaaat cctacacgtt agacctgata ctctttagct 720
ggaggattcc tcctgaacgc cgcaaagaag gccacctgga taaaaaaggg caatggaggt 780
gactcagtca agttgagcaa ggaacaaatt cagtatgcag ctgcatatat cgggcaatct 840
tacggccagg gaagcaaatg caaagtccac cccaaaactg ttgaggatgc tttgggcgtt 900
tgcagcagaa ctgtagaagg aacagatact actactacaa ctactgaaaa gctttgctcc 960
agaatgcaag agaatgaaaa aggtacaacg aagttacatg gggagcaaca aggtgaaagg 1020
ttggtggatt gtacttgtaa ggacgggaaa atcaatcagc tacctcaact gtaccattgc 1080
catcttcaga ttaaaatggc agagaatttc ttcttaagaa aaatagtact agtaaccaaa 1140
ttcctgcagg cttgcaggta aggacgacag ggcaaagagt aaataagagt acatgcatgc 1200
atttttctgc acagatcagg ggcacagggt cgcaggatgc gcatggtgtt taattcgaac 1260
aaataaatca gctctagcta gatcgcaaaa tcctgtactg gccatcagaa ttcagaacta 1320
aggatcaatg ctagctgcca ctctgaaaag agggagagga aaagttattc tcctcatttc 1380
tttcacaggg accaccatca gctgctgtgc tcgagtagca gtgaacaatg gagcgagaga 1440
caaagctata ggcagcagcg aggagtgagc tagcactgat actactgggc gtgatcagct 1500
cgccattgtc atcgagcatt tgagctgagc tgaagctgaa gctgaactta attctctcct 1560
ctctccgtgc tgttttggta ttgaatgtag gatcaaccga tcgatgcatc aattaagctc 1620
gcacaggcgc agggccctga cgaacgaacg aactaacgag taacgatgct tatcctagcc 1680
tcgctcctgt cattctctgc gtgaactcaa tgcagtacac ttcaccagta cagccatcat 1740
ttctgggtgc ccctggctgc tgtgcatatc atgtaaatgc ttgcctagat tagcccccct 1800
cactgacgtc catccaacgt cgacagctta gcccatgcac gtatgtagta gcccgtccaa 1860
cacctagcag tagtcacccc cacaagcaat caaaagtaaa agtgaaaaca acagttcaca 1920
caaattatac tcgatcgtaa tagtagcact actcgccatg tcccgacctc agattgatct 1980
ttccgtccgt ccattcgtcc atccattcta atccggcaat cgcatcaagt tcgccggatg 2040
gtggtggtgc agttaaatca ggcatactag tggtggtgaa tgttggcgat agaggtaagg 2100
tttaactcca ctggagcggg atagtagcta gccgctggac ccgttggttc cgacagtggc 2160
gaaaaatatg ccattccgcg gggggcgaag agatagggga attttcagac agccgcatat 2220
atcccccgct tgggctggcg agaggcgatc gatcgatcga tcgggcgaga tatattccgt 2280
tccacccccc ggccatggcc gggaaattcc cccaccggca gacacgctct cgtctccctc 2340
ccccacgcac ccactcgtgc gcgcgcgcgc gtgtatatat atataggcag aggaggccac 2400
accctccagg gcaacccaaa tcaccaacac cactacacta cacacaccac tgcgacctga 2460
cctgaacctg atcacacaca cacactctct ctctttctct gtgctcagtg ctcacctctc 2520
tggaaggaga ccaaaaggcc aaagagaaac acgagcacca accaacacag ctgagccaga 2580
gcccagagcg ctagagccag cgggagatag ccagtcaaat gtacttgtag cgctctctcg 2640
cacagcccgg cgaccaatct ccagaggaca gcgagcgagc tgcttccttc aagctttgtt 2700
tcttctcctc caaacagcgc gcgctttttg tgtactcccc gagagttgac agccgtcgtc 2760
gtcgtcacc 2769
<210> 4
<211> 1926
<212> DNA
<213> Oryza sativa L.
<400> 4
atgtgcaact ccggcaccag ctcctcgccg tcggcgcctg cgccgccgcc gccgccgctc 60
acctcgttca agcactcctc ccacctcctc cgcctcgtcg acgatgacgc cgacgacggc 120
catgcgctgc tgctctccaa ggtggccggc gaggcgcagg cgatcgggcg ggtgtcggtg 180
ccgatggcgg tgacggggct cgtcatgtac tcgcgggcgc tcatctcgat gctgttcctt 240
ggccggctcg gcgagctggc cctcgccgga gggtcgctag cgctcggctt cgccaacatc 300
accggctact cggtgctctc cgggctggcg ctcgggatgg agcccatctg cggccaggcg 360
ttcggcgcgc gccgcgggaa gctgctggcg ctggcgctcc accgcaccgt gctgctgctg 420
ctcgccgtcg cgctgcccat ctccctcctg tgggtgacgt ccacggggta catactgaag 480
cagctcggcc aggacgaggg cgtggcggac gcggcgcaga cgttcgcggc gtacgcgtcg 540
gccgacctgg cggtgctcgc cgtgctgcac ccgctccgcg tctacctccg gtcgcagaac 600
ctgacgctgc ccatcaccgc ctgctcgctc ttctccgtgc tgctgcacgg gcccatcaac 660
tacctcctcg tcgtgcgcct ccgcatgggc gtcgccggcg tcgcgctcgc cgtcgcgctc 720
accgacctta acctgctcct cgcgctcctc tgcttcctcg ccatctccgg ggcccacagg 780
gactcgtggg tggggcccac ctccgactgc ctccgcgggt ggccggcgct gctccgcctc 840
gccgtgccga ccgccaccgc ggtgtgcctc gagtggtggt ggtacgagct catgatcgtg 900
ctgtcgggcc tcctcgccaa cccgcgcgcc accgtggcgt ccatgggcat cctcatccag 960
gccacgtcgc tcgtctacgt gttcccgtcc tccctcggcc agggcgcgtc cacgcgcgtc 1020
agccaccagc tcggcgcggg caggcccgcg ggggcgcgcc gcgcggccgg cgccgccctc 1080
tccatcggcc tcgtcgtcgg cgcggcggcc gccaccttca tggtgtcggt ccgcagccac 1140
tggggccgca tgttcacgtc ggacggcgag atcctccgcc tcacggccgt ggcgctcccc 1200
atcgcggggc tctgcgagct cggcaactgc ccgcagacgg ccgggtgcgg cgtcctccgc 1260
ggcagcgccc gcccggccag cggcgcgcgc atcaacctcg cctccttcta cctggtcggc 1320
atgccggtcg gcgtggcgct ggcattcggc gcccgcctag gcttcgccgg gctgtggctg 1380
ggcctccttg ccgcgcaggc tgcctgcgcg gtgtggatgg cgcgcgccgt ggccgccacc 1440
gactgggacg tcgaggtggc gcgtgccaag gagctgacca aggcgtccac tacaggcagc 1500
ggcaccaacc accagcacga gtgcaacaac agcaacacca acaccgccaa cgcaaaggct 1560
aacaccaaaa cgacaacgtc tcccgccgcc agtaacatca atgccggtgg cggcggcagc 1620
agcgacaacc gcggttacgt gcccatcagc gagagcggcc acaacgacgg cagcgacgac 1680
ctggagaagc tggaggaagg gctcatggtg gccacgagtg gcggctgcgg cgacgcgtta 1740
ggcgtcgaca cgaaggctgg ggacaagcag cagtgcagca acggtggtgc cggtacggcg 1800
gagggaaatg cggggcagag gaggggctcg gcgtcgtcgg agagggcccc gctgatcagt 1860
gtgggggacg acgaggaggc cggggaggag aacgacggcg acggcggtgg aggtggccac 1920
gtctag 1926
<210> 5
<211> 1935
<212> DNA
<213> Oryza sativa L.
<400> 5
atgtgcaact ccggcaccag ctcctcgccg tcggcgcctg cgccgccgcc gccgccgctc 60
acctcgttca agcactcctc ccacctcctc cgcctcgtcg acgatgacgc cgacgacggc 120
catgcgctgc tgctctccaa ggtggccggc gaggcgcagg cgatcgggcg ggtgtcggtg 180
ccgatggcgg tgactgggct cgtcatgtac tcgcgggcgc tcatctcgat gctgttcctt 240
ggccggctcg gcgagctggc cctcgccgga gggtcgctgg cgctcggctt cgccaacatc 300
accggctact cggtgctctc cgggctggcg ctcgggatgg agcccatctg cggccaggcg 360
ttcggcgcgc gccgcgggaa gctgctggcg ctggcgctcc accgcaccgt gctgctgctg 420
ctcgccgtcg cgctgcccat ctccctcctg tgggtgacgt ccacggggta catactgaag 480
cagctcggcc aggacgaggg cgtggcggac gcggcgcaga cgttcgcggc gtacgcgtcg 540
gccgacctgg cggtgctcgc cgtgctgcac ccgctccgcg tctacctccg gtcgcagaac 600
ctgacgctgc ccatcaccgc ctgctcgctc ttctccgtgc tgctgcacgg gcccatcaac 660
tacctcctcg tcgtgcgcct ccgcatgggc gtcgccggcg tcgcgctcgc cgtcgcgctc 720
accgacctta acctgctcct cgcgctcctc tgcttcctcg ccatctccgg ggcccacagg 780
gactcgtggg tggggcccac ctccgactgc ctccgcgggt ggccggcgct gctccgcctc 840
gccgtgccga ccgccaccgc ggtgtgcctc gagtggtggt ggtacgagct catgatcgtg 900
ctgtcgggcc tcctcgccaa tccgcgcgcc accgtggcgt ccatgggcat cctcatccag 960
gccacgtcgc tcgtctacgt gttcccgtcc tccctcggcc agggcgcgtc cacgcgcgtc 1020
agccaccagc tcggcgcggg caggcccgcg ggggcgcgcc gcgcggccgg cgccgccctc 1080
tccatcggcc tcgtcgtcgg cgcggcggcc gccaccttca tggtgtcggt ccgcagccac 1140
tggggccgca tgttcacgtc ggacggcgag atcctccgcc tcacggccgt ggcgctcccc 1200
atcgcggggc tctgcgagct cggcaactgc ccgcagacgg ccgggtgcgg cgtcctccgc 1260
ggcagcgccc gcccggccag cggcgcgcgc atcaacctcg cctccttcta cctggtcggc 1320
atgccggtcg gcgtggcgct ggcattcggc gcccgcctag gcttcgccgg gctgtggctg 1380
ggcctccttg ccgcgcaggc tgcctgcgcg gtgtggatgg cgcgcgccgt ggccgccacc 1440
gactgggacg tcgaggtggc gcgtgccaag gagctgacca aggcgtccac tacaggcagc 1500
ggcaccaacc accagcacga gtgcaacaac agcaacacca acaccgccaa cgcaaaggct 1560
aacaccaaaa cgacaacgtc tcccgccgcc agtaacatca atgccggtgg cggcggcagc 1620
agcgacaacc gcggttacgt gcccatcagc gagagcggcc acaacgacgg cagcgacgac 1680
ctggagaagc tggaggaagg gctcatggtg gccacgagtg gcggctgctg cggctgcggc 1740
gacgcgttag gcgtcgacac gaaggctggg gacaagcagc agtgcagcaa cggtggtgcc 1800
ggtacggcgg agggaaatgc ggggcagagg aggggctcgg cgtcgtcgga gagggccccg 1860
ctgatcagtg tgggggacga cgaggaggct ggggaggagc acgacggcga cggcggtgga 1920
ggtggccacg tctag 1935
<210> 6
<211> 641
<212> PRT
<213> Oryza sativa L.
<400> 6
Met Cys Asn Ser Gly Thr Ser Ser Ser Pro Ser Ala Pro Ala Pro Pro
1 5 10 15
Pro Pro Pro Leu Thr Ser Phe Lys His Ser Ser His Leu Leu Arg Leu
20 25 30
Val Asp Asp Asp Ala Asp Asp Gly His Ala Leu Leu Leu Ser Lys Val
35 40 45
Ala Gly Glu Ala Gln Ala Ile Gly Arg Val Ser Val Pro Met Ala Val
50 55 60
Thr Gly Leu Val Met Tyr Ser Arg Ala Leu Ile Ser Met Leu Phe Leu
65 70 75 80
Gly Arg Leu Gly Glu Leu Ala Leu Ala Gly Gly Ser Leu Ala Leu Gly
85 90 95
Phe Ala Asn Ile Thr Gly Tyr Ser Val Leu Ser Gly Leu Ala Leu Gly
100 105 110
Met Glu Pro Ile Cys Gly Gln Ala Phe Gly Ala Arg Arg Gly Lys Leu
115 120 125
Leu Ala Leu Ala Leu His Arg Thr Val Leu Leu Leu Leu Ala Val Ala
130 135 140
Leu Pro Ile Ser Leu Leu Trp Val Thr Ser Thr Gly Tyr Ile Leu Lys
145 150 155 160
Gln Leu Gly Gln Asp Glu Gly Val Ala Asp Ala Ala Gln Thr Phe Ala
165 170 175
Ala Tyr Ala Ser Ala Asp Leu Ala Val Leu Ala Val Leu His Pro Leu
180 185 190
Arg Val Tyr Leu Arg Ser Gln Asn Leu Thr Leu Pro Ile Thr Ala Cys
195 200 205
Ser Leu Phe Ser Val Leu Leu His Gly Pro Ile Asn Tyr Leu Leu Val
210 215 220
Val Arg Leu Arg Met Gly Val Ala Gly Val Ala Leu Ala Val Ala Leu
225 230 235 240
Thr Asp Leu Asn Leu Leu Leu Ala Leu Leu Cys Phe Leu Ala Ile Ser
245 250 255
Gly Ala His Arg Asp Ser Trp Val Gly Pro Thr Ser Asp Cys Leu Arg
260 265 270
Gly Trp Pro Ala Leu Leu Arg Leu Ala Val Pro Thr Ala Thr Ala Val
275 280 285
Cys Leu Glu Trp Trp Trp Tyr Glu Leu Met Ile Val Leu Ser Gly Leu
290 295 300
Leu Ala Asn Pro Arg Ala Thr Val Ala Ser Met Gly Ile Leu Ile Gln
305 310 315 320
Ala Thr Ser Leu Val Tyr Val Phe Pro Ser Ser Leu Gly Gln Gly Ala
325 330 335
Ser Thr Arg Val Ser His Gln Leu Gly Ala Gly Arg Pro Ala Gly Ala
340 345 350
Arg Arg Ala Ala Gly Ala Ala Leu Ser Ile Gly Leu Val Val Gly Ala
355 360 365
Ala Ala Ala Thr Phe Met Val Ser Val Arg Ser His Trp Gly Arg Met
370 375 380
Phe Thr Ser Asp Gly Glu Ile Leu Arg Leu Thr Ala Val Ala Leu Pro
385 390 395 400
Ile Ala Gly Leu Cys Glu Leu Gly Asn Cys Pro Gln Thr Ala Gly Cys
405 410 415
Gly Val Leu Arg Gly Ser Ala Arg Pro Ala Ser Gly Ala Arg Ile Asn
420 425 430
Leu Ala Ser Phe Tyr Leu Val Gly Met Pro Val Gly Val Ala Leu Ala
435 440 445
Phe Gly Ala Arg Leu Gly Phe Ala Gly Leu Trp Leu Gly Leu Leu Ala
450 455 460
Ala Gln Ala Ala Cys Ala Val Trp Met Ala Arg Ala Val Ala Ala Thr
465 470 475 480
Asp Trp Asp Val Glu Val Ala Arg Ala Lys Glu Leu Thr Lys Ala Ser
485 490 495
Thr Thr Gly Ser Gly Thr Asn His Gln His Glu Cys Asn Asn Ser Asn
500 505 510
Thr Asn Thr Ala Asn Ala Lys Ala Asn Thr Lys Thr Thr Thr Ser Pro
515 520 525
Ala Ala Ser Asn Ile Asn Ala Gly Gly Gly Gly Ser Ser Asp Asn Arg
530 535 540
Gly Tyr Val Pro Ile Ser Glu Ser Gly His Asn Asp Gly Ser Asp Asp
545 550 555 560
Leu Glu Lys Leu Glu Glu Gly Leu Met Val Ala Thr Ser Gly Gly Cys
565 570 575
Gly Asp Ala Leu Gly Val Asp Thr Lys Ala Gly Asp Lys Gln Gln Cys
580 585 590
Ser Asn Gly Gly Ala Gly Thr Ala Glu Gly Asn Ala Gly Gln Arg Arg
595 600 605
Gly Ser Ala Ser Ser Glu Arg Ala Pro Leu Ile Ser Val Gly Asp Asp
610 615 620
Glu Glu Ala Gly Glu Glu Asn Asp Gly Asp Gly Gly Gly Gly Gly His
625 630 635 640
Val
<210> 7
<211> 644
<212> PRT
<213> Oryza sativa L.
<400> 7
Met Cys Asn Ser Gly Thr Ser Ser Ser Pro Ser Ala Pro Ala Pro Pro
1 5 10 15
Pro Pro Pro Leu Thr Ser Phe Lys His Ser Ser His Leu Leu Arg Leu
20 25 30
Val Asp Asp Asp Ala Asp Asp Gly His Ala Leu Leu Leu Ser Lys Val
35 40 45
Ala Gly Glu Ala Gln Ala Ile Gly Arg Val Ser Val Pro Met Ala Val
50 55 60
Thr Gly Leu Val Met Tyr Ser Arg Ala Leu Ile Ser Met Leu Phe Leu
65 70 75 80
Gly Arg Leu Gly Glu Leu Ala Leu Ala Gly Gly Ser Leu Ala Leu Gly
85 90 95
Phe Ala Asn Ile Thr Gly Tyr Ser Val Leu Ser Gly Leu Ala Leu Gly
100 105 110
Met Glu Pro Ile Cys Gly Gln Ala Phe Gly Ala Arg Arg Gly Lys Leu
115 120 125
Leu Ala Leu Ala Leu His Arg Thr Val Leu Leu Leu Leu Ala Val Ala
130 135 140
Leu Pro Ile Ser Leu Leu Trp Val Thr Ser Thr Gly Tyr Ile Leu Lys
145 150 155 160
Gln Leu Gly Gln Asp Glu Gly Val Ala Asp Ala Ala Gln Thr Phe Ala
165 170 175
Ala Tyr Ala Ser Ala Asp Leu Ala Val Leu Ala Val Leu His Pro Leu
180 185 190
Arg Val Tyr Leu Arg Ser Gln Asn Leu Thr Leu Pro Ile Thr Ala Cys
195 200 205
Ser Leu Phe Ser Val Leu Leu His Gly Pro Ile Asn Tyr Leu Leu Val
210 215 220
Val Arg Leu Arg Met Gly Val Ala Gly Val Ala Leu Ala Val Ala Leu
225 230 235 240
Thr Asp Leu Asn Leu Leu Leu Ala Leu Leu Cys Phe Leu Ala Ile Ser
245 250 255
Gly Ala His Arg Asp Ser Trp Val Gly Pro Thr Ser Asp Cys Leu Arg
260 265 270
Gly Trp Pro Ala Leu Leu Arg Leu Ala Val Pro Thr Ala Thr Ala Val
275 280 285
Cys Leu Glu Trp Trp Trp Tyr Glu Leu Met Ile Val Leu Ser Gly Leu
290 295 300
Leu Ala Asn Pro Arg Ala Thr Val Ala Ser Met Gly Ile Leu Ile Gln
305 310 315 320
Ala Thr Ser Leu Val Tyr Val Phe Pro Ser Ser Leu Gly Gln Gly Ala
325 330 335
Ser Thr Arg Val Ser His Gln Leu Gly Ala Gly Arg Pro Ala Gly Ala
340 345 350
Arg Arg Ala Ala Gly Ala Ala Leu Ser Ile Gly Leu Val Val Gly Ala
355 360 365
Ala Ala Ala Thr Phe Met Val Ser Val Arg Ser His Trp Gly Arg Met
370 375 380
Phe Thr Ser Asp Gly Glu Ile Leu Arg Leu Thr Ala Val Ala Leu Pro
385 390 395 400
Ile Ala Gly Leu Cys Glu Leu Gly Asn Cys Pro Gln Thr Ala Gly Cys
405 410 415
Gly Val Leu Arg Gly Ser Ala Arg Pro Ala Ser Gly Ala Arg Ile Asn
420 425 430
Leu Ala Ser Phe Tyr Leu Val Gly Met Pro Val Gly Val Ala Leu Ala
435 440 445
Phe Gly Ala Arg Leu Gly Phe Ala Gly Leu Trp Leu Gly Leu Leu Ala
450 455 460
Ala Gln Ala Ala Cys Ala Val Trp Met Ala Arg Ala Val Ala Ala Thr
465 470 475 480
Asp Trp Asp Val Glu Val Ala Arg Ala Lys Glu Leu Thr Lys Ala Ser
485 490 495
Thr Thr Gly Ser Gly Thr Asn His Gln His Glu Cys Asn Asn Ser Asn
500 505 510
Thr Asn Thr Ala Asn Ala Lys Ala Asn Thr Lys Thr Thr Thr Ser Pro
515 520 525
Ala Ala Ser Asn Ile Asn Ala Gly Gly Gly Gly Ser Ser Asp Asn Arg
530 535 540
Gly Tyr Val Pro Ile Ser Glu Ser Gly His Asn Asp Gly Ser Asp Asp
545 550 555 560
Leu Glu Lys Leu Glu Glu Gly Leu Met Val Ala Thr Ser Gly Gly Cys
565 570 575
Cys Gly Cys Gly Asp Ala Leu Gly Val Asp Thr Lys Ala Gly Asp Lys
580 585 590
Gln Gln Cys Ser Asn Gly Gly Ala Gly Thr Ala Glu Gly Asn Ala Gly
595 600 605
Gln Arg Arg Gly Ser Ala Ser Ser Glu Arg Ala Pro Leu Ile Ser Val
610 615 620
Gly Asp Asp Glu Glu Ala Gly Glu Glu His Asp Gly Asp Gly Gly Gly
625 630 635 640
Gly Gly His Val
<210> 8
<211> 2605
<212> DNA
<213> Oryza sativa L.
<400> 8
atgtgcaact ccggcaccag ctcctcgccg tcggcgcctg cgccgccgcc gccgccgctc 60
acctcgttca agcactcctc ccacctcctc cgcctcgtcg acgatgacgc cgacgacggc 120
catgcgctgc tgctctccaa ggtaaaacac gcggtacata tgctgtagta atacttaccc 180
gcggcttggt aattttgatg gcgtgaacag aacatgtagg ccattatatc aaagagctaa 240
tgcaagaagc acgcatagcg acatagctgg ctggctggct ggttgtttaa tgcttattta 300
ctagtagcta ggcatcactg gcagtaacag taacgagaaa gaaaaggaaa gctccagctg 360
ttgggaaatg gcagagctga tcaatacgtc catgcacacg aacagctgat cgagacgacg 420
acgacgttgc tttgcttgct ttgcttgttg gtttctaaca tgcgtgagtg cgtgtgtctc 480
ccaggtggcc ggcgaggcgc aggcgatcgg gcgggtgtcg gtgccgatgg cggtgactgg 540
gctcgtcatg tactcgcggg cgctcatctc gatgctgttc cttggccggc tcggcgagct 600
ggccctcgcc ggagggtcgc tggcgctcgg cttcgccaac atcaccggct actcggtgct 660
ctccgggctg gcgctcggga tggagcccat ctgcggccag gcgttcggcg cgcgccgcgg 720
gaagctgctg gcgctggcgc tccaccgcac cgtgctgctg ctgctcgccg tcgcgctgcc 780
catctccctc ctgtgggtga cgtccacggg gtacatactg aagcagctcg gccaggacga 840
gggcgtggcg gacgcggcgc agacgttcgc ggcgtacgcg tcggccgacc tggcggtgct 900
cgccgtgctg cacccgctcc gcgtctacct ccggtcgcag aacctgacgc tgcccatcac 960
cgcctgctcg ctcttctccg tgctgctgca cgggcccatc aactacctcc tcgtcgtgcg 1020
cctccgcatg ggcgtcgccg gcgtcgcgct cgccgtcgcg ctcaccgacc ttaacctgct 1080
cctcgcgctc ctctgcttcc tcgccatctc cggggcccac agggactcgt gggtggggcc 1140
cacctccgac tgcctccgcg ggtggccggc gctgctccgc ctcgccgtgc cgaccgccac 1200
cgcggtgtgc ctcgagtggt ggtggtacga gctcatgatc gtgctgtcgg gcctcctcgc 1260
caatccgcgc gccaccgtgg cgtccatggg catcctcatc caggccacgt cgctcgtcta 1320
cgtgttcccg tcctccctcg gccagggcgc gtccacgcgc gtcagccacc agctcggcgc 1380
gggcaggccc gcgggggcgc gccgcgcggc cggcgccgcc ctctccatcg gcctcgtcgt 1440
cggcgcggcg gccgccacct tcatggtgtc ggtccgcagc cactggggcc gcatgttcac 1500
gtcggacggc gagatcctcc gcctcacggc cgtggcgctc cccatcgcgg ggctctgcga 1560
gctcggcaac tgcccgcaga cggccgggtg cggcgtcctc cgcggcagcg cccgcccggc 1620
cagcggcgcg cgcatcaacc tcgcctcctt ctacctggtc ggcatgccgg tcggcgtggc 1680
gctggcattc ggcgcccgcc taggcttcgc cgggctgtgg ctgggcctcc ttgccgcgca 1740
ggctgcctgc gcggtgtgga tggcgcgcgc cgtggccgcc accgactggg acgtcgaggt 1800
ggcgcgtgcc aaggagctga ccaaggcgtc cactacaggc agcggcacca accaccagca 1860
cgagtgcaac aacagcaaca ccaacaccgc caacgcaaag gctaacacca aaacgacaac 1920
gtctcccgcc gccagtaaca tcaatgccgg tggcggcggc agcagcgaca accgcggtta 1980
cgtgcccatc agcgagagcg gccacaacga cggcagcgac gacctggaga agctggagga 2040
agggctcatg gtggccacga gtggcggctg ctgcggctgc ggcgacgcgt taggcgtcga 2100
cacgaaggct ggggacaagc agcagtgcag caacggtggt gccggtacgg cggagggaaa 2160
tgcggggcag aggaggggct cggcgtcgtc ggagagggcc ccgctgatca gtgtggggga 2220
cgacgaggag gctggggagg agcacgacgg cgacggcggt ggaggtggcc acgtctagct 2280
agctgctaat caaccagcgt ggtcgatcca tccatcgatt aattctggag aggttttgat 2340
cgtacgtacg taggctatgt ttgacactga tcggccggtc tccatttcat ctttctctcc 2400
atcttgattt gggggtgagg tttagttttg tctgtataac caagctgagc agctaattaa 2460
tgagagtatt caggaaaaaa aaagagggag aaaaaaacat atatattctt cccttatttt 2520
tcttaattaa ttatacttct atgtacaaat actaattagt ttgggtgtaa attataatta 2580
aatcaattga tggtgattaa ttaag 2605
<210> 9
<211> 24
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 9
ggcatgcttg aacgaggtga gcgg 24
<210> 10
<211> 24
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 10
aaacccgctc acctcgttca agca 24
<210> 11
<211> 23
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 11
gccgccggag ggtcgctagc gct 23
<210> 12
<211> 23
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 12
aaacagcgct agcgaccctc cgg 23
<210> 13
<211> 24
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 13
ggcacgacga cggctgtcaa ctct 24
<210> 14
<211> 24
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 14
aaacagagtt gacagccgtc gtcg 24
<210> 15
<211> 24
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 15
gccgcggggc tcgtcatgta ctcg 24
<210> 16
<211> 24
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 16
aaaccgagta catgacgagc cccg 24
<210> 17
<211> 49
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 17
taattgtgtg tgcagcccgg gatccatgtg caactccggc accagctcc 49
<210> 18
<211> 47
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 18
gcgtgtcgac tagtccatgg tacctgacgt ggccacctcc accgccg 47
<210> 19
<211> 48
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 19
gattacgaat tcgagctcgg tacctgtagc tgtgcgatat cctagctt 48
<210> 20
<211> 52
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 20
cctgcaggtc gactctagag gatccacacg cccactagtt ctattacaag tc 52
<210> 21
<211> 49
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 21
cctgcaggtc gactctagag gatcctgtag ctgtgcgata tcctagctt 49
<210> 22
<211> 55
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 22
gaaaaactag aaatttaccc tcagatctac catggtgacg acgacgacgg ctgtc 55
<210> 23
<211> 49
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 23
cgggatcgag ggaaggattt cacatatgtg caactccggc accagctcc 49
<210> 24
<211> 53
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 24
agcttattta attacctgca gggaattcct agacgtggcc acctccaccg ccg 53
<210> 25
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 25
aaattcactg tgctcgtctc 20
<210> 26
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 26
catggtcaaa attcgagctc 20
<210> 27
<211> 22
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 27
acctacctgt gtaaagataa gt 22
<210> 28
<211> 21
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 28
tccaatttca atcgaacttc c 21
<210> 29
<211> 19
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 29
ttttcactca attgcgctg 19
<210> 30
<211> 19
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 30
gtaaatcagc tgcctaccc 19
<210> 31
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 31
tgcaaacact tactcctagg 20
<210> 32
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 32
ttttacccgg catctacatc 20
<210> 33
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 33
ctgaagttgt acagcctgtc 20
<210> 34
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 34
acttgaaacg gagggaatag 20
<210> 35
<211> 18
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 35
ggtacttggg ttccggta 18
<210> 36
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 36
acttgcaatt caccccatac 20
<210> 37
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 37
attaagagct tgccatacga 20
<210> 38
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 38
ccttagtgtc cgtagcttat 20
<210> 39
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 39
tgtttctctt tggccttttg 20
<210> 40
<211> 20
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 40
caacaccact acactacaca 20
<210> 41
<211> 18
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 41
ggacttggag ggacgtgg 18
<210> 42
<211> 18
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 42
tgacggaggt ggaggtag 18
<210> 43
<211> 22
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 43
aggaagatga tggtaaaact ct 22
<210> 44
<211> 21
<212> DNA
<213> Oligonucleotide (Oligonucleotide)
<400> 44
acgagatgca gtttatgtac a 21

Claims (20)

1. The method comprises the following steps ofGS3.1Use of a gene or a protein encoded thereby or a modulator thereof for:
(i) Regulating and controlling grain type, tillering number and yield of the plant;
(ii) Regulating and controlling the amount of p-coumaric acid, flavone and lignin synthesis pathway compounds in plants; and
(iii) Regulating and controlling the amount of auxin and gibberellin in plants;
wherein saidGS3.1Genes or proteins encoded thereby include homologues thereof; the saidGS3.1The encoded protein or homologue thereof isLOC_Os03g12790Or a polypeptide of the amino acid sequence shown in SEQ ID NO. 6;
wherein the modulator is down-regulatedGS3.1Down-regulation of expression or activity of a gene or protein encoded thereby, saidGS3.1The down-regulator of the gene is a CRISPR-based recombinant construct for: increasing the grain size of the plant, including increasing grain length, grain width and grain weight; the yield of plants is improved; increasing the tillering number of the plant; reducing transport or amount of p-coumaric acid in plants; reducing the amount of flavonoids in plants; increasing the amount of lignin and its synthesis pathway compounds in the plant; promoting the transport or synthesis of auxin in the plant and increasing the amount of auxin in the plant; promoting gibberellin transport in plants Or synthesizing and increasing the quantity of gibberellin in plants; or (b)
The regulator is up-regulatingGS3.1Up-regulator of expression or activity of a gene or protein encoded thereby, saidGS3.1Gene or its encoded protein or its up-regulator is over-expressedGS3.1Recombinant construct of a gene for: improving the transport or amount of p-coumaric acid in plants; increasing the amount of flavonoids in plants; reducing the amount of lignin and its synthesis pathway compounds in plants; inhibiting the transport or synthesis of auxin in plants and reducing the amount of auxin in plants; and inhibiting gibberellin transport or synthesis in plants, and reducing the amount of gibberellin in plants;
the flavone is naringenin; the lignin and the synthesis pathway compounds thereof are as follows: caffeic acid, ferulic acid, coniferyl alcohol, largonin-4-O-glucoside or lignin;
the plant is Gramineae plant.
2. The use according to claim 1, wherein the gene is synthesized by up-regulating auxinYUCCA7Auxin response geneARF15AndARF24or down-regulating auxin-inactivating genesGH3.8To promote the transport or synthesis of auxin in plants and to increase the amount of auxin in plants.
3. The use as claimed in claim 1 wherein the gibberellin response gene is upregulated GRF1AndGRF6and/or down-regulating gibberellin-inactivating genesGA20x10To promote the transport or synthesis of gibberellin in plants and to increase the amount of gibberellin in plants.
4. The use according to claim 1, wherein the auxin synthesis gene is down-regulatedYUCCA7Auxin response geneARF15AndARF24，and/or up-regulating auxin inactivating genesGH3.8To inhibit auxin transport or synthesis in plants and to reduce auxin levels in plants.
5. Use according to claim 1, characterized in thatBy down-regulating gibberellin response genesGRF1AndGRF6and/or up-regulating gibberellin-inactivating genesGA20x10To inhibit gibberellin transport or synthesis in plants and to reduce gibberellin levels in plants.
6. A method of regulating a plant trait comprising: regulation in plantsGS3.1Expression or activity of a gene or protein encoded thereby; the said processGS3.1Genes or proteins encoded thereby include homologues thereof; the saidGS3.1The encoded protein or homologue thereof isLOC_Os03g12790Or a polypeptide of the amino acid sequence shown in SEQ ID NO. 6; wherein, the plant traits include: (i) grain size, tillering number and yield of the plant; (ii) The amount of p-coumaric acid, flavone and lignin synthesis pathway compounds in the plant; and (iii) the amounts of auxin and gibberellin in the plant;
Wherein the method comprises the following steps: down-regulation ofGS3.1Expression or activity of a gene or protein encoded thereby: increasing the grain size of the plant, including increasing grain length, grain width or grain weight; the yield of plants is improved; increasing the tillering number of the plant; reducing transport or amount of p-coumaric acid in plants; reducing the amount of flavonoids in plants; increasing the amount of lignin and its synthesis pathway compounds in the plant; promoting the transport or synthesis of auxin in plants, or increasing the amount of auxin in plants; and promoting gibberellin transport or synthesis in plants, or increasing gibberellin levels in plants; or (b)
The method comprises the following steps: upregulation ofGS3.1Expression or activity of a gene or protein encoded thereby: improving the transport or amount of p-coumaric acid in plants; increasing the amount of flavonoids in plants; reducing the amount of lignin and its synthesis pathway compounds in plants; inhibiting the transport or synthesis of auxin in plants and reducing the amount of auxin in plants; and inhibiting gibberellin transport or synthesis in plants, and reducing the amount of gibberellin in plants;
the flavone is naringenin; the lignin and the synthesis pathway compounds thereof are as follows: caffeic acid, ferulic acid, coniferyl alcohol, largonin-4-O-glucoside or lignin;
The plant is Gramineae plant.
7. The method of claim 6, wherein the gene is synthesized by up-regulating auxinYUCCA7Auxin response geneARF15AndARF24or down-regulating auxin-inactivating genesGH3.8To promote the transport or synthesis of auxin in plants and to increase the amount of auxin in plants.
8. The method of claim 6 wherein the gibberellin response gene is upregulatedGRF1AndGRF6and/or down-regulating gibberellin-inactivating genesGA20x10To promote the transport or synthesis of gibberellin in plants and to increase the amount of gibberellin in plants.
9. The method of claim 6, wherein the gene is synthesized by down-regulating auxinYUCCA7Auxin response geneARF15AndARF24，and/or up-regulating auxin inactivating genesGH3.8To inhibit auxin transport or synthesis in plants, or to reduce the amount of auxin in plants.
10. The method of claim 6 wherein the gibberellin response gene is downregulatedGRF1AndGRF6and/or up-regulating gibberellin-inactivating genesGA20x10To inhibit gibberellin transport or synthesis in plants and to reduce gibberellin levels in plants.
11. The use according to any one of claims 1 to 5 or the method according to any one of claims 6 to 10, characterized in that the down-regulation is performed GS3.1Expression or activity of a gene or protein encoded thereby includes: knock-out or silencing in plantsGS3.1Or inhibition of the coding gene of (A)GS3.1Activity of the encoded protein.
12. The use or method according to claim 11, wherein the downregulation is effectedGS3.1Expression or activity of a gene or protein encoded thereby includes: gene editing with CRISPR system to knock outGS3.1Is encoded by (a)Knocking out genes by homologous recombinationGS3.1In the presence ofGS3.1Will be in the plant of (C)GS3.1Performing loss-of-function mutations, or silencing with interfering molecules that specifically interfere with gene expressionGS3.1。
13. The use or method of claim 12, wherein the loss-of-function mutation comprises: make the following stepsGS3.1Insertion of CGC between amino acid residues 576 and 577 of the encoded protein, and mutation of position 631 from N to H, orGS3.1The encoded protein terminates prematurely.
14. The use according to any one of claims 1 to 5 or the method according to any one of claims 6 to 10, characterized in that up-regulation is effectedGS3.1Expression or activity of a gene or protein encoded thereby includes: will beGS3.1The gene or the expression construct or vector containing the gene is transferred into plants.
15. The use or method according to claim 11, wherein the down-regulation is performed GS3.1Expression or activity of a gene or protein encoded thereby includes: down-regulation of tissue or organ specificity, or down-regulation of spatiotemporal specificity.
16. The use or method according to claim 15, wherein downregulation is by a tissue or organ specific promoter, a spatiotemporal specific promoter or an inducible promoterGS3.1Expression or activity of a gene or protein encoded thereby.
17. The use or method according to claim 14, wherein the upregulation isGS3.1Expression or activity of a gene or protein encoded thereby includes: tissue-or organ-specific up-regulation, or space-time specific up-regulation.
18. The use or method according to claim 17, wherein the promoter is selected from the group consisting of a tissue-or organ-specific promoter, a spatiotemporal-specific promoter and an inducible promoterUp-regulatingGS3.1Expression or activity of a gene or protein encoded thereby.
19. The use or method of claim 18, wherein the tissue or organ specific promoter comprises: ear, glume-specific expressed promoters, or the spatiotemporal specificities include: promoters for young ear stage specific expression.
20. Plant materialGS3.1Use of a gene or a protein encoded thereby as a molecular marker for identifying a plant trait; the said GS3.1Genes or proteins encoded thereby include homologues thereof; the saidGS3.1The encoded protein or homologue thereof isLOC_ Os03g12790Or a polypeptide of the amino acid sequence shown in SEQ ID NO. 6; wherein, the plant traits include: (i) grain size, tillering number and yield of the plant; (ii) The amount of p-coumaric acid, flavone and lignin synthesis pathway compounds in the plant; and (iii) the amounts of auxin and gibberellin in the plant; the lignin and the synthesis pathway compounds thereof are as follows: caffeic acid, ferulic acid, coniferyl alcohol, largonin-4-O-glucoside or lignin.
CN202110388561.3A 2021-04-12 2021-04-12 Grain type and yield control gene and application thereof Active CN115247184B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110388561.3A CN115247184B (en) 2021-04-12 2021-04-12 Grain type and yield control gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110388561.3A CN115247184B (en) 2021-04-12 2021-04-12 Grain type and yield control gene and application thereof

Publications (2)

Publication Number Publication Date
CN115247184A CN115247184A (en) 2022-10-28
CN115247184B true CN115247184B (en) 2024-03-12

Family

ID=83697415

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110388561.3A Active CN115247184B (en) 2021-04-12 2021-04-12 Grain type and yield control gene and application thereof

Country Status (1)

Country Link
CN (1) CN115247184B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107298702A (en) * 2017-08-09 2017-10-27 四川农业大学 A kind of rice grain shape GAP-associated protein GAP and its encoding gene

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013090814A2 (en) * 2011-12-16 2013-06-20 Board Of Trustees Of Michigan State University p-Coumaroyl-CoA:Monolignol Transferase

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107298702A (en) * 2017-08-09 2017-10-27 四川农业大学 A kind of rice grain shape GAP-associated protein GAP and its encoding gene

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
EAY89130.1;无;GenBank;全文 *

Also Published As

Publication number Publication date
CN115247184A (en) 2022-10-28

Similar Documents

Publication Publication Date Title
Li et al. A putative leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction
JP4021615B2 (en) Genetic control of plant growth and development
US7956240B2 (en) Plants having improved growth characteristics and method for making the same
US20030166197A1 (en) Ethylene insensitive plants
US20100199380A1 (en) Plants having enhanced yield-related traits and a method for making the same
CN102803291B (en) There is the plant of the Correlated Yield Characters of enhancing and/or the abiotic stress tolerance of enhancing and prepare its method
CN101855355A (en) Plants having increased yield-related traits and a method for making the same
CN101688214A (en) Plant and the method that is used to produce this plant with enhanced yield correlated character
US10329577B2 (en) Methods of modulating seed and organ size in plants
CN101627125A (en) Plants having enhanced yield-related traits and a method for making the same
CN101268193A (en) Plant yield improvement by group 3 LEA expression
CN101883783A (en) Has plant of enhanced yield correlated character and preparation method thereof
CN102766618B (en) Rice OsICL protein and coding gene thereof, and application of the two
CN103451228B (en) Method for regulating size and grain weight of rice seeds
CN101460611A (en) Plants having improved growth characteristics and method for making the same
CN105612171B (en) The method for adjusting the seed in plant and organ size
CN101969759A (en) Plants having enhanced yield-related traits and a method for making the same
CN101778942A (en) Plants having enhanced yield-related traits and a method for making the same
ES2429430T3 (en) Gene and protein for the detection of nitrogen regulated sugars and their modulation
CN101595222B (en) Plants having enhanced seed yield-related traits and a method for making the same
CN111826364B (en) Disease and pest resistance related gene and application thereof
CN101874116A (en) Plants having increased yield-related traits and a method for making the same
CN101548016B (en) Plants having enhanced yield-related traits and a method for making the same using consensus sequences from the yabby protein family
CN115247184B (en) Grain type and yield control gene and application thereof
CN101061228A (en) Isopentenyl transferase sequences and methods of use

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant