CN101595222B - Plants having enhanced seed yield-related traits and a method for making the same - Google Patents

Plants having enhanced seed yield-related traits and a method for making the same Download PDF

Info

Publication number
CN101595222B
CN101595222B CN2007800463872A CN200780046387A CN101595222B CN 101595222 B CN101595222 B CN 101595222B CN 2007800463872 A CN2007800463872 A CN 2007800463872A CN 200780046387 A CN200780046387 A CN 200780046387A CN 101595222 B CN101595222 B CN 101595222B
Authority
CN
China
Prior art keywords
plant
seed
nucleic acid
val
increase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2007800463872A
Other languages
Chinese (zh)
Other versions
CN101595222A (en
Inventor
A·I·桑兹莫林纳罗
L·范德斯蒂内
M·拉蒙
F·罗兰
P·范迪克
J·泰弗莱恩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CropDesign NV
Original Assignee
CropDesign NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CropDesign NV filed Critical CropDesign NV
Priority claimed from PCT/EP2007/063890 external-priority patent/WO2008071767A1/en
Publication of CN101595222A publication Critical patent/CN101595222A/en
Application granted granted Critical
Publication of CN101595222B publication Critical patent/CN101595222B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Abstract

The present invention concerns a method for enhancing yield-related traits in plants, particularly increasing seed yield, by modulating expression in a plant of a nucleic acid encoding a Class III Trehalose Phosphate Phosphatase (TPP) polypeptide. The present invention also concerns plants having modulated expression of a nucleic acid encoding a Class III TPP polypeptide, which plants have enhanced yield-related traits relative to control plants. The invention further concerns novel Class III TPP nucleic acid and polypeptide sequences. The invention also provides nucleic acid and polypeptide sequences, and constructs comprising the same, which are useful in the methods of the invention.

Description

Plant and preparation method thereof with seed production correlated character of improvement
Relate generally to biology field of the present invention also relates to for the method that improves Correlated Yield Characters important on the plant diversified economy.More specifically, the present invention relates to improve by the expression of the nucleic acid of adjusting coding III class treahalose phosphate Phosphoric acid esterase (TPP) polypeptide in plant the method for Correlated Yield Characters in the plant.The invention still further relates to the plant of the expression with the change of III class TPP peptide coding nucleotide sequence, wherein said plant has the Correlated Yield Characters of improvement with respect to control plant.The invention still further relates to new III class TPP nucleic acid and peptide sequence.The present invention also is provided for nucleic acid and the peptide sequence in the inventive method, and the construct that comprises this type of nucleic acid.
The world population of sustainable growth is supplied the research that atrophy has stimulated relevant increase farm efficiency with agricultural with the arable land.The plant that conventional crop and the utilization of Horticulture improved means select breeding technique to have welcome characteristic with evaluation.Yet this type of selects breeding technique to have several defectives, and namely these technology generally expend a lot of work and produce such plant, and it often contains the heterology hereditary component, and it may always not cause the desired proterties transmitted from the parental generation plant.Recent advances in molecular biology has allowed the germplasm of human improvement animal and plant.The genetic engineering of plant is so that can separate and operate genetic material (generally being in DNA or rna form) and import subsequently this genetic material to plant.This type of technology has generation and possesses the crop of diversified economy, agronomy or Horticulture Ameliorative character or the ability of plant.
Proterties with special economic meaning is the output that increases.But output is normally defined the measuring result from the economic worth of crop.This result can define with regard to quantity and/or quality aspect.Output directly depends on several factors, such as the number of organ and size, plant structure (such as the number of branch), seed generation, leaf aging etc.Root development, nutrient intake, stress tolerance and early stage vigor (early vigor) also can be the important factors that determines output.Optimize aforementioned factor thereby can contribution be arranged to increasing crop yield.
Seed production is the proterties that is even more important, because the seed of many plants is extremely important for human and animal's nutrition.Crop such as cereal, rice, wheat, rape and soybean account for the over half of human total calorie of intake, no matter be the direct consumption by seed itself, or the consumption by the meat products of being raised by the seed of processing.They also are the sources of the used carbohydrate of industrial processes, oils and multiclass metabolite.Seed contains embryo (new bud and the source of root) and endosperm (nutrition source of embryonic development in sprouting and the seedling early growth process).The growth of seed relates to many genes, and needs metabolite to be transferred to the seed of growing from root, leaf and stem.Endosperm particularly absorbs the metabolic precursor thereof of carbohydrate, oils and protein, it is synthesized the storage polymer, so that the grains are plump.
Another important character for numerous crops is early stage vigor.Improveing early stage vigor is the important goal of modern rice breeding plan on temperate zone and tropical rice varieties.It is important that long root is planted in the rice for correct soil fixing at water.In that direct sowing is to the situation that is submerged the field with rice, and in the situation that plant must emerge rapidly from water, long stem is relevant with vigor.In the situation of implementing drilling, long mesocotyl and coleoptile is important for well emerging.With early stage vigor artificial reconstructed will be extremely important in agricultural to endophytic ability.For example, bad early stage vigor has limited based on Zea mays (Zea mayesL.) hybrid of Corn Belt germplasm (Corn Belt germplasm) and has introduced a fine variety European Atlantic ocean region.
Another important character is the abiotic stress tolerance of improvement.Abiotic stress is the major cause of world wide Crop damage, reduces mean yield and surpass 50% (Wang etc., Planta (2003) 218:1-14) for most of staple crop plants.Abiotic stress can be caused by arid, salinity, extreme temperature, chemical toxicity and oxidative stress.Improving plant will be very big economic advantages to the peasant and can allow during unfavourable condition and in arable farming otherwise be impossible land raise crop at world wide the ability of abiotic stress tolerance.
Another important Correlated Yield Characters is phytomass, especially for fodder crop such as clover, ensiling cereal and hay.Have the more light of plant absorbing and carbonic acid gas that the larger plant of larger leaf area usually can be smaller, therefore probably at more (the Fasoula ﹠amp of the weightening finish same period; Tollenaar 2005 Maydica 50:39).
The ability that increases plant biomass will have many application in such as fields such as agriculturals, comprise production, arboriculture, gardening and the forest industry of ornamental plant.Increase output and also can produce for the algae of using at bio-reactor (be used for the biotechnology production of materials such as medicine, antibody or vaccine, or be used for the bio-transformation of organic waste) and other this class field.
The plant growing person usually based on for crop or plant, and the part of valuable plant or crop economically, interested in the particular aspects of improvement output.For example, for some crop or some end-use, the plant growing person may value the raising of the phytomass (weight) of the one or more parts of plant especially, and described part comprises on the ground (can gather in the crops) part and/or underground (can gather in the crops) part.This is that over-ground part or underground part are especially relevant with plant consumption.For many crops, especially cereal expects to improve seed production especially.The seed production that improves can show in many ways, based on institute for crop or plant and end-use thereof, all respects of seed production are for plant growing person's importance difference.
Can select and select output to be changed or the aspect of seed production, will be especially favourable for the plant growing person.Available gene, the i.e. concrete aspect of suitable change seed production or the gene of component are chosen in special expectation.For example, the thousand seed weight of the full rate of increase and increase is high expectations for the crop such as corn.For rice and wheat, the thousand seed weight of full rate, harvest index and the increase of increase is high expectations.
Have now found that the expression of the nucleic acid of in plant, regulating coding III class treahalose phosphate Phosphoric acid esterase (TPP) polypeptide, produce the plant of the Correlated Yield Characters with multiple improvement.
Find trehalose at several organic sphere (life kingdom), it is the non-reducing disaccharide that is comprised of two glucose molecules that connect by α-1,1 key.In bacterium, fungi and insect, show that trehalose has the carbohydrate memory function and bring into play function in stress tolerance.In plant, trehalose begin to be regarded as being limited to extremophile end biological (extremophite) for example resurrection plant bring back to life grass (Selaginellalepidophylla), but accept extensively now be Trehalose Metabolism vegitabilia all over.
Trehalose is synthetic from UDPG and G-6-P in two enzymatic reactions.By enzyme TPS (trehalose phosphate synthase), UDPG and G-6-P are converted into UDP (uridine diphosphate (UDP)) and α, α-trehalose 6-phosphoric acid (T-6-P) in the first step.In second step, by the catalysis of enzyme TPP (treahalose phosphate Phosphoric acid esterase), the T-6-P dephosphorylation produces trehalose and ortho-phosphoric acid.
In yeast, there is enzymic activity in two (TPS and TPP are active) in the large protein complex, described protein complex comprises active subunits TPS1 and TPS2 and regulates subunit, and TPS1 has the TPS activity, and TPS2 has the TPP activity.In intestinal bacteria (E.coli), these two kinds of enzymic activitys are found in different protein complexes.In plant, do not characterize so far this protein complex.
In the Arabidopis thaliana, the trehalose biosynthetic enzyme is divided three classes:
The I class: comprise four genes, AtTPS1 to AtTPS4 and ScTPS1 have high similarity;
The II class: have 7 members, AtTPS5 to AtTPS11 and ScTPS2 have the height sequence similarity.And
The III class: have 10 members, AtTPPA to AtTPPJ, the C end of the protein of coding and intestinal bacteria TPS2 and ScTPS2 protein has similarity.
The gene of the protein of these classifications of encoding also is present in the other plant species.
In I class and II class, only clearly determined the enzymic activity of AtTPS1, described AtTPS1 shows the TPS activity, and (Blazquez etc., Plant are year March J.1998; 13 (5): 685-9.).Surprisingly, so far without any the active report of the TPP of other II classes TPS protein.On the contrary, AtTPPA and AtTPPB (two members of III class) have been described TPP active (Vogel etc., Plant are year March J.1998 before; 13 (5): 673-83).Plant III class TPP contains two Phosphoric acid esterase apokoinou construction motifs, and it finds (Thaller etc., Protein Sci.1998 July in all TPP enzymes of describing so far; 7 (7): 1647-52).
The genetic manipulation of having reported trehalose biosynthetic genes causes the stress tolerance that improves in the plant, and causes huge growth to change.Reported intestinal bacteria OtsA and the overexpression of OtsB gene in transgene tobacco and potato plants and caused root and leaf development not normal, and development of plants is slow.In the OtsA rotaring gene tobacco plant, produce less seed, and in OtsB transgenic Rhizoma Solani tuber osi plant, do not produce stem tuber (Goddijn etc., Plant Physiol.1997 January; 113 (1): 181-90), other people have described similar result (Holmstrom etc., Nature, 379,683-684; Romero etc., Planta, 201,293-297; Pilont-Smits etc., 1998; JPlant Physiol.152:525-532; Schluepmann etc., the Proc Natl Acad Sci U.S., 2003; 100 (11): 6849-54).Mutation defect in TPS and the TPP gene shows developmental defect according to reports.TPS1 knocks out the mutant embryonic development impaired (Eastmond etc., Plant are year January J.2002 in the Arabidopis thaliana; 29 (2): 225-35).
The disclosed US patent application of Jackson etc., US 20060191040 mentions separation and the sign of corn gene RAMOSA3 (RA3), described RAMOSA3 is responsible for meristematic tissue growth and inflorescence development according to reports, comprises branch (branching).This shows that gene, gene product and regulatory region can be used for controlling branch, meristematic tissue growth, inflorescence development and arrangement, and finally improves plant biomass.Although the structure that changes (because the change of branch or change of inflorescence structure) can cause the increase of output or the increase of seed production in some cases, this is uncertain.Having is manyly increasing output or is increasing other components that seed production needs to replace (in place) before can realizing.For example, do not have setting percentage (seed set), seed full (rate), plant fertilizability etc., will not have the increase of seed production.In addition, Jackson etc. do not mention which aspect that can improve output, are biomass or the raising seed productions (it can be the relevant parameter of seed size, seed amount, thousand seed weight, harvest index or other seed productions) of plant specific part.
Therefore, III class TPP polypeptide is regulated in surprising discovery in plant expression produces with respect to control plant, has the plant of the Correlated Yield Characters (seed production that especially increases) of multiple improvement.
After this any III class TPP polypeptide that means as defined herein of quoting of " protein that is used for the inventive method " after.The nucleic acid of " be used for the inventive method " any quotes the nucleic acid of this type of III class TPP polypeptide that means to encode after this.Term " polypeptide " and " protein " are used interchangeably and refer to the amino acid of the polymerized form of random length in this article.Term " polynucleotide ", " nucleotide sequence ", " nucleotide sequence ", " polynucleotide molecule " are used interchangeably in this article and refer to be in Nucleotide in the random length polymerized form, i.e. ribonucleotide or deoxyribonucleotide or these two combination.
To select suitable control plant be the habitual part that arranges of experiment and can comprise corresponding wild-type plant or without the corresponding plant of goal gene.Control plant generally is plant species or or even the identical mutation identical with plant to be assessed.Control plant also can be the inefficacy zygote of plant to be assessed." control plant " not only refers to whole strain plant as used in this article, also refers to plant part, comprises seed and plants subdivision.
Be used for regulating preferred method that coding nucleic acid that (preferred increasing) be used for the protein of the inventive method expresses is by introduce and be expressed as follows the coding nucleic acid that the literary composition definition is used for the protein of the inventive method plant.
The nucleic acid of plant to be introduced (and thereby be used for implement the inventive method) is the existing any nucleic acid with the protein type described of coding, hereinafter is called again " III class TPP nucleic acid " or " III class TPP gene " or " III class TPP polypeptide ".
" III class TPP polypeptide " means to have arbitrarily the trehalose-6-phosphate phosphatase activity as herein defined, comprises the polypeptide of at least one trehalose-6-phosphate enzyme (trehalose-6-phosphate phosphatase) structural domain.
Trehalose-6-phosphate phosphatase structural domain length is generally 200-250 amino acid, and generally comprises Phosphoric acid esterase consensus sequence motif, and described motif is found (Thaller etc., 1998) in the TPP of so far all descriptions enzyme.The representational consensus sequence of trehalose-6-phosphate phosphatase structural domain provides in SEQ ID NO:93.The aminoacid sequence of the trehalose-6-phosphate phosphatase structural domain that comprises among the SEQ ID NO:2 provides in SEQ ID NO:94.Those skilled in the art use tools and techniques known in the art, will be easy to identify the existence of trehalose-6-phosphate phosphatase structural domain.The further details that embodiment 2 herein, 3 and 4 provides relevant trehalose-6-phosphate phosphatase structural domain to identify.In III class TPP polypeptide, this Phosphoric acid esterase consensus sequence motif generally contains two Phosphoric acid esterase frames, is called A and B-Phosphoric acid esterase frame.SEQ ID NO:96 represents the consensus sequence of Phosphoric acid esterase frame A, and SEQ ID NO:97 represents the consensus sequence of Phosphoric acid esterase frame B.
The nucleic acid encoding that is used for the inventive method comprises the III class TPP polypeptide of at least one trehalose-6-phosphate phosphatase structural domain, described structural domain is according to the preferred sequence that increases progressively, and preferably has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or higher amino acid sequence identity with SEQ IDNO:93 or SEQ ID NO:94.Further preferably, the trehalose-6-phosphate phosphatase structural domain comprises at least one (preferred two) Phosphoric acid esterase frame, described Phosphoric acid esterase frame is according to the preferred sequence that increases progressively, and has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or higher sequence identity with Phosphoric acid esterase frame or SEQ ID NO:96 or SEQ ID NO:97.
III class TPP polypeptide also comprises Serine and is rich in the district, and described Serine is rich in the N end that the district generally is positioned at the trehalose-6-phosphate phosphatase structural domain.SEQ ID NO:95 represents the consensus sequence that Serine is rich in structural domain.Preferably, the nucleic acid encoding III class TPP polypeptide that is used for the inventive method, described III class TPP polypeptide comprises Serine and is rich in structural domain, described Serine is rich in structural domain according to the preferred sequence that increases progressively, and has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or higher sequence identity with SEQ ID NO:95.
Preferably, the accounting coding III class TPP protein of introduced plant, described III class TPP protein is according to the preferred sequence that increases progressively, be selected from SEQ ID NO:4,6 and 8 sequence has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.Most preferably, III class TPP nucleic acid is by shown among the SEQ ID NO:3,5 and 7 any.
General, when III class TPP polypeptide was used for making up TPP/TPS genealogical tree (for example shown in Fig. 2 A), trend clustered in the III class TPP protein group that comprises aminoacid sequence shown in the SEQ ID NO:2, rather than clusters in any other group.
The example that is used for the protein of the inventive method provides with 1 Table A of its coding nucleic acid by this paper embodiment.
What can also be used for the inventive method is the homologue of the arbitrary amino acid sequence that provides of 1 Table A of embodiment." homologue " of protein comprises such peptide, oligopeptides, polypeptide, protein and enzyme, and they have aminoacid replacement, disappearance and/or insertion and have similar biologic activity and functionally active to the non-modified protein of described peptide, oligopeptides, polypeptide, protein and enzyme source with respect to non-modified above-mentioned protein.
Disappearance refers to remove one or more amino acid from protein.
Insertion refers to the introducing in the predetermined site in protein of one or more amino-acid residues.Insertion can comprise in the fusion of single or multiple amino acid whose N end and/or the fusion of C end and the sequence inserts.Usually, less than the fusion of N end or the fusion of C end in the insertion meeting of aminoacid sequence inside, about 1-10 residue rank.The example of N end or C end fusion rotein or fusogenic peptide comprise as the binding domains of used transcriptional activator in the yeast two-hybrid system or activation structure territory, bacteriophage coat protein, (Histidine)-6-label, glutathione S-transferase-label, A albumen, maltose binding protein, Tetrahydrofolate dehydrogenase, Tag100 epi-position, c-myc epi-position,
Figure G2007800463872D00071
-epi-position, lacZ, CMP (calmodulin binding peptide), HA epi-position, C albumen epi-position and VSV epi-position.
Replace and to refer to having similar characteristics the amino acid of other amino acid substitution protein of (such as similar hydrophobicity, wetting ability, antigenicity, formation or destroy the tendency of α-helixstructure or beta sheet structure).Aminoacid replacement generally is single residue, but can be a bunch collection property, and this depends on the functional constraint that places polypeptide; Inserting can be about 1-10 amino-acid residue rank usually.Aminoacid replacement preferably conservative amino acid replaces.Conservative property replacement table is (seeing for example Creighton (1984) Proteins.W.H.Freeman and Company and following table 1) well-known in the art.
Table 1: the example that conservative amino acid replaces
Residue Conservative property replaces Residue Conservative property replaces
Ala Ser Leu Ile；Val
Arg Lys Lys Arg；Gln
Asn Gln；His Met Leu；Ile
Asp Glu Phe Met；Leu；Tyr
Gln Asn Ser Thr；Gly
Cys Ser Thr Ser；Val
Glu Asp Trp Tyr
Gly Pro Tyr Trp；Phe
His Asn；Gln Val Ile；Leu
Ile Leu，Val
Aminoacid replacement, disappearance and/or insert and to use peptide synthetic technology well-known in the art such as the solid phase method of peptide synthesis etc. or by the recombinant DNA operation and carry out easily.Being used for the operation dna sequence dna is well-known in the art with replacement, the insertion that produces protein or the method that lacks variant.For example, it is well-known and comprise M13 mutagenesis, T7-Gen vitro mutagenesis method (USB to be used for producing at the predetermined site place of DNA the technology that replaces sudden change and to be those skilled in the art, Clevelaand, OH), the site-directed mutagenesis (Stratagene of QuickChange, San Diego, CA), site-directed mutagenesis or other site-directed mutagenesiss of PCR-mediation.
What can also be used for the inventive method is the derivative of arbitrary polypeptide of providing of 1 Table A of embodiment, or the straight homologues of any polypeptide that provides in 1 Table A of embodiment or paralog thing, or the derivative of the straight homologues of any polypeptide that provides in the Table A or paralog thing." derivative " comprises such peptide, oligopeptides, polypeptide, wherein compare with the aminoacid sequence of the protein of natural generation form (shown in SEQ ID NO:2), they comprise the interpolation of the amino-acid residue that the amino-acid residue that occurs with non-natural occurs amino acid whose replacement or non-natural.The derivative of the polypeptide that provides in 1 Table A of embodiment is suitable other examples for the inventive method.The derivative that is used for the inventive method preferably to its derived from non-modified protein have similar biologic activity and functionally active.
" derivative " of polypeptide comprises such peptide, oligopeptides, polypeptide, wherein compare with the aminoacid sequence of the natural generation form of protein (for example target protein matter), they comprise the interpolation of the amino-acid residue that the amino-acid residue that occurs with non-natural occurs amino acid whose replacement or non-natural.Protein " derivative " also comprises such peptide, oligopeptides, polypeptide; wherein compare with the aminoacid sequence of the natural generation form of polypeptide, they comprise change (glycosylation, acidylate, isoprenylation, phosphorylation, myristoylation, sulphating etc.) amino-acid residue or non-natural change amino-acid residue of natural generation.Compare with the aminoacid sequence that derivative is originated, this derivative can also comprise one or more non-aminoacid replacement base or the interpolation (for example reporter molecule or other parts) of covalently or non-covalently being combined with described aminoacid sequence, as for promote detecting the reporter molecule of this derivative combination, and the amino-acid residue that occurs with non-natural that the aminoacid sequence of the protein of natural generation compares.In addition, " derivative " also comprises the natural generation form of protein and such as the fusions of the labelled peptide of FLAG, HIS6 or Trx (summary of labelled peptide referring to Terpe, Appl.Microbiol.Biotechnol.60,523-533,2003).
The present invention is by using the plant that is transformed by the Arabidopis thaliana nucleotide sequence of the coded polypeptide sequence SEQ ID NO:2 shown in the SEQ ID NO:1 to be illustrated, yet enforcement of the present invention is not limited to these sequences.The inventive method can advantageously use coding to carry out such as any nucleic acid of defined protein for the inventive method in the literary composition, described nucleic acid comprises the coding nucleic acid of straight homologues, paralog thing and the homologue of SEQ ID NO:2, any nucleotide sequence that for example provides in the Table A of (but being not limited to) embodiment 1.
The aminoacid sequence that provides in 1 Table A of embodiment is straight homologues and the paralog thing for the III class TPP polypeptide shown in the SEQ ID NO:2 of the inventive method, and the example of its coding nucleic acid.Straight homologues and paralog thing comprise to describe the evolution concept of gene ancestral relationship.The paralog thing be the same species endogenous origin in the gene of my late grandfather's gene replication, and straight homologues is from the different biological genes that species form that originate from, and also is derived from identical my late grandfather's gene.
Straight homologues and paralog thing can easily find by carrying out so-called interactivity blast search.It generally comprises a BLAST, and a described BLAST participates in submit Query sequence (for example using any sequence of listing in the Table A of embodiment 1) and is used for blast search for arbitrary sequence library (ncbi database that can use such as the public).When beginning from nucleotide sequence, usually use BLASTN or TBLASTX (Application standard default value), and when beginning from protein sequence, can use BLASTP or TBLASTN (Application standard default value).Randomly can screen BLAST result.The full length sequence of submitting subsequently the selection result and non-the selection result to is with for carry out reverse BLAST (the 2nd BLAST) from the sequence of biology, wherein search sequence is from described biology (be in the situation of SEQ ID NO:1 or SEQ ID NO:2 in search sequence wherein, the 2nd BLAST thereby will be for arabidopsis thaliana sequence).The result who compares subsequently the first and second blast searches.Be derived from search sequence from the identical species of the species of wherein deriving if hit from the high-order position of a BLAST, oppositely BLAST then identifies the paralog thing subsequently ideally to produce in the highest search sequence of hitting; Be not derived from search sequence from the identical species of the species of wherein deriving if the high-order position among the BLAST is hit, and preferably when reverse BLAST, produce the search sequence that belongs to the highest row that hit, then identify straight homologues.
It is that with low E-value those hit that high-order position is hit.The E-value is lower, mark more remarkable (or in other words, this hit because of the chance odds lower).The calculating of E-value is well-known in the art.Except the E-value, comparative result is also scored by identity percentage ratio.Identity percentage ratio refer to two compare identical Nucleotide (or amino acid) number in the length-specific scope between nucleic acid (or polypeptide) sequence.In the situation of large-scale family, can use ClustalW, use subsequently in abutting connection with the tree method in order to help to show the cluster of genes involved and in order to identify straight homologues and paralog thing.
The Table A of embodiment 1 provides by the straight homologues of the III class TPP protein shown in the SEQ ID NO:2 and the example of paralog thing.Use above-mentioned BLAST process can easily identify other straight homologuess and paralog thing.
Protein of the present invention is (shown in Fig. 1 and the embodiment 4) terms that can identify by the existence of one or more conservative treahalose phosphate phosphatase domains " structural domain " refers to along the sequence alignment result of evolution related protein and at one group of conservative amino acid of specific location.Although the amino acid in other positions can change between homologue, however the amino acid indication of the high conservative of specific location the structure of protein, stability or active aspect be essential amino acid.Structural domain is because of identified by the conservative degree of the height in the aligned sequences of protein homology thing family, they can be as identifying that thing is to determine whether the polypeptide of being discussed arbitrarily belongs to the previous peptide family of having identified (in the case, for the protein of the inventive method and coding nucleic acid thereof as defined herein).
Term " motif " or " consensus sequence " or " label " refer to short conserved regions in the sequence of evolution related protein.Motif is the high conservative part of structural domain often, but also can only comprise the part of structural domain, maybe can be positioned at (if whole amino acid of motif are positioned at outside the structural domain of definition) outside the conserved domain.
Also there is the specialized database for the identification of structural domain, such as SMART (Schultz etc. (1998) the Proc.Natl.Acad.Sci. U.S. 95,5857-5864; Letunic etc. (2002) Nucleic AcidsRes 30,242-244), InterPro (Mulder etc., (2003) Nucl.Acids.Res.31,315-318), Prosite (Bucher and Bairoch (1994), be used for the broad sense collection of illustrative plates grammer of biomolecular sequence motif and in the function of automatization sequence interpretation, () ISMB-94; Second Committee molecular biology intelligence system international conference collected works .Altman R., Brutlag D., Karp P., Lathrop R., Searls D. compiles, 53-61 page or leaf, AAAIPress, Menlo Park; Hulo etc., Nucl.Acids.Res.32:D134-D137, (2004)) or Pfam (Bateman etc., Nucleic Acids Research30 (1): 276-280 (2002)) evaluation.The one group of instrument that is used for analysing protein sequence on the computer chip can obtain (resident (Gasteiger etc. on Swiss Institute of Bioinformatics at ExPASY proteomics server, ExPASy: be used for going deep into the protein science server of understanding and analysing protein, Nucleic Acids Res.31:3784-3788 (2003)).
Also use routine techniques well known in the art can easily identify structural domain, for example identify by sequence alignment.Being used for aligned sequences is well-known in the art for method relatively, and these class methods comprise GAP, BESTFIT, BLAST, FASTA and TFASTA.GAP uses Needleman and Wunsch algorithm ((1970) J Mol Biol 48:443-453) to find the overall comparison that makes the maximization of coupling number and make minimized two complete sequence of room number (covering whole sequence).BLAST algorithm (Altschul etc. (1990) J Mol Biol 215:403-10) sequence of calculation identity percentage ratio and execution are to the statistical study of similarity between two sequences.Be used for carrying out software that BLAST analyzes and be the public, to pass through NCBI (NCBI) obtainable.The homologue thing can use for example ClustalW multiple sequence alignment algorithm (1.83 version) easily evaluation to give tacit consent to pairing comparison parameter and methods of marking (with percentage ratio).The overall percentage ratio of similarity and identity also can use one of obtainable method in the MatGAT software package and determine (Campanella etc., BMCBioinformatics.2003 Jul 10; 4:29.MatGAT: use protein or dna sequence dna and the application that produces similarity/identity matrix).Can carry out trickle craft and write to optimize the comparison of guarding between the motif, apparent such as those skilled in the art.Except using full length sequence to identify homologue, also can use ad hoc structure territory (such as one of treahalose phosphate phosphatase domain or motif defined above) in addition.The sequence identity value of describing with per-cent in embodiment 3 is used said procedure, utilizes default parameters, for complete nucleic acid or aminoacid sequence and definite for the structural domain of selecting or conservative motif.
In addition, III class TPP protein (at least with its natural form) generally has the treahalose phosphate enzymic activity.Polypeptide with treahalose phosphate enzymic activity belongs to the EC:3.1.3.12 fermentoid of classifying according to the enzyme council of NK of Biochemistry and Molecular Biology League of Nations (Nomenclature Committee of the International Union ofBiochemistry and Molecular Biology (NC-IUBMB)).EC:3.1.3.12 quasi-enzyme catalytic reaction: trehalose-6-phosphate+H 2O=trehalose+phosphoric acid.
The activity of treahalose phosphate zymoprotein can be by the substrate level determining to process in the vitro reactions and the product level determination of accumulation, namely by the trehalose-6-phosphate of reaction accumulation and the level determination of trehalose.The Enzymology method of measuring trehalose can be glucose based on hydrolysis of trehalose, and such as Van Dijck etc., Biochem is on August 15, J.2002; 366 (Pt 1): 63-71 and Zentella etc., PlantPhysiol.1999 April; 119 (4): those methods that 1473-82 describes.
The trehalose-6-phosphate level also can be by Avonce etc., Plant Physiol.2004 November; 136 (3): 3649-59; Schluepmann etc., 2003 described methods are by measuring with HPLC (high performance liquid chromatography).Based on other the method for measuring the inorganic phosphate that discharges from trehalose-6-phosphate also by Klutts etc., J Biol Chem.2003 January 24; 278 (4): 2093-100 describes.Another uses method that the liquid chromatography (LC) of coupling MS-Q3 (three grades of four pole type MS) measures the trehalose-6-phosphate level by Lunn etc., and Biochem is on July 1, J.2006; 397 (1): 139-48 describes.Further details provides in embodiment 5 and embodiment 6.
The nucleic acid example that is suitable for implementing the inventive method comprises the nucleotide sequence that provides in the Table A of embodiment 1, but is not limited to these sequences.The nucleic acid variant can be used for implementing method of the present invention.Such nucleic acid variant example comprise for the part of the coding nucleic acid of the protein of the inventive method, with the nucleic acid of the coding nucleic acid hybridization of the protein that is used for the inventive method, be used for the inventive method protein coding nucleic acid splice variant, be used for the allelic variant of coding nucleic acid of the protein of the inventive method, and the variant of the coding nucleic acid of the protein that is used for the inventive method that obtains by gene shuffling.Now with Terminology part, hybridization sequences, splice variant, allelic variant and gene shuffling.
The coding nucleic acid that is used for the protein of the inventive method needs not be total length nucleic acid, because the enforcement of the inventive method does not rely on the use of total length nucleotide sequence.The part coded polypeptide that is used for the inventive method, described polypeptide fall in the definition of coding nucleic acid of the protein that is used for the inventive method as defined herein, and with the Table A of embodiment 1 in the aminoacid sequence that provides have substantially the same biologic activity.Preferably, part is the part of arbitrary nucleic acid of providing in the Table A of embodiment 1.The part normal length is at least 625 continuous nucleotides, preferred length is at least 825 continuous nucleotides, more preferably length is at least 1025 continuous nucleotides, most preferably length is at least 1125 continuous nucleotides, and described continuous nucleotide is the arbitrary nucleotide sequence that provides in the Table A of embodiment 1.Most preferably, part is the part of nucleic acid SEQ ID NO:1.Preferably, the part encoding amino acid sequence, when described aminoacid sequence be used for to make up TPP/TPS genealogical tree (for example shown in Fig. 2 A), trend clustered in the III class TPP protein group that comprises aminoacid sequence shown in the SEQ ID NO:2, rather than cluster in any other group.
The part of the coding nucleic acid of III class TPP protein can prepare by nucleic acid is carried out one or more disappearances as herein defined.Part can be used with the form of separating, and perhaps itself and other coding (or non-coding) sequence can be merged, in order to for example, produce the protein that has made up some activity.When merging with other encoding sequences, the polypeptide that produces after translation may be larger than the III class TPP protein portion of prediction.
The invention provides the method for improvement plant biomass correlated character (especially increasing seed production), it is included in the plant part of coding nucleic acid of straight homologues, paralog thing or the homologue of the arbitrary amino acid sequence that provides in the Table A of introducing and expressing the part of the arbitrary nucleotide sequence that provides in the Table A of embodiment 1 or embodiment 1.
Another nucleic acid variant that is used for the inventive method is under the stringent condition that reduces, preferably under stringent condition, can with the coding nucleic acid of III class TPP protein defined herein or with the nucleic acid of part hybridization defined herein.
The hybridization sequences coded polypeptide that is used for the inventive method, described polypeptide has treahalose phosphate phosphatase domain (seeing the comparison of Fig. 2 A and Fig. 3), and with the Table A of embodiment 1 in the III class TPP protein of the arbitrary amino acid sequence representative that provides have substantially the same biologic activity.The hybridization sequences normal length is at least 625 continuous nucleotides, preferred length is at least 825 continuous nucleotides, more preferably length is at least 1025 continuous nucleotides, most preferably length is at least 1125 continuous nucleotides, and described continuous nucleotide is the arbitrary nucleotide sequence that provides in the Table A of embodiment 1.Preferably, hybridization sequences be can with the sequence of any nucleic acid hybridization of providing in the Table A of embodiment 1, or the part of these sequences, part as defined above.Most preferably, hybridization sequences can be hybridized with the nucleic acid shown in the nucleic acid SEQID NO:1 or its part.
Preferably, the hybridization sequences encoding amino acid sequence, when described aminoacid sequence be used for to make up TPP/TPS genealogical tree (for example shown in Fig. 2 A), trend clustered in the III class TPP protein group that comprises aminoacid sequence shown in the SEQ ID NO:2, rather than cluster in any other group.
Most preferably, the polynucleotide molecule of separation can be under stringent condition and the arbitrary sequence hybridization shown in the SEQ ID NO:4,6 and 8.
The invention provides the method for improvement plant biomass correlated character (especially increasing seed production), its be included in the plant introduce and express can with the nucleic acid of arbitrary nucleic acid hybridization of providing in the Table A of embodiment 1, or in plant, introduce and express can with the nucleic acid of the coding nucleic acid hybridization of straight homologues, paralog thing or the homologue of any nucleotide sequence of providing in the Table A of embodiment 1.
Term as defined herein " hybridization " is the process of the mutual renaturation of complementary nucleotide sequence of homology basically wherein.Crossover process can be carried out in solution fully, and namely two kinds of complementary nucleic acid all are in the solution.Crossover process also can occur under one of complementary nucleic acid is fixed to the situation of matrix such as magnetic bead, agarose (Sepharose) pearl or any other resin.Crossover process also can be fixed on solid support such as nitrocellulose filter or the nylon membrane or be fixed to by for example photolithography in the situation on the silicate glasses upholder (latter is called nucleic acid array or microarray or is called nucleic acid chip) for example at one of complementary nucleic acid carries out.For hybridization is occured, usually with nucleic acid molecule thermally denature or chemical modification so that double-stranded unwinding become two strands and/or remove hair clip or other secondary structures from single-chain nucleic acid.
Term " severity " refer to the condition of hybridizing therein.The severity of hybridization is formed by condition such as temperature, salt concn, ionic strength and hybridization buffer to be affected.Usually, low stringency is chosen as when the ionic strength of determining and pH, is lower than particular sequence pyrolysis chain temperature (T m) about 30 ℃.Medium stringency is that temperature is lower than T at this moment mAbout 20 ℃ and high stringency be this moment temperature be lower than T mAbout 10 ℃.High stringency hybridization condition is generally for separating of having the hybridization sequences of high sequence similarity with target nucleic acid sequence.Yet nucleic acid can depart from and because of the degeneracy of the genetic codon substantially the same polypeptide of still encoding in sequence.Thereby sometimes may need medium stringency hybridization condition to identify this type of nucleic acid molecule.
T mThe temperature when the ionic strength of determining and pH, 50% target sequence and the probe hybridization that mates fully under described temperature.T mThe based composition and the length that depend on solution condition and probe.For example, long sequence specifically hybridization under comparatively high temps.From being lower than T mAbout 16 ℃ until 32 ℃ obtain maximum hybridization speed.The existence of monovalent cation in solution reduced the Coulomb repulsion between two nucleic acid chains, thereby promotes hybrid molecule to form; This effect is obvious (for greater concn, this effect can be ignored) for the na concn up to 0.4M.Methane amide reduces the melting temperature(Tm) of DNA-DNA and DNA-RNA duplex, and every percentage ratio methane amide reduces 0.6-0.7 ℃, and adds 50% methane amide and allow to hybridize at 30-45 ℃, although hybridization speed can reduce.Base-pair mismatch has reduced the thermostability of hybridization speed and duplex.On average and for large probe, every % base mispairing T mDescend about 1 ℃.The type that depends on hybrid molecule, T mCan use following equation to calculate:
1) DNA-DNA crossbred (Meinkoth and Wahl, Anal.Biochem., 138:267-284,1984):
T m=81.5 ℃+16.6xlog 10[Na +] a+ 0.41x%[G/C b]-500x[L c] -1-0.61x% methane amide
2) DNA-RNA or RNA-RNA crossbred:
T m＝79.8+18.5(log 10[Na +] a)+0.58(％G/C bb)+11.8(％G/C b) 2-820/L c
3) few DNA or few RNA dCrossbred:
For＜20 Nucleotide: T m=2 (l n)
For 20-35 Nucleotide: T m=22+1.46 (l n)
aOr for other monovalent cations, but only be accurate in the 0.01-0.4M scope.
bAccurate in the 30%-75% scope for %GC only.
cThe length of L=duplex (in base pair).
dOligo, oligonucleotide; l n, the useful length of=primer=2 * (G/C number)+(A/T number).
Can with any control non-specific binding of numerous known technologies, for example process to hybridization buffer and with the RNA enzyme with proteinaceous solution closed film, interpolation heterology RNA, heterology DNA and SDS.For the non-homology probe, a series of hybridization can be undertaken by changing one of following condition: (i) reduce progressively renaturation temperature (for example from 68 ℃ to 42 ℃) or (ii) reduce progressively methane amide concentration (for example from 50% to 0%).The technician understands during the hybridization can change and will keep or change the many kinds of parameters of stringency.
Except the hybridization condition, the hybridization specificity generally also depends on the function of post-hybridization washing.For removing because of the background due to the non-specific hybridization, sample is with the salts solution washing of dilution.The key factor of this type of washing comprises ionic strength and the temperature of final washing soln: salt concn is lower and wash temperature is higher, and then the severity of washing is higher.Wash conditions is generally on the hybridization severity or be lower than hybridization severity and carrying out.Positive hybridization produces the signal that doubles at least background signal.Usually, the suitable stringency that is used for nucleic acid hybridization analysis method or gene amplification detection method as mentioned above.Also can select stricter or more undemanding condition.The technician understands during the washing can change and will keep or change the many kinds of parameters of stringency.
For example, be used for length and be included in 65 ℃ greater than the common high stringency hybridization condition of the DNA hybrid molecule of 50 Nucleotide and hybridize in 1 * SSC and 50% methane amide in 1 * SSC or at 42 ℃, wash in 0.3 * SSC at 65 ℃ subsequently.Be used for length and be included in 55 ℃ greater than the example of the medium stringency hybridization condition of the DNA hybrid molecule of 50 Nucleotide and hybridize in 6 * SSC and 50% methane amide in 4 * SSC or at 40 ℃, wash in 2 * SSC at 50 ℃ subsequently.The length of hybrid molecule is the expection length of hybrid nucleic acid.When the known nucleic acid hybridization of sequence, can and identify that by aligned sequences described conserved regions is determined hybrid molecule length herein.1 * SSC is 0.15M NaCI and 15mM Trisodium Citrate; Hybridization solution and washing soln can comprise 5 * Denhardt reagent, 0.5-1.0%SDS, the fragmentation salmon sperm DNA of 100 μ g/ml sex change, 0.5% trisodium phosphate extraly.
In order to define the purpose of severity level, can be with reference to (2001) MolecularCloning:a laboratory manual such as Sambrook, the third edition, Cold Spring Harbor LaboratoryPress, CSH, New York or with reference to Current Protocols in Molecular Biology, John Wiley ﹠amp; Sons, N.Y. (1989 and annual upgrade version).
Another nucleic acid variant that can be used for the inventive method is the as defined above splice variant of III class TPP protein of coding this paper.Term as used in this article " splice variant " comprise wherein excise, replace, be shifted or add selected intron and/or exon or wherein intron shortened or the variant of the nucleotide sequence that lengthens.This type of variant will be a kind of variant that has wherein basically kept the biologic activity of protein; This can realize by the functional fragment of selective retention protein.This type of splice variant can find or can manually make at occurring in nature.Be used for prediction and the method for separating this type of splice variant and be well-known in the artly (seeing for example Foissac and Schiex, BMCBioinformatics., 2005; 6:25).
The invention provides the method for improvement plant biomass correlated character (especially increasing seed production), it is included in the plant splice variant of coding nucleic acid of straight homologues, paralog thing or the homologue of the arbitrary amino acid sequence that provides in the Table A of introducing and expressing the splice variant of the arbitrary nucleotide sequence that provides in the Table A of embodiment 1 or embodiment 1.
Preferred splice variant is the splice variant of nucleic acid shown in the SEQ ID NO:1, or the splice variant of the coding nucleic acid of the straight homologues of SEQ IDNO:2 or paralog thing.Preferably, the aminoacid sequence of coding splice variant comprises any one or a plurality of motif defined herein or structural domain.Preferably, when the aminoacid sequence of splice variant coding is used for making up TPP/TPS genealogical tree (for example shown in Fig. 2 A), trend clusters in the group of the III class TPP protein that comprises aminoacid sequence shown in the SEQ ID NO:2, rather than clusters in any other group.
Another nucleic acid variant that is used for enforcement the inventive method is the allelic variant of the coding nucleic acid of III class TPP protein as hereinbefore defined.Allelotrope or allelic variant are the alternative forms of given gene, are positioned at identical chromosome position.The natural existence of allelic variant, and contain in the methods of the invention be the purposes of these natural allelic variants.Allelic variant comprises single nucleotide polymorphism (SNP) and little insertion/deletion (INDEL).The size of INDEL is usually less than 100bp.SNP and INDEL are formed on the maximum set of sequence variants in the biological natural generation sexual polymorphism strain of major part.Be used for the allelic variant of the inventive method and the III class TPP protein of SEQ ID NO:2 and have essentially identical biologic activity.
The invention provides the method for improvement plant biomass correlated character (especially increasing seed production), it is included in the plant introduces and expresses the allelic variant of the arbitrary nucleic acid that provides in the Table A of embodiment 1 or be included in the allelic variant of coding nucleic acid of introducing in the plant and expressing straight homologues, paralog thing or the homologue of the arbitrary amino acid sequence that provides in the Table A of embodiment 1.
Preferably, allelic variant is the allelic variant of SEQ ID NO:1, or the allelic variant of the coding nucleic acid of the straight homologues of SEQ ID NO:2 or paralog thing.Preferably, the aminoacid sequence of coding allelic variant comprises any one or a plurality of motif defined herein or structural domain, preferably, when the aminoacid sequence of allelic variant coding is used for making up TPP/TPS genealogical tree (for example shown in Fig. 2 A), trend clusters in the group of the III class TPP protein that comprises aminoacid sequence shown in the SEQ ID NO:2, rather than clusters in any other group.
Another nucleic acid variant that is used for the inventive method is the nucleic acid variant that obtains by gene shuffling.Gene shuffling or orthogenesis also can be used for producing the as defined above variant of the nucleic acid of III class TPP protein of encoding.This comprises the repetition of DNA reorganization, succeeded by suitable screening and/or selection, have the biologic activity of change with generation, coding has variant or its part (Castle etc. (2004) Science 304 (5674): 1151-4 of the nucleic acid of III class TPP protein; United States Patent (USP) 5,811,238 and 6,395,547).
The invention provides the method for improvement plant biomass correlated character, it is included in the plant variant of introducing and expressing in the nucleotide sequence that provides in the Table A of embodiment 1 any, or being included in the plant variant of nucleic acid sequence encoding of introducing and expressing straight homologues, paralog thing or the homologue of the arbitrary amino acid sequence that provides in the Table A of embodiment 1, described variant nucleic acid obtains by gene shuffling.
The aminoacid sequence of the variant nucleic acid encoding that preferably, obtains by gene shuffling comprises motif or the structural domain of any one or a plurality of this paper definition.Preferably, when the aminoacid sequence of the variant nucleic acid encoding that obtains by gene shuffling is used for making up TPP/TPS genealogical tree (for example shown in Fig. 2 A), trend clusters in the group of the III class TPP protein that comprises aminoacid sequence shown in the SEQ ID NO:2, rather than clusters in any other group.
In addition, can also pass through site-directed mutagenic obtained nucleic acid variant.Several method can be used for realizing site-directed mutagenesis; The most frequently used method that is based on PCR (Current Protocols inMolecular Biology.Wiley volume).
The coding nucleic acid of III class TPP protein can be from any natural or artificial source.Can modify by careful manual operation the natural form of described nucleic acid at composition and/or genome environment.Preferred III class TPP coding nucleic acid is from plant, and preferred source more preferably is derived from Cruciferae from dicotyledons again, and most preferably nucleic acid is from Arabidopis thaliana.
Therefore any III class of this paper TPP protein quotes the III class TPP protein that means to define as mentioned.Any nucleic acid of this type of III class of encoding TPP protein is suitable for implementing the inventive method.
The present invention also comprises can be by plant or its part (comprising seed) of the inventive method acquisition.Described plant or its part comprise the nucleic acid transgenosis of the III class TPP protein that coding defines as mentioned.
The present invention also provides unknown so far III class TPP nucleotide sequence and III class TPP protein sequence.These sequences also can be used for implementing method of the present invention.
The preferred embodiments of the invention provide the nucleic acid molecule of separation thus, and it comprises:
(i) nucleic acid shown in SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:125, SEQ ID NO:127 or the SEQ ID NO:129;
(ii) complement of the arbitrary SEQ ID NO that provides in (i);
(iii) nucleic acid of coding III class TPP protein, described III class TPP protein is according to the preferred sequence that increases progressively, and the arbitrary aminoacid sequence that provides with SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ IDNO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128 or SEQ IDNO:130 has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity;
(iv) can be with top (i), (ii) under stringent condition or the nucleic acid of the arbitrary nucleic acid hybridization that provides (iii).
Another embodiment of the present invention provides isolated polypeptide, and it comprises:
(i) aminoacid sequence shown in SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128 or the SEQ ID NO:130;
(ii) according to the preferred sequence that increases progressively, the arbitrary aminoacid sequence that provides with SEQ ID NO:4, SEQ ID NO:6, SEQ IDNO:8, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128 or SEQ ID NO:130 has the aminoacid sequence of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity;
(iii) above (i) or (ii) in the derivative of the arbitrary amino acid sequence that provides.
The present invention also provides genetic constructs and carrier to promote to introduce and/or express the nucleotide sequence that is used for the inventive method in plant.Described gene construct can insert and be suitable for being converted in the plant and be suitable for commercially available carrier at the cells goal gene that transforms.The present invention also provides such as defined gene construct purposes in the methods of the invention in the literary composition.
More specifically, the invention provides construct, it comprises:
(a) nucleic acid of coding as top defined III class TPP protein;
(b) one or more regulating and controlling sequences that can drive the nucleotide sequences expression of (a); Randomly
(c) transcription termination sequence.
Nucleic acid in the preferred construct of the present invention is the polynucleotide molecule of coding III class TPP protein, its aminoacid sequence has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity according to the preferred sequence that increases progressively with the sequence shown in any among SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128 or the SEQ ID NO:130.Most preferably, this III class TPP polynucleotide molecule is any nucleotide sequence SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:121, SEQ ID NO:123, SEQID NO:125, SEQ ID NO:127 or SEQ ID NO:129.
Plant transforms with the carrier that comprises aim sequence (being the nucleotide sequence of the coding III class TPP polypeptide that defines of this paper).The technician is appreciated that successfully and transforms, selects and breed the host cell that contains aim sequence and the genetic elements that must exist very much on carrier.Aim sequence is connected with one or more regulating and controlling sequences (at least with promotor) effectively.Term " regulatory element ", " regulating and controlling sequence " and " promotor " all are used interchangeably and mean in a broad sense to realize the modulability nucleotide sequence that the sequence that is attached thereto is expressed in this article.Term " promotor " refer generally to be positioned at genetic transcription starting point upstream and participate in identification and in conjunction with RNA polymerase and other protein, thereby instruct the nucleic acid regulating and controlling sequence of the transcribed nucleic acid that effectively connects.Aforementioned term comprises from typical eukaryotic gene group gene and (comprising for the required TATA frame of accurate transcripting starting, have or do not have the CCAAT box sequence) in the transcriptional regulatory sequences of deriving and replying grow stimulation and/or outside stimulus or with the tissue specificity mode change genetic expression the additional adjustment element (as, upstream activating sequence, enhanser and silencer).This term also comprises the transcriptional regulatory sequences of typical prokaryotic gene, and it can comprise-35 frame sequences and/or-10 frame transcriptional regulatory sequences in the case.Term " regulatory element " also comprises to be given, activates or strengthen synthetic fusion molecule or the derivative that nucleic acid molecule expresses in cell, tissue or organ.Term as used in this article " effectively connect " refer to functionally be connected between promoter sequence and the goal gene, to such an extent as to can starting goal gene, promoter sequence transcribes.
Advantageously, can use the expression of the promoters driven nucleotide sequence of any type.Term " promotor " refers to be positioned at the nucleic acid control sequence of genetic transcription starting point upstream, and participates in identification and in conjunction with RNA polymerase and other protein, instruct thus effectively transcribing of connection nucleic acid." plant " promotor comprises controlling element, its mediation encoding sequence section expression in vegetable cell.Thereby plant promoter need not as plant origin, but can derive from virus or microorganism, for example, particularly derives from the virus of attacking vegetable cell." plant promoter " also can derive from vegetable cell, for example, derives from the plant of the nucleotide sequence conversion of wish expression.This is applicable equally for other " plant " adjustment signals, for example the situation of " plant " terminator.Be positioned at promotor for the nucleotide sequence upstream of the inventive method and can replace, insert by one or more Nucleotide and/or disappearance be modified, and can not disturb promotor, open reading frame (ORF) or 3 '-control region such as terminator or away from function or the activity of locational other the 3 ' control regions of ORF.Might increase its activity by the sequence of modifying promotor in addition, perhaps replace with fully and have more active promotor or even from the promotor of allos organism.For expressing in plant, nucleic acid molecule effectively is connected in suitable promotor.
Promotor can be constitutive promoter, refers at the great majority that grow but the promotor that needs not to be in all stages and activate under most of envrionment conditionss, at least a cell, tissue or organ transcription.Alternatively, promotor can be inducible promoter, and namely the response chemistry (is summarized referring to Gatz 1997 Annu.Rev.Plant Physiol.Plant Mol.Biol., 48:89-108), environment or physical stimulation, have the transcription initiation of inducing or increase.The example of other inducible promoters is stress induced promoters, the promotor or the pathogen-inducible promoter that namely activate when plant contact various abiotic stress condition.
In addition or alternative, promotor can be organ specificity or tissue-specific promotor, namely can be in some organ or tissue, such as preferential initial promotor of transcribing in the tissues such as leaf, root, seed; Perhaps can be ubiquitous promotor, basically in the institute of organism in a organized way or activate in the cell; Perhaps promotor can be the developmental regulation type, thereby activates in some etap or at the plant part that genesis and development changes.Can be only in some organ or tissue initial promotor of transcribing be called in the text " organ specificity " or " tissue specificity " promotor, similarly, can be only in some cell initial promotor of transcribing be called in the text " cell-specific " promotor.
Preferably, III class TPP nucleic acid or its variant effectively are connected with constitutive promoter.Preferred constitutive promoter is basically all over the constitutive promoter of expressing.Promotor is also preferably from plant, more preferably obtain from monocotyledons.Most preferably using GOS2 promotor (especially from rice GOS2 promotor), most preferably is basic promotor shown in SEQ ID NO:98.Be understood that suitability of the present invention is not limited to the III class TPP nucleic acid shown in the SEQ ID NO:1, suitability of the present invention also is not limited to the expression of III class TPP nucleic acid when the GOS2 promoters driven simultaneously.According to another preferred feature of the present invention, constitutive promoter is high mobility group protein matter (HMGP) promotor, and preferred HMGP promotor is from rice, and is more preferably substantially similar with SEQ ID NO:131, most preferably identical with SEQ ID NO:131.Other constitutive promoters that also can be used for driving III class TPP expression of nucleic acid are as shown in table 2 below.
Table 2: the example of constitutive promoter
Gene source Reference
Actin muscle McElroy etc., Plant Cell, 2:163-171,1990
CAMV 35S Odell etc., Nature, 313:810-812,1985
CaMV 19S Nilsson etc., Physiol.Plant.100:456-462,1997
GOS2 De Pater etc., Plant J Nov; 2 (6): 837-44,1992, WO 2004/065596
Ubiquitin Christensen etc., Plant Mol.Biol.18:675-689,1992
The rice cyclophilin Buchholz etc., Plant Mol Biol.25 (5): 837-43,1994
Corn H3 histone Lepetit etc., Mol.Gen.Genet.231:276-285,1992
Clover H3 histone The Plant Mol.Biol.11:641-649 such as Wu, 1988
Actin muscle 2 An etc., Plant are (1) J.10; 107-121,1996
34S FMV Sanger etc., Plant.Mol.Biol., 14,1990:433-443
The Rubisco small subunit US 4,962,028
OCS Leisner (1988) the Proc Natl Acad Sci U.S. 85 (5): 2553
SAD1 Jain etc., Crop Science, 39 (6), 1999:1696
SAD2 Jain etc., Crop Science, 39 (6), 1999:1696
nos Shaw etc. (1984) Nucleic Acids Res.12 (20): 7831-7846
The V-ATP enzyme WO 01/14572
Super promotor WO 95/14098
G box protein matter WO 94/12015
For identifying the promotor of functional equivalent, can analyze promotor length and/or the expression pattern of candidate's promotor, for example promotor effectively is connected in reporter gene, and measures expression level and the pattern of reporter gene in the plant Various Tissues.Suitable well-known reporter gene comprises for example β-glucuronidase or beta-galactosidase enzymes.Measure promoter activity by the enzymatic activity of measuring β-glucuronidase or beta-galactosidase enzymes.Then can compare with promotor length and/or expression pattern and with reference to promotor (such as promotor used in the inventive method).Alternatively, can utilize method well known in the art such as Northern trace (RNA analysis) in conjunction with the density quantitative analysis of autoradiogram(ARGM), quantitative PCR in real time or RT-PCR, by quantitative mRNA or by the mRNA level of used nucleic acid in the inventive method and the mRNA level of housekeeping gene such as 18S rRNA are compared, measure promotor length (Heid etc., 1996Genome Methods 6:986-994).Usually, term " weak promoter " means to drive the promotor of encoding sequence low expression level, described low-level be about 1/10,000 transcript of each cell to about 1/100,000 transcript, to the level of about 1/500,0000 transcript.On the contrary, " strong promoter " drives the encoding sequence high level expression, and perhaps about 1/10 transcript of each cell is to about 1/100 transcript, to the level of about 1/1,000 transcript.
Choose wantonly, can in the construct of introduced plant, use one or more terminator sequences.Term " terminator " comprises control sequence, and it is the dna sequence dna that is positioned at transcription unit's end, 3 ' processing of transmission of signal initiation primary transcript and Polyadenylation and the termination of transcribing.Terminator can be from natural gene, multiple other plant gene or from T-DNA.For example, terminator to be added can or be derived from the other plant gene or the suboptimum selection of land is derived from any other eukaryotic gene alternatively from nopaline synthase or octopine synthase gene.Other controlling element can comprise transcribes and translational enhancer.One skilled in the art will know that the sequence that is suitable for implementing terminator of the present invention and enhanser.This class sequence is conventionally known to one of skill in the art or can easily obtains.
Intron sequences also can be added in 5 ' non-translational region (UTR) or the encoding sequence, to be increased in the amount of the ripe information that accumulates in the endochylema.But be included in mRNA level and the protein level of verified montage intron in plant expression constructs and animal expression construct transcription unit increases genetic expression to reaching 1000 times of (Buchman and Berg, Mol.Cell Biol.8:4395-4405 (1988); Callis etc., Gens Dev 1:1183-1200 (1987)).This type of intron enhancement of genetic expression is the strongest generally near being positioned at transcription unit 5 ' end the time.It is known in the art using corn intron A dh1- S introne 1,2 and 6, Bronze-1 intron.For general information, see: The Maize Handbook, the 116th chapter, Freeling and Walbot compile, Springer, N.Y. (1994).
Other control sequences (except promotor, enhanser, silencer, intron sequences, 3 ' UTR and/or 5 ' UTR zone) can be protein and/or RNA stable element.This class sequence is conventionally known to one of skill in the art or can easily obtains.
Genetic constructs of the present invention also is included in keeps and/or copies required replication orgin sequence in the particular cell types.An example is situation about genetic constructs need to be kept in bacterial cell as additive type genetic elements (such as plasmid or clay molecule).Preferred replication orgin includes but not limited to f1-ori and colE1.
Be successful transfer and/or the transgenic plant of selecting to contain these nucleic acid, preferably the applying marking gene (or reporter gene) that detects used nucleotide sequence in the inventive method.Therefore, genetic constructs can randomly comprise selectable marker gene.As used herein, term " selected marker " or " selected marker " or " reporter gene " comprise any gene of giving cell phenotype, this gene is at cells, is conducive to identify and/or selects cell through nucleic acid construct transfection of the present invention or conversion.These marker gene can be identified by a series of different principles the successful transfer of nucleic acid molecule.Suitable mark can be selected from the mark of giving microbiotic or Herbicid resistant, and it is introduced new metabolism proterties or allows visual selection.But the example of selectable marker gene comprises the gene of the giving antibiotics resistance (nptII of phosphorylation Liu Suanyan NEOMYCIN SULPHATE and kantlex for example, or the hpt of phosphorylation Totomycin, perhaps give for example gene of bleomycin, Streptomycin sulphate, tsiklomitsin, paraxin, penbritin, gentamicin, Geneticin (G418), spectinomycin or blasticidin resistance), the gene of conferring herbicide resistance (for example provides
Figure G2007800463872D00251
The bar of resistance; AroA or the gox of glyphosate resistance are provided, perhaps give for example gene of the resistance of imidazolone, phosphinothricin or sulfacarbamide) or provide the gene of metabolism proterties (for example to allow plant to use seminose as the manA of sole carbon source, or the xylose isomerase of relevant xylose utilization; Or anti-nutrition mark is such as the resistance to 1,5-anhydroglucitol).The expression of visable indicia gene causes forming color (for example β-glucuronidase GUS or beta-galactosidase enzymes and painted substrate thereof for example X-Gal), luminous (for example luciferin/luciferase system) or fluorescence (green fluorescent protein GFP and derivative thereof).This only is the inventory of the possible mark of sub-fraction.The technician is very familiar to this class mark.Preferably use different marks according to different organisms and system of selection.
Known nucleic acid is stablized or integration,temporal advances vegetable cell, and only a few cell is taken in foreign DNA, and is integrated into its genome (if desired), and this depends on used expression vector and used rotaring dyeing technology.For identifying and select these intasomies, but the gene of the selective marker of usually will encoding (as indicated above those) is introduced in the host cell with goal gene.For example, these marks can use in mutant, and original these genes do not have function in the described mutant, for example lack by ordinary method.In addition, but the used sequence of the nucleic acid molecule of coding selective marker and code book invention polypeptide or the inventive method can be introduced host cell in same carrier, perhaps in independent carrier.By the cell of the nucleic acid stability transfection of introducing can be for example by select (for example, but be integrated with the cell survival of selective marker and other cells die) identified.
In case successfully introduce nucleic acid, to no longer need or do not expect to exist in the genetically modified host cell marker gene, particularly microbiotic and herbicide resistance gene advantageously adopt the technology that can remove or excise these marker gene so introduce the method for nucleic acid according to the present invention.A kind of such method is the method that is called cotransformation.The cotransformation method adopts two carriers to transform simultaneously, and a carrier carries according to nucleic acid of the present invention, and Second support carries marker gene.The transformant of larger proportion receive or for plant, contain (up to 40% or above transformant) two carriers.For Agrobacterium-mediated Transformation, transformant receives only the part of carrier usually, is the sequence of T-DNA institute side joint, and it is often referred to expression cassette.Can from conversion of plant, remove marker gene by hybridization subsequently.In another approach, utilize the marker gene be integrated into transposon to transform (being called the Ac/Ds technology) with the nucleic acid of expectation.Transformant can be hybridized with the transposase source, perhaps with the instantaneous or stable conversion transformant of nucleic acid of giving the transposase expression.At in some cases (about 10%), in case successfully transform, transposon is jumped out the host cell gene group and is lost.In some other situation, transposon skips to different positions.In these cases, must eliminate marker gene by hybridization.In the microbiology field, researched and developed technology that might or be convenient to detect this type of event.Another favourable method depends on the method that is called recombination system, it is advantageous that and can exempt the hybridization removal process.Foremost this type systematic is called the Cre/lox system.Cre1 is recombinase, the sequence of its excision between the loxP sequence.If marker gene is incorporated between the loxP sequence, in case successfully transform, because the expression of this recombinase, it is excised.Other recombination systems have HIN/HIX, FLP/FRT and REP/STB system (Tribble etc., J.Biol.Chem., 275,2000:22255-22267; Velmurugan etc., J.Cell Biol., 149,2000:553-566).Might be integrated into Plant Genome according to nucleic acid of the present invention locus specificity.These methods also can be applied to microorganism such as yeast, fungi or bacterium naturally.
The present invention also provides with respect to control plant, generation has the method for transgenic plant of the Correlated Yield Characters (especially increase seed production) of improvement, and described method is included in any coding nucleic acid of introducing and expressing III class TPP protein as hereinbefore defined in the plant.
Be the object of the invention, " genetically modified ", " transgenosis " or " restructuring " with regard to nucleotide sequence, mean to comprise expression cassette, gene construct or the carrier of this nucleotide sequence or the biology that transforms with nucleotide sequence of the present invention, expression cassette or carrier, these make up all and produce by recombination method, wherein
(a) coding is used for the nucleic acid sequences to proteins of the inventive method, or
(b) the genetic regulation sequence that effectively is connected with nucleotide sequence of the present invention, promotor for example, or
(c) a) and b).
Be not in its natural genotypic environment or modify by genetic manipulation method, be modified with may for example adopt replace, interpolation, disappearance, inversion or insert the form of one or more nucleotide residues.Natural genotypic environment is interpreted as natural gene group locus or the chromogene seat in the plant that means to originate or exists in genomic library.In the situation of genomic library, the natural genotypic environment of nucleotide sequence preferably obtains keeping, and is kept at least in part.This environment is distributed at least one side of nucleotide sequence and has at least 50bp, preferred 500bp at least, 1000bp at least particularly preferably, the most preferably sequence length of 5000bp at least.The for example combination of the natural generation of the corresponding nucleotide sequence of used polypeptide in natural promoter and the code book inventive method of nucleotide sequence of the expression cassette one of natural generation, as hereinbefore defined-when being subject to modifying, become transgene expression cassette by non-natural synthetic (" manually ") method (such as mutagenic treatment) at this expression cassette.Appropriate method is for example at US 5,565,350 or WO00/15815 in describe.
More specifically, the invention provides the method for the transgenic plant that produce the output with increase, described method comprises:
(i) in plant, plant part or vegetable cell, introduce and express III class TPP nucleic acid or its variant; With
(ii) culturing plants cell under the condition of Promoting plant growth and growth.
Can be with the direct introduced plant cell of nucleic acid or plant itself (comprising any other part of introducing tissue, organ or plant).According to a preferred aspect of the present invention, preferably by transforming the nucleic acid introduced plant.
Term " introducing " or " conversion " comprise that exogenous polynucleotide are transferred in the host cell as mentioned in this article, and what the method that no matter is used for transforming is.Can follow-up clone's property propagation the plant tissue of (no matter occur by organ or the embryo occurs) can transform and the whole strain plant that can therefrom regenerate with genetic constructs of the present invention.The concrete tissue of selecting will depend on clone's property proliferating system of the concrete species that can be used for and be suitable for just transforming most.The example organization target comprises leaf dish, pollen, embryo, cotyledon, hypocotyl, megagametophyte, callus, existing meristematic tissue (for example apical meristem, axillalry bud and root meristematic tissue) and the meristematic tissue (for example cotyledon meristematic tissue and hypocotyl meristematic tissue) of inducing.Polynucleotide can instantaneous or stably be introduced host cell and can keep to nonconformity, for example as plasmid.Alternatively, polynucleotide can be integrated in the host genome.The transformed plant cells that produces can be used for regenerating in the manner known to persons skilled in the art conversion of plant subsequently.
Alien gene is converted into and is called conversion in the Plant Genome.The conversion of plant species is quite conventional technology now.Advantageously, the either method in several method for transformation can be used for goal gene is introduced suitable ancester cell.Be used for from plant tissue or vegetable cell transforms and the described method of the plant that regenerates can be used for instantaneous conversion or be used for stable conversion.Method for transformation comprise the chemical that uses liposome, electroporation, increase dissociative DNA to take in, DNA direct injection to plant, particle gun blast technique, use conversion method and the micro-projective method (microprojection) of virus or pollen.Method for transformation can be selected from calcium for protoplastis/polyoxyethylene glycol method (Krens, F.A. etc., (1982) Nature296,72-74; (1987) Plant Mol Biol 8:363-373 such as Negrutiu I); The electroporation of protoplastis ((1985) Bio/Technol 3 such as Shillito R.D., 1099-1102); Micro-injection (Crossway A etc., (1986) Mol.Gen Genet 202:179-185) to vegetable material; The Particle bombardment (Klein TM etc., (1987) Nature 327:70) of DNA or RNA coating, (nonconformity) virus infection method etc.Transgenic plant comprise the genetically modified crops plant, preferably produce by agriculture bacillus mediated conversion method.Favourable method for transformation is the conversion method of in plant (in planta).For this purpose, for example might make Agrobacterium act on the meristematic tissue that plant seed maybe might be inoculated with Agrobacterium plant.To act on complete plant or act at least flower primordium be particularly advantageous to the verified Agrobacterium suspension that makes conversion according to the present invention.Plant continues subsequently to cultivate that (Clough and Bent, Plant J. (1998) 16,735-743) until obtain the seed of the plant of processing.The method that is used for agriculture bacillus mediated rice conversion comprises the known method that transforms for rice, such as those methods of in arbitrary following document, describing: European patent application EP 1198985A1, Aldemita and Hodges (Planta199:612-617,1996); Chan etc. (Plant Mol Biol 22 (3): 491-506,1993), Hiei etc. (Plant J 6 (2): 271-282,1994), its disclosure is incorporated herein by reference in this article, as providing fully.In the situation that corn transforms, (Nat.Biotechnol 14 (6): 745-50 for preferred method such as Ishida etc., 1996) or Frame etc. (Plant Physiol 129 (1): 13-22,2002) describe, its disclosure is incorporated herein by reference as fully in this article.Described method by way of example mode further by B.Jenes etc., Techniques for Gene Transfer,: Transgenic Plants, the 1st volume, Engineering and Utilization, S.D.Kung and R.Wu compile, Academic Press (1993) 128-143 and at Potrykus Annu.Rev.PlantPhysiol.Plant Molec.Biol.42 (1991) 205-225) in description.Nucleic acid to be expressed or construct preferably are cloned into the carrier that is suitable for transforming agrobacterium tumefaciens (Agrobacterium tumefaciens), such as pBin19 (Bevan etc., Nucl.Acids Res.12 (1984) 8711).The Agrobacterium that is transformed by this carrier can be used for conversion of plant according to known way subsequently, the plant of for example using as model, (Arabidopsis is in scope of the present invention such as Arabidopis thaliana, be not considered as crop plants) or crop plants, for example tobacco plant is also cultivated them subsequently by the leaf that soaks abrasive leaf or chopping in Agrobacterium solution in suitable medium.The conversion of plant by agrobacterium tumefaciens for example by With Willmitzer at Nucl.Acid Res. (1988) 16, Vectors for Gene Transfer in Higher Plants is described in 9877 or especially from F.F.White; At Transgenic Plants, the 1st volume, Engineering and Utilization, S.D.Kung and R.Wu compile, and Academic Press is known in 1993, the 15-38 pages or leaves.
Except transformant cell (it is the necessary complete plant of regeneration subsequently), also might the merismatic cell of conversion of plant and special those cells that develop into gamete that transform.In this case, the gamete of conversion is followed natural development of plants process, produces transgenic plant.Therefore, for example the Arabidopis thaliana seed is processed with Agrobacterium and obtain seed from is grown plant, wherein a certain proportion of described plant is transformed and is genetically modified [Feldman, KA and Marks MD (1987) Mol GenGenet 208:274-289 therefore; Feldmann K (1992).: C Koncz compiles, N-H Chua and J Shell, Methods in Arabidopsis Research.Word Scientific, Singapore, 274-289 page or leaf].Alternative method based on repeatedly remove inflorescence and make in the rosette in the heart the excision position and the Agrobacterium incubation of conversion, thereby the seed that transforms can obtain at the time point in evening equally, and (Chang (1994) Plant is J.5:551-558; Katavic (1994) Mol Gen Genet, 245:363-370).Yet especially effective means is the vacuum infiltration method of improvement, such as " flower is contaminated " method.In the situation of Arabidopis thaliana vacuum infiltration method, complete plant is under reduced pressure processed [Bechthold, N (1993) with the Agrobacterium suspension.C R Acad Sci Paris Life Sci, 316:1194-1199], and in the situation of " flower dip method ", of short duration incubation [the Clough of Agrobacterium suspension that flower tissue and the tensio-active agent of growing processed, SJ and (und) Bent, AF (1998) The Plant J.16,735-743].Gathered in the crops in both cases a certain proportion of transgenic seed, and these seeds can be distinguished with the non-transgenic seed by cultivating under aforesaid selection condition.In addition, the stable conversion of plastid is favourable because plastid in most of crop with parent mode heredity, reduce or eliminated transgenosis through the pollen flow risk.The conversion of chloroplast gene group generally by at Klaus etc., 2004[Nature Biotechnology 22 (2), 225-229] in the exemplary method realization of being showed.In brief, sequence to be transformed be cloned into together with the selected marker and the flanking sequence of chloroplast gene group homology between.The flanking sequence of these homologies instructs locus specificity to be integrated in the plastom(e).To numerous different plant species described plastid transformation and the summary can come from Bock (2001) transgenosis plastid (Transgenicplastids in basic research and plant biotechnology) .J Mol Biol.2001 September 21 in fundamental research and Plant Biotechnology; 312 (3): 425-38 or Maliga, P (2003) plastid transformation technology commercialization progress (Progress towards commercialization of plastid transformationtechnology) .Trends Biotechnol.21,20-28.Further the biotechnology progress has been made report with the form of unmarked plastid transformation body recently, described unmarked plastid transformation body can produce (Klaus etc. by the instantaneous marker gene of integrating altogether, 2004, Nature Biotechnology 22 (2), 225-229).
The vegetable cell of genetic modification can be regenerated by all methods that those skilled in the art are familiar with.Suitable method be found in S.D.Kung and R Wu, Potrykus or
Figure G2007800463872D00301
Above-mentioned publication with Willmitzer.
Usually after conversion, vegetable cell or the cell colony of selecting one or more marks to exist, wherein said mark become whole strain plant with the material regeneration that transforms subsequently by the effable genes encoding of the plant that moves with the goal gene corotation.For the plant of selecting to transform, the vegetable material that obtains in conversion is accepted in principle selection condition and is processed, to such an extent as to the plant that transforms can be distinguished with unconverted plant.For example, can sow with the seed that mode mentioned above obtains, after date when initial the cultivation carries out suitable selection by spraying.Another kind of possibility is contained in the seed of growing on the agar plate that uses suitable selective agent (as required after sterilization), so that the seed that only transforms can grow into plant.Perhaps, the plant of conversion is by the existence screening of above-mentioned those selective markers.
After DNA shifted and regenerates, existence, copy number and/or genome structure that the conversion of plant of supposition can also for example use Southern to analyze goal gene were estimated.Alternative or in addition, the expression level of the new DNA that introduces can use Northern and/or Western, and these two kinds of technology are that those skilled in the art are well-known.
The conversion of plant that produces can be bred by several different methods, as passing through clonal expansion method or classical breeding technique.For example, the s-generation (or T2) transformant that the first-generation (or T1) conversion of plant can carry out selfing and select to isozygoty, and the T2 plant can further breed by classical breeding technique subsequently.
The inverting biological that produces can be taked various ways.For example, they can be the mosaics of transformant and non-transformed cell; Clone's transformant (for example being converted to contain whole cells of expression cassette); The transplant of transforming tissue and unconverted tissue (for example in plant, with the root stock of the conversion of unconverted grafting of tender branch).
The present invention extends to any vegetable cell or the plant that produces by any means described in the literary composition clearly, and extends to whole plant parts and propagulum thereof.The present invention extends further to and comprises the former generation conversion that produces by any preceding method or the offspring of transfectional cell, tissue, organ or whole strain plant, and unique requirement is Posterity phenotype one or more yielding characteristicses and/or the phenotypic characteristic identical with those offsprings that produce by the parental generation in the inventive method.
The present invention also comprises host cell, and it contains the nucleic acid of the III class TPP protein that separative coding defines as mentioned.The preferred host cell of the present invention is vegetable cell.
Host plant advantageously can synthesize whole plants of used polypeptide in the inventive method in principle for used nucleic acid or carrier, expression cassette or construct or carrier in the inventive method.
Therefore, as indicated above, the transgenic plant that are used for the object of the invention are interpreted as expression: at the genome of described plant, the used nucleic acid of the inventive method might will carry out homology or heterogenous expression by nucleic acid not on its natural gene seat.But, just as mentioned, genetically modified also expression: although in Plant Genome, according to nucleic acid used in nucleic acid of the present invention or the inventive method on its natural place, but described sequence is modified with respect to native sequences, and/or the regulating and controlling sequence of native sequences is modified.Genetically modifiedly preferably be interpreted as expression: express at nucleic acid according to the present invention non-natural seat in genome, and namely homology is expressed, and the heterogenous expression of nucleic acid perhaps preferably occurs.Preferred transgenic plant are mentioned at this paper.
The present invention also extend to plant the part gathered in the crops as, but be not limited to seed, leaf, fruit, flower, stem, root stock, stem tuber and bulb.The invention further relates to from, preferred directly from the product in the part gathered in the crops of this kind of plant, such as dried particles or powder, oil, fat and lipid acid, starch or protein.
According to preferred feature of the present invention, the expression of adjusting is the expression that increases.In this area, put down in writing in detail for increasing the method for nucleic acid or gene or gene product expression and they and for example comprised, by the overexpression of suitable promoters driven, use transcriptional enhancer or translational enhancer.Can in the suitable location (generally being the upstream) of the polynucleotide of non-allos form, be introduced as the isolating nucleic acid of promotor or enhancer element, so that up-regulated expression.For example, internal promoter can and/or replace and changes in vivo and (see Kmiec, United States Patent (USP) the 5th, 565, No. 350 by sudden change, disappearance; Zarling etc. PCT/US93/03868), maybe can give the startup that separates with respect to the correct direction of gene of the present invention and apart from the introduced plant cell, so that controlling gene is expressed.
If need expression of polypeptides, usually wish to comprise the poly-adenosine district at the 3 ' end in polynucleotide encoding district.The poly-adenosine district can be from natural gene, from multiple other plant gene or from T-DNA.3 ' terminal sequence to be added can be from for example nopaline synthase or octopine synthase gene or alternatively from another plant gene or more not preferably from any other eukaryotic gene.
As mentioned above, also can add intron sequences.
Other regulating and controlling sequences (except promotor, enhanser, silencer, intron sequences, 3 ' UTR and/or 5 ' UTR district, outside the Microrna target site) can be protein and/or RNA stabilization element.
As indicated above, the preferred method of expression that be used for to regulate the coding nucleic acid of (preferred increasing) III class TPP protein is the coding nucleic acid of introducing and expressing III class TPP protein plant; Yet, realize that our legal effect namely improves Correlated Yield Characters and also can realize with other known technologies.It below will be the description of some these type of technology.
A kind of this type of technology is that T-DNA activates mark (Hayashi etc., Science (1992) 1350-1353), it relates in the genome area of goal gene or gene coding region upstream or downstream 10kb sentence structure like this and insert T-DNA (usually containing promotor (also can be translational enhancer or intron)), so that promotor instructs the expression of being decided gene by target.Usually, the natural promoter of deciding gene by target decides to described target that the Enhancer elements effect is destroyed and this gene to be in the promotor control of new introducing lower.Promotor generally is embedded among the T-DNA.This T-DNA inserts Plant Genome randomly, for example by agroinfection, and causes near the improvement of the gene insertion T-DNA to be expressed.Cause is expressed near the improvement of the gene of the promotor of introducing, the transgenic plant performance dominant phenotype of generation.
Effect of the present invention also can use TILLING (local damage that the genome interior orientation is induced) technology to produce.This be for generation of and/or identify the induced-mutation technique of the coding nucleic acid of expression with change and/or active III class TPP protein.TILLING also allows to select to carry the plant of this type of mutation variants.These mutation variants may be displayed on the intensity aspect or aspect the position or in the expression (if for example sudden change affect promotor) of improvement aspect the time.These mutation variants can show than showed active higher III class TPP protein active by the gene that is in its natural form.TILLING is with high-density mutagenesis and high-throughput screening method combination.The general step of following in TILLING is: (Redei GP and Koncz C (1992) are at Methods in Arabidopsis Research in (a) EMS mutagenesis, Koncz C, Chua NH, Schell J, Singapore compiles, World Scientific PublishingCo, the 16-82 page or leaf; Feldmann etc., (1994) at Meyerowitz EM, Somerville CR compiles, Arabidopsis.Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY, 137-172 page or leaf; Lightner J and Caspar T (1998) are at JMartinez-Zapater, and J Salinas compiles, Methods on Molecular Biology the 82nd volume .Humana Press, Totowa, NJ, 91-104 page or leaf); (b) individual DNA prepares and compiles; (c) pcr amplification purpose district; (d) denature and renature is to allow to form heteroduplex; (e) DHPLC, wherein with heteroduplex whether the existence in compiling thing detect and be an extra peak in the color atlas; (f) identify mutated individual; (g) to the order-checking of sudden change PCR product.The method that is used for TILLING is (McCallum etc., (2000) Nat Biotechnol 18:455-457 well-known in the art; Summary is seen Stemple (2004) Nat Rev Genet 5 (2): 145-50).
Effect of the present invention also can use homologous recombination to produce, and the nucleic acid that described homologous recombination allows to select is introduced in the genome on the selected location of determining.Homologous recombination is the standard technique that is used for routinely unicellular lower eukaryote such as yeast or liver moss sword-like leave moss (Physcomitrella) in bio-science.The method that is used for carrying out homologous recombination plant is not only to model plant (Offringa etc. (1990) EMBO J9 (10): 3077-84) but also to crop plants such as rice (Terada etc. (2002) Nat Biotech20 (10): 1030-4; Iida and Terada (2004) Curr Opin Biotech 15 (2): 132-8) be described.
This paper mentions that the Correlated Yield Characters of improvement means the biomass (weight) that the one or more parts of plant increase, and described part can comprise on the ground (can gather in the crops) part and/or underground (can gather in the crops) part.
Particularly, this type of can gather in the crops part is seed, and the enforcement of the inventive method generation has the plant of the seed production of increase with respect to the seed production of suitable control plant.
Term " output " but usually mean the measuring result of economic worth, its inevitable with specify crop, with area and relevant with the time period.Single plant part based on they number, size and/or weight and directly output is had contribution, or actual output is the every acre yield for certain crop and time, and this determines divided by the acreage of plantation by ultimate production (comprise results with output assessment).
Term " increase ", " improvement " or " enhancing " be interchangeable and should refer to compare at least 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 35% or 40% more output and/or growth with wild-type plant as defined herein in the application's implication.
The seed production itself that increases can show as following one or more indexs: a) seed biomass (seed gross weight) increases, and this can be based on single seed and/or every strain plant and/or per hectare or acre; B) every strain plant increases spends number; C) (full) seed number that increases; D) the full rate of seed (it is expressed as the ratio between full seed number and the seed sum) that increases; E) harvest index that increases, it is expressed as the ratio that can gather in the crops part (such as seed) output and total biomass; And f) thousand seed weight (TKW) that increases, this is from full seed number and the gross weight extrapolation thereof of counting.The TKW that increases can be because of due to the seed size and/or seed weight that increase, and also can be because of due to the increase of embryo and/or endosperm size.
The increase of seed production also can show as the increase of seed size and/or seed volume.In addition, the increase of seed production itself can self-expression be the increase of seed area and/or seed length and/or seed width and/or seed girth also.
Take corn as example, the output increase can show as following one or more indexs: the increase of the increase of per hectare or the increase of the acre plant number of cultivating, every strain plant spike number, line number, every row grain number, grain weight, thousand seed weight, fringe length/diameter, the increase of the full rate of seed (wherein the full rate of seed is that the full seed number is total and multiply by 100 divided by seed) and other.Take rice as example, itself can show as the increase of following one or more indexs the output increase: the increase of per hectare or acre plant number, every strain plant panicle number, every panicle spikelet number, every panicle flower (Xiao Hua) number (it is expressed as the full seed number to the ratio of former panicle number), the full rate of seed (wherein the full rate of seed be the full seed number divided by the seed sum and multiply by 100), the increase of thousand seed weight and other.
Because transgenic plant of the present invention have the seed production of increase, thereby with respect to the growth velocity of control plant, the growth velocity that these plants might the corresponding stage performance in its life cycle increase (during its life cycle at least part of).The growth velocity that increases can be specific for one or more parts (comprising seed) of plant, or can basically spread all over whole strain plant.Plant with growth velocity of increase can possess short life cycle.The life of plant cycle can be considered as meaning to grow to the needed time in stage that plant has produced the dry mature seed similar to parent material from dry mature seed.This life cycle can be affected by following factors, such as early stage vigor, growth velocity, green degree index, flowering time and seed maturity speed.The increase of growth velocity can occur during life cycle on the one or more stages in life cycle or whole plant basically plant.The growth velocity that increases during early stage in life cycle of plant can reflect the vigor of enhancing.The increase of growth velocity can change the harvest cycle of plant, allows plant than the late sowing kind and/or than early harvest, otherwise this is with impossible (similar effect can obtain with flowering time early).If growth velocity increases fully, can allow further to sow the seed (for example sowing and gather in the crops the rice plant, subsequently sowing and optional other rice plants that gather in the crops in a conventional growth cycle) of identical plant species.Similarly, if growth velocity sufficiently increases, can allow further to sow the seed (for example sowing and harvesting corn plant are for example sowed and optional results soybean, potato or any other suitable plant subsequently) of different plant species.The results additional times also is possible in the situation of some crop plants from identical rhizome.The harvest cycle that changes plant can cause the increase of every acre year biomass yield (number of times (as in a year) that can grow and gather in the crops because of any specified plant increases).The increase of growth velocity also can allow cultivating transgenic plant in the geographic area widely than its wild type counterparts, because the region limits of cultivating crop is often determined by the plantation time (dry season) or in the adverse environment condition of results period (season in evening).If the shortening harvest cycle then can be avoided this class unfavourable condition.Growth velocity can be determined by obtain many kinds of parameters from growth curve, this type of parameter can be: T-Mid (plant reaches the time that its 50% overall dimension spends) and T-90 (plant reaches the time that its 90% overall dimension spends), etc.
The plant of the growth velocity with increase is compared in the enforcement generation of the inventive method with control plant.Thereby according to the present invention, providing the method that increases plant growth rate, it comprises adjusting, the expression of III class TPP nucleic acid sequences to proteins in plant as defined herein of preferred increase coding.
Compare with control plant, no matter plant is under the non-stress condition or plant is exposed under the various abiotic stress, and the increase of output and/or growth velocity all occurs.Plant is generally replied being exposed to coerce to make by growing slowlyer.Under the condition of serious stress of soil condition, plant even can stop growing fully.On the other hand, slightly coerce and be defined as in this article plant any of its exposure coerced, the wherein said ability that does not cause plant to stop growing fully and recover growth of coercing.Compare with the control plant under the non-stress condition, slightly coerce and in meaning of the present invention, cause being coerced the plant-growth reduction less than 40%, 35% or 30%, preferably less than 25%, 20% or 15%, be more preferably less than 14%, 13%, 12%, 11% or 10% or lower.Because the progress on the agricultural practice (irrigation, fertilising, pesticide treatments) does not often run into condition of serious stress of soil in the raise crop plant.Therefore, by the impaired growth of the slight stress-inducing upper undesirable feature of agricultural often.Slightly coerce is that the common biological and/or inanimate (environment) that plant exposes is coerced.Abiotic stress can be because of due to arid or waterlogging, Anoxia stress, salt stress, chemical toxicity, oxidative stress and heat, cold or the freezing temperature.Abiotic stress can be to coerce (especially because arid), salt stress, oxidative stress or ion by water to coerce the osmotic stress that causes.It generally is that those that caused by pathogenic agent such as bacterium, virus, fungi and insect are coerced that biology is coerced.Other abiotic stress may cause nutrition deficient, for example the scarcity of nitrogen, phosphorus and potassium.
Especially, method of the present invention can be implemented the plant that has the output of increase with respect to control plant to produce under non-stress condition or under slight drought condition.Such as report in (Planta (2003) 218:1-14) such as Wang, abiotic stress causes adversely affecting a series of morphological change, physiology variation, biochemical change and the molecule of plant-growth and productivity to change.Known arid, salinity, extreme temperature and oxidative stress are also can damaging and primary cellular defect by induced growth by similar mechanism of connecting each other.Rabbani etc. (Plant Physiol (2003) 133:1755-1767) have described " cross-talk " that drought stress and high salinity are coerced a very high degree.For example, arid and/or salinification main manifestations are osmotic stress, cause the destruction of cell homeostasis and ion distribution.Often follow the oxidative stress of high temperature or low temperature, salinity or drought stress can cause functional protein and structural protein sex change.Therefore, these various environment-stress usually activate similar Cell signal transduction pathway and cell response, as producing stress protein matter, raising antioxidant, accumulation compatible solute and growth-inhibiting.Term as used in this article " non-coercing " condition is the envrionment conditions that allows the plant optimum growh.Those skilled in the art know that normal edaphic condition and weather condition for given place.
The enforcement of the inventive method is with respect to the appropriate control plant of cultivating under comparable conditions, gives under non-stress condition or output that the plant of cultivating under slight drought condition increases.Thereby the invention provides under non-stress condition or the method for the plant of under slight drought condition, cultivating improvement Correlated Yield Characters, described method comprises that the nucleic acid that increases coding III class TPP polypeptide expresses in plant.
In the preferred embodiment of the invention, the Correlated Yield Characters of improvement represents by one or more increase in following: the seed sum of every strain plant, the full seed number of every strain plant and the seed weight of every strain plant.Preferably, these are increased under the non-stress condition and find in the growing plants.
The inventive method advantageously is applicable to any plant.
Term as used in this article " plant " comprise ancestors and offspring and the plant part of whole strain plant, plant, comprise seed, branch, stem, leaf, root (comprising stem tuber), flower and tissue and organ, wherein every kind of mentioned object comprises goal gene/nucleic acid.Term " plant " also comprise vegetable cell, suspension culture, callus, embryo, meristem zone, gametophyte, sporophyte, pollen and sporule, same every kind of object of mentioning comprises goal gene/nucleic acid.
The plant that is used in particular in the inventive method comprises the whole plants that belong to vegitabilia (Viridiplantae) superfamily, especially monocotyledons and dicotyledons comprise being selected from following feeding or feed beans, ornamental plant, food crop, tree or shrub: maple species (Acer spp.), Actinidia species (Actinidia spp.), Abelmoschus species (Abelmoschus spp.), Agropyron species (Agropyron spp.), allium species (Allium spp.), Amaranthus species (Amaranthus spp.), pineapple (Ananas comosus), Anona species (Annona spp.), celery (Apiumgraveolens), Arachis species (Arachis spp.), Artocarpus Forst species (Artocarpus spp.), officinalis (Asparagus officinalis), Avena species (Avena spp.) (oat (Avenasativa) for example, wild avena sativa (Avena fatua), than praising oat (Avena byzantina), Avena fatua var.sativa, hybrid oat (Avena hybrida), carambola (Averrhoa carambola), wax gourd (Benincasa hispida), Brazil's chestnut (Bertholletia excelsea), beet (Beta vulgaris), Btassica species (Brassica spp.) (colea (Brassica napus) for example, overgrown with weeds blue or green species (Brassica rapa ssp.) [canola oil dish, rape (oilseed rape), turnip (turnip rape)]), Cadaba farinosa, tea (Camellia sinensis), Canna generalis Bailey (Canna indica), Capsicum species (Capsicum spp.), Carex elata, papaya (Carica papaya), carissa macrocarpa (Carissa macrocarpa), hickory species (Carya spp.), safflower (Carthamustinctorius), Castanea species (Castanea spp.), hare's-lettuce (Cichorium endivia), Cinnamomum species (Cinnamomum spp.), watermelon (Citrullus lanatus), Citrus species (Citrus spp.), cocoanut species (Cocos spp.), Coffea species (Coffea spp.), taro (Colocasiaesculenta), Africa Firmiana species (Cola spp.), coriander (Coriandrum sativum), Corylus species (Corylus spp.), hawthorn species (Crataegus spp.), Stigma Croci (Crocussativus), Cucurbita species (Cucurbita spp.), Cucumis species (Cucumis spp.), cynara scolymus species (Cynara spp.), Radix Dauci Sativae (Daucus carota), acutifoliate podocarpium herb species (Desmodiumspp.), longan (Dimocarpus longan), Wild yam species (Dioscorea spp.), Diospyros species (Diospyros spp.), Echinochloa species (Echinochloa spp.), oil palm belongs to (Elaeis) (oil palm (Elaeis guineensis) for example, America oil palm Elaeis (oleifera)) Finger-millet (Eleusine coracana), loquat (Eriobotrya japonica), red young fruit (Eugenia uniflora), Fagopyrum species (Fagopyrum spp.), Fagus species (Fagus spp.), Fructus Fici (Ficus carica), cumquat species (Fortunella spp.), Fragaria species (Fragaria spp.), ginkgo (Ginkgobiloba), Glycine (Glycine spp.) (soybean for example, soybean (Soja hispida) or soybean (Sojamax)), upland cotton (Gossypium hirstum), Helianthus (Helianthus spp.) (for example Sunflower Receptacle (Helianthus annuus)), long tube tawny daylily (Hemerocallis fulva), hibiscus species (Hibiscus spp.), Hordeum (Hordeum spp.) (for example barley (Hordeum vulgare)), sweet potato (Ipomoea batatas), Juglans species (Juglans spp.), lettuce (Lactuca sativa), Lathyrus species (Lathyrus spp.), Lens culinaris (Lens culinaris), flax (Lmumusitatissimum), lichee (Litchi chinensis), Lotus species (Lotus spp.), patola (Luffa acutangula), lupinus species (Lupinus spp.), Luzula sylvatica, tomato belongs to (Lycopersicon spp.) (tomato (Lycopersicon esculentum for example, Lycopersicon lycopersicum, Lycopersicon pyriforme)), sclerderm Macroptilium species (Macrotyloma spp.), Malus species (Malus spp.), recessed edge Malpighia coccigera (Malpighiaemarginata), shea (Mammea americana), mango (Mangifera indica), cassava species (Manihot spp.), sapota (Manilkara zapota), clover (Medicagosativa), Melilotus species (Melilotus spp.), Mentha species (Mentha spp.), awns species (Miscanthus spp.), Momordica species (Momordica spp.), black mulberry (Morus nigra), Musa species (Musa spp.), Nicotiana species (Nicotiana spp.), Olea species (Oleaspp.), Opuntia species (Opuntia spp.), bird foot Macroptilium species (Ornithopus spp.), Oryza (Oryza spp.) (rice for example, broad-leaved rice (Oryza latifolia)), millet (Panicum miliaceum), Purple Granadilla (Passiflora edulis), Selinum pastinaca (Pastinaca sativa), Persea species (Perseaspp.), celery (Petroselinum crispum), Phaseolus species (Phaseolus spp.), thorn certain herbaceous plants with big flowers species (Phoenix spp.), Physalis species (Physalis spp.), Pinus species (Pinus spp.), Pistacia vera (Pistacia vera), Pisum species (Pisum spp.), Poa L. species (Poaspp.), Populus species (Populus spp.), mesquite grass species (Prosopis spp.), Prunus species (Prunus spp.), Psidium species (Psidium spp.), pomegranate (Punica granatum), European pear (Pyrus communis), oak species (Quercus spp.), radish (Raphanussativus), rheum rhabarbarum (Rheum rhabarbarum), currant species (Ribes spp.), castor-oil plant (Ricinus communis), rubus species (Rubus spp.), saccharum species (Saccharum spp.), Sambucus species (Sambucus spp.), rye (Secale cereale), flax species (Sesamum spp.), sinapsis alba species (Sinapis sp.), Solanum (Solanumspp.) (potato (Solanum tuberosum) for example, red eggplant (Solanum integrifolium) or tomato (Solanum lycopersicum)), dichromatism chinese sorghum (Sorghum bicolor), spinach species (Spinacia spp.), Syzygium species (Syzygium spp.), Tagetes species (Tagetes spp.), tamarind (Tamarindus indica), cocoa tree (Theobroma cacao), Clover species (Trifolium spp.), Triticosecale rimpaui, Triticum (Triticum spp.) (common wheat (Triticum aestivum) for example, durum wheat (Triticum durum), cylinder wheat (Triticumturgidum), Triticum hybernum, Macha wheat (Triticum macha) (Triticum macha), common wheat (Triticum sativum) or common wheat (Triticum vulgare)), little Flower of Chinese Globeflower (Tropaeolumminus), Flower of Chinese Globeflower (Tropaeolum majus), genus vaccinium species (Vaccinium spp.), tare species (Vicia spp.), Vigna species (Vigna spp.), sweet violet (Viola odorata), Vitis species (Vitis spp.), Zea mays, Zizania palustris, zizyphus species (Ziziphus spp.) etc.
According to the preferred embodiment of the invention, plant is crop plants.The example of crop plants comprises soybean, Sunflower Receptacle, canola oil dish (canola), clover, rape (rapeseed), cotton, tomato, potato and tobacco.Also preferably, plant is monocotyledons.Monocotyledonous example comprises sugarcane.More preferably, plant is cereal.The example of cereal comprises rice, corn, wheat, barley, grain, rye, Chinese sorghum and oat.
The present invention also comprises the purposes and the purposes of these III classes TPP protein for improvement plant biomass correlated character of the nucleic acid of coding III class TPP protein as herein described.
Nucleic acid or the III class TPP protein itself of coding III class TPP protein as herein described can be used for the procedure of breeding, wherein identify the dna marker that can be connected with III class TPP encoding gene hereditarily.Described nucleotide sequence/gene or III class TPP protein itself can be used for defining molecule marker.This DNA or protein labeling can be used for selecting to have in the methods of the invention the as mentioned plant of the Correlated Yield Characters of the improvement of definition subsequently in the procedure of breeding.
The nucleic acid of coding III class TPP protein or the allelic variant of gene also can be used for the auxiliary procedure of breeding of mark.This procedure of breeding needs to introduce allelic variation by for example using the EMS mutagenesis that plant is carried out mutagenic treatment sometimes; Alternatively, this program can be from one group of allelic variant of the non-artificial what is called that causes " nature " origin.Carry out subsequently the evaluation of allelic variant, for example by the PCR method.After this be the step of excellent allelic variant of discussing and cause increasing the sequence of output for selecting.The growth performance that generally contains the plant of the different allelic variants that sequence is discussed to some extent by monitoring is implemented to select.Can be in the greenhouse or the monitor on field growth performance.Other optional step comprise and will identify plant and the another kind of plant hybridization of excellent allelic variant.This can be used for for example producing the combination of target phenotypic characteristic.
The nucleic acid of coding III class TPP protein also can be as probe in order to carry out genetic mapping or physical mapping to gene, and described probe reaches the mark of the proterties related with these genes as the part of described gene.This type of information can be used for plant breeding, so that exploitation has the strain of purpose phenotype.The nucleotide sequence that this purposes of the nucleic acid of coding III class TPP protein only needs to have at least 15 length of nucleotides.The nucleic acid of coding III class TPP protein can be used as restriction fragment length polymorphism (RFLP) mark.Southern trace (the Sambrook J of the plant genome DNA of restrictive diges-tion, Fritsch EF and Maniatis T (1989) Molecular Cloning, ALaboratory Manual) can be with the nuclei acid probe of coding III class TPP protein.What produce carries out genetic analysis to make up genetic map in conjunction with graphic computer program such as the MapMaker (Lander etc. (1987) Genomics1:174-181) of can using subsequently.In addition, this nucleic acid can be used for surveying the Southern trace of the genomic dna that contains one group of individuality processing through restriction endonuclease, and wherein said one group of individual representative has parental generation and the offspring of definite genetic cross.The separation of dna polymorphism is marked and is used for calculating the position (Botstein etc. (1980) Am.J.Hum.Genet.32:314-331) of nucleic acid in using the previous genetic map that obtains of this colony of III class TPP protein.
Generation and its purposes in genetic mapping of the probe that plant gene derives have been described in Bernatzky and Tanksley (1986) Plant Mol.Biol.Reporter 4:37-41.Numerous publications have been described the genetic mapping that uses methodology mentioned above or its modification method that specific cDNA is cloned.For example, to hand over mutually group, the group that backcrosses, panmictic population, contiguous isozygotying be can be used for mapping with other population of individuals to F2.This type of methodology is that those skilled in the art are well-known.
It (is the arrangement of sequence on physical map that described nucleic acid probe also can be used for physical mapping; See that Hoheisel etc. exists: Non-mammalian Genomic Analyasis:A Practical Guide, Academic press 1996, the 319-346 pages or leaves and the reference of wherein quoting).
In another embodiment, nucleic acid probe can directly use in fluorescence in situ hybridization (FISH) graphing method (Trask (1991) Trends Genet.7:149-154).(several kb are to a hundreds of kb although large-scale clone is used in current FISH graphing method support; See (1995) the Genome Res.5:13-20 such as Laan), however the improvement of sensitivity can allow to use shorter probe to carry out the FISH mapping.
The multiple method based on nucleic acid amplification that is used for genetic mapping and physical mapping can be used described nucleotide sequence and implement.Example is found in " definition " part in the literary composition.Example comprises the polymorphism (CAPS of allele specific amplification (Kazazian (1989) J.Lab.Clin.Med 11:95-96), pcr amplified fragment; Sheffield etc., (1993) Genomics 16:325-332), allele-specific connects (Landegren etc., (1988) Science 241:1077-1080), Nucleotide extension (Sokolov (1990) Nucleic Acid Res.18:3671), Radiation hybrid mapping (Walter etc., Nat.Genet.7:22-28) and Happy mapping (Dear and Cook, (1989) NucleicAcid Res.17:6795-6807) (1997).For implementing these methods, use the nucleotide sequence design and produce the primer pair that is used for amplified reaction or primer extension reaction.The design of this class primer is that those skilled in the art are well-known.Use the method for the genetic mapping of PCR-based, may need to identify the difference of crossing over corresponding to dna sequence dna between the parent of nucleotide sequence of the present invention zone mapping.Yet this is usually dispensable to drawing method.
The inventive method produces the plant of the seed production that has as previously described increase.These proterties also can with economically favourable other proterties combinations, as output strengthen proterties, to other abiotic and biological tolerances of coercing, the proterties of regulating multiple constructivity feature and/or biochemical characteristics and/or physiologic character.
Accompanying drawing is described
The present invention is described referring now to following accompanying drawing, wherein:
Fig. 1 is the synoptic diagram of the structural element that exists in the III class TPP polypeptide.The position of the characteristic element that illustrates: treahalose phosphate phosphatase domain, phosphatase-1 b OX A and BOX B, and Serine is rich in structural domain.
Fig. 2 is sequence alignment and the genealogical tree of embodiment 2 described TPS/TPP polypeptide.Fig. 2 A shows the genealogical tree of TPS/TPP polypeptide.The evolution Zhi Hanyou I class TPS protein that ellipse is irised out and II class TPS protein.III class TPP protein (in the rectangle frame) does not cluster in I class and II class TPS group.Fig. 2 B shows the comparison of the III class TPP polypeptide of plant origin.The zone of treahalose phosphate phosphatase domain highlights with black matrix.Serine is rich in (structural domain) and Phosphoric acid esterase A and B frame and highlights with the rectangle frame.Fig. 2 C shows the genealogical tree of the III class TPP polypeptide in non-plant source.The comparison of the III class TPP polypeptide in Fig. 2 D non-plant source.
Fig. 3 is the comparison of the treahalose phosphate phosphatase domain found in the III class TPP polypeptide.
Fig. 4 shows the TPP activity that HPLC measures.First figure, the corresponding control sample pGEX of Fig. 4 A, second figure, the corresponding TPPI sample of Fig. 4 B.
Fig. 5 is the quantitatively active column diagram of TPP that shows that control sample, pGEX and TPP sample HPLC measure.
Fig. 6 shows that Arabidopis thaliana III class TPP polypeptide is to the complementarity of yeast strain YSH448 (tps2 Δ) growth defect.The flat board of the spot test (drop assay) that the photo among Fig. 6 A is corresponding 30 ℃, it all is alive being presented at bacterial strains all under the non-limiting temperature.Fig. 6 B shows 37 ℃ of lower flat boards, and it is presented to only have under 37 ℃ of the restrictive temperatures only has the strain growth of III class TPP polypeptide conversion good.Fig. 6 C shows the flat board of 39 ℃ of lower spot tests.
Fig. 7 is for increasing the binary vector of the Arabidopis thaliana III class TPP protein coding expression of nucleic acid under the control of GOS2 promotor in the rice.
Fig. 8 sequence table.
Embodiment
The present invention is described referring now to as an illustration the following example only.The following example is not intended to thoroughly definition or the restriction scope of the invention.
Embodiment 1: identify SEQ ID NO:1 and the relevant sequence of SEQ ID NO:2
Usage data storehouse sequence search instrument is such as basic Local Alignment instrument (BLAST) (Altschul etc. (1990) J.Mol.Biol.215:403-410; With (1997) Nucleic Acids Res.25:3389-3402 such as Altschul) identify (full-length cDNA, EST or the genome) sequence relevant with SEQ ID NO:1 and/or the protein sequence relevant with SEQ ID NO:2 in those sequences of in the Entrez RiboaptDB of NCBI (NCBI), safeguarding.This program is used for relatively and by the significance,statistical that calculates coupling finding the zone that has local similarity between sequence by nucleotide sequence or peptide sequence and sequence library.The polypeptide coded to SEQ ID NO:1 uses the TBLASTN algorithm, adopts default setting and filters to ignore the counteracting of low-complexity sequence.The result who analyzes relatively shows by pairing property, and according to probability scoring (E-value) ordering, wherein is somebody's turn to do the specific comparison result of scoring reflection because of the accidental probability (the E-value is lower, and the significance of hitting is higher) that occurs.Except the E-value, more also score by identity percentage ratio.Identity percentage ratio refer to two compare identical Nucleotide (or amino acid) number in the length-specific scope between nucleic acid (or polypeptide) sequence.In some cases, can adjust default parameters to regulate the severity of search procedure.
Table A provides the nucleic acid relevant with the protein sequence shown in the nucleotide sequence shown in the SEQ ID NO:1 and the SEQ ID NO:2 and the tabulation of protein sequence.
Table A: be used for the nucleotide sequence relevant with nucleotide sequence shown in the SEQ ID NO:1 of the inventive method, and corresponding derivation polypeptide.For each sequence, provide protein or the database login of the nucleic acid of this protein of encoding number.
Title The source is biological NT/PROT SEQ ID NO： Database login number State
＞SEQ ID NO：2 Arabidopis thaliana nt 1 NA Total length
＞SEQ ID NO：2 Arabidopis thaliana PROT 2 NA Total length
＞Ta_contig100831008 Common wheat nt 3 NA Total length
＞Ta_contig100831008 Common wheat PROT 4 NA Total length
＞Gm_contig16565 Soybean nt 5 NA Total length
＞Gm_contig16565 Soybean PROT 6 NA Total length
＞TAG_Contig-7-M6b1 The Tagetes species nt 7 NA Total length
＞TAG_Contig-7-M6b1 The Tagetes species PROT 8 NA Total length
＞AT1G22210 Arabidopis thaliana nt 9 AT1G22210 Total length
＞AT1G22210 Arabidopis thaliana PROT 10 AT1G22210 Total length
＞AT1G35910 Arabidopis thaliana nt 11 AT1G35910 Total length
＞AT1G35910 Arabidopis thaliana PROT 12 AT1G35910 Total length
＞AT1G78090 Arabidopis thaliana nt 13 AT1G78090 Total length
＞AT1G78090 Arabidopis thaliana PROT 14 AT1G78090 Total length
＞AT2G22190 Arabidopis thaliana nt 15 AT2G22190 Total length
＞AT2G22190 Arabidopis thaliana PROT 16 AT2G22190 Total length
＞AT4G12430 Arabidopis thaliana nt 17 AT4G12430 Total length
＞AT4G12430 Arabidopis thaliana PROT 18 AT4G12430 Total length
＞AT4G22590 Arabidopis thaliana nt 19 AT4G22590 Total length
＞AT4G22590 Arabidopis thaliana PROT 20 AT4G22590 Total length
＞At4g39770 Arabidopis thaliana nt 21 At4g39770 Total length
＞At4g39770 Arabidopis thaliana PROT 22 At4g39770 Total length
＞AT5G10100 Arabidopis thaliana nt 23 AT5G10100 Total length
＞AT5G10100 Arabidopis thaliana PROT 24 AT5G10100 Total length
＞AT5G51460 Arabidopis thaliana nt 25 AT5G51460 Total length
＞AT5G51460 Arabidopis thaliana PROT 26 AT5G51460 Total length
＞AT5G65140 Arabidopis thaliana nt 27 AT5G65140 Total length
＞AT5G65140 Arabidopis thaliana PROT 28 AT5G65140 Total length
＞pOP-lcl|scaff_II.875 The comospore poplar nt 29 pOP-lcl|scaff_II .875 Total length
＞pOP-lcl|scaff_II.875 The comospore poplar PROT 30 pOP-lcl|scaff_II .875 Total length
＞pOP-lcl|scaff_V.739 The comospore poplar nt 31 pOP-lcl|scaff_V. 739 Total length
＞pOP-lcl|scaff_V.739 The comospore poplar PROT 32 pOP-lcl|scaff_V. 739 Total length
＞pOP-lcl|scaff_VII.559 The comospore poplar nt 33 pOP-lcl|scaff_V II.559 Total length
＞pOP-lcl|scaff_VII.559 The comospore poplar PROT 34 pOP-lcl|scaff_V II.559 Total length
＞pOP-llcl|scaff_127.52 The comospore poplar nt 35 pOP-llcl|scaff_1 27.52 Total length
＞pOP-llcl|scaff_127.52 The comospore poplar PROT 36 pOP-llcl|scaff_1 27.52 Total length
＞pOP-llcl|scaff_III.843 The comospore poplar nt 37 pOP-llcl|scaff_I II.843 Total length
＞pOP-llcl|scaff_III.843 The comospore poplar PROT 38 pOP-llcl|scaff_I II.843 Total length
＞pOP-llcl|scaff_V.167 The comospore poplar nt 39 pOP-llcl|scaff_ V.167 Total length
＞pOP-llcl|scaff_V.167 The comospore poplar PROT 40 pOP-llcl|scaff_ V.167 Total length
＞pOP-llcl|scaff_XII.1254 The comospore poplar nt 41 pOP-llcl|scaff_ XII.1254 Total length
＞pOP-llcl|scaff_XII.1254 The comospore poplar PROT 42 pOP-llcl|scaff_ XII.1254 Total length
＞pOP-llcl|scaff_XV.1052 The comospore poplar nt 43 pOP-llcl|scaff_ XV.1052 Total length
＞pOP-llcl|scaff_XV.1052 The comospore poplar PROT 44 pOP-llcl|scaff_ XV.1052 Total length
＞Os02g0661100 Rice nt 45 Os02g0661100 Total length
＞Os02g0661100 Rice PROT 46 Os02g0661100 Total length
＞Os02g0753000 Rice nt 47 Os02g0753000 Total length
＞Os02g0753000 Rice PROT 48 Os02g0753000 Total length
＞Os03g0386500 Rice nt 49 Os03g0386500 Total length
＞Os03g0386500 Rice PROT 50 Os03g0386500 Total length
＞Os06g0222100 Rice nt 51 Os06g0222100 Total length
＞Os06g0222100 Rice PROT 52 Os06g0222100 Total length
＞Os07g0485000 Rice nt 53 Os07g0485000 Total length
＞Os07g0485000 Rice PROT 54 Os07g0485000 Total length
＞Os07g0624600 Rice nt 55 Os07g0624600 Total length
＞Os07g0624600 Rice PROT 56 Os07g0624600 Total length
＞Os09g0369400 Rice nt 57 Os09g0369400 Total length
＞Os09g0369400 Rice PROT 58 Os09g0369400 Total length
＞Os10g0553300 Rice nt 59 Os10g0553300 Total length
＞Os10g0553300 Rice PROT 60 Os10g0553300 Total length
＞Aquilegia_TC11239 The aquilegia species nt 61 Aquilegia_TC1 1239 Total length
＞Aquilegia_TC11239 The aquilegia species PROT 62 Aquilegia_TC1 1239 Total length
＞Aquilegia_TC17706 The aquilegia species nt 63 Aquilegia_TC1 7706 Total length
＞Aquilegia_TC17706 The aquilegia species PROT 64 Aquilegia_TC1 7706 Total length
＞Bc_Q4AC11 Rape nt 65 Bc_Q4AC11 Total length
＞Bc_Q4AC11 Rape PROT 66 Bc_Q4AC11 Total length
＞Br_Q4ABQ9 Overgrown with weeds blue or green nt 67 Br_Q4ABQ9 Total length
＞Br_Q4ABQ9 Overgrown with weeds blue or green PROT 68 Br_Q4ABQ9 Total length
＞Gh_TC35369 Upland cotton nt 69 Gh_TC35369 Total length
＞Gh_TC35369 Upland cotton PROT 70 Gh_TC35369 Total length
＞Hv_TC139314 Barley nt 71 HV_TC139314 Total length
＞Hv_TC139314 Barley PROT 72 HV_TC139314 Total length
＞Mt_TC108059 The puncture vine clover nt 73 Mt_TC108059 Total length
＞Mt_TC108059 The puncture vine clover PROT 74 Mt_TC108059 Total length
＞Mt_TC108097 The puncture vine clover nt 75 Mt_TC108097 Total length
＞Mt_TC108097 The puncture vine clover PROT 76 Mt_TC108097 Total length
＞Nb_TC7464 The Ben Shi tobacco nt 77 Nb_TC7464 Total length
＞Nb_TC7464 The Ben Shi tobacco PROT 78 Nb_TC7464 Total length
＞Nt_Q3ZTF5 Tobacco nt 79 Nt_Q3ZTF5 Total length
＞Nt_Q3ZTF5 Tobacco PROT 80 Nt_Q3ZTF5 Total length
＞Nt_TC7310 Tobacco nt 81 Nt_TC7310 Total length
＞Nt_TC7310 Tobacco PROT 82 Nt_TC7310 Total length
＞Sb_TC17204 Dichromatism chinese sorghum nt 83 Sb_TC17204 Total length
＞Sb_TC17204 Dichromatism chinese sorghum PROT 84 Sb_TC17204 Total length
＞St_TC151769 Dichromatism chinese sorghum nt 85 St_TC151769 Total length
＞St_TC151769 Dichromatism chinese sorghum PROT 86 St_TC151769 Total length
＞Ta_TC252250 Common wheat nt 87 Ta_TC252250 Total length
＞Ta_TC252250 Common wheat PROT 88 Ta_TC252250 Total length
＞Zm_ABD92779 Zea mays nt 89 Zm_ABD92779 Total length
＞Zm_ABD92779 Zea mays PROT 90 Zm_ABD92779 Total length
＞Zm_ABD92780 Zea mays nt 91 Zm_ABD92780 Total length
＞Zm_ABD92780 Zea mays PROT 92 Zm_ABD92780 Total length
NA. not application.In public database, do not find.
Nt: nucleotide sequence
PROT: protein sequence
The comparison of embodiment 2:III class TPP peptide sequence
(it is based on clustering algorithm (Clustal algorithm) (Thompson etc., (1997) NucleicAcids Res 25:4876-4882 of the progressive comparison of generally using from the AlignX program of Vector NTI (Invitrogen) in use; Chenna etc., (2003) Nucleic Acids Res31:3497-3500)) carry out the comparison of III class TPP peptide sequence.Can use in abutting connection with clustering algorithm constructing system tree, adopt default value (default value of the open point penalty in room is 10, and the default value that point penalty is extended in the room is 0.1, and the weight matrix of selection is Blosum 62 (if comparison polypeptide)).
Embodiment 3: calculate the overall per-cent identity (global percentage identity) between the peptide sequence can be used for implementing the inventive method
A method MatGAT in the method that use can obtain in this area (matrix overall comparison instrument (Matrix Global Alignment Tool)) software (BMC Bioinformatics.20034:29.MatGAT: use protein or dna sequence dna and the application that produces similarity/identity matrix, Campanella JJ, Bitincka L, Smalley J; Software by Ledion Bitincka trustship), determine overall similarity and identity per-cent between some given in 1 Table A of embodiment full-length polypeptide sequences.MatGAT software need not data are compared in advance, can produce the similarity of DNA or protein sequence/identity matrix.This program is utilized Myers and Miller overall comparison algorithm, and (the open point penalty in room is 12, and to extend point penalty be 2 in the room) carry out a series of in twos comparison, utilize Blosum 62 (for polypeptide) to calculate similarity and identity, then the result is arranged in distance matrix.Sequence similarity is shown in the diagonal lines Lower Half, and sequence identity is shown in the diagonal lines first half.
More used parameter has:
Matrix: Blosum 62 scores
First room: 12
Extend the room: 2
The software analysis result of overall situation similarity and identity is shown in diagonal lines below and the diagonal lines top among the table B.Overall similarity between the paralog protein shown in SEQ ID NO:2 and the table B1 is greater than 48% identity.The similarity of the plant homologous sequence that SEQ ID NO:2 and table B2 and B3 provide is greater than 40% identity (protein of dicotyledonous source plant) with greater than 45% identity (protein of unifacial leaf source plant).
Table B: the overall similarity of full-length polypeptide sequence scope and the MatGAT result of identity.
Table B1: overall similarity and identity between the paralog thing of Arabidopis thaliana III class TPP polypeptide.
1 2 3 4 5 6 7 8 9
1.AT2G22190 48.5 64 61.8 57.2 48.6 48.8 51.9 55.3
2.AT5G51460 65.2 48.6 48.6 51.5 59.1 61 45 48.2
3.AT5G65140 78.1 69.1 74.1 60.2 47.1 47.3 51.1 60.1
4.AT5G10100 75.6 66.5 88.4 57.3 45.7 47.2 50.3 55.1
5.AT1G35910 72.1 70.4 78.1 76.7 50.9 52 54.2 59.7
6.AT4G22590 65.5 77.1 67.9 67.9 69.5 81.2 45.8 47.7
7.AT4G12430 66.3 76.1 67.6 69.4 72.1 89.7 46.7 49.4
8.AT1G22210 67.5 60.3 66.8 65.3 68.8 61.5 63.3 58.5
9.AT1G78090 69.5 68.6 77 74.1 77.3 68.4 67.9 73.5
10.SEQ ID NO：2 69.5 68.6 77 74.1 77.3 68.4 67.9 73.3 100
Table B2: overall similarity and identity between the III class TPP homologous peptide thing in dicotyledons source.
Protein 1 2 3 4 5 6 7 8 9 10 11 12 13 14
1.Nt_Q3ZTF5 49.7 49.4 50.5 50.8 50.6 44 73.7 74.6 68.2 50.4 65 75.6 60.7
2.Bc_Q4AC11 68.2 81.7 57.7 57.2 62.5 56.2 47.4 46 47.3 60.6 47.8 46.9 44.4
3.Br_Q4ABQ9 67.7 88.7 57.7 57.7 58.5 53.2 46 45.6 47.5 60.7 46.7 45.4 43.8
4.pOP-lcl|scaff_II.875 65.6 75.7 75.1 89.9 62 58.1 49.5 49.6 49.1 59.1 47.9 50.1 46.4
5.pOP-lcl|scaff_V.739 66.9 75.5 74.3 94.7 60.1 55.9 50.1 49.5 50 57 48.1 50 46
6.pOP-lcl|scaff_VII.559 66.4 75.7 71.8 74.5 74.3 81.9 48.3 47.6 46.5 61.5 47.3 49.1 44.1
7.pOP-llcl|scaff_V.167 63.1 72.9 68.6 72.1 71.9 88 42 41.7 41.8 57.4 42.7 42.6 40.5
8.pOP-llcl|scaff_XV.1052 85 66.6 63 63.2 64.8 66.7 62.3 87.1 69.1 49.1 64.6 74.4 57.8
9.pOP-llcl|scaff_XII.1254 87.1 66.4 63.6 63.8 65.4 66.2 61.8 92.5 68.5 49.2 64.7 75 57.1
10.pOP-llcl|scaff_127.52 83.1 66.8 64.2 63.4 66.1 64.2 63.3 82.1 82.9 48.6 85.2 67.2 54.7
11.Gh_TC35369 62.8 70.4 70.7 70.4 70.6 67.6 64.3 60.9 61 60 48.2 49.9 57.1
12.pOP-llcl|scaff_III.843 80.8 64.5 63.7 65.3 64.2 63.7 62.3 80.3 81.4 91.5 59.6 64.9 53.4
13.Gm_contig16565 85.9 67.4 63 63.5 64.5 65.4 63.8 85.9 86.4 83 61.4 81.7 57.8
14.TAG_Contig-7-M6b1 68 60.6 60.8 61.4 62.5 56.6 53.3 67.6 65.9 65.8 76 64 66.1
15.SEQ ID NO：2 69.3 71.9 70.1 74.9 76.7 70.8 69.1 69.2 69.5 68.4 66 66.1 68.4 61.5
Table B3: overall similarity and identity between the III class TPP homologous peptide thing in monocotyledons source.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
1.Os02g0753000 63 42.9 51.9 48 51.8 49.9 47.3 47.3 62.1 54.3 48.7 57.1 57.1
2.Os08g0409100 77 38.2 56.2 59.9 50.8 52.5 51.6 49.4 77 63.7 52.6 59.4 56.4
3.Os06g0222100 50.8 46.3 34.2 35 33.4 31.2 28.6 29.8 37.1 31.9 31.5 34.9 35.1
4.Os07g0624600 71.1 71.4 43.5 45 52.9 50.4 48.3 47.3 53.9 49.3 48.4 64.7 63.4
5.Os09g0369400 58.8 69.2 48.7 57.8 41.5 42 39.3 37.5 65.7 50.9 39.9 47.2 46.5
6.Os03g0386500 66.2 64.9 40.3 64.5 51.1 45.3 43.6 44.9 50.5 56.5 45 55.9 55.3
7.Os02g0661100 66.6 70.6 41.9 65.5 55.8 58.2 51.9 55.7 50.4 46.1 84.5 50.4 49.6
8.Os07g0485000 65.7 67 40.1 63.4 51.7 60.2 68.5 53.9 48.1 46.7 50.6 47.2 48.5
9.Os10g0553300 65.4 66.5 40.4 64.4 53.4 58.1 72 66.5 47.8 43.3 55.5 47.7 49.1
10.Ta_TC252250 75.9 88.5 47.1 69.7 71.3 63.5 69.2 64.6 66.2 74.5 50.5 57.7 55.8
11.HV_TC139314 65.7 71.9 39.8 61.7 55.6 72.3 59 60.7 56.5 75.6 45.7 53.6 50.4
12.Ta_contig10083 66.9 68 41.8 64.2 54.7 58.1 91.7 67.2 71.5 69.2 58.3 48.3 47.2
13.Zm_SRA ABD92780 71.4 71.4 42.4 74.3 57.5 68.5 63.6 65.5 64.1 69.2 65.1 62.9 65.5
14.Zm_RA3 74.1 74.3 43.8 75.7 57.3 66.5 65.5 66.8 66.2 71.6 64.5 62.6 78.1
15.SEQ ID NO：2 73.3 74.3 46.5 68.7 58.2 61.5 69.8 65.2 68.3 72.5 61.2 70.1 67.1 66.3
Table B4: overall similarity and identity between the III class TPP homologous peptide thing in non-plant source.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
1.E.coli_OTSBP 36.8 36.4 35.8 29.2 30.7 23.5 26.1 11.3 36.8 36.4 29.2 30.7 23.5
2.Xo_Q5H2G4 54.1 38 38.9 33.5 28.8 24.5 25.1 10.8 100 38 33.5 28.8 24.5
3.Q3IZA2_RHOS4 55.3 53.1 46.5 32 28.6 23.3 25.2 10.8 38 100 32 28.6 23.3
4.RHILE_O87819 53.4 57.1 61.2 31 26.4 23.3 24.9 11.3 38.9 46.5 31 26.4 23.3
5.THETH_Q5MCN5 47.4 48.4 45.8 44.4 27.1 30.3 27 10.5 32.8 32 100 27.1 30.3
6.Arthr_Q4NG94 46.7 41.2 42.3 40.1 43.4 26.3 27.7 9.6 28.7 28.3 27.1 100 26.3
7.DROME_Q9VM 18 44.6 42 43.5 44.6 46.7 45.7 40.6 10.9 24.5 23.3 30.3 26.4 100
8.DROME_Q9VM19 42.9 39.9 45.1 44 45.8 46.5 64.9 10.6 25.1 25.2 27 27.7 40.6
9.Sc_P31688|TPS2 17.5 16.9 17 16.4 15.2 15.1 17.7 16.6 11.1 10.8 10.5 9.8 10.9
10.Xo_Q5H2G4 54.1 100 53.1 57.1 47.6 41.5 42 39.9 17 38 33.5 28.8 24.5
11.Q3IZA2|Q3IZA2_RHOS4 55.3 53.1 100 61.2 45.8 41.9 43.5 45.1 17 53.1 32 28.6 23.3
12.THETH_Q5MCN5 47.4 48.4 45.8 44.4 100 43.4 46.7 45.8 15.6 48.4 45.8 27.1 30.3
13.Arthr_Q4NG94 46.7 41.2 42.3 40.1 43.4 100 44.2 46.5 15.1 41.2 42.3 43.4 26.3
14.DROME_Q9VM18 44.6 42 43.5 44.6 46.7 45.7 100 64.9 17.7 42 43.5 46.7 45.7
15.SEQ ID NO：2 37.4 34 37.2 34 36.9 38.5 41.7 41.2 23.7 34 37.2 36.9 38.5 41.7
Embodiment 4: identify the structural domain that comprises in the III class TPP polypeptide
Protein families, structural domain and site (Integrated Resource of ProteinFamilies, Domains and Sites (the InterPro)) database of reallocating resources is the integrated interface that carries out based on the search of text and sequence tag database commonly used.The InterPro database gets up these database combination, and they utilize diverse ways to learn and the relevant fully bioinformation in various degree of the protein of sign, to obtain protein tag.The cooperation database comprises SWISS-PROT, PROSITE, TrEMBL, PRINTS, ProDom and Pfam, Smart and TIGRFAMs.Interpro is by European information biology institute (the European Bioinformatics Institute) trustship that is positioned at Britain.
The InterPro scanning result of peptide sequence shown in the SEQ ID NO:14 is shown in table C.
The InterPro scanning result of peptide sequence shown in the table C:SEQ ID NO:14
Database Accession number Logon name The homologous region of structural domain
TIGRFAMs TIGR01484 HAD-SF-IIB:HAD-lytic enzyme superfamily 119-332
Pfam PF02358 The treahalose phosphate Phosphoric acid esterase 121-354
TIGRFAMs TIGR00685 T6PP: trehalose-6-phosphate enzyme 115-365
Embodiment 5: the active determination in vitro of treahalose phosphate phosphatase activity
The coding region clone of the AtTPPI isotype that Arabidopis thaliana III class TPP polypeptide is corresponding enters pGEX-4T-1 (Pharmacia) plasmid, and described plasmid is designed to produce the GST-fusion rotein.This carrier is introduced intestinal bacteria.The recombinant protein of the expression that purifying produces in coli strain BL21, and it is active to measure TPP by HPLC.
At expression in escherichia coli
Transform super competence coli strain BL21Star with the pGEX-GST construct TM(DE3) One
Figure G2007800463872D00511
(Invitrogen) cell, and in the dull and stereotyped upper 37 ℃ of overnight incubation of Luria Bertani (LB) substratum+penbritin (Amp).Collect bacterium colony and change 200mlLB+Amp over to, 37 ℃ of concussions were cultivated 4 hours, then added sec.-propyl-β-thiogalactoside (IPTG, 0.3mM final concentration) abduction delivering.Under 30 ℃, carried out another incubation period 4 hours subsequently.4 ℃ of centrifugal (30 minutes, 3000 rev/mins) collecting cells also are resuspended in ice-cold 1x phosphoric acid buffer liquor (PBS) (the 140mM NaCl of 5ml; 2.7mM KCl; 10mM Na 2HPO 41.8mM KH 2PO 4PH 7.3), five equilibrium is in 5 cold screw-cap test tubes.After 4 ℃ centrifugal (5 minutes, 6000 rev/mins), freezing precipitation and be stored in-80 ℃ in liquid nitrogen.
Protein purification
Cell ice-cold lysis buffer (the 1x PBS of 5mli; 0.4%Triton, 2mM MgCl 2, 1mM EDTA, 2mM dithiothreitol (DTT) (DTT), 0.2mg/ml N,O-Diacetylmuramidase and 1 EDTA protease inhibitor cocktail (Roche)/10ml lysis buffer) washing once, hatched 15 minutes on ice, and with ultrasonic wave (sonication) supersound process (Sartorius of 15 pulse per second (PPS)s
Figure G2007800463872D00521
P).Lysate is at 4 ℃ of lower 12,000g centrifugal clarifications.The supernatant part is mixed with 200 μ l gsh-sepharose globules (Amersham Biosciences), and described globule has been used lavation buffer solution pre-equilibration (1xPBS; 0.1%Triton, 2mM MgCl 2, 1mM EDTA, 1mMDTT), and in cylinder (rollerdrum) 4 ℃ hatched 1 hour.4 ℃ centrifugal (1 minute, 1800 rev/mins) collects globule, and the lavation buffer solution ice-cold with 1ml washs 5 times, and carrying out being stored in before the TPP determination of activity-20 ℃.
The TPP determination of activity
Trehalose-6-phosphate phosphatase (TPP) is active to add trehalose (T) detection that trehalose-6-phosphate (T6P) produces afterwards by being determined in the protein example.Sample adds 150 μ l assay buffer (2mM T6P, the 2mM MgCl that contain T6P 2, 10 μ M Validacin (Takeda)s and 45mM Tris-HCl, pH 7.5) or do not contain 150 μ l assay buffer (the 2mM MgCl of T6P 2, 10 μ M Validacin (Takeda)s and 45mM Tris-HCl, pH 7.5).37 ℃ hatch 1-1.5 hour after, centrifugal (10 minutes, 1,200g) collect globule, and upper cleer and peaceful T standard diluent be injected into HPLC.Measure protein concn by the Bradford method.
Result shown in Figure 4 shows that TPPI has the trehalose-6-phosphate phosphatase activity.
Embodiment 6: the activity in vivo of treahalose phosphate Phosphoric acid esterase is measured
Enzyme shown in the SEQ ID NO:2 active and the activity of its paralog thing protein with the sequence shown in the SEQ ID NO:10,12,16,18,20,22,24,26 and 28 are according to Vogel etc., 1998 methods (carrying out little change) of describing are measured by the functional complementation of yeast tps2 mutant.In brief, comprise the listed primer of dna fragmentation use table D of the coding region of the arbitrary sequence shown in the SEQ ID No:1,9,11,15,17,19,21,23,25 and 27, increase from Arabidopis thaliana cDNA by the polymerase chain reaction.Dna fragmentation enters Yeast expression carrier pYX212 with rear clone.This construct is introduced thermo-responsive (thermosensitive) yeast tps2-defective bacterial strain YSH448.The yeast strain that transforms is in 30 ℃ of the temperature that allows, and grows in the SD-URA dextrose culture-medium under the restricted condition of 38 ℃ and 39 ℃.As shown in Figure 6, only comprise coding region SEQID NO:2,10,12,16,18,20,22,24,26 or 28 construct can be in 37 ℃ of restrictive temperatures and 39 ℃ of lower growths that recover yeast.Contain the growth that the yeast conversion body of empty carrier pYX212 does not recover tps2 defective bacterial strain YSH448.Expression is used separately as the positive and negative control from the yeast conversion body of the wild-type yeast gene TPS2 of carrier pYX212 and the yeast conversion body of empty pYX212.
Table D: be used for pcr amplification from the primer tabulation of the III class polypeptide of Arabidopis thaliana.Terminator codon is by providing in the cloning vector.
The prm title The source SEQ ID NO： Sequence
＞PrmAtTPPA-5 Synthesize 101 GGAAGATCTATGGACATGAAATCTGGTCACTC
＞PrmAtTPPA-3 Synthesize 102 AAGGCCTACCCATTGATCTCTTCCATGTCA
＞PrmAtTPPB-5 Synthesize 103 GGAATTCATGACTAACCAGAATGTCATCGTT
＞PrmAtTPPB-3 Synthesize 104 AAGGCCTCTCTTCTCCCACTGTCTTCCTC
＞PrmAtTPPC-5 Synthesize 105 CGGGATCCATGAAGATTACGGATATTTCCGG
＞PrmAtTPPC-3 Synthesize 106 AAGGCCTTTCTCCAAGTGTTTGTTTCTTCC
＞PrmAtTPPD-5 Synthesize 107 CGGGATCCATGACAAACCATAATGCCTTAATC
＞PrmAtTPPD-3 Synthesize 108 AAGGCCTTCTTCCTCTTAGTGACATTTGTTTC
＞PrmAtTPPE-5 Synthesize 109 CGGGATCCATGTTCGAAGAAATACTTCATAAATC
＞PrmAtTPPE-3 Synthesize 110 AAGGCCTTGCCCCACACCTTGACTGTTTC
＞PrmAtTPPF-5 Synthesize 111 CATGCCATGGATTTAAACTCAAACCACAAATC
＞PrmAtTPPF-3 Synthesize 112 TCCCCCGGGAAAACCAGTAGAATTCTTCTCCAAC
＞PrmAtTPPG-5 Synthesize 113 CATGCCATGGATTTGAATATAAACAAGACGAC
＞PrmAtTPPG-3 Synthesize 114 AAGGCCTAAAACTTGTTTTTGAACTTTCCATCTTC
＞PrmAtTPPH-5 Synthesize 115 CGGGATCCATGGTTAGATTCATAGAAGAAAACAC
＞PrmAtTPPH-3 Synthesize 116 AAGGCCTTGCTCCAGATCTCAATTGTTTCC
＞PrmAtTPPI-5 Synthesize 117 CGGGATCCATGTCAGCTAGTCAAAACATTGTC
＞PrmAtTPPI-3 Synthesize 118 AAGGCCTCATTCTTGGCTGCATTTGTTTCC
＞PrmAtTPPJ-5 Synthesize 119 CGGGATCCATGGTGAGCCAAAACGTCGTCG
＞PrmAtTPPJ-3 Synthesize 120 AAGGCCTTTGCTGCATCTGTTTCCACTCC
Embodiment 7: the nucleotide sequence shown in the clone SEQ ID NO:1
Unless stated otherwise, recombinant DNA technology is according to (Sambrook (2001) MolecularCloning:a laboratory manual, third edition Cold Spring Harbor LaboratoryPress, CSH, New York) in or Ausubel etc. (1994), Current Protocols inMolecular Biology, the standard method of describing in Current Protocols the 1st and 2 volumes is carried out.The standard material and the method that are used for plant molecular work are described at the Plant Molecular Biology Labfax (1993) of the R.D.D.Croy that is published by BIOS ScientificPublications Ltd (UK) and Blackwell Scientific Publications (UK).
Arabidopis thaliana III class TPP gene uses Arabidopsis thaliana Seedlings cDNA library (Invitrogen, Paisley, Britain) to increase as template by PCR.The used primer of pcr amplification is
-prm05451 (SEQ ID NO:99, primer; Justice is arranged, and initiator codon is black matrix, and the AttB1 site is italic: 5 '-ggggacaagtttgtacaaaaaagcaggcttaaaca
Figure G2007800463872D00541
Actaaccagaatgtcatc-3 ') and prm05452 (SEQ ID NO:100, primer 2; Antisense, complementation, the AttB2 site is italic: 5 '-
Figure G2007800463872D00542
Tgtaattatgtt gcatgtctt-3 '), it comprises the AttB site for the Gateway restructuring.Under standard conditions, use Hifi Taq archaeal dna polymerase to carry out PCR.The PCR fragment of amplification expection length, and also the Application standard method gives purifying.Implement subsequently the first step of Gateway method, i.e. BP reaction, " entering the clone " that restructuring is named according to Gateway with generation in PCR fragment and the pDONR201 plasmid artificial body for generating during this period, pEC_III class TPP.Plasmid pDONR201 conduct
Figure G2007800463872D00543
The component part of technology is bought from Invitrogen.
Embodiment 8: use the nucleotide sequence construction of expression vector shown in SEQ ID NO:1
Entering clone pEC_III class TPP uses with the purpose carrier that is used for the rice conversion in the LR reaction subsequently.This carrier contains as functional element on the T-DNA border: the plant selected marker; But selection markers expression cassette and intention and the Gateway box that has been cloned in restructuring in the described purpose nucleotide sequence generation LR body that enters in the clone.The rice GOS2 promotor (SEQ ID NO:98) that is used for constitutive expression is positioned at the upstream of this Gateway box.
After the LR reconstitution steps, the expression vector pXC_III class TPP (Fig. 7) of generation is converted among the agrobacterium strains LBA4044 according to method well-known in the art.
Embodiment 9: Plant Transformation
Rice transforms
The Agrobacterium that contains expression vector is used for transforming rice plant.Ripe dry seed shelling with the Japanese Cultivar Nipponbare of rice.By incubation in 70% ethanol one minute, in 2,%Hg,Cl2 30 minutes subsequently, subsequently with sterile distilled water washing 6 times 15 minutes and implement sterilization.The seed of sterilization is containing the upper sprouting of the substratum of 2,4-D (callus inducing medium) subsequently.Incubation is after 4 weeks in the dark, and the embryogenic callus that scultellum is derived downcuts and breeds at the same substratum.After 2 weeks, callus is bred or is bred by upload other 2 weeks of culture at the same substratum.The embryogenic callus sheet was uploaded culture 3 at fresh culture, cultivated altogether afterwards (active to strengthen cell fission).
The agrobacterium strains LBA4404 that contains expression vector is used for cultivating altogether.Agrobacterium is seeded in to contain on the suitable antibiotic AB substratum and at 28 ℃ and cultivated 3.Subsequently bacterium is collected and is resuspended in liquid and cultivate altogether in the substratum to density (OD600) about 1.Suspension is transferred to culture dish subsequently and callus was soaked 15 minutes in this suspension.Callus is organized subsequently and to be blotted and to be transferred on the common cultivation substratum of curing and in the dark in 25 ℃ of incubations 3 days at filter paper.The callus of cultivating altogether in the dark in 28 ℃ in the presence of selective agent in containing 2,4 weeks of cultivation on the substratum of 4-D.During the section, form mushroom resistant calli island at this moment.To regeneration culture medium and behind incubation under the light, the release of embryo generation potentiality and seedling are in subsequently 4-5 week growth in this material transfer.Seedling downcut from callus and containing incubation 2-3 week on the substratum of plant hormone, wherein seedling is transferred to soil from described substratum.The seedling of sclerosis is cultivated in the greenhouse under high humidity and short day.
A construct produces about 35 independent T0 rice transformant.With former generation transformant be transferred to the greenhouse from incubator for tissue culture.Behind the copy number of quantitative PCR analysis with checking T-DNA inset, the single copy transgenic plant that only keep performance selective agent tolerance are used for results T1 seed.Seed is gathered in the crops after transplanting subsequently the 3-5 month.Present method produces term single gene seat transformant (Aldemita and Hodges1996, Chan etc. 1993, Hiei etc. 1994) to surpass 50% ratio.
Corn transforms
The conversion of corn is carried out according to the modification method to (1996.Nature Biotech 14745-50) described methods such as Ishida.Conversion in corn be that genotype relies on and only specific genotype can operate for transforming and regeneration.Inbred lines A188 (University of Minnesota) or be good source for the donor material that transforms as parent's hybrid with A188, but other genotype also can successfully be used.In rear about 11 days (DAP) results of pollination, this moment, the length of immature embryos was about 1 to 1.2mm to mealie from maize plant.Immature embryos is cultivated altogether with the agrobacterium tumefaciens that contains expression vector and transgenic plant occur to recover by organ.The embryo that downcuts is on callus inducing medium, cultivate at the corn regeneration culture medium subsequently, and wherein said regeneration culture medium contains selective agent (for example imidazolone, but can use the multiple choices mark).Culture plate is cultivated 2-3 week at 25 ℃ under illumination, or until seedling growth.Green seedling is transferred to the maize rooting substratum and cultivates 2-3 week at 25 ℃ from each embryo, until root development.The seedling that to take root migrates in the soil in greenhouse.From the plant of performance selective agent T-DNA inset tolerance and that contain single copy, produce the T1 seed.
Wheat transforms
The conversion of wheat is carried out with the method that (1996) Nature Biotech 14 (6): the 745-50 such as Ishida such as Ishida describe.Usually in conversion, use (can obtain from Mexico CIMMYT) Cultivar Bobwhite.Immature embryos is cultivated altogether with the agrobacterium tumefaciens that contains expression vector and transgenic plant occur to recover by organ.With the Agrobacterium incubation after, embryo on the callus inducing medium, subsequently external cultivation on regeneration culture medium, wherein said regeneration culture medium contains selective agent (for example imidazolone, but can use the multiple choices mark).Culture plate is cultivated 2-3 week at 25 ℃ under illumination, or until seedling growth.Green seedling is transferred to root media and cultivates 2-3 week at 25 ℃ from each embryo, until root development.The seedling that to take root migrates in the soil in greenhouse.From the plant of performance selective agent T-DNA inset tolerance and that contain single copy, produce the T1 seed.
Transformation of soybean
According to Texas A﹠amp; M United States Patent (USP) 5,164, the modification method soybean transformation of method described in 310.Several commercial soybean varieties are feasible for conversion by this method.Cultivar Jack (can be able to obtain from Illinois seed money) is generally used for transforming.Soybean seeds is sterilized so that external sowing.From 7 age in days seedling, downcut hypocotyl, radicle and a slice cotyledon.Further cultivate the cotyledon of epicotyl and remainder to grow the armpit tight knot.These armpit tight knots are downcut and with the agrobacterium tumefaciens incubation that contains expression vector.After common cultivation is processed, explant is washed and is transferred to the selection substratum.The seedling of regeneration is downcut and places on the seedling elongation medium.The seedling that length is no more than 1cm places on the root media until root development.The seedling that to take root migrates in the soil in greenhouse.From the plant tolerance of performance selective agent and that contain single copy T-DNA inset, produce the T1 seed.
Rape/canola oil dish transforms
Use cotyledon petiole and the hypocotyl of 5-6 age in days seedling to transform as the explant that is used for tissue culture and according to (1998, Plant Cell Rep 17:183-188) such as Babic.Commercial Cultivar Westar (Agriculture Canada) is for the standard variety that transforms, but also can use other kinds.Canola oil colza is done the surface sterilization so that external sowing.From external seedling, downcut and have the cotyledon petiole explant that adheres to cotyledon, and immerse bacterial suspension with the cut ends of (containing expression vector) Agrobacterium by petiole explant and inoculate.Explant subsequently on the MSBAP-3 substratum that contains 3mg/l BAP, 3% sucrose, 0.7% plant agar (Phytagar) at 23 ℃, cultivated under the illumination in 16 hours 2 days.After cultivating altogether 2 with Agrobacterium, petiole explant is transferred on the MSBAP-3 substratum of 3mg/l BAP, cefotaxime, Pyocianil or the Ticarcillin/Clavulanate Acid (300mg/l) that contain and continues 7, and cultivating at the MSBAP-3 substratum that contains cefotaxime, Pyocianil or Ticarcillin/Clavulanate Acid and selective agent subsequently, until seedling regeneration.When seedling has 5-10mm length, seedling is downcut and is transferred to seedling elongation medium (MSBAP-0.5 that contains 0.5mg/l BAP).The seedling of the about 2cm of length is transferred to root media (MS0) for root induction.The seedling that to take root migrates in the soil in greenhouse.Produce the T1 seed the plant that singly copies the T-DNA inset from showing the selective agent tolerance and containing.
Clover transforms
The reproducibility clone of clover uses the method for (McKersie etc., 1999 Plant Physiol 119:839-847) to be transformed.The regeneration of clover and conversion are that genotype is dependent and thereby need aftergrowth.The method that obtains the reproducibility plant has been described.For example, these reproducibility plants any other commercial alfalfa variety that can be selected from Cultivar Rangelander (Agriculture Canada) or describe such as Brown DCW and AAtanassov (1985.Plant Cell Tissue Culture 4:111-112).Alternatively, RA3 kind (University of Wisconsin) has been selected for (Walker etc., 1978Am J Bot 65:654-659) in the tissue culture.Petiole explant and the agrobacterium tumefaciens C58C1 pMP90 (McKersie etc., 1999 Plant Physiol 119:839-847) or the overnight culture of LBA4404 that contain expression vector are cultivated altogether.Explant is containing 288mg/L Pro, 53mg/L Thioproline, 4.35g/L K in the dark 2SO 4With cultivated altogether 3 days on the SH inducing culture of 100 μ m Syringylethanones. explant washing and plating in the half concentrated Murashige-Skoog substratum (Murashige and Skoog, 1962) contain not containing Syringylethanone suitable selective agent and suitable microbiotic with the identical SH inducing culture of restraining the Agrobacterium growth on.After several weeks, somatic embryo is transferred to do not contain growth regulator, do not contain microbiotic and contain in the BOi2Y Development culture base of 50g/L sucrose.Somatic embryo is sprouted at half concentrated Murashige-Skoog substratum subsequently.The sprigging that to take root is cultivated to flowerpot and in the greenhouse.Produce the T1 seed the plant that singly copies the T-DNA inset from showing the selective agent tolerance and containing.
Cotton Transformation
According to US 5,159, the method for describing in 135 is used agrobacterium tumefaciens (Agrobacteriumtumefaciens) converting cotton.Cottonseed surface sterilization 20 minutes in the chlorine bleach liquor, and with the distilled water wash that contains 500 μ g/ml cefotaximes.Then cottonseed is transferred in the SH-substratum that contains 50 μ g/ml F-1991s (benomyl) and sprouts.Take out the hypocotyl of seedling in 4-6 days ages, be cut into 0.5 centimetre fritter, and place on 0.8% agar.With Agrobacterium suspension (about 10 8Every milliliter in individual cell has the overnight culture dilution of goal gene and suitable selective marker to obtain by conversion) the inoculation Hypocotyl Explants.Room temperature and illumination after lower 3 days are transferred to tissue solid medium (1.6g/l takes off the acetyl gellan gum), described substratum has Murashige and Skoog salt and vitamin B5 (Gamborg etc., Exp.Cell Res.50:151-158 (1968)), 0.1mg/l 2,4-D, 0.1mg/l 6-Furfurylaminopurine (6-furfurylaminopurine), 750 μ g/ml MgCl 2, and 50-100 μ g/ml cefotaxime and 400-500 μ g/ml hydroxyl benzyl XiLin in order to kill residual bacterium.Separate each clone after 2-3 month (every 4-6 week succeeding transfer culture once), and further cultivate on selective medium (30 ℃, 16 hours photoperiod) in order to organize amplification.What transform organized subsequently further cultivation 2-3 on Nonsele ctive culture media individual month, to produce somatic embryo.The embryo of the healthy appearance of at least 4 millimeters long is transferred in the test tube of the SH substratum that has in the thin vermiculite, and described culture medium supplemented has 0.1mg/l indolylacetic acid, 6 chaff aminopurine and gibberellenic acids.Embryo is at 30 ℃, the lower cultivation of 16 hours photoperiod, and the plantlet of 2-3 leaf phase is transferred to and is had in vermiculite and the nutraceutical flowerpot.The plant sclerosis also moves on to further cultivation in the greenhouse subsequently.
Embodiment 10: the phenotype evaluation method
Prepare 10.1 estimate
Produce about 35 T0 rice transformant independently.Transformant was transferred to the greenhouse from incubator for tissue culture and was used for Growth and yield T1 seed former generation.Stay 5 events, the T1 offspring of wherein said event separates with 3: 1 ratios genetically modified presence/absence.For each event in these events, select to contain genetically modified about 10 strain T1 seedling (heterozygote and homozygote) and lack genetically modified about 10 strain T1 seedling (inefficacy zygote) by monitoring visual marker expression.Transgenic plant and corresponding inefficacy zygote are cultivated on random site side by side.Greenhouse experiment is short day (illumination in 12 hours), 28 ℃ and in the dark 22 ℃ and relative humidity 70% under light.
According to T1 generation identical appraisal procedure (but each event has more individuality) in T2 generation of 4 T1 events, further assessed.From sowing time to the ripening stage, plant Multiple through then out digital image-forming case.On each time point, every strain plant is obtained digital image (2048 * 1536 pixels, 1,000 6 hundred ten thousand looks) from least 6 different angles.
The arid screening
In flowerpot soil, cultivate under normal operation the plant from the T2 seed, until enter heading stage.Then it is transferred to " drying " zone, stop to irrigate.In the flowerpot of selecting at random, insert the humidity detection instrument, with monitoring Soil Water Content (SWC).When SWC is lower than certain threshold value, continue to add water from the trend plant, until reach normal level.Then plant is transferred back under the normal condition again again.Remaining cultivation (plant maturation, seed results) is identical with the plant of not cultivating under the abiotic stress condition.The growth of cultivating under the detail record normal condition and output parameter.
The nitrogen use efficiency screening
Under normal condition except nutritive medium, in flowerpot soil, cultivate the rice plant from the T2 seed.With specific nutritive medium flowerpot is watered from the plant transplanting to the maturation, the nitrogen of described nutritive medium (N) content is usually than low 7 to 8 times of normal (contrast) plant always.Remaining cultivation (plant maturation, seed results) is identical with the plant of not cultivating under the abiotic stress condition.The growth of cultivating under the detail record normal condition and output parameter.
10.2 statistical study: F check
Utilize two-way ANOVA (variance analysis) as statistical model, the plant phenotype feature is carried out comprehensive assessment.All measuring parameters with all events of all plant of gene transformation of the present invention are carried out the F check.Carry out F and check to check the effect of all transformation events of gene pairs, and check the population effect of gene, also be called " whole genetic effect ".The significance threshold value setting of true whole genetic effect is 5% probability level of F check.If significance F test value points to certain genetic effect, this means to be not only that the existence of gene or location cause difference on the phenotype.
10.3 the parameter of measuring
The measurement of biomass correlation parameter
From sowing time to the ripening stage, plant Multiple through then out digital image-forming case.On each time point, every strain plant is obtained digital image (2048 * 1536 pixels, 1,000 6 hundred ten thousand looks) from least 6 different angles.
Plant on the ground area (in other words Leaf biomass) is determined by the sum of all pixels that counting is different from the ground plant part digital image of background.This value is got same time point from the mean value of the photo of different angle shots, and is converted to the physical surface value (physicalsurface value) that represents with square millimeter by calibration.Experiment shows that the ground plant area of measuring by this method is relevant with the biomass that plant shoot divides.Area reaches the area of the point in time measurement of its maximum Leaf biomass plant on the ground.
Plant (seedling) the on the ground area estimation of the early stage vigor of plant from sprouting rear three weeks.The increase of root biomass is expressed as the increase of root total biomass (being measured as the maximum root biomass that radical exponent was observed in vegetative period); Perhaps be expressed as root/hat than the increase of (root/shoot index) (being measured as the ratio of root and stem active growth root quality and stem quality during the phase).
The measurement of seed correlation parameter
Elementary panicle, the counting that results are ripe, pack, stick bar code label, then in baking box in 37 ℃ of dryings three days.With the panicle threshing, collect and count all seeds subsequently.Use air-blast device that full husk and ghost are separated.Discard ghost, again the remaining part of counting.At the analytical balance full husk of weighing.Determine the number of full seed by counting remaining full husk number after separating step.All full husks of gathering in the crops from plant are measured the seed ultimate production by weighing.Measure the seed sum of every strain plant from the number of the husk of plant results by counting.Draw thousand seed weight (TKW) from full seed number and the deduction of their gross weight of counting.Harvest index is defined as seed ultimate production and ground area (mm in the present invention 2) between ratio, multiply by again the factor 10 6Each is paniculiform spends sum to be defined as in the present invention ratio between seed sum and the ripe elementary panicle number.The full rate of seed is defined as the ratio (representing with %) that the full seed number accounts for the seed sum in the present invention.
Embodiment 11: the phenotype evaluation result of transgenic plant
Provided the evaluation result of under the control of GOS2 promotor, expressing the transgenosis rice plant of nucleic acid sequence SEQ ID NO:1 among the table E.Also show the difference percentage ratio between transgenic plant and the corresponding inefficacy zygote, be lower than 0.05 from the P value of F check.
Compare with control plant (in this case, the inefficacy zygote), seed ultimate production, full seed number, the full rate of seed and harvest index significantly increase in the transgenic plant of express nucleic acid sequence SEQ ID NO:1.
Table E: the evaluation result of under the control of GOS2 promotor, expressing the transgenosis rice plant of nucleic acid sequence SEQ ID NO:1.
Proterties With respect to control plant, the increase % in the transgenic plant
The seed ultimate production 15
The full seed number 17
The seed sum 11
Harvest index 7
Every panicle is spent number 5
Aboveground Biomass of Young 6
The transgenosis rice plant of expressing nucleic acid sequence SEQ ID NO:1 under the control of GOS2 promotor also carries out the arid screening, compares with corresponding control plant, and following parameters increases, and is marked with *Parameter be lower than 0.05 from the P value of F check. *Seed ultimate production (increasing by 11% with respect to control plant), *Full seed number (increasing by 10% with respect to control plant), *Harvest index (increasing by 11% with respect to control plant), full rate (increasing by 8% with respect to control plant).
Table F: the evaluation result of under the control of GOS2 promotor, expressing the transgenosis rice plant (screening of experience nitrogen use efficiency) of nucleic acid sequence SEQ ID NO:1.
Compare with corresponding control plant, the plant of experience nitrogen use efficiency screening shows below the increase of the parameter of table description.
Proterties Increase %
Aboveground Biomass of Young 9.8
Root biomass 11.4
The seed ultimate production 11.2
The full seed number 25.9
Every panicle is spent number 6.1
Plant height 13.4
The seed sum 9.5
Table G: the evaluation result of under HMG promotor (high speed swimming family) control, expressing the transgenosis rice plant (screening of experience nitrogen) of nucleic acid sequence SEQ IDNO:1.
Compare with corresponding control plant, the plant of experience nitrogen use efficiency screening shows below the increase of the parameter of table description.
Proterties Increase %
Vigor 18.2
The full seed number 32.2
Sequence table
＜110〉Cropdesign NV
＜120〉has the plant and preparation method thereof of the seed production correlated character of improvement
<130>PF58635
<150>EP 06126279.6
<151>2006-12-15
<150>US 60/883,168
<151>2007-01-03
<160>131
＜170〉PatentIn version 3 .3
<210>1
<211>1125
<212>DNA
＜213〉Arabidopis thaliana (Arabidopsis thaliana)
<400>1
atgactaacc agaatgtcat cgtttccgac aggaaaccca tcttgggttt gaaaaccatc 60
actgtctctg tctctaactc tcctctgttc tctaattcct ttcccactta ctttaacttc 120
cctcgtcgaa agctcttgaa acttcttgaa gcagccgaca aaaacaactt agttgttgct 180
ccaaagatta cgtctatgat cgattccatg cgtgattctt cccctacacg tctcagatcc 240
tcttcctatg actctgtttc agataacgac gacaaaacat cttggatcgt tcgttttcct 300
tcggctttaa atatgtttga tgagattgtg aatgctgcga aagggaaaca gattgtcgtg 360
tttcttgatt acgacggaac tctttctccc atagttgaag atcccgacaa agctttcata 420
acccatgaga tgagagaagt cgtaaaagac gtggcttcga atttcccgac tgctattgtc 480
accgggagat ccattgagaa ggttcgtagt tttgtccaag taaacgagat ttactacgcc 540
ggaagccacg gcatggacat tgaaggtccg accaacgaaa atagtaacgg ccagagtaat 600
gaaagagtgc tattccaacc tgctcgtgaa tttttaccga tgatcgagaa ggtggttaat 660
attttagagg aaaaaacaaa atggatccct ggggctatgg tggagaacaa caagttttgt 720
ctgtccgtac attttcgacg tgttgatgag aagagatggc ctgcattagc tgaagtagta 780
aaatcagttc ttattgatta tccaaagctg aaactaaccc aaggtagaaa ggtacttgaa 840
atccgcccca caatcaaatg ggacaagggc caggcactca attttttact aaaatcatta 900
ggatatgaaa attcggatga tgtcgtgccg gtgtatatcg gggatgaccg tactgacgaa 960
gatgcgttta aggttttacg tgaaagggga caaggttttg ggatttttgt ctcaaaagta 1020
ccaaaggaca ccaatgcctc ttattctctt caagaccctt ctcaggttaa caagtttctg 1080
gaacgtttag tagaatggaa gaggaagaca gtgggagaag agtga 1125
<210>2
<211>374
<212>PRT
＜213〉Arabidopis thaliana
<400>2
Met Thr Asn Gln Asn Val Ile Val Ser Asp Arg Lys Pro Ile Leu Gly
1 5 10 15
Leu Lys Thr Ile Thr Val Ser Val Ser Asn Ser Pro Leu Phe Ser Asn
20 25 30
Ser Phe Pro Thr Tyr Phe Asn Phe Pro Arg Arg Lys Leu Leu Lys Leu
35 40 45
Leu Glu Ala Ala Asp Lys Asn Asn Leu Val Val Ala Pro Lys Ile Thr
50 55 60
Ser Met Ile Asp Ser Met Arg Asp Ser Ser Pro Thr Arg Leu Arg Ser
65 70 75 80
Ser Ser Tyr Asp Ser Val Ser Asp Asn Asp Asp Lys Thr Ser Trp Ile
85 90 95
Val Arg Phe Pro Ser Ala Leu Asn Met Phe Asp Glu Ile Val Asn Ala
100 105 110
Ala Lys Gly Lys Gln Ile Val Val Phe Leu Asp Tyr Asp Gly Thr Leu
115 120 125
Ser Pro Ile Val Glu Asp Pro Asp Lys Ala Phe Ile Thr His Glu Met
130 135 140
Arg Glu Val Val Lys Asp Val Ala Ser Asn Phe Pro Thr Ala Ile Val
145 150 155 160
Thr Gly Arg Ser Ile Glu Lys Val Arg Ser Phe Val Gln Val Asn Glu
165 170 175
Ile Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Glu Gly Pro Thr Asn
180 185 190
Glu Asn Ser Asn Gly Gln Ser Asn Glu Arg Val Leu Phe Gln Pro Ala
195 200 205
Arg Glu Phe Leu Pro Met Ile Glu Lys Val Val Asn Ile Leu Glu Glu
210 215 220
Lys Thr Lys Trp Ile Pro Gly Ala Met Val Glu Asn Asn Lys Phe Cys
225 230 235 240
Leu Ser Val His Phe Arg Arg Val Asp Glu Lys Arg Trp Pro Ala Leu
245 250 255
Ala Glu Val Val Lys Ser Val Leu Ile Asp Tyr Pro Lys Leu Lys Leu
260 265 270
Thr Gln Gly Arg Lys Val Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp
275 280 285
Lys Gly Gln Ala Leu Asn Phe Leu Leu Lys Ser Leu Gly Tyr Glu Asn
290 295 300
Ser Asp Asp Val Val Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu
305 310 315 320
Asp Ala Phe Lys Val Leu Arg Glu Arg Gly Gln Gly Phe Gly Ile Phe
325 330 335
Val Ser Lys Val Pro Lys Asp Thr Asn Ala Ser Tyr Ser Leu Gln Asp
340 345 350
Pro Ser Gln Val Asn Lys Phe Leu Glu Arg Leu Val Glu Trp Lys Arg
355 360 365
Lys Thr Val Gly Glu Glu
370
<210>3
<211>2027
<212>DNA
＜213〉common wheat (Triticum aestivum)
<400>3
cccaatccaa ggctctgtca tactaagtga caccttctga acaacggagt tttctcgaaa 60
aggaggttga agcccgggcc tctgcatcat tctgaacatt ggagttaagc ggagctggct 120
ttgcatggct tttcctatgt gccaatccac tcttctgata tagatgtgtc atctctctca 180
gcatgacaag ttcacaggta ctctgctttt gatgaacttc ctccacacct gcagtgacaa 240
gaaaacgctg aagaagtggt tcttcatcga caagacagtg ggctaagaga atccagctga 300
aagagagacg accgccgttc tgaccacatt ttttcctcgt cccacccgat ggatttgagc 360
aacggctcac cggtcatcag tgatccgatg tcaatgagcc agtcgttgat gggagtgctg 420
ccttccaaca tgatgccgtt ttcagtcagg cccgggggtt actccggcgc tggtggcgcc 480
ggcgtaaacg tcagcaggcg caagatcgag gaggtcctcg tgagcgggct gctggatgcc 540
atgaaatcct cgtcgccacg taagaagcac aacgtggtct tcggccagga aaacctgccc 600
gaagaagatc ctgcctacag tgcatggatg gcaaaatgcc cctctgctct ggcttccttc 660
aagcagatcg tagccagtgc acaaggcaag aagattgcgg tcttcctgga ctacgatggc 720
acactgtcgc cgatcgtcga cgaccctgaa aaagccgtca tgtcccctgt gatgagagct 780
gctgtgagaa acgtcgccaa atacttcccc gccgccatcg tcagcggaag gtcccggaag 840
aaggttcttg aattcgtaaa actgaaggaa ctctgctatg ctggaagtca tgggatggac 900
ataatgacat cttcttcagc acattatgaa cacaatactg aaaagggcaa agaagccaac 960
ctcttccaac ctgctcgcga ttttctgcct atgatcgatg aggtttccaa ggccctcttg 1020
gaagtcacga gcggaatcga aggcgcgagc gttgaggaca acaagttctg cgtgtctgtt 1080
cattaccgca acgtagacga gaaggactgg gagctggtcg cacggctcgt aaacgaggtg 1140
ctggaggatt tcccccctct caaagtgacc aacgggcgaa tggttttaga ggttcgtccg 1200
gtgatcgact gggacaaggg gaaggccgtc gagttcctgc ttcagtcgct cgggctgagc 1260
gactccgaga acgtgatccc aatctacatc ggcgacgacc gcaccgacga agacgcgttc 1320
aaggtgctcc gggagaggaa ctgcgggtac gggatactgg tctcgcaggc gcccaaggaa 1380
accgaagcct tctactcgct cagggacccg tctgaagtga tggagttcct gaactccttg 1440
gtgagatgga agaagcactc gctatgaaca aacaggagat gactgtagtt tccgaggcga 1500
cagttttgca gcgttggaaa ccatagctag ggtcgaatga tgttgccgtc ccctgttaat 1560
tcgtttaggt cgattgatat tcttgtactg ctagtcatgt tctttgccac cgagaaattt 1620
gatcggtggc tgtgttggtt gttatacata atgctttagg ttaacataaa ttggatctgg 1680
atctcttgat tagaacacca atacatgtgc ggtagcgtgt gaacttacaa gtgattgacg 1740
aaatcccata ctcttgatgc aggccctagt cgatgcagca cacgggaata gttggcgaag 1800
cggaacagca ccgagtgaat agcccatggc cgaaagcgtg aacgtagcca gcaataggta 1860
gaagacgccc agaaggctac cggcactaga gatggccggc atcaaccagc gactggtcgg 1920
tgtagagcag caggaagccg ccggcacatc cttgcggtgg ccggctgtgg tgatggcctt 1980
ctgatccctt tatgcaccct tttaggatcg gtagttagga gtttgtt 2027
<210>4
<211>372
<212>PRT
＜213〉common wheat
<400>4
Met Asp Leu Ser Asn Gly Ser Pro Val Ile Ser Asp Pro Met Ser Met
1 5 10 15
Ser Gln Ser Leu Met Gly Val Leu Pro Ser Asn Met Met Pro Phe Ser
20 25 30
Val Arg Pro Gly Gly Tyr Ser Gly Ala Gly Gly Ala Gly Val Asn Val
35 40 45
Ser Arg Arg Lys Ile Glu Glu Val Leu Val Ser Gly Leu Leu Asp Ala
50 55 60
Met Lys Ser Ser Ser Pro Arg Lys Lys His Asn Val Val Phe Gly Gln
65 70 75 80
Glu Asn Leu Pro Glu Glu Asp Pro Ala Tyr Ser Ala Trp Met Ala Lys
85 90 95
Cys Pro Ser Ala Leu Ala Ser Phe Lys Gln Ile Val Ala Ser Ala Gln
100 105 110
Gly Lys Lys Ile Ala Val Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro
115 120 125
Ile Val Asp Asp Pro Glu Lys Ala Val Met Ser Pro Val Met Arg Ala
130 135 140
Ala Val Arg Asn Val Ala Lys Tyr Phe Pro Ala Ala Ile Val Ser Gly
145 150 155 160
Arg Ser Arg Lys Lys Val Leu Glu Phe Val Lys Leu Lys Glu Leu Cys
165 170 175
Tyr Ala Gly Ser His Gly Met Asp Ile Met Thr Ser Ser Ser Ala His
180 185 190
Tyr Glu His Asn Thr Glu Lys Gly Lys Glu Ala Asn Leu Phe Gln Pro
195 200 205
Ala Arg Asp Phe Leu Pro Met Ile Asp Glu Val Ser Lys Ala Leu Leu
210 215 220
Glu Val Thr Ser Gly Ile Glu Gly Ala Ser Val Glu Asp Asn Lys Phe
225 230 235 240
Cys Val Ser Val His Tyr Arg Asn Val Asp Glu Lys Asp Trp Glu Leu
245 250 255
Val Ala Arg Leu Val Asn Glu Val Leu Glu Asp Phe Pro Pro Leu Lys
260 265 270
Val Thr Asn Gly Arg Met Val Leu Glu Val Arg Pro Val Ile Asp Trp
275 280 285
Asp Lys Gly Lys Ala Val Glu Phe Leu Leu Gln Ser Leu Gly Leu Ser
290 295 300
Asp Ser Glu Asn Val Ile Pro Ile Tyr Ile Gly Asp Asp Arg Thr Asp
305 310 315 320
Glu Asp Ala Phe Lys Val Leu Arg Glu Arg Asn Cys Gly Tyr Gly Ile
325 330 335
Leu Val Ser Gln Ala Pro Lys Glu Thr Glu Ala Phe Tyr Ser Leu Arg
340 345 350
Asp Pro Ser Glu Val Met Glu Phe Leu Asn Ser Leu Val Arg Trp Lys
355 360 365
Lys His Ser Leu
370
<210>5
<211>2002
<212>DNA
＜213〉soybean (G1ycine max)
<400>5
actatttttt tcaggagaat attattgcgc ttttcgtgtt tctccccgaa agcaccaata 60
acgcattgcc ttccctatgg tcgctgtgtt aaagtttggc tgcccataat attaccccat 120
ttttagcttc tgccaaacaa caacttgtgc cttttttttt gtctcctttc ttatttgttt 180
ctttttagcc tttttgtttt tttattggcc gccaaactaa aaacaatatc agtatttgcg 240
tcttttaatc tggtattcct ctcttctgac tggtggcttc gttttcgcct ttgaagatat 300
ttagacgaaa acgagaatcc gcattctgat tctgaagatt catgtctaat ctcatttctt 360
tcttcccttg ggttgagctc gttttttagg agctcggcag ttgatggact gttaccccaa 420
gagcagtgac aagaaaacat taaagaggtg gttttttatt gataaaagag ttgggtgaag 480
tggaaatccg ataagtatta tttcaattgg tgctcaatac tccttaaagt tcttacattg 540
ttgctggact gtaaattgat ttaaaatctg gatcccatgg acttgaagtc gaatcatact 600
cctgttctca ctgatgctgc acctgtaaca aagtctagac tgggtgtgca ttccagtttg 660
ttgccttact cccatgctgg gacaaccttt acacatggaa tgttattgac tatcccgagg 720
aagaagacag gaattcttga agatgttcgt tctagtggtt ggttggatgc catgaaatca 780
tcttcacctc cagccaggaa gataacaaag gatgttggcc atgggtttgc atcatctgat 840
tctgaaactg ctggtgctta ttttagctgg ctgctaaaat acccatccgc acttgcatct 900
tttgatcaaa tcatgaacta tgcaaaaggg aaaagaattg cgctgtttat ggattatgat 960
ggaactcttt caccaattgt ggataatcct gactgtgctt tcatgtccga caatatgcgt 1020
gctgctgtta aaaaggtggc agaatatttt ccaacagcaa taattagtgg aagaagccgt 1080
gataaggtat atcaatttgt aggactaaca gaactctatt atgctggtag tcatggaatg 1140
gacatcattg ggcctgttag acaatctgta tctgataatc acccaaattg cattaggtct 1200
acagacaagc agggtaagga agtaaattta ttccaacctg ctgctgaatt tctgcccatg 1260
attaatgagg tacttaattc tcttgaagag tgtacgaaag acattaaagg agctaaagtt 1320
gagaacaata aattttgtgt atctgtgcac taccggaatg tagatgaaaa gtattggaat 1380
tgggtggggc aacatgttca tgatgttctg aagggctatc cacgtttgcg cttaactcat 1440
gggcggaagg ttttagagat ccgacctgtg attaactggg ataagggcaa agctgtcacg 1500
tttctacttg agtcacttgg gctaaacaat tgtgatgatg tgcttcctat atatattgga 1560
gatgatcgga cagacgaaga tgcatttaag gttttgagag agggaaataa aggttatggg 1620
atcttggtgt cttcagcacc aaaagaaagc aacgcaattt actctcttcg tgatccatca 1680
gaggtcatgg aatttctcaa gtcacttgtg ttgtggaaat caagcacctt aaaaagcctt 1740
atatagtgta tagaggagag aatatactct gctatactat actatatcat aaaaaaaaaa 1800
aacagctttt ttcgattttg gtttttctca gaaacattcc aagaggttta ctggagcaga 1860
tttacgcaca gaagaacctc ttttggtaac aacagcgttg tcgctaccca gtttttttgc 1920
tcgaagctct tgtggtagct gtaaattcgt caactcataa ttataaatat cttaaagaag 1980
taaaaaaaaa aaaaaaaaag cg 2002
<210>6
<211>389
<212>PRT
＜213〉soybean
<400>6
Met Asp Leu Lys Ser Asn His Thr Pro Val Leu Thr Asp Ala Ala Pro
1 5 10 15
Val Thr Lys Ser Arg Leu Gly Val His Ser Ser Leu Leu Pro Tyr Ser
20 25 30
His Ala Gly Thr Thr Phe Thr His Gly Met Leu Leu Thr Ile Pro Arg
35 40 45
Lys Lys Thr Gly Ile Leu Glu Asp Val Arg Ser Ser Gly Trp Leu Asp
50 55 60
Ala Met Lys Ser Ser Ser Pro Pro Ala Arg Lys Ile Thr Lys Asp Val
65 70 75 80
Gly His Gly Phe Ala Ser Ser Asp Ser Glu Thr Ala Gly Ala Tyr Phe
85 90 95
Ser Trp Leu Leu Lys Tyr Pro Ser Ala Leu Ala Ser Phe Asp Gln Ile
100 105 110
Met Asn Tyr Ala Lys Gly Lys Arg Ile Ala Leu Phe Met Asp Tyr Asp
115 120 125
Gly Thr Leu Ser Pro Ile Val Asp Asn Pro Asp Cys Ala Phe Met Ser
130 135 140
Asp Asn Met Arg Ala Ala Val Lys Lys Val Ala Glu Tyr Phe Pro Thr
145 150 155 160
Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr Gln Phe Val Gly
165 170 175
Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Ile Gly
180 185 190
Pro Val Arg Gln Ser Val Ser Asp Asn His Pro Asn Cys Ile Arg Ser
195 200 205
Thr Asp Lys Gln Gly Lys Glu Val Asn Leu Phe Gln Pro Ala Ala Glu
210 215 220
Phe Leu Pro Met Ile Asn Glu Val Leu Asn Ser Leu Glu Glu Cys Thr
225 230 235 240
Lys Asp Ile Lys Gly Ala Lys Val Glu Asn Asn Lys Phe Cys Val Ser
245 250 255
Val His Tyr Arg Asn Val Asp Glu Lys Tyr Trp Asn Trp Val Gly Gln
260 265 270
His Val His Asp Val Leu Lys Gly Tyr Pro Arg Leu Arg Leu Thr His
275 280 285
Gly Arg Lys Val Leu Glu Ile Arg Pro Val Ile Asn Trp Asp Lys Gly
290 295 300
Lys Ala Val Thr Phe Leu Leu Glu Ser Leu Gly Leu Asn Asn Cys Asp
305 310 315 320
Asp Val Leu Pro Ile Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala
325 330 335
Phe Lys Val Leu Arg Glu Gly Asn Lys Gly Tyr Gly Ile Leu Val Ser
340 345 350
Ser Ala Pro Lys Glu Ser Asn Ala Ile Tyr Ser Leu Arg Asp Pro Ser
355 360 365
Glu Val Met Glu Phe Leu Lys Ser Leu Val Leu Trp Lys Ser Ser Thr
370 375 380
Leu Lys Ser Leu Ile
385
<210>7
<211>1402
<212>DNA
＜213〉Tagetes species (Tagetes spp.)
<400>7
cgaccattgg caaaccgaga ttaggaattc atgattcatt actaccatac gcatcttctg 60
gagtcttctc tcaagctcca tttcttaaaa aacctggact acttgatgat gttcgttcta 120
ctagctggtt ggatgccatg aaatcttctt ctccaaggaa tgttctaaaa aataacgcca 180
ctgatttgtc aaatgatgtt gcttaccgca attggatgat taagtatccg tctgcacttg 240
catccattga acagattgca aataatgcaa agggaaagag gattgccttg tttctagatt 300
atgacggaac attatccccg atcgtggaca atccagatca tgccttcatg tctaatgcta 360
tgcgtgctgc agtaagaaat gtggcaaaat acattccaac agcaattatt agtggcagaa 420
gctgtgaaaa ggtacacaag tttgtaggac tgaaagaact atattatgct ggtagtcatg 480
ggatggacat aatgggtcct gttcagcctc caactgatca tagaattgag gctatagaag 540
gaaatttgta ccagcctgct agtgaatttc tacccatgat caacgaggtt tttgtgtccc 600
ttgttgagat aaccaaggac atagaaggag caaaagtcga agacaacaag ttttgtgtct 660
cagtgcacta tcgtaatgta gatgagaaga actggacaat ggtagcacaa tgtgtcgaag 720
acactttgaa aaactatcca cgtctgagat tgactcacgg gcggatggtt ttagagatcc 780
gccctgtgct taagtgggac aaggggaagg ctgttgagtt cttactcgaa tcacttggct 840
taagtaattg tgatgatgtg ctccctatat atgtagggga tgacagaaca gacgaagatg 900
cattcaagtt tttaagagag ggtagtcttg gttatggcat cttggtgact cctgccccaa 960
aggaaagcag tgcatattat tctctcaggg atccatccga ggtgatggaa tttatcaact 1020
tactagtgat gcataagaag tcggttccat gattcgactg attcgtacaa taggaagacg 1080
ttctgaaatt ttcatttaaa agaataaaac aaggcatctg aagtagaaat gagcacttct 1140
tcaacctccc tacctggcaa ttgtaaatcg cacgatatta ctttcttcat gtttgacata 1200
cgggaaagat atatgtgtat atacaatttc ttattattga atcccatgta cgtacatatc 1260
cggtcggttt tgttaataca aagatccggt attgttagta taaagttaga cgaaaatcaa 1320
gttgattgat gtaaaatttt ctttgtatga atgttcggta ctttactttt aatgtttcta 1380
tgaaattttg atattgtgtt tt 1402
<210>8
<211>304
<212>PRT
＜213〉Tagetes species
<400>8
Met Lys Ser Ser Ser Pro Arg Asn Val Leu Lys Asn Asn Ala Thr Asp
1 5 10 15
Leu Ser Asn Asp Val Ala Tyr Arg Asn Trp Met Ile Lys Tyr Pro Ser
20 25 30
Ala Leu Ala Ser Ile Glu Gln Ile Ala Asn Asn Ala Lys Gly Lys Arg
35 40 45
Ile Ala Leu Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp
50 55 60
Asn Pro Asp His Ala Phe Met Ser Asn Ala Met Arg Ala Ala Val Arg
65 70 75 80
Asn Val Ala Lys Tyr Ile Pro Thr Ala Ile Ile Ser Gly Arg Ser Cys
85 90 95
Glu Lys Val His Lys Phe Val Gly Leu Lys Glu Leu Tyr Tyr Ala Gly
100 105 110
Ser His Gly Met Asp Ile Met Gly Pro Val Gln Pro Pro Thr Asp His
115 120 125
Arg Ile Glu Ala Ile Glu Gly Asn Leu Tyr Gln Pro Ala Ser Glu Phe
130 135 140
Leu Pro Met Ile Asn Glu Val Phe Val Ser Leu Val Glu Ile Thr Lys
145 150 155 160
Asp Ile Glu Gly Ala Lys Val Glu Asp Asn Lys Phe Cys Val Ser Val
165 170 175
His Tyr Arg Asn Val Asp Glu Lys Asn Trp Thr Met Val Ala Gln Cys
180 185 190
Val Glu Asp Thr Leu Lys Asn Tyr Pro Arg Leu Arg Leu Thr His Gly
195 200 205
Arg Met Val Leu Glu Ile Arg Pro Val Leu Lys Trp Asp Lys Gly Lys
210 215 220
Ala Val Glu Phe Leu Leu Glu Ser Leu Gly Leu Ser Asn Cys Asp Asp
225 230 235 240
Val Leu Pro Ile Tyr Val Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe
245 250 255
Lys Phe Leu Arg Glu Gly Ser Leu Gly Tyr Gly Ile Leu Val Thr Pro
260 265 270
Ala Pro Lys Glu Ser Ser Ala Tyr Tyr Ser Leu Arg Asp Pro Ser Glu
275 280 285
Val Met Glu Phe Ile Asn Leu Leu Val Met His Lys Lys Ser Val Pro
290 295 300
<210>9
<211>1207
<212>DNA
＜213〉Arabidopis thaliana
<400>9
atgaagatta cggatatttc cggaaagatc gagactttgg ttgattcctt aagggatatg 60
tccccgaccc gtgtcagatc ttccttctct gatgaacatg tatccgagaa cgatgacgag 120
agaagctcct ggattgctct tcatccgtca gcattggata tgttcgaaca aatcatgcgt 180
gatgctgaag gcaaacaaat tattatgttt cttgattacg acggaactct ctcgctaatc 240
actgaagatc acgacagagc ctacataacc gacgagatgc gagaagttgt aaaggaagtg 300
gctacatatt tcaagacagc gatcatcagc ggacgaagca ctgacaaagt acagagtttt 360
gtgaaactca ctggtattca ctacgctggg agccacggca tggacattaa gggtccgaca 420
aataccgatc agagtaacca agaagaagtg atgtttcaac ctgcaagtga ctatttaccg 480
atgattgacg aggtggttaa tgttttgaag gaaaagacaa aatctatccc tggagctacg 540
gtcgagcaca acaagttttg tctaacagta cattttcgtc gggtcgatga aacgggatgg 600
gctgcattag ctgagcaagt gagattggtt ctcattgatt atccgaaatt gagactgaca 660
caaggcagaa aggtcttaga actccgacct tccatcaaat gggacaaggg aaaggctctc 720
gaatttttgc taaactcatt agggatagca gaatctaaag atgttttacc ggtttacatt 780
ggagatgacc gtactgatga agatgcattt aaggttttat gtgaaagggg acaaggtttt 840
gggattatcg tctcaaaaac tattaaggaa acgtacgcct cttactctct tcaagaccca 900
tctcaggtta aagaatttct ggagcgtttg gtaaagtgga agaaacaaac acttggagaa 960
taagaagaag aactggttca taagagatat tgagtttcgt gttcttaatt cttataaccc 1020
gtcctgaaat atatgggact cttagcaaaa taaaaatgga gaccttaatt tttagatttt 1080
aaatttattg tttcaatgaa taatactgaa aagattaatt tttcgttaaa atggtcttgt 1140
aagatattct aatgattttt ttttatatga attaagaagc atgtttcgtt gaatttatag 1200
gttaaca 1207
<210>10
<211>320
<212>PRT
＜213〉Arabidopis thaliana
<400>10
Met Lys Ile Thr Asp Ile Ser Gly Lys Ile Glu Thr Leu Val Asp Ser
1 5 10 15
Leu Arg Asp Met Ser Pro Thr Arg Val Arg Ser Ser Phe Ser Asp Glu
20 25 30
His Val Ser Glu Asn Asp Asp Glu Arg Ser Ser Trp Ile Ala Leu His
35 40 45
Pro Ser Ala Leu Asp Met Phe Glu Gln Ile Met Arg Asp Ala Glu Gly
50 55 60
Lys Gln Ile Ile Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Leu Ile
65 70 75 80
Thr Glu Asp His Asp Arg Ala Tyr Ile Thr Asp Glu Met Arg Glu Val
85 90 95
Val Lys Glu Val Ala Thr Tyr Phe Lys Thr Ala Ile Ile Ser Gly Arg
100 105 110
Ser Thr Asp Lys Val Gln Ser Phe Val Lys Leu Thr Gly Ile His Tyr
115 120 125
Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro Thr Asn Thr Asp Gln
130 135 140
Ser Asn Gln Glu Glu Val Met Phe Gln Pro Ala Ser Asp Tyr Leu Pro
145 150 155 160
Met Ile Asp Glu Val Val Asn Val Leu Lys Glu Lys Thr Lys Ser Ile
165 170 175
Pro Gly Ala Thr Val Glu His Asn Lys Phe Cys Leu Thr Val His Phe
180 185 190
Arg Arg Val Asp Glu Thr Gly Trp Ala Ala Leu Ala Glu Gln Val Arg
195 200 205
Leu Val Leu Ile Asp Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys
210 215 220
Val Leu Glu Leu Arg Pro Ser Ile Lys Trp Asp Lys Gly Lys Ala Leu
225 230 235 240
Glu Phe Leu Leu Asn Ser Leu Gly Ile Ala Glu Ser Lys Asp Val Leu
245 250 255
Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val
260 265 270
Leu Cys Glu Arg Gly Gln Gly Phe Gly Ile Ile Val Ser Lys Thr Ile
275 280 285
Lys Glu Thr Tyr Ala Ser Tyr Ser Leu Gln Asp Pro Ser Gln Val Lys
290 295 300
Glu Phe Leu Glu Arg Leu Val Lys Trp Lys Lys Gln Thr Leu Gly Glu
305 310 315 320
<210>11
<211>1396
<212>DNA
＜213〉Arabidopis thaliana
<400>11
atgtattaag acttgacaac ttgtctttct cacaccaaac ccctctcctc tgtttcataa 60
catctgctct ttcttttttt tcctaagccc ctaatgacaa accataatgc cttaatctct 120
gatgctaaag gcagcatcgg agttgcggtt agagttccaa accaatctct gttttctccc 180
ggaggtggcc gatacatcag cattccccgg aagaaactcg tgcagaagct agaggccgac 240
ccgagtcaaa cccgtatcca cacttggatc gaagccatga gggcttcttc cccaacccgt 300
acccgaccgg ggaacatatc tcccctcccg gagtccgatg aggaggatga atactcttct 360
tggatggctc aacacccgtc agctttaacc atgtttgaag agatagctga agcttcaaaa 420
gggaaacaaa tcgtgatgtt tctcgactat gacggtacat tatcccccat tgttgaaaac 480
cctgatcgag cttacatgtc tgaagagatg agagaggcag tgaaaggcgt ggctagatat 540
ttcccgaccg cgattgtcac tggaagatgc cgtgataagg ttcgtagatt tgtgaaactt 600
cccggacttt actatgcagg tagccatgga atggacatca aaggaccttc caaaagaaac 660
aaacataaca agaacaataa aggagttctt ttccaagcgg cgaatgagtt tttgcctatg 720
attgacaagg tctctaagtg tctagtagag aaaatgagag acatagaagg agcaaacgtc 780
gagaacaaca agttttgtgt ctccgtacat taccgttgtg ttgatcaaaa ggactgggga 840
ttggtagcgg aacacgtgac atcgatattg agtgagtatc cgaaactgag gttgacacaa 900
ggaagaaaag tcttagagat tcgaccaacc atcaaatggg ataaaggcaa agctctcgag 960
ttcttgctcg aatccttagg attcgctaac tctaacgatg ttttgcccat ctatatagga 1020
gatgatcgta cggacgagga tgctttcaag gttttgagaa acaaaggaca aggctttggt 1080
atacttgtgt ccaaaattcc aaaggaaacg agtgctacat attctctaca agaaccttcc 1140
gaggtaggag agtttttgca gcgactcgtg gaatggaaac aaatgtcact aagaggaaga 1200
tagccaattt cctgacataa atttattttc aattaataaa tgaattagtt ttcactatgc 1260
aacaaaaatt gttgtatata tgatcaatgt ttttttaatt attttactct tcatgaacaa 1320
atgtaagttt ataggaactt tcttaaccaa gaaaaaagta agtttgctag tataatattt 1380
tcatcattct cttttt 1396
<210>12
<211>369
<212>PRT
＜213〉Arabidopis thaliana
<400>12
Met Thr Asn His Asn Ala Leu Ile Ser Asp Ala Lys Gly Ser Ile Gly
1 5 10 15
Val Ala Val Arg Val Pro Asn Gln Ser Leu Phe Ser Pro Gly Gly Gly
20 25 30
Arg Tyr Ile Ser Ile Pro Arg Lys Lys Leu Val Gln Lys Leu Glu Ala
35 40 45
Asp Pro Ser Gln Thr Arg Ile His Thr Trp Ile Glu Ala Met Arg Ala
50 55 60
Ser Ser Pro Thr Arg Thr Arg Pro Gly Asn Ile Ser Pro Leu Pro Glu
65 70 75 80
Ser Asp Glu Glu Asp Glu Tyr Ser Ser Trp Met Ala Gln His Pro Ser
85 90 95
Ala Leu Thr Met Phe Glu Glu Ile Ala Glu Ala Ser Lys Gly Lys Gln
100 105 110
Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Glu
115 120 125
Asn Pro Asp Arg Ala Tyr Met Ser Glu Glu Met Arg Glu Ala Val Lys
130 135 140
Gly Val Ala Arg Tyr Phe Pro Thr Ala Ile Val Thr Gly Arg Cys Arg
145 150 155 160
Asp Lys Val Arg Arg Phe Val Lys Leu Pro Gly Leu Tyr Tyr Ala Gly
165 170 175
Ser His Gly Met Asp Ile Lys Gly Pro Ser Lys Arg Asn Lys His Asn
180 185 190
Lys Asn Asn Lys Gly Val Leu Phe Gln Ala Ala Asn Glu Phe Leu Pro
195 200 205
Met Ile Asp Lys Val Ser Lys Cys Leu Val Glu Lys Met Arg Asp Ile
210 215 220
Glu Gly Ala Asn Val Glu Asn Asn Lys Phe Cys Val Ser Val His Tyr
225 230 235 240
Arg Cys Val Asp Gln Lys Asp Trp Gly Leu Val Ala Glu His Val Thr
245 250 255
Ser Ile Leu Ser Glu Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys
260 265 270
Val Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu
275 280 285
Glu Phe Leu Leu Glu Ser Leu Gly Phe Ala Asn Ser Asn Asp Val Leu
290 295 300
Pro Ile Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val
305 310 315 320
Leu Arg Asn Lys Gly Gln Gly Phe Gly Ile Leu Val Ser Lys Ile Pro
325 330 335
Lys Glu Thr Ser Ala Thr Tyr Ser Leu Gln Glu Pro Ser Glu Val Gly
340 345 350
Glu Phe Leu Gln Arg Leu Val Glu Trp Lys Gln Met Ser Leu Arg Gly
355 360 365
Arg
<210>13
<211>1398
<212>DNA
＜213〉Arabidopis thaliana
<400>13
ctcctcacct tctctctctc aacatctctc tctttctctg tcttctctct gtctcaacga 60
gaatatgact aaccagaatg tcatcgtttc cgacaggaaa cccatcttgg gtttgaaaac 120
cateactgtc tctgtctcta actctcctct gttctctaat tcctttccca cttactttaa 180
cttccctcgt cgaaagctct tgaaacttct tgaagcagcc gacaaaaaca acttagttgt 240
tgctccaaag attacgtcta tgatcgattc catgcgtgat tcttccccta cacgtctcag 300
atcctcttcc tatgactctg tttcagataa cgacgacaaa acatcttgga tcgttcgttt 360
tccttcggct ttaaatatgt ttgatgagat tgtgaatgct gcgaaaggga aacagattgt 420
catgtttctt gattacgacg gaactctttc tcccatagtt gaagatcccg acaaagcttt 480
cataacccat gagatgagag aagtcgtaaa agacgtggct tcgaatttcc cgactgctat 540
tgtcaccggg agatccattg agaaggttcg tagttttgtc caagtaaacg agatttacta 600
cgccggaagc cacggcatgg acattgaagg tccgaccaac gaaaatagta acggccagag 660
taatgaaaga gtgctattcc aacctgctcg tgaattttta ccgatgatcg agaaggtggt 720
taatatttta gaggaaaaaa caaaatggat ccctggggct atggtggaga acaacaagtt 780
ttgtctgtcc gtacattttc gacgtgttga tgagaagaga tggcctgcat tagctgaagt 840
agtaaaatca gttcttattg attatccaaa gctgaaacta acccaaggta gaaaggtact 900
tgaaatccgc cccacaatca aatgggacaa gggccaggca ctcaattttt tactaaaatc 960
attaggatat gaaaattcgg atgatgttgt gccggtgtat atcggggatg accgtactga 1020
cgaagatgcg tttaaggttt tacgtgaaag gggacaaggt tttgggattc ttgtctcaaa 1080
agtaccaaag gacaccaatg cctcttattc tcttcaagac ccttctcagg ttaacaagtt 1140
tctggaacgt ttagtagaat ggaagaggaa gacagtggga gaagagtgaa agacatgcaa 1200
cataattaca caaataacac ctgagttttg agtagattat taatttatat aaacaccctt 1260
tttaaattag tagatgcctg gagggtgttt cggccagaag tttttctttt aatctacatc 1320
gaaccgaaaa ttgtaaattt cgtgtaacga tttagaaatg gaaaaatata ttaataattt 1380
actcattctt atttgacc 1398
<210>14
<211>374
<212>PRT
＜213〉Arabidopis thaliana
<400>14
Met Thr Asn Gln Asn Val Ile Val Ser Asp Arg Lys Pro Ile Leu Gly
1 5 10 15
Leu Lys Thr Ile Thr Val Ser Val Ser Asn Ser Pro Leu Phe Ser Asn
20 25 30
Ser Phe Pro Thr Tyr Phe Asn Phe Pro Arg Arg Lys Leu Leu Lys Leu
35 40 45
Leu Glu Ala Ala Asp Lys Asn Asn Leu Val Val Ala Pro Lys Ile Thr
50 55 60
Ser Met Ile Asp Ser Met Arg Asp Ser Ser Pro Thr Arg Leu Arg Ser
65 70 75 80
Ser Ser Tyr Asp Ser Val Ser Asp Asn Asp Asp Lys Thr Ser Trp Ile
85 90 95
Val Arg Phe Pro Ser Ala Leu Asn Met Phe Asp Glu Ile Val Asn Ala
100 105 110
Ala Lys Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu
115 120 125
Ser Pro Ile Val Glu Asp Pro Asp Lys Ala Phe Ile Thr His Glu Met
130 135 140
Arg Glu Val Val Lys Asp Val Ala Ser Asn Phe Pro Thr Ala Ile Val
145 150 155 160
Thr Gly Arg Ser Ile Glu Lys Val Arg Ser Phe Val Gln Val Asn Glu
165 170 175
Ile Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Glu Gly Pro Thr Asn
180 185 190
Glu Asn Ser Asn Gly Gln Ser Asn Glu Arg Val Leu Phe Gln Pro Ala
195 200 205
Arg Glu Phe Leu Pro Met Ile Glu Lys Val Val Asn Ile Leu Glu Glu
210 215 220
Lys Thr Lys Trp Ile Pro Gly Ala Met Val Glu Asn Asn Lys Phe Cys
225 230 235 240
Leu Ser Val His Phe Arg Arg Val Asp Glu Lys Arg Trp Pro Ala Leu
245 250 255
Ala Glu Val Val Lys Ser Val Leu Ile Asp Tyr Pro Lys Leu Lys Leu
260 265 270
Thr Gln Gly Arg Lys Val Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp
275 280 285
Lys Gly Gln Ala Leu Asn Phe Leu Leu Lys Ser Leu Gly Tyr Glu Asn
290 295 300
Ser Asp Asp Val Val Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu
305 310 315 320
Asp Ala Phe Lys Val Leu Arg Glu Arg Gly Gln Gly Phe Gly Ile Leu
325 330 335
Val Ser Lys Val Pro Lys Asp Thr Asn Ala Ser Tyr Ser Leu Gln Asp
340 345 350
Pro Ser Gln Val Asn Lys Phe Leu Glu Arg Leu Val Glu Trp Lys Arg
355 360 365
Lys Thr Val Gly Glu Glu
370
<210>15
<211>1259
<212>DNA
＜213〉Arabidopis thaliana
<400>15
acattcactc tcatttccat caaaattata acttcatttt acattttgat taatatccta 60
aaatggttag attcatcgaa gaaaatatta ctaaaatgtt ggagacaaag gccatctcaa 120
actcggaggt tttatatgtc ggaggagacg acggagacac gtcaccaacg acgaaagttc 180
ttcatgattt tcagatcaac agcggaggag gactgataag atcatgggtt gattctatga 240
gagcttgttc tcctactcgc cctaaatcct tcaatagcca atcttgttgg attaaggaac 300
atccatctgc tttgaacatg ttcgaagaaa tacttcataa atctgaagga aaacaaatag 360
ttatgtttct tgattatgat ggtactctct ctcccattgt tgatgatcct gatcgagctt 420
tcatgtccaa gaagatgcga aatactgtga ggaaacttgc aaagtgtttt ccaacagcca 480
tagttagtgg gagatgcaga gagaaggttt ctagttttgt gaaattaact gagttatact 540
acgctggaag tcatggcatg gacatcaaag gaccagagca aggatctaaa tacaagaaag 600
aaaatcagtc tcttctttgt caacccgcaa ctgaattcct cccggtgata aacgaggttt 660
ataaaaaact agtcgagaac actcaatcga ttccaggagc gaaagttgag aacaacaaat 720
tttgtgcgtc tgttcacttt cgatgcgtag aagaaaataa atggagtgac ttggcccatc 780
aagttcgatc agtcttgaag aattacccca agctcatgct tacccaagga agaaaagtat 840
tggagattcg tccaatcatt aagtgggata aaggcaaagc actcgagttt ttgttagaat 900
cactaggata tgataattgt accgatgttt ttcctatata tattggagat gatcgtaccg 960
acgaagacgc ctttaagata ctgagagaca aaaaacaagg tcttggaatt cttgtgtcca 1020
aatacgcaaa ggagactaat gcttcttatt ctttgcaaga gccagatgag gttatggttt 1080
ttttagaacg tttggtggaa tggaaacagt caaggtgtgg ggcatgaaga gtttacaagt 1140
acaggagaaa cttgttcttt ttcttttttc tttttactat gtagtattgg taaagattct 1200
aacgtataag agaacgagaa taagtttatt aatataacaa gaagacaaat attgaggtt 1259
<210>16
<21l>354
<212>PRT
＜213〉Arabidopis thaliana
<400>16
Met Val Arg Phe Ile Glu Glu Asn Ile Thr Lys Met Leu Glu Thr Lys
1 5 10 15
Ala Ile Ser Asn Ser Glu Val Leu Tyr Val Gly Gly Asp Asp Gly Asp
20 25 30
Thr Ser Pro Thr Thr Lys Val Leu His Asp Phe Gln Ile Asn Ser Gly
35 40 45
Gly Gly Leu Ile Arg Ser Trp Val Asp Ser Met Arg Ala Cys Ser Pro
50 55 60
Thr Arg Pro Lys Ser Phe Asn Ser Gln Ser Cys Trp Ile Lys Glu His
65 70 75 80
Pro Ser Ala Leu Asn Met Phe Glu Glu Ile Leu His Lys Ser Glu Gly
85 90 95
Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile
100 105 110
Val Asp Asp Pro Asp Arg Ala Phe Met Ser Lys Lys Met Arg Asn Thr
115 120 125
Val Arg Lys Leu Ala Lys Cys Phe Pro Thr Ala Ile Val Ser Gly Arg
130 135 140
Cys Arg Glu Lys Val Ser Ser Phe Val Lys Leu Thr Glu Leu Tyr Tyr
145 150 155 160
Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro Glu Gln Gly Ser Lys
165 170 175
Tyr Lys Lys Glu Asn Gln Ser Leu Leu Cys Gln Pro Ala Thr Glu Phe
180 185 190
Leu Pro Val Ile Asn Glu Val Tyr Lys Lys Leu Val Glu Asn Thr Gln
195 200 205
Ser Ile Pro Gly Ala Lys Val Glu Asn Asn Lys Phe Cys Ala Ser Val
210 215 220
His Phe Arg Cys Val Glu Glu Asn Lys Trp Ser Asp Leu Ala His Gln
225 230 235 240
Val Arg Ser Val Leu Lys Asn Tyr Pro Lys Leu Met Leu Thr Gln Gly
245 250 255
Arg Lys Val Leu Glu Ile Arg Pro Ile Ile Lys Trp Asp Lys Gly Lys
260 265 270
Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly Tyr Asp Asn Cys Thr Asp
275 280 285
Val Phe Pro Ile Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe
290 295 300
Lys Ile Leu Arg Asp Lys Lys Gln Gly Leu Gly Ile Leu Val Ser Lys
305 310 315 320
Tyr Ala Lys Glu Thr Asn Ala Ser Tyr Ser Leu Gln Glu Pro Asp Glu
325 330 335
Val Met Val Phe Leu Glu Arg Leu Val Glu Trp Lys Gln Ser Arg Cys
340 345 350
Gly Ala
<210>17
<211>1690
<212>DNA
＜213〉Arabidopis thaliana
<400>17
tttcttctct tcctcctaca ttctcgactc tctcttttta ttagggtttt caattttaat 60
caaaaaaaaa ccctcaaatc tcatttttgg atttggtttc ttctgcgatc tctgagattc 120
aatttcttct atcaaaggaa acaaaaaact tcatctttcc gaagattttt tttccttcct 180
tctggagctc ttttgaatca ggtgaatttc taattgaatc tgaaagttta cgatgaacaa 240
tttgatatga tgataagttt tgtttgatgg agctttcacc aacaagcagt gacaagaaaa 300
caatgaagag atggtttttc atagataaac gagttggata gagtgttatt gaagataaag 360
aaagcaaaaa acagaagttc ttgcattgaa gcattggttt tagagtttat tgaagcattg 420
tttagagttt tgattaatgg atttaaactc aaaccacaaa tcctctgttc ttaaagatcc 480
ttcaccatca gttaaccaat caagactcgg cgtgtctagt agatttatga tgagtcaatg 540
gaagaaacct gcgaaactcg atgatgttag atccaatggt tggttagatg caatgatttc 600
atcttctcca ccgcgtaaga agcttgtcaa agattttaat gttgaagttg ctcctgaaga 660
tgattttgct caacgtgctt ggatggtgaa atatccttcg gcgattagct cgtttgcgca 720
tattgcagct caagcaaaga agaaaaagat tgctgtattt ctagattatg atggtactct 780
ttctccaata gttgatgatc ctgatcgtgc catcatgtct gatgcaatgc gttctgcggt 840
taaagatgtc gcgagttact tcccaaccgc aataattagc ggtagaagcc gtgacaaggt 900
ttatcagttg gtaggactaa cagaacttta ttacgcgggt agtcatggaa tggacataat 960
gacttcttct gatggtccga attgtttcaa atccactgac caacagggta aggaagtgaa 1020
tctgtttcag cccgcgagag aattcatacc ggttatcgac gaggttttta gaacccttgt 1080
tgagaaaatg aaagatatca aaggtgcaaa agtagagaac cacaagttct gtgcatctgt 1140
acattaccgt aacgttgacg aaaaggattg gcctattatt gctcagcgtg ttcatgacca 1200
cttgaaacaa taccctcgtt tgcgtctaac tcatgggagg aaggttttag aggttcgtcc 1260
tgtgatagac tggaacaaag gaagagcggt cgagtttcta ttagaatctc tcggattaag 1320
caataaagac gatttgcttc ctatctacat tggtgatgac acaaccgatg aagatgcgtt 1380
caaggtactg agagatggga accgaggttt cggcatccta gtatcgtcta taccgaaaga 1440
aagcaatgcg ttttactccc ttagagatcc atccgaggtg aagaagtttc taaagacttt 1500
ggtgaaatgg gcaaagttgg agaagaattc tactggtttt tgaataatat agtggaattt 1560
tatgattaaa tgcttattta cacttttttt tgtttcttta atcttttttc atctctaccc 1620
agttttagtc acagcttaat ttatgatttt ccatttatct ggtggaagtt aagttattaa 1680
agttacatgt 1690
<210>18
<211>368
<212>PRT
＜213〉Arabidopis thaliana
<400>18
Met Asp Leu Asn Ser Asn His Lys Ser Ser Val Leu Lys Asp Pro Ser
1 5 10 15
Pro Ser Val Asn Gln Ser Arg Leu Gly Val Ser Ser Arg Phe Met Met
20 25 30
Ser Gln Trp Lys Lys Pro Ala Lys Leu Asp Asp Val Arg Ser Asn Gly
35 40 45
Trp Leu Asp Ala Met Ile Ser Ser Ser Pro Pro Arg Lys Lys Leu Val
50 55 60
Lys Asp Phe Asn Val Glu Val Ala Pro Glu Asp Asp Phe Ala Gln Arg
65 70 75 80
Ala Trp Met Val Lys Tyr Pro Ser Ala Ile Ser Ser Phe Ala His Ile
85 90 95
Ala Ala Gln Ala Lys Lys Lys Lys Ile Ala Val Phe Leu Asp Tyr Asp
100 105 110
Gly Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Arg Ala Ile Met Ser
115 120 125
Asp Ala Met Arg Ser Ala Val Lys Asp Val Ala Ser Tyr Phe Pro Thr
130 135 140
Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr Gln Leu Val Gly
145 150 155 160
Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Met Thr
165 170 175
Ser Ser Asp Gly Pro Asn Cys Phe Lys Ser Thr Asp Gln Gln Gly Lys
180 185 190
Glu Val Asn Leu Phe Gln Pro Ala Arg Glu Phe Ile Pro Val Ile Asp
195 200 205
Glu Val Phe Arg Thr Leu Val Glu Lys Met Lys Asp Ile Lys Gly Ala
210 215 220
Lys Val Glu Asn His Lys Phe Cys Ala Ser Val His Tyr Arg Asn Val
225 230 235 240
Asp Glu Lys Asp Trp Pro Ile Ile Ala Gln Arg Val His Asp His Leu
245 250 255
Lys Gln Tyr Pro Arg Leu Arg Leu Thr His Gly Arg Lys Val Leu Glu
260 265 270
Val Arg Pro Val Ile Asp Trp Asn Lys Gly Arg Ala Val Glu Phe Leu
275 280 285
Leu Glu Ser Leu Gly Leu Ser Asn Lys Asp Asp Leu Leu Pro Ile Tyr
290 295 300
Ile Gly Asp Asp Thr Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Asp
305 310 315 320
Gly Asn Arg Gly Phe Gly Ile Leu Val Ser Ser Ile Pro Lys Glu Ser
325 330 335
Asn Ala Phe Tyr Ser Leu Arg Asp Pro Ser Glu Val Lys Lys Phe Leu
340 345 350
Lys Thr Leu Val Lys Trp Ala Lys Leu Glu Lys Asn Ser Thr Gly Phe
355 360 365
<210>19
<211>1687
<212>DNA
＜213〉Arabidopis thaliana
<400>19
gtgagctctt tgcaattttt agggttttct tcgaataaag aaaaaaaaaa tccctgatct 60
tcctcttagt gatttctcct ttcgagatcc ctgagattcc gagaaaatct gcattttttt 120
ctcgtgattc tctagctctg ttttgtgttt tacacagctc ttttgaatca ggtttgtgtg 180
tgatagcgtt gttgtggtaa aagctttgta catttgaaga tttagagatg ataagttttc 240
aggtaaccta cttttaatgg acagttcaac aacaagcagt gataagaaaa cactaaagag 300
gtggtttttc attgacaaaa gagttggata aagtgtgttt agaagaagcc gtcgaatttc 360
ttagtttgaa gcattttatt gtttggagag ttcgatggat ttgaatataa acaagacgac 420
ccctgttctt agtgacccta ctacaccagt aagtaaaaca agacttggat catccttccc 480
ttcagggaga ttcatgatga attctagaaa gaagattcct aaactcgatg atgttcgatc 540
taacggttgg ttggacgcga tgatatcttc gtctccaccg cgtaaaaggc ttgtcaagga 600
tttcaatatt gagattgctc ctgaagatga tttttctcaa cgggcctgga tgctcaagta 660
tccttcagcg attacctcgt ttgcgcatat tgcagctcaa gcaaagaaca agaagatagc 720
tgtgtttcta gattatgatg gaacactttc tccaatagtc gatgaccctg atcgcgccat 780
catgtctgat gcgatgcgtg ctgctgtgaa agatgtcgcc aagtacttcc caacagcaat 840
aattagtggt agaagccgtg acaaggttta ccaattggta gggctaaccg aactctatta 900
cgcgggtagt cacgggatgg acattatgac tcctgtaaat ccaaatggat cccctgaaga 960
ccctaattgt ataaaaacca ctgaccaaca gggtgaggag gtaaacctct ttcagcctgc 1020
taaagagttc atacccgtca ttgaagaggt ttataataac ctcgttgaga taactaaatg 1080
tatcaaaggt gcaaaagtag agaaccataa gttttgtact tctgtacatt accgtaatgt 1140
tgacgagaag gactggccac ttgttgctca acgcgttcat gaccacctga aacgataccc 1200
tcgtttgcgt ataactcacg gtagaaaggt tttagaggtg cgtcctgtga ttgagtggaa 1260
caaaggaaaa gcagtagagt ttctgttaga gtctctcgga ttaagcaaca acgatgagtt 1320
cctcccaatc ttcatcggag atgacaagac cgatgaagat gcattcaagg tactgaggga 1380
agggaacaga ggatttggaa tattggtatc gtctgtacca aaagaaagca atgcatttta 1440
ctctcttaga gacccttccg aggtgaagaa gtttctcaag actttggtga aatgggggaa 1500
gatggaaagt tcaaaaacaa gtttttgatg attgtgtagg agaatcagaa gcttcattct 1560
gcactgcttt ttaatttctt attttttttc cttttttaaa gtttgtactt ctatatatta 1620
tcatttttcc atattatcca ttaagcaaac gggaaaaaca agaatataac gattgtcttg 1680
acatttt 1687
<210>20
<211>377
<212>PRT
＜213〉Arabidopis thaliana
<400>20
Met Asp Leu Asn Ile Asn Lys Thr Thr Pro Val Leu Ser Asp Pro Thr
1 5 10 15
Thr Pro Val Ser Lys Thr Arg Leu Gly Ser Ser Phe Pro Ser Gly Arg
20 25 30
Phe Met Met Asn Ser Arg Lys Lys Ile Pro Lys Leu Asp Asp Val Arg
35 40 45
Ser Asn Gly Trp Leu Asp Ala Met Ile Ser Ser Ser Pro Pro Arg Lys
50 55 60
Arg Leu Val Lys Asp Phe Asn Ile Glu Ile Ala Pro Glu Asp Asp Phe
65 70 75 80
Ser Gln Arg Ala Trp Met Leu Lys Tyr Pro Ser Ala Ile Thr Ser Phe
85 90 95
Ala His Ile Ala Ala Gln Ala Lys Asn Lys Lys Ile Ala Val Phe Leu
100 105 110
Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Arg Ala
115 120 125
Ile Met Ser Asp Ala Met Arg Ala Ala Val Lys Asp Val Ala Lys Tyr
130 135 140
Phe Pro Thr Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr Gln
145 150 155 160
Leu Val Gly Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp
165 170 175
Ile Met Thr Pro Val Asn Pro Asn Gly Ser Pro Glu Asp Pro Asn Cys
180 185 190
Ile Lys Thr Thr Asp Gln Gln Gly Glu Glu Val Asn Leu Phe Gln Pro
195 200 205
Ala Lys Glu Phe Ile Pro Val Ile Glu Glu Val Tyr Asn Asn Leu Val
210 215 220
Glu Ile Thr Lys Cys Ile Lys Gly Ala Lys Val Glu Asn His Lys Phe
225 230 235 240
Cys Thr Ser Val His Tyr Arg Asn Val Asp Glu Lys Asp Trp Pro Leu
245 250 255
Val Ala Gln Arg Val His Asp His Leu Lys Arg Tyr Pro Arg Leu Arg
260 265 270
Ile Thr His Gly Arg Lys Val Leu Glu Val Arg Pro Val Ile Glu Trp
275 280 285
Asn Lys Gly Lys Ala Val Glu Phe Leu Leu Glu Ser Leu Gly Leu Ser
290 295 300
Asn Asn Asp Glu Phe Leu Pro Ile Phe Ile Gly Asp Asp Lys Thr Asp
305 310 315 320
Glu Asp Ala Phe Lys Val Leu Arg Glu Gly Asn Arg Gly Phe Gly Ile
325 330 335
Leu Val Ser Ser Val Pro Lys Glu Ser Asn Ala Phe Tyr Ser Leu Arg
340 345 350
Asp Pro Ser Glu Val Lys Lys Phe Leu Lys Thr Leu Val Lys Trp Gly
355 360 365
Lys Met Glu Ser Ser Lys Thr Ser Phe
370 375
<210>21
<211>1283
<212>DNA
4213〉Arabidopis thaliana
<400>21
gtctctctca aagcctacac actcattctc actctgtttc tacaacccta aatctctttt 60
catttacaga cagaaatggt tagattcata gaagaaaaca caaaacttgt agaaaaagaa 120
accgggaaca aatcaaacaa cgatgtaaca acaacgaaga agaaagctct tcaagatatc 180
attatcaaca atggagtagg attgatcaat tcatgggttg attcaatgag agcttgttcc 240
cctactcatc ttaaatcttt gttgaaacaa agctcttggc tcacggaaca tccatcagct 300
ttggatatgt ttgaagagat tcttcacctt tctgaaggaa aacaaatcgt tatgttcttg 360
gattatgatg gcactttatc tcccattgtt gatgatccag atcgagcttt catgtctaga 420
aagatgagaa gaactgtgag gaaactagca aactgtttcc cgacggccat agttagtggg 480
agatgcatag aaaaggttta taactttgta aaactaactg agttgtacta tgctggaagt 540
catggaatgg acatcaaagg accagagcaa gggtccaaat atgagcaaat tttacaggat 600
agtaaatctc ttctttgcca accagctaca gagttcctcc ccatgatcga cgaggtttat 660
cataaattag tggagaaaac aaaatctact cccggagccc aagtagagaa caacaaattt 720
tgtgtctctg ttcacttccg acgcgtagat gaaaataact ggagtgattt ggctaaccaa 780
gttcgatcag taatgaaaga ctaccctaag ctccgtctta ctcaaggaag aaaagttttg 840
gaggttcgtc cgattattaa atgggacaaa ggcaaagcac tcgagttttt attagagtca 900
cttggatacg ctaattgtac cgacgttttc cctctttata tcggagatga tcgcaccgac 960
gaagatgcat tcaaggtatt gagagaacga agacaaggtc ttggcattct tgtatctaaa 1020
tttccaaagg agactagcgc gtcttattca ctgcaagaac ccgatgaggt tatggagttc 1080
ttgcaacgtt tagtggaatg gaaacaattg agatctggag catgatgaga gctataacta 1140
cagaagaatc gtttcttctt aattagtaac ttgttaattt tattttattt tcttgctctc 1200
atatattgta ctcaacgcgt atgtaaaatg tttataagaa aattgtagat ccatcattct 1260
caaggaaaat atgttttata tat 1283
<210>22
<211>349
<212>PRT
＜213〉Arabidopis thaliana
<400>22
Met Val Arg Phe Ile Glu Glu Asn Thr Lys Leu Val Glu Lys Glu Thr
1 5 10 15
Gly Asn Lys Ser Asn Asn Asp Val Thr Thr Thr Lys Lys Lys Ala Leu
20 25 30
Gln Asp Ile Ile Ile Asn Asn Gly Val Gly Leu Ile Asn Ser Trp Val
35 40 45
Asp Ser Met Arg Ala Cys Ser Pro Thr His Leu Lys Ser Leu Leu Lys
50 55 60
Gln Ser Ser Trp Leu Thr Glu His Pro Ser Ala Leu Asp Met Phe Glu
65 70 75 80
Glu Ile Leu His Leu Ser Glu Gly Lys Gln Ile Val Met Phe Leu Asp
85 90 95
Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Arg Ala Phe
100 105 110
Met Ser Arg Lys Met Arg Arg Thr Val Arg Lys Leu Ala Asn Cys Phe
115 120 125
Pro Thr Ala Ile Val Ser Gly Arg Cys Ile Glu Lys Val Tyr Asn Phe
130 135 140
Val Lys Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile
145 150 155 160
Lys Gly Pro Glu Gln Gly Ser Lys Tyr Glu Gln Ile Leu Gln Asp Ser
165 170 175
Lys Ser Leu Leu Cys Gln Pro Ala Thr Glu Phe Leu Pro Met Ile Asp
180 185 190
Glu Val Tyr His Lys Leu Val Glu Lys Thr Lys Ser Thr Pro Gly Ala
195 200 205
Gln Val Glu Asn Asn Lys Phe Cys Val Ser Val His Phe Arg Arg Val
210 215 220
Asp Glu Asn Asn Trp Ser Asp Leu Ala Asn Gln Val Arg Ser Val Met
225 230 235 240
Lys Asp Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys Val Leu Glu
245 250 255
Val Arg Pro Ile Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu
260 265 270
Leu Glu Ser Leu Gly Tyr Ala Asn Cys Thr Asp Val Phe Pro Leu Tyr
275 280 285
Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Glu
290 295 300
Arg Arg Gln Gly Leu Gly Ile Leu Val Ser Lys Phe Pro Lys Glu Thr
305 310 315 320
Ser Ala Ser Tyr Ser Leu Gln Glu Pro Asp Glu Val Met Glu Phe Leu
325 330 335
Gln Arg Leu Val Glu Trp Lys Gln Leu Arg Ser Gly Ala
340 345
<210>23
<211>1280
<212>DNA
＜213〉Arabidopis thaliana
<400>23
atgtcagcta gtcaaaacat tgtcgtatca gagactacaa tgtcaagtat catccccaac 60
aacaacaaca acaacaacaa ctcttcttca cagaaactcc ctccttgttt aatctcaatt 120
tccaagaaaa agcttctcaa gaacatcgac atcatcaatg gtggtggaca aagaatcaac 180
gcttgggtag attcaatgcg tgcttcttct cctactcatc tcaaatctct tccttcttct 240
atctccacac agcaacaact caactcatgg atcatgcaac atccttcagc actagaaaaa 300
ttcgaacaga taatggaagc ttcgagaggg aaacaaatcg taatgtttct tgattatgac 360
ggtactctct ctcccattgt tgatgatcca gacaaagctt tcatgtcaag caagatgaga 420
agaacagtga aaaaactggc taagtgtttc cccactgcta tagttactgg tagatgcata 480
gacaaggtgt ataactttgt gaagcttgct gagctgtatt atgctggaag ccatggcatg 540
gacattaaag gtccagcaaa aggcttctcc agacacaaga gggttaaaca gtctcttctg 600
taccaaccag ctaatgacta tcttcccatg atcgatgaag tttatagaca actcttggaa 660
aaaacaaaat cgactccagg agccaaagta gaaaaccaca agttttgtgc ttctgtgcac 720
tttcgctgcg tcgatgagaa gaaatggagc gaactggttc tacaggttcg gtcggtatta 780
aagaaattcc ctacgctgca actgacccaa ggtcggaagg ttttcgaaat ccgtccaatg 840
attgaatggg ataaaggaaa ggctcttgag ttcttgttag aatcacttgg atttgggaac 900
actaacaatg ttttcccggt ttatattggt gacgatcgaa ctgacgaaga tgcatttaag 960
atgctacgag acagaggcga aggctttggc attcttgtct ccaagtttcc caaggatact 1020
gatgcttcgt attctttgca agatccatcc gaggtgatgg atttcttacg acgattggtg 1080
gaatggaaac aaatgcagcc aagaatgtga aatgataata taataaacga gtgacaatat 1140
tcgaaatgcc aatggatgta tataatgaat atgttcatgc ctaacttttt taggaacgtt 1200
gtaattggta aaggatatgg cagtgtcttt aacgtacccc cattaggtta atcttcttgt 1260
tcgtcacatt gtatttttgt 1280
<210>24
<211>369
<212>PRT
＜213〉Arabidopis thaliana
<400>24
Met Ser Ala Ser Gln Asn Ile Val Val Ser Glu Thr Thr Met Ser Ser
1 5 10 15
Ile Ile Pro Asn Asn Asn Asn Asn Asn Asn Asn Ser Ser Ser Gln Lys
20 25 30
Leu Pro Pro Cys Leu Ile Ser Ile Ser Lys Lys Lys Leu Leu Lys Asn
35 40 45
Ile Asp Ile Ile Asn Gly Gly Gly Gln Arg Ile Asn Ala Trp Val Asp
50 55 60
Ser Met Arg Ala Ser Ser Pro Thr His Leu Lys Ser Leu Pro Ser Ser
65 70 75 80
Ile Ser Thr Gln Gln Gln Leu Asn Ser Trp Ile Met Gln His Pro Ser
85 90 95
Ala Leu Glu Lys Phe Glu Gln Ile Met Glu Ala Ser Arg Gly Lys Gln
100 105 110
Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp
115 120 125
Asp Pro Asp Lys Ala Phe Met Ser Ser Lys Met Arg Arg Thr Val Lys
130 135 140
Lys Leu Ala Lys Cys Phe Pro Thr Ala Ile Val Thr Gly Arg Cys Ile
145 150 155 160
Asp Lys Val Tyr Asn Phe Val Lys Leu Ala Glu Leu Tyr Tyr Ala Gly
165 170 175
Ser His Gly Met Asp Ile Lys Gly Pro Ala Lys Gly Phe Ser Arg His
180 185 190
Lys Arg Val Lys Gln Ser Leu Leu Tyr Gln Pro Ala Asn Asp Tyr Leu
195 200 205
Pro Met Ile Asp Glu Val Tyr Arg Gln Leu Leu Glu Lys Thr Lys Ser
210 215 220
Thr Pro Gly Ala Lys Val Glu Asn His Lys Phe Cys Ala Ser Val His
225 230 235 240
Phe Arg Cys Val Asp Glu Lys Lys Trp Ser Glu Leu Val Leu Gln Val
245 250 255
Arg Ser Val Leu Lys Lys Phe Pro Thr Leu Gln Leu Thr Gln Gly Arg
260 265 270
Lys Val Phe Glu Ile Arg Pro Met Ile Glu Trp Asp Lys Gly Lys Ala
275 280 285
Leu Glu Phe Leu Leu Glu Ser Leu Gly Phe Gly Asn Thr Asn Asn Val
290 295 300
Phe Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys
305 310 315 320
Met Leu Arg Asp Arg Gly Glu Gly Phe Gly Ile Leu Val Ser Lys Phe
325 330 335
Pro Lys Asp Thr Asp Ala Ser Tyr Ser Leu Gln Asp Pro Ser Glu Val
340 345 350
Met Asp Phe Leu Arg Arg Leu Val Glu Trp Lys Gln Met Gln Pro Arg
355 360 365
Met
<210>25
<211>1558
<212>DNA
＜213〉Arabidopis thaliana
<400>25
gatacaatct tagtaatcac acttgagtat ttttcttaac tggttttgtt tcttggcatc 60
ttcatttcag ggtctatatt tctctgagga attggattct tatagaagtt aaaccgcaga 120
gcttcttcta tccaatagtc ctctgagaat cgtcgatata gtttgctgat atagttgtta 180
tggacatgaa atctggtcac tcgtctcctg taatgactga ttctccacca ataagcaact 240
caagattaac cattcgtcag aatagacttc cttactcatc agcagcagcc acggctatct 300
cacagaacaa caatctctta ctaaccgttc caagaaagaa aactgggatc cttgatgatg 360
ttaagtctaa tggttggctt gatgcgatga aatcttcttc tcctcctcct acaatactta 420
acaaagataa cttaagcaat gatgctacgg atatgactta tcgcgaatgg atgcagctca 480
agtatccatc agctcttacc tcttttgaga aaatcatgag ttttgcaaaa ggcaaaagaa 540
tagcattgtt tcttgattat gacgggacac tttcgcctat tgttgaggaa cctgattgtg 600
catacatgtc aagtgctatg cgtagtgcag tgcaaaatgt tgccaagtat ttccctaccg 660
cgatcattag tggaagaagc cgggataagg tgtatgagtt tgttaatttg agtgaacttt 720
attacgccgg aagccatgga atggacatca tgagtcccgc aggagaatct ttaaaccatg 780
aacatagccg tactgtatca gtttacgaac aggggaaaga tgtaaatcta ttccagcctg 840
ctagcgagtt tctcccgatg atcgataagg tgctttgttc tcttatagag agtacaaaag 900
atatcaaagg ggtaaaagta gaagacaaca agttctgcat ctctgtgcat taccgcaatg 960
tagaagaaaa gaactggaca ttggttgcac agtgtgtaga tgatgtcatc agaacatatc 1020
caaaactacg gctaacacat ggccggaagg ttttagagat ccgtcctgtg attgactggg 1080
acaaagggaa agctgtgaca tttctacttg aatcactcgg cctaaacaac tgtgaggatg 1140
ttcttccaat ctatgttggg gatgatcgaa cagacgaaga tgcatttaag gtactacgag 1200
atggaccaaa ccacggttat ggtatattag tctctgctgt gcctaaagac agcaatgcct 1260
tttactcgct tcgtgacccg tctgaggtga tggagtttct gaagtcattg gtgacatgga 1320
agagatcaat gggttaaagt agaagaagaa gatgtagaag aaaagtggtt aacgttaata 1380
tatattacaa atatgcaagt tagaggttta ttgttacttt tcggctttat acaaaaacta 1440
ccgttgagat ttaacttaac ggtatcggag gagagatcac atgatggctt aaaacatgcc 1500
ggagatactt tttccgacca atctctttat cttctacaac tgtaaattcc tccatctc 1558
<210>26
<211>385
<212>PRT
＜213〉Arabidopis thaliana
<400>26
Met Asp Met Lys Ser Gly His Ser Ser Pro Val Met Thr Asp Ser Pro
1 5 10 15
Pro Ile Ser Asn Ser Arg Leu Thr Ile Arg Gln Asn Arg Leu Pro Tyr
20 25 30
Ser Ser Ala Ala Ala Thr Ala Ile Ser Gln Asn Asn Asn Leu Leu Leu
35 40 45
Thr Val Pro Arg Lys Lys Thr Gly Ile Leu Asp Asp Val Lys Ser Asn
50 55 60
Gly Trp Leu Asp Ala Met Lys Ser Ser Ser Pro Pro Pro Thr Ile Leu
65 70 75 80
Asn Lys Asp Asn Leu Ser Asn Asp Ala Thr Asp Met Thr Tyr Arg Glu
85 90 95
Trp Met Gln Leu Lys Tyr Pro Ser Ala Leu Thr Ser Phe Glu Lys Ile
100 105 110
Met Ser Phe Ala Lys Gly Lys Arg Ile Ala Leu Phe Leu Asp Tyr Asp
115 120 125
Gly Thr Leu Ser Pro Ile Val Glu Glu Pro Asp Cys Ala Tyr Met Ser
130 135 140
Ser Ala Met Arg Ser Ala Val Gln Asn Val Ala Lys Tyr Phe Pro Thr
145 150 155 160
Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr Glu Phe Val Asn
165 170 175
Leu Ser Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Met Ser
180 185 190
Pro Ala Gly Glu Ser Leu Asn His Glu His Ser Arg Thr Val Ser Val
195 200 205
Tyr Glu Gln Gly Lys Asp Val Asn Leu Phe Gln Pro Ala Ser Glu Phe
210 215 220
Leu Pro Met Ile Asp Lys Val Leu Cys Ser Leu Ile Glu Ser Thr Lys
225 230 235 240
Asp Ile Lys Gly Val Lys Val Glu Asp Asn Lys Phe Cys Ile Ser Val
245 250 255
His Tyr Arg Asn Val Glu Glu Lys Asn Trp Thr Leu Val Ala Gln Cys
260 265 270
Val Asp Asp Val Ile Arg Thr Tyr Pro Lys Leu Arg Leu Thr His Gly
275 280 285
Arg Lys Val Leu Glu Ile Arg Pro Val Ile Asp Trp Asp Lys Gly Lys
290 295 300
Ala Val Thr Phe Leu Leu Glu Ser Leu Gly Leu Asn Asn Cys Glu Asp
305 310 315 320
Val Leu Pro Ile Tyr Val Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe
325 330 335
Lys Val Leu Arg Asp Gly Pro Asn His Gly Tyr Gly Ile Leu Val Ser
340 345 350
Ala Val Pro Lys Asp Ser Asn Ala Phe Tyr Ser Leu Arg Asp Pro Ser
355 360 365
Glu Val Met Glu Phe Leu Lys Ser Leu Val Thr Trp Lys Arg Ser Met
370 375 380
Gly
385
<210>27
<211>1530
<212>DNA
＜213〉Arabidopis thaliana
<400>27
gaacacttca aaaaacatag caacttcact tcttcctcct ccttcctagt ttctcgtttg 60
gtctcattct ctttaattac ctcctcctct gttctgctca tcccctgttt ttatagtttt 120
atataaaatg gtgagccaaa acgtcgtcgt atcagacgcc aagaccggga tcataacggt 180
ctctacagtc tctaactcct ctgtctttac tcctaccgct caaaaaccac cgactgctcc 240
tggttacatc tcagtttcca agaaaaaact cctcaaaaac cttgaaatca atggagctga 300
tcaaagtcaa agacttaact cttgggttga ctccatgaga gcttcttctc ctacccatct 360
caaatcactt tcctctttct cttccgaaga agaacacaat tcttggatca aacgacatcc 420
atcagcactt aacatgttcg aacgaatcat cgaagaagca agaggaaaac aaatcgtcat 480
gtttcttgat tatgacggta ctctttctcc gatcgtggat gatccagaca gagctttcat 540
gactagcaag atgagaagaa cagtgaaaaa aatggctaag tgttttccaa cttccatagt 600
tactggtaga tgcatcgaca aggtttatag ctttgtgaag ctagcagaac tgtattatgc 660
tggaagccat gggatggata ttaaaggccc aactaaaggt ttctcaagat acaataagga 720
taaaccatcc gttctttacc aaccagccgg cgactttctt cccatgatcg atgaggttta 780
taaacaatta gtggagaaaa ccaaatctac accaggagcc aaagtggaga acaacaagtt 840
ctgtctttct gtgcacttcc gttgtgttga cgagaagaaa tggagcgagc tggcttcaaa 900
agttcggtcg gtggtaaaga actatccgac gttgaaactg tctcaaggtc gaaaggtttt 960
tgaaatccga cctataatta aatggaacaa aggcaaggct cttgagtttt tgttagagtc 1020
actcggattt gaaaactgta acgatgtatt tccaatttac attggtgatg ataaaaccga 1080
tgaagatgca tttaagctac tacgagggag aggacaaggc tttggtattc ttgtctccaa 1140
gttccccaaa gacaccagtg cgtcgtattc tttacaagac ccacctgagg tgatgaattt 1200
cttgggacgg ttggtggagt ggaaacagat gcagcaataa acgtgcaagg ggcaatgaag 1260
tacatttagt agtcttttta ataaaacgag aatattcata actataggtg catatataga 1320
tataatatgt acatccctaa cctataatgg aacattgtac aagatcctct tatagattga 1380
tcttgttcat cacaaatctt ttcttttagt aaaagagatt atatgaacaa gaaaaatggg 1440
gaacttttat cgatttgggg atatattatt atagccttct atctttattg cttgtaggca 1500
atttcttact tttcaagtta ggctattgta 1530
<210>28
<211>370
<212>PRT
＜213〉Arabidopis thaliana
<400>28
Met Val Ser Gln Asn Val Val Val Ser Asp Ala Lys Thr Gly Ile Ile
1 5 10 15
Thr Val Ser Thr Val Ser Asn Ser Ser Val Phe Thr Pro Thr Ala Gln
20 25 30
Lys Pro Pro Thr Ala Pro Gly Tyr Ile Ser Val Ser Lys Lys Lys Leu
35 40 45
Leu Lys Asn Leu Glu Ile Asn Gly Ala Asp Gln Ser Gln Arg Leu Asn
50 55 60
Ser Trp Val Asp Ser Met Arg Ala Ser Ser Pro Thr His Leu Lys Ser
65 70 75 80
Leu Ser Ser Phe Ser Ser Glu Glu Glu His Asn Ser Trp Ile Lys Arg
85 90 95
His Pro Ser Ala Leu Asn Met Phe Glu Arg Ile Ile Glu Glu Ala Arg
100 105 110
Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro
115 120 125
Ile Val Asp Asp Pro Asp Arg Ala Phe Met Thr Ser Lys Met Arg Arg
130 135 140
Thr Val Lys Lys Met Ala Lys Cys Phe Pro Thr Ser Ile Val Thr Gly
145 150 155 160
Arg Cys Ile Asp Lys Val Tyr Ser Phe Val Lys Leu Ala Glu Leu Tyr
165 170 175
Tyr Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro Thr Lys Gly Phe
180 185 190
Ser Arg Tyr Asn Lys Asp Lys Pro Ser Val Leu Tyr Gln Pro Ala Gly
195 200 205
Asp Phe Leu Pro Met Ile Asp Glu Val Tyr Lys Gln Leu Val Glu Lys
210 215 220
Thr Lys Ser Thr Pro Gly Ala Lys Val Glu Asn Asn Lys Phe Cys Leu
225 230 235 240
Ser Val His Phe Arg Cys Val Asp Glu Lys Lys Trp Ser Glu Leu Ala
245 250 255
Ser Lys Val Arg Ser Val Val Lys Asn Tyr Pro Thr Leu Lys Leu Ser
260 265 270
Gln Gly Arg Lys Val Phe Glu Ile Arg Pro Ile Ile Lys Trp Asn Lys
275 280 285
Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly Phe Glu Asn Cys
290 295 300
Asn Asp Val Phe Pro Ile Tyr Ile Gly Asp Asp Lys Thr Asp Glu Asp
305 310 315 320
Ala Phe Lys Leu Leu Arg Gly Arg Gly Gln Gly Phe Gly Ile Leu Val
325 330 335
Ser Lys Phe Pro Lys Asp Thr Ser Ala Ser Tyr Ser Leu Gln Asp Pro
340 345 350
Pro Glu Val Met Asn Phe Leu Gly Arg Leu Val Glu Trp Lys Gln Met
355 360 365
Gln Gln
370
<210>29
<211>1178
4212>DNA
＜213〉comospore poplar (Populus trichocarpa)
<400>29
atatgcagag tttagtttac acaagcggag atgacaaacc agaatgtggt tgtgcctgat 60
gccaaacagg gtattgatat caccatcgca atggtgctgc ccaagtctct gttttcacct 120
gttgtgccaa agccattgcc tgccgctcct ggtgggtatt tcacaataac ccgaaagagg 180
ttctcgaaga agacagaaac tggaggcaaa atcagttcct gggttgattc tatgagggat 240
tcttcaccta cccgtgtcaa atccaccact tctttatcag aaactgaaga gaaaaattct 300
tggattgtaa accatccttc tgctctgaac atgtttgagc aaatagtgaa aggctcaaag 360
ggaaagcaga ttgtgatgtt ccttgattat gatggtacac tgtcacccat tgttgaagat 420
cctgacagag cattcatgac caatgagatg agagaagctg tcagggacgt tgctagatac 480
tttcccacgg ctatagtgac gggaaggtgt agaaaaaagg tgtatagctt tgtaagattg 540
gcagggcttt attatgctgg tagccatggc atggacatca agggaccatc caaaaataat 600
tgcaaatacg aaaaaggtgg tgtactcttt caacctgcca gtgaattttt acccatgatt 660
gatgaggtgt acaatgtctt gttggagaga acaaaatcta tcccaggagc taaagtagaa 720
aacaacaaat tttgcgtatc cgtacacttt cgatgtgttg aggaaaagat gtgggctata 780
ttagtagagc aagtccgatc agttctcaat gattatccca agcttagatt aactcaaggg 840
aggaaggttt tagagatccg acccaccatt aaatgggaca agggcaaagc tcttgaattc 900
ttgttagagt cattaggata tgccaattct actgacgttt ttccggtcta tattggagat 960
gatcgaactg atgaggacgc attcaaggtt ctaagaaaca gggggcaagg gcttgggatt 1020
cttgtttcta aagttcccaa ggaaacaaat gcctcttatt ctctacagga accaaaagag 1080
gcaagttctt taatgtaaca agcaagttgt tatactttta tttgtggtaa taattattgt 1140
taaattttca gttttgcaag ttcgactaat aaatcata 1178
<210>30
<211>355
<212>PRT
＜213〉comospore poplar
<400>30
Met Thr Asn Gln Asn Val Val Val Pro Asp Ala Lys Gln Gly Ile Asp
1 5 10 15
Ile Thr Ile Ala Met Val Leu Pro Lys Ser Leu Phe Ser Pro Val Val
20 25 30
Pro Lys Pro Leu Pro Ala Ala Pro Gly Gly Tyr Phe Thr Ile Thr Arg
35 40 45
Lys Arg Phe Ser Lys Lys Thr Glu Thr Gly Gly Lys Ile Ser Ser Trp
50 55 60
Val Asp Ser Met Arg Asp Ser Ser Pro Thr Arg Val Lys Ser Thr Thr
65 70 75 80
Ser Leu Ser Glu Thr Glu Glu Lys Asn Ser Trp Ile Val Asn His Pro
85 90 95
Ser Ala Leu Asn Met Phe Glu Gln Ile Val Lys Gly Ser Lys Gly Lys
100 105 110
Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val
115 120 125
Glu Asp Pro Asp Arg Ala Phe Met Thr Asn Glu Met Arg Glu Ala Val
130 135 140
Arg Asp Val Ala Arg Tyr Phe Pro Thr Ala Ile Val Thr Gly Arg Cys
145 150 155 160
Arg Lys Lys Val Tyr Ser Phe Val Arg Leu Ala Gly Leu Tyr Tyr Ala
165 170 175
Gly Ser His Gly Met Asp Ile Lys Gly Pro Ser Lys Asn Asn Cys Lys
180 185 190
Tyr Glu Lys Gly Gly Val Leu Phe Gln Pro Ala Ser Glu Phe Leu Pro
195 200 205
Met Ile Asp Glu Val Tyr Asn Val Leu Leu Glu Arg Thr Lys Ser Ile
210 215 220
Pro Gly Ala Lys Val Glu Asn Asn Lys Phe Cys Val Ser Val His Phe
225 230 235 240
Arg Cys Val Glu Glu Lys Met Trp Ala Ile Leu Val Glu Gln Val Arg
245 250 255
Ser Val Leu Asn Asp Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys
260 265 270
Val Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu
275 280 285
Glu Phe Leu Leu Glu Ser Leu Gly Tyr Ala Asn Ser Thr Asp Val Phe
290 295 300
Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val
305 310 315 320
Leu Arg Asn Arg Gly Gln Gly Leu Gly Ile Leu Val Ser Lys Val Pro
325 330 335
Lys Glu Thr Asn Ala Ser Tyr Ser Leu Gln Glu Pro Lys Glu Ala Ser
340 345 350
Ser Leu Met
355
<210>31
<211>1184
<212>DNA
＜213〉comospore poplar
<400>31
gtgtgcagag tttagtttat acaaacagag atgacaaacc agaatgtggt tgtgcctaat 60
gccagaaaag gtgttgatat caccatcaca atggccctgt ccaagtctct gttttcacct 120
gttgtgccga agccattgcc agctgctcct ggtgggtatt tcacaatatc ccggaagatg 180
ttcgcaaaga agactgaaac tggaggcaaa accaattcct gggctgattc tatgagagat 240
tcttcaccta cccgtgtcaa atccactacg tctttatcag aaatcgagga gaaaaatact 300
tggattgtaa atcatccttc tgctttgaac atgttcgagc aaatagtgaa tggctcaaag 360
ggaaaacaga ttgtaatgtt tttagattat gatggtacac tgtcacccat tgttgaagat 420
cctgacaggg cattcatgac caacgagatg agagaagctg ttagggacgt cgctagatac 480
tttcccactg ctatagtgac gggaaggtgt agggataagg tgtacagctt cgtaagattg 540
gcagggcttt attacgctgg tagccatggc atggacatca agggaccatc caagaattgt 600
tgcagaaaca aaaaagatta tcaaggtgta ctttttcaac ctgccagtga ttttttaccc 660
atgattgatg aggtgtacaa tgctttgctg gagagaacaa agtatatccc aggggctaga 720
gtagaagaca acaaattttg catatccgta cactttcgtt gtgtcgagga aaagatgtgg 780
gctgcattag tagagcaagt aagatcagtt ctcaatggtt atccaaaact tcgattaact 840
caagggagga aggttttaga gatccgaccc accattaaat gggacaaggg caaagctctt 900
gagttcgtgt tggaatcatt aggatatgcc aattctactg atgttttacc agtttatatt 960
ggagatgatc gaactgatga ggatgcattc aaggttctaa gaaacagggg acaagggctt 1020
gggattcttg tttctaaagt tcccaaggaa acaaatgcct cgtattctct acaagagcca 1080
acagaggcaa gttctttaat ctaacaagca aaggggttat gattaatttc tggtgctaat 1140
tatggttgat tttcaatctt acaagatgga ctgatgaatt atgt 1184
<210>32
<211>357
<212>PRT
＜213〉comospore poplar
<400>32
Met Thr Asn Gln Asn Val Val Val Pro Asn Ala Arg Lys Gly Val Asp
1 5 10 15
Ile Thr Ile Thr Met Ala Leu Ser Lys Ser Leu Phe Ser Pro Val Val
20 25 30
Pro Lys Pro Leu Pro Ala Ala Pro Gly Gly Tyr Phe Thr Ile Ser Arg
35 40 45
Lys Met Phe Ala Lys Lys Thr Glu Thr Gly Gly Lys Thr Asn Ser Trp
50 55 60
Ala Asp Ser Met Arg Asp Ser Ser Pro Thr Arg Val Lys Ser Thr Thr
65 70 75 80
Ser Leu Ser Glu Ile Glu Glu Lys Asn Thr Trp Ile Val Asn His Pro
85 90 95
Ser Ala Leu Asn Met Phe Glu Gln Ile Val Asn Gly Ser Lys Gly Lys
100 105 110
Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val
115 120 125
Glu Asp Pro Asp Arg Ala Phe Met Thr Asn Glu Met Arg Glu Ala Val
130 135 140
Arg Asp Val Ala Arg Tyr Phe Pro Thr Ala Ile Val Thr Gly Arg Cys
145 150 155 160
Arg Asp Lys Val Tyr Ser Phe Val Arg Leu Ala Gly Leu Tyr Tyr Ala
165 170 175
Gly Ser His Gly Met Asp Ile Lys Gly Pro Ser Lys Asn Cys Cys Arg
180 185 190
Asn Lys Lys Asp Tyr Gln Gly Val Leu Phe Gln Pro Ala Ser Asp Phe
195 200 205
Leu Pro Met Ile Asp Glu Val Tyr Asn Ala Leu Leu Glu Arg Thr Lys
210 215 220
Tyr Ile Pro Gly Ala Arg Val Glu Asp Asn Lys Phe Cys Ile Ser Val
225 230 235 240
His Phe Arg Cys Val Glu Glu Lys Met Trp Ala Ala Leu Val Glu Gln
245 250 255
Val Arg Ser Val Leu Asn Gly Tyr Pro Lys Leu Arg Leu Thr Gln Gly
260 265 270
Arg Lys Val Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys
275 280 285
Ala Leu Glu Phe Val Leu Glu Ser Leu Gly Tyr Ala Asn Ser Thr Asp
290 295 300
Val Leu Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe
305 310 315 320
Lys Val Leu Arg Asn Arg Gly Gln Gly Leu Gly Ile Leu Val Ser Lys
325 330 335
Val Pro Lys Glu Thr Asn Ala Ser Tyr Ser Leu Gln Glu Pro Thr Glu
340 345 350
Ala Ser Ser Leu Ile
355
<210>33
<211>1337
<212>DNA
＜213〉comospore poplar
<400>33
attttggttt ttgttttttc tagtggaaag atgacaaacc aaaatgtggt agtggctgat 60
acaaactctg gactcaactt ggcaatcaca gtgcatgtaa caaactcctc tatcttcaca 120
acggcggccc agaaacctcc agcggcacca ggtggttaca tatccatttc tagaaagaaa 180
ctcttaaaga atctggaaat caatggagga gcaagaatta atgcttgggt tgattccatg 240
agagcctcat ctcctactca tatcaagtcc acgccttctg ttaatgaaga ccaaagctca 300
tggattcttc accacccatc agcactggag atgtttgagc agataattga tgcctctaaa 360
ggaaagcaaa ttgttatgtt cttggactat gatggcacac tttctcctat tgttgatgac 420
ccagataaag ctttcatgtc caagcaggtg atgagagcaa cagtgagaaa gcttgcaaga 480
tttttcccta ctgcaatagt gagtgggagg tgcagagaca aggtgtataa ctttgtacgg 540
ttagcagaac tgtactatgc tggaagccat ggcatggaca ttaaaggacc agcaaaaggc 600
tccaaataca agaaagtgag tgagctttac cactgtattt gcaagtacca tccaggcggt 660
gatggtgttg tctttcaggc tgccagtgaa tttcttccca tgatagatga ggtttacgaa 720
gaattggtag agaaaactaa aacaactcca ggggccaagg tggagaacaa caaattctgc 780
ctctctgtgc actatcgctg cgttgatgag aaaaaatgga gtggactggc acaagtagtt 840
aagtcagtgt tgaaggagta cccaaagctt cgacttactc aaggaagaaa ggttttagaa 900
atccgcccta ccattaaatg ggacaaagga aaggctcttg aatttttgtt agagtcactt 960
ggattcgcca attgcactga tgtttttcct gtttacattg gagatgatag aacagacgaa 1020
gatgcattta aggtactaag agagagagga caaggttttg gtatcttggt ctctaaaatc 1080
ccaaaggaca ctagtgcatc ttattcccta caggaaccca cccaggcaag ttatggattt 1140
cttgcgacgt ttggtggagt ggaaacggct ggcctttcaa gggcggtcaa gggtggtgta 1200
aagagtagtg ggaagattga gacagtacag atatacccac cccttcaaga aatgtaatta 1260
agggtgggat gttagactat gtgatcatct cttgttcaag attaaaaagt atgaacaaga 1320
aaagtaggga aatataa 1337
<210>34
<211>408
<212>PRT
＜213〉comospore poplar
<400>34
Met Thr Asn Gln Asn Val Val Val Ala Asp Thr Asn Ser Gly Leu Asn
1 5 10 15
Leu Ala Ile Thr Val His Val Thr Asn Ser Ser Ile Phe Thr Thr Ala
20 25 30
Ala Gln Lys Pro Pro Ala Ala Pro Gly Gly Tyr Ile Ser Ile Ser Arg
35 40 45
Lys Lys Leu Leu Lys Asn Leu Glu Ile Asn Gly Gly Ala Arg Ile Asn
50 55 60
Ala Trp Val Asp Ser Met Arg Ala Ser Ser Pro Thr His Ile Lys Ser
65 70 75 80
Thr Pro Ser Val Asn Glu Asp Gln Ser Ser Trp Ile Leu His His Pro
85 90 95
Ser Ala Leu Glu Met Phe Glu Gln Ile Ile Asp Ala Ser Lys Gly Lys
100 105 110
Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val
115 120 125
Asp Asp Pro Asp Lys Ala Phe Met Ser Lys Gln Val Met Arg Ala Thr
130 135 140
Val Arg Lys Leu Ala Arg Phe Phe Pro Thr Ala Ile Val Ser Gly Arg
145 150 155 160
Cys Arg Asp Lys Val Tyr Asn Phe Val Arg Leu Ala Glu Leu Tyr Tyr
165 170 175
Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro Ala Lys Gly Ser Lys
180 185 190
Tyr Lys Lys Val Ser Glu Leu Tyr His Cys Ile Cys Lys Tyr His Pro
195 200 205
Gly Gly Asp Gly Val Val Phe Gln Ala Ala Ser Glu Phe Leu Pro Met
210 215 220
Ile Asp Glu Val Tyr Glu Glu Leu Val Glu Lys Thr Lys Thr Thr Pro
225 230 235 240
Gly Ala Lys Val Glu Asn Asn Lys Phe Cys Leu Ser Val His Tyr Arg
245 250 255
Cys Val Asp Glu Lys Lys Trp Ser Gly Leu Ala Gln Val Val Lys Ser
260 265 270
Val Leu Lys Glu Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys Val
275 280 285
Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu
290 295 300
Phe Leu Leu Glu Ser Leu Gly Phe Ala Asn Cys Thr Asp Val Phe Pro
305 310 315 320
Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu
325 330 335
Arg Glu Arg Gly Gln Gly Phe Gly Ile Leu Val Ser Lys Ile Pro Lys
340 345 350
Asp Thr Ser Ala Ser Tyr Ser Leu Gln Glu Pro Thr Gln Ala Ser Tyr
355 360 365
Gly Phe Leu Ala Thr Phe Gly Gly Val Glu Thr Ala Gly Leu Ser Arg
370 375 380
Ala Val Lys Gly Gly Val Lys Ser Ser Gly Lys Ile Glu Thr Val Gln
385 390 395 400
Ile Tyr Pro Pro Leu Gln Glu Met
405
<210>35
<211>1253
<212>DNA
＜213〉comospore poplar
<400>35
tcacaagtac taccaagtaa tttggctacc atggatatcg agtcaaacca ttcttctcct 60
gttctcactg atcctgctcc aataaacaag tcaaggctcg gcatccattc taatttgttg 120
tcttacgcac catcgggagg atcactctcc tctagcaagt atagaaacgt taacattcct 180
agaaaaaagc ctgggaaact tgatgaagtc tgctcgaacg catgtctgga tgccatgaaa 240
tcctcatcac cccctcgcaa gaagctcatt aaggatggtg ctgacacagc ttacggcacc 300
tggatgctca agcatccatc agcactcaac tcatttgagg aaattgcaaa ttttgccaaa 360
aacaaaaaga tagcaatgtt tctagactac gatggtactc tctctccaat agtagatgac 420
ccagataatg cccttatgtc tgatgatatg cgttttgcag taagaaactt cgcaaaatat 480
ttcccaacgg cgattattag tggaagaagt cgtgacaagg tttatcagct tgtaggacta 540
acagaattgt attatgctgg tagtcatggg atggacatct tgggccctgt acgaaaagcg 600
gtgtccaatg accatccaaa ctgtaatgaa tcaactactg accaacaggg caaggaggtg 660
aatctgtttc agcctgctag agaatttata cctctgatcg atgaggtttt tagaaccctt 720
gtcgaggata ctaaggggat caaaggtgca aaagttgaga atcataaatt ttgcgtctct 780
gtacatttcc gtaatgtaga tgagaagaac tggcaatcta ttgcacaatg tgttcaggat 840
attttagata agtatcctcg tttgcgaaaa actcatggac ggaaggtttt agaggtccgt 900
ccaatgattg actggaataa aggaaaagca gttgaatttt tgcttgaatc tctaggtcta 960
agtaatagag atgatgtact cccaatttat attggtgatg atctgacaga tgaagatgca 1020
ttcaaggtgc tccgggaggg gaatcgaggc tgtggaattt tggtgtcatc tagacccaaa 1080
gaaaccaatg cagtttactc tctcagagat ccatcggagg tgatgaaatt tctcaattcc 1140
ctggtgacat ggaagaaggt ggatgcatcc tgaataatag gaggaacatc tgatgacatg 1200
cagagataat ttagaaattt gattttgaat attttataga tattttgcaa aat 1253
<210>36
<211>380
<212>PRT
＜213〉comospore poplar
<400>36
Met Asp Ile Glu Ser Asn His Ser Ser Pro Val Leu Thr Asp Pro Ala
1 5 10 15
Pro Ile Asn Lys Ser Arg Leu Gly Ile His Ser Asn Leu Leu Ser Tyr
20 25 30
Ala Pro Ser Gly Gly Ser Leu Ser Ser Ser Lys Tyr Arg Asn Val Asn
35 40 45
Ile Pro Arg Lys Lys Pro Gly Lys Leu Asp Glu Val Cys Ser Asn Ala
50 55 60
Cys Leu Asp Ala Met Lys Ser Ser Ser Pro Pro Arg Lys Lys Leu Ile
65 70 75 80
Lys Asp Gly Ala Asp Thr Ala Tyr Gly Thr Trp Met Leu Lys His Pro
85 90 95
Ser Ala Leu Asn Ser Phe Glu Glu Ile Ala Asn Phe Ala Lys Asn Lys
100 105 110
Lys Ile Ala Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val
115 120 125
Asp Asp Pro Asp Asn Ala Leu Met Ser Asp Asp Met Arg Phe Ala Val
130 135 140
Arg Asn Phe Ala Lys Tyr Phe Pro Thr Ala Ile Ile Ser Gly Arg Ser
145 150 155 160
Arg Asp Lys Val Tyr Gln Leu Val Gly Leu Thr Glu Leu Tyr Tyr Ala
165 170 175
Gly Ser His Gly Met Asp Ile Leu Gly Pro Val Arg Lys Ala Val Ser
180 185 190
Asn Asp His Pro Asn Cys Asn Glu Ser Thr Thr Asp Gln Gln Gly Lys
195 200 205
Glu Val Asn Leu Phe Gln Pro Ala Arg Glu Phe Ile Pro Leu Ile Asp
210 215 220
Glu Val Phe Arg Thr Leu Val Glu Asp Thr Lys Gly Ile Lys Gly Ala
225 230 235 240
Lys Val Glu Asn His Lys Phe Cys Val Ser Val His Phe Arg Asn Val
245 250 255
Asp Glu Lys Asn Trp Gln Ser Ile Ala Gln Cys Val Gln Asp Ile Leu
260 265 270
Asp Lys Tyr Pro Arg Leu Arg Lys Thr His Gly Arg Lys Val Leu Glu
275 280 285
Val Arg Pro Met Ile Asp Trp Asn Lys Gly Lys Ala Val Glu Phe Leu
290 295 300
Leu Glu Ser Leu Gly Leu Ser Asn Arg Asp Asp Val Leu Pro Ile Tyr
305 310 315 320
Ile Gly Asp Asp Leu Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Glu
325 330 335
Gly Asn Arg Gly Cys Gly Ile Leu Val Ser Ser Arg Pro Lys Glu Thr
340 345 350
Asn Ala Val Tyr Ser Leu Arg Asp Pro Ser Glu Val Met Lys Phe Leu
355 360 365
Asn Ser Leu Val Thr Trp Lys Lys Val Asp Ala Ser
370 375 380
<210>37
<211>1271
<212>DNA
＜213〉comospore poplar
<400>37
aacaactctg ctgcaagtaa tttggctacg atggatgtcg agtcaaatca ttcttctcct 60
gttctcgctg accctgcatc gataaacagt tcaaggctcg gtatctattc taatctgttg 120
ccttactcac caccaggagg atcactctcc tctagcaagt atagtaggaa aaagccaggg 180
aagcttgacg aagtctgctc gagtggatgg ctggatgcca tgaaatcttc atcaccccct 240
cggaagaagc tctttaagga tggttctgac accgcttaca gttcctggat gttcaagcat 300
ccatcagcac tcaattcatt tgaggaaatt gcaaattttg ctaaaaacaa gaagatagca 360
atgtttctag actatgatgg gactctttct ccaattgtag atgacccgga taatgcgttt 420
atgtctgatg atatgcgttc tattgtaaaa aacgttgcga agtatttccc aacggcgatt 480
attagtggaa gaagtcgtga caaggtttat cagctggtag gactaacaga actatattat 540
gctggtagtc atgggatgga cattttgggc cctgtaggaa aagcttcaat gtccaatgat 600
catccaaact atagtgaatc tactactgac caacagggca aggaggtgaa tctgttccag 660
cctgctagag aatttatacc tatgatcgat gaggttttta gaacccttgt cgagaatact 720
aagggaatcg agggtgcaaa agtcgagaat cacaaatttt gtgcctctgt gcatttccga 780
aatgtagatg aggagaactg gcaacctatt gcacaatgtg ttcaggatat tctagataag 840
taccctcgtt tgcggagaac tcatggacgg aaggttttag aggtccgtcc aatgattgac 900
tggaataaag ggaaggcagt tgaattcctg cttgaatctc tagggctaag taacagagac 960
gacgtgctct caatttatat cggcgatgat ctgtcagatg aggatgcgtt caaggtgctc 1020
cgggagggga atcgaggtta tggaattctc gtatcatcta gacccaaaga aaccagtgca 1080
gtttactctc tcaaagatcc aattgaggtg atgaaatttc ttaactcctt ggtgacatgg 1140
aagaaggtag aagaaggtgg atgcatcctg aataacagga ggactatctg atgacatgca 1200
tatagcttag gtttttgatt tcgagcattt taattattga tattacataa taaagaggct 1260
gttggtacag c 1271
<210>38
<211>386
<212>PRT
＜213〉comospore poplar
<400>38
Met Asp Val Glu Ser Asn His Ser Ser Pro Val Leu Ala Asp Pro Ala
1 5 10 15
Ser Ile Asn Ser Ser Arg Leu Gly Ile Tyr Ser Asn Leu Leu Pro Tyr
20 25 30
Ser Pro Pro Gly Gly Ser Leu Ser Ser Ser Lys Tyr Ser Arg Lys Lys
35 40 45
Pro Gly Lys Leu Asp Glu Val Cys Ser Ser Gly Trp Leu Asp Ala Met
50 55 60
Lys Ser Ser Ser Pro Pro Arg Lys Lys Leu Phe Lys Asp Gly Ser Asp
65 70 75 80
Thr Ala Tyr Ser Ser Trp Met Phe Lys His Pro Ser Ala Leu Asn Ser
85 90 95
Phe Glu Glu Ile Ala Asn Phe Ala Lys Asn Lys Lys Ile Ala Met Phe
100 105 110
Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Asn
115 120 125
Ala Phe Met Ser Asp Asp Met Arg Ser Ile Val Lys Asn Val Ala Lys
130 135 140
Tyr Phe Pro Thr Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr
145 150 155 160
Gln Leu Val Gly Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met
165 170 175
Asp Ile Leu Gly Pro Val Gly Lys Ala Ser Met Ser Asn Asp His Pro
180 185 190
Asn Tyr Ser Glu Ser Thr Thr Asp Gln Gln Gly Lys Glu Val Asn Leu
195 200 205
Phe Gln Pro Ala Arg Glu Phe Ile Pro Met Ile Asp Glu Val Phe Arg
210 215 220
Thr Leu Val Glu Asn Thr Lys Gly Ile Glu Gly Ala Lys Val Glu Asn
225 230 235 240
His Lys Phe Cys Ala Ser Val His Phe Arg Asn Val Asp Glu Glu Asn
245 250 255
Trp Gln Pro Ile Ala Gln Cys Val Gln Asp Ile Leu Asp Lys Tyr Pro
260 265 270
Arg Leu Arg Arg Thr His Gly Arg Lys Val Leu Glu Val Arg Pro Met
275 280 285
Ile Asp Trp Asn Lys Gly Lys Ala Val Glu Phe Leu Leu Glu Ser Leu
290 295 300
Gly Leu Ser Asn Arg Asp Asp Val Leu Ser Ile Tyr Ile Gly Asp Asp
305 310 315 320
Leu Ser Asp Glu Asp Ala Phe Lys Val Leu Arg Glu Gly Asn Arg Gly
325 330 335
Tyr Gly Ile Leu Val Ser Ser Arg Pro Lys Glu Thr Ser Ala Val Tyr
340 345 350
Ser Leu Lys Asp Pro Ile Glu Val Met Lys Phe Leu Asn Ser Leu Val
355 360 365
Thr Trp Lys Lys Val Glu Glu Gly Gly Cys Ile Leu Asn Asn Arg Arg
370 375 380
Thr Ile
385
<210>39
<211>1307
<212>DNA
＜213〉comospore poplar
<400>39
ggtttttttt tttttttttg tagaggaaag atgacaaacc aaaatgtggt agtggctgat 60
acaaactctg gaatcaactt ggcaatcaca gtgcatgtaa caaattcctc tatcttcacc 120
acggccgcgc agaagcctcc ggcggctcct ggtggttaca tctctatttc cagaaagaaa 180
cttttaaaga atcttgaaat cagtggagga gcaagattta atgcttgggt taattccatg 240
agaacctctt ctcctactca tgtcaagtcc acaccttctg ctaatgacga ccaaagctca 300
tggattcttc accacccatc agcactggag atgtttgagc agataattga tgcctccaaa 360
ggaaagcaaa tagttatgtt cttggactat gatggcacac tttctcctat cgttgatgac 420
ccagatagag ctttcatgtc caagaaggtt gatgagagca acagtgagaa agcttgcgag 480
attttttcct actgcaatag tgagtgggag atgcagagac aagcagaact gtactatgct 540
ggaagccatg gcatggacat caaaggacca gccaaaggca gcaaatacaa gaaaggcagt 600
gaaggtgttg tttttcaagc tggcagtgag tttcttccaa tgatagatga ggtttacaaa 660
gaactggtag agaaaactaa aacaactcca ggggccaagg tggaaaataa caaattctgt 720
ctctctgtgc actatcgctg cgttgatgag aagaaatgga gtggactggc tcaagtagtt 780
aagtcagtgt tgaaggagta cccaaagctt cgacttactc aaggaagaaa ggttttagaa 840
atccgcccta ccattaaatg ggacaaagga aaggctcttg aatttttgtt agagtctctt 900
ggattcgcca attgtactga tgtttttcct gtttacattg gagatgatag aacagacgag 960
gatgcattta aggtgctgag agagagagga caaggttttg gtatcttggt ctctaaattc 1020
cccaaggaca ctagtgcatc ttattcccta caagaaccca cccaggcaag tagtatccaa 1080
tacatgcata attgctgtca tggatttttt gcaacgtttg gtgcagtgga aacggctagc 1140
ctttcaaggg cagtcaaggg tttaagatgg agtaggaaaa tcgaaacagt atatatatat 1200
atatacccac cccttcaaga aatgtaatta agggtgggat cgatgttaga ccacgtaatt 1260
tcttgttcag gttaaaaaaa tatgaacaag aaaataggaa gggaaaa 1307
<210>40
<211>398
<212>PRT
＜213〉comospore poplar
<400>40
Met Thr Asn Gln Asn Val Val Val Ala Asp Thr Asn Ser Gly Ile Asn
1 5 10 15
Leu Ala Ile Thr Val His Val Thr Asn Ser Ser Ile Phe Thr Thr Ala
20 25 30
Ala Gln Lys Pro Pro Ala Ala Pro Gly Gly Tyr Ile Ser Ile Ser Arg
35 40 45
Lys Lys Leu Leu Lys Asn Leu Glu Ile Ser Gly Gly Ala Arg Phe Asn
50 55 60
Ala Trp Val Asn Ser Met Arg Thr Ser Ser Pro Thr His Val Lys Ser
65 70 75 80
Thr Pro Ser Ala Asn Asp Asp Gln Ser Ser Trp Ile Leu His His Pro
85 90 95
Ser Ala Leu Glu Met Phe Glu Gln Ile Ile Asp Ala Ser Lys Gly Lys
100 105 110
Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val
115 120 125
Asp Asp Pro Asp Arg Ala Phe Met Ser Lys Lys Val Asp Glu Ser Asn
130 135 140
Ser Glu Lys Ala Cys Glu Ile Phe Ser Tyr Cys Asn Ser Glu Trp Glu
145 150 155 160
Met Gln Arg Gln Ala Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp
165 170 175
Ile Lys Gly Pro Ala Lys Gly Ser Lys Tyr Lys Lys Gly Ser Glu Gly
180 185 190
Val Val Phe Gln Ala Gly Ser Glu Phe Leu Pro Met Ile Asp Glu Val
195 200 205
Tyr Lys Glu Leu Val Glu Lys Thr Lys Thr Thr Pro Gly Ala Lys Val
210 215 220
Glu Asn Asn Lys Phe Cys Leu Ser Val His Tyr Arg Cys Val Asp Glu
225 230 235 240
Lys Lys Trp Ser Gly Leu Ala Gln Val Val Lys Ser Val Leu Lys Glu
245 250 255
Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys Val Leu Glu Ile Arg
260 265 270
Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu Glu
275 280 285
Ser Leu Gly Phe Ala Asn Cys Thr Asp Val Phe Pro Val Tyr Ile Gly
290 295 300
Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Glu Arg Gly
305 310 315 320
Gln Gly Phe Gly Ile Leu Val Ser Lys Phe Pro Lys Asp Thr Ser Ala
325 330 335
Ser Tyr Ser Leu Gln Glu Pro Thr Gln Ala Ser Ser Ile Gln Tyr Met
340 345 350
His Asn Cys Cys His Gly Phe Phe Ala Thr Phe Gly Ala Val Glu Thr
355 360 365
Ala Ser Leu Ser Arg Ala Val Lys Gly Leu Arg Trp Ser Arg Lys Ile
370 375 380
Glu Thr Val Tyr Ile Tyr Ile Tyr Pro Pro Leu Gln Glu Met
385 390 395
<210>41
<211>1274
<212>DNA
＜213〉comospore poplar
<400>41
ataaaaaata ctcttacgaa tctgaatccg atggacctca aatcaaatca taatgctcct 60
gtgctcactg attctgctcc cctaagcaag tcaaggctac gcgggtacca ccatggtttg 120
atgctgccgt actcaccctc aggtgcacct ttctcgtcaa atctattact atctattcct 180
aggaggaaaa ctggagtgct tgatgatgtt cgctcctgtg gttggctgga tgccatgaaa 240
tcatcatctc ctactcataa gaagtttgcc aaggatatta accatgagct ttccgcacct 300
gatccagaag ttgcctatcg cacctggctg cttaaatatc catctgcgct tgcatctttc 360
gagcaaattg caaactttgc aaaaggcaag agaatcgcct tatttctgga ttatgatggt 420
actctttcac caattgttga aaatcctgac aatgccttca tgtctgctga tatgcgttcc 480
attgtaaagg aagtggcaaa atatttccca acagcaataa tcagtggaag aagccgtgac 540
aaggtgtatg agtttgtagg gcttacagaa ctctactatg cgggtagtca tggtatggat 600
atcatgggcc ctgtcaggca atctgtatct gacgaccacc gaaattgtat caagtctacg 660
gacaagcagg gcaacgaagt taacttattc cagcctgcaa gagaattttt acctatgatt 720
gacgaggttt atagttccct tgtcaggatt accgaagata ttaaaggggc aacagttgag 780
aacaataaat tctgtgtctc tgtacattac cgtaacgttg atcaagataa ctggaaatca 840
gttggggagc gtgtccagga tgtcataaag aagtatcctc gcctgcgatt gactcatggg 900
aggaaggttt tagaaatccg tcccgcgatc aattgggaca aggggaaagc tcttgaattt 960
ctacttgaat cactagatct cagcaattgt gatgatgtgc tgccgattta tgttggagat 1020
gaccggacag atgaagatgc atttaaggtt ttgagagaga ggaactgtgg ttatggcatt 1080
tttgtatcaa aatcaccgaa ggaaagcaat gcgtattact ctctcagaga cccagcagag 1140
gtcatggagt ttctcaagtc cctggtgaca tggaagaaat cgagtgcttt ataaatgtta 1200
caaggaatta cataaagagg agaatactat aacatacaca gacaacatga aaggcatttt 1260
atattcttaa gttc 1274
<210>42
<211>387
<212>PRT
＜213〉comospore poplar
<400>42
Met Asp Leu Lys Ser Asn His Asn Ala Pro Val Leu Thr Asp Ser Ala
1 5 10 15
Pro Leu Ser Lys Ser Arg Leu Arg Gly Tyr His His Gly Leu Met Leu
20 25 30
Pro Tyr Ser Pro Ser Gly Ala Pro Phe Ser Ser Asn Leu Leu Leu Ser
35 40 45
Ile Pro Arg Arg Lys Thr Gly Val Leu Asp Asp Val Arg Ser Cys Gly
50 55 60
Trp Leu Asp Ala Met Lys Ser Ser Ser Pro Thr His Lys Lys Phe Ala
65 70 75 80
Lys Asp Ile Asn His Glu Leu Ser Ala Pro Asp Pro Glu Val Ala Tyr
85 90 95
Arg Thr Trp Leu Leu Lys Tyr Pro Ser Ala Leu Ala Ser Phe Glu Gln
100 105 110
Ile Ala Asn Phe Ala Lys Gly Lys Arg Ile Ala Leu Phe Leu Asp Tyr
115 120 125
Asp Gly Thr Leu Ser Pro Ile Val Glu Asn Pro Asp Asn Ala Phe Met
130 135 140
Ser Ala Asp Met Arg Ser Ile Val Lys Glu Val Ala Lys Tyr Phe Pro
145 150 155 160
Thr Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr Glu Phe Val
165 170 175
Gly Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Met
180 185 190
Gly Pro Val Arg Gln Ser Val Ser Asp Asp His Arg Asn Cys Ile Lys
195 200 205
Ser Thr Asp Lys Gln Gly Asn Glu Val Asn Leu Phe Gln Pro Ala Arg
210 215 220
Glu Phe Leu Pro Met Ile Asp Glu Val Tyr Ser Ser Leu Val Arg Ile
225 230 235 240
Thr Glu Asp Ile Lys Gly Ala Thr Val Glu Asn Asn Lys Phe Cys Val
245 250 255
Ser Val His Tyr Arg Asn Val Asp Gln Asp Asn Trp Lys Ser Val Gly
260 265 270
Glu Arg Val Gln Asp Val Ile Lys Lys Tyr Pro Arg Leu Arg Leu Thr
275 280 285
His Gly Arg Lys Val Leu Glu Ile Arg Pro Ala Ile Asn Trp Asp Lys
290 295 300
Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Asp Leu Ser Asn Cys
305 310 315 320
Asp Asp Val Leu Pro Ile Tyr Val Gly Asp Asp Arg Thr Asp Glu Asp
325 330 335
Ala Phe Lys Val Leu Arg Glu Arg Asn Cys Gly Tyr Gly Ile Phe Val
340 345 350
Ser Lys Ser Pro Lys Glu Ser Asn Ala Tyr Tyr Ser Leu Arg Asp Pro
355 360 365
Ala Glu Val Met Glu Phe Leu Lys Ser Leu Val Thr Trp Lys Lys Ser
370 375 380
Ser Ala Leu
385
<210>43
<211>1271
<212>DNA
＜213〉comospore poplar
<400>43
tatcttacga atctggatca tctggatccg atggacctca aatcaaatca cagtgctcct 60
gtgctcactg attctgcacc cctaggcaag tcaagactag gtgggcatca tggtttgttc 120
ccatgctcac cctcaggcgg tgcagctttt tcgccgaatc tatggttatc tattcctaag 180
aagaaaactg gagttcttga tgatgttcgc tccattggtt ggctggacgc aatgaaatca 240
tcatctcctc ctcacaagaa gtttaacaag gatattaaca tggagctttc ctcgcctgat 300
ccggaagctg cctaccgcac ttggcttctt aaatatccat ctgctcttgc atcttttgag 360
caaattgcaa actttgcaaa aggcaagaga atcgccttgt tcctggatta tgatggtact 420
ctatcgccga ttgtagaaaa tcccgacaat gccctcatgt ctgatgttat gcgttctgct 480
gtaaagaaag tggcaaaata tttccccaca gcaataatta gtggaagaag ccgtgacaag 540
gtatacgagt ttgtaggact cacagaactc tattatgcgg gtagccatgg aatggatatt 600
gtgggccctg ttaggcactc cacatctgat gatcacccaa attgtatcga gtctacggac 660
atgcagggaa atgaagttaa tttattccag ccagctagag aatttttacc tatgatcgac 720
gaggttttta gctcccttct caagagtacc gaagaaatta aaggtgcaac agttgagaac 780
aataaattct gtgtctctgt acattaccga aatgttgatg aagataaatg gaaagcagtt 840
tgggagtgtg tcgaagatgt cattaagaag taccctcgcc tgcgattgac ttttgggagg 900
aaggttttag aaattcgtcc cacgatcaat tgggacaagg ggaaagctct tgtgtttcta 960
cttgaatcac taggtctcag caattgtgat gatgtgctcc ctatttatgt tggagatgac 1020
cggacagatg aagatgcatt taagattttg agagagagga actgtggtta tgggattctg 1080
gtatcaaaat cacccaagga aagcaatgca tattactctc tcagggaccc atccgaggtc 1140
atggagtttc tcaagtccct tgtgatgtgg aagaagtcga gtgctcaata aatgctacaa 1200
ggaatacaca aggaagagga gaatactcta atatacacat acaacatgaa agactttata 1260
tgtttttttc t 1271
<210>44
<211>386
<212>PRT
＜213〉comospore poplar
<400>44
Met Asp Leu Lys Ser Asn His Ser Ala Pro Val Leu Thr Asp Ser Ala
1 5 10 15
Pro Leu Gly Lys Ser Arg Leu Gly Gly His His Gly Leu Phe Pro Cys
20 25 30
Ser Pro Ser Gly Gly Ala Ala Phe Ser Pro Asn Leu Trp Leu Ser Ile
35 40 45
Pro Lys Lys Lys Thr Gly Val Leu Asp Asp Val Arg Ser Ile Gly Trp
50 55 60
Leu Asp Ala Met Lys Ser Ser Ser Pro Pro His Lys Lys Phe Asn Lys
65 70 75 80
Asp Ile Asn Met Glu Leu Ser Ser Pro Asp Pro Glu Ala Ala Tyr Arg
85 90 95
Thr Trp Leu Leu Lys Tyr Pro Ser Ala Leu Ala Ser Phe Glu Gln Ile
100 105 110
Ala Asn Phe Ala Lys Gly Lys Arg Ile Ala Leu Phe Leu Asp Tyr Asp
115 120 125
Gly Thr Leu Ser Pro Ile Val Glu Asn Pro Asp Asn Ala Leu Met Ser
130 135 140
Asp Val Met Arg Ser Ala Val Lys Lys Val Ala Lys Tyr Phe Pro Thr
145 150 155 160
Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr Glu Phe Val Gly
165 170 175
Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Val Gly
180 185 190
Pro Val Arg His Ser Thr Ser Asp Asp His Pro Asn Cys Ile Glu Ser
195 200 205
Thr Asp Met Gln Gly Asn Glu Val Asn Leu Phe Gln Pro Ala Arg Glu
210 215 220
Phe Leu Pro Met Ile Asp Glu Val Phe Ser Ser Leu Leu Lys Ser Thr
225 230 235 240
Glu Glu Ile Lys Gly Ala Thr Val Glu Asn Asn Lys Phe Cys Val Ser
245 250 255
Val His Tyr Arg Asn Val Asp Glu Asp Lys Trp Lys Ala Val Trp Glu
260 265 270
Cys Val Glu Asp Val Ile Lys Lys Tyr Pro Arg Leu Arg Leu Thr Phe
275 280 285
Gly Arg Lys Val Leu Glu Ile Arg Pro Thr Ile Asn Trp Asp Lys Gly
290 295 300
Lys Ala Leu Val Phe Leu Leu Glu Ser Leu Gly Leu Ser Asn Cys Asp
305 310 315 320
Asp Val Leu Pro Ile Tyr Val Gly Asp Asp Arg Thr Asp Glu Asp Ala
325 330 335
Phe Lys Ile Leu Arg Glu Arg Asn Cys Gly Tyr Gly Ile Leu Val Ser
340 345 350
Lys Ser Pro Lys Glu Ser Asn Ala Tyr Tyr Ser Leu Arg Asp Pro Ser
355 360 365
Glu Val Met Glu Phe Leu Lys Ser Leu Val Met Trp Lys Lys Ser Ser
370 375 380
Ala Gln
385
<2lO>45
<211>1768
<212>DNA
＜213〉rice (Oryza sativa)
<400>45
agcactccat cttcctccat ctgcgtattt tccaacacat ctctcttgca gttcgtttca 60
agtctttcat taagtaaaac tttctgaaca tttgaagtgc aacggagctg gcgttttatg 120
gcttttccta tgaagcaatc cacatctctg atatagatgt gtactcgttc tgaacatgac 180
aagttctcag gtatttctct gttgatgaac tgcctccaca cctgcagtga caagaagaca 240
ctgaagaagt ggtttttcat cgacaagaca gttggctaaa ttcagcagtg cactcgtcct 300
taaagcgatc gatcatactt ctttcttgat ctcatcatcc taaattttcc caaatggatt 360
tgagcaatag ctcacctgtc atcaccgatc cggtggcgat cagccagcag ttgttgggcg 420
gcctgccttc aaatctgatg cagttttcag tcatgcccgg tggctactcc agctctggca 480
tgaacgttgg tgtcagtagg ctcaaaatcg aggaagtcct tgtcaatgga ctgcttgatg 540
ccatgaaatc ctcgtcacct cgcaggaggc tgaatgtagc atttggcgag gacaattcat 600
ctgaagaaga agaccctgct tacagcgctt ggatggcaaa atgtccttct gctttggctt 660
ccttcaagca aattgtagcc agtgcacaag ggaagaagat tgctgtgttt ctagactatg 720
acggcacact gtcgcctatt gtggatgatc ctgacaaagc agtgatgtct cccgtgatga 780
gagctgctgt gagaaatgtt gcgaagtact tccccactgc aattgtcagc ggaaggtccc 840
gcaataaggt gtttgaattt gtaaaactga aggagcttta ttatgctgga agccatggta 900
tggacataat ggcaccttca gcaaatcatg agcacagtgc tgaaaagagc aaacaggcca 960
atctcttcca acctgcacac gactttctgc caatgatcga tgaggttacc aagtccctct 1020
tgcaagttgt cagtggaatt gaaggtgcaa ctgttgagaa caacaaattc tgcgtttctg 1080
tacattatcg caacgttgca gagaaggatt ggaaactggt cgcacggctc gtaaacgaag 1140
tgctggaggc ttttcctcgt ctcaaagtaa ccaatggacg aatggtttta gaggttcgtc 1200
cggtgatcga ctgggacaag ggaaaggctg tggagtttct gctccagtca ctcgggctaa 1260
atgactctga aaatgtgatc cccatctaca ttggagacga cagaactgac gaagacgctt 1320
tcaaggtact tcgacagcga aattgcggtt atggaatact agtttcacag gttcccaagg 1380
aaactgaagc cttctactcg ctgagagatc catctgaagt gatggagttc ctcaatttct 1440
tggtgagatg gaagaagcac tcagtgtgaa aaaaagaaga cagtctgagc aggttttact 1500
aatactactc cggcagaaat aactgtagtt tccgaggcga caattttgaa gcattggacg 1560
ctgtagatag atgtaataac tctctagata tgtggttcca attcattctt attgatcgat 1620
gttattgtat tgttcatgtt ctccaccgct gagaaaaatt aatcagtgat ggttgatccg 1680
gtctcttgcc attgtaagtt gtaagcaaga aggccctctt cttagtatcc atgctgatga 1740
acgaaattaa aaccttcatt tttcgtgt 1768
<210>46
<211>371
<212>PRT
＜213〉rice
<400>46
Met Asp Leu Ser Asn Ser Ser Pro Val Ile Thr Asp Pro Val Ala Ile
1 5 10 15
Ser Gln Gln Leu Leu Gly Gly Leu Pro Ser Asn Leu Met Gln Phe Ser
20 25 30
Val Met Pro Gly Gly Tyr Ser Ser Ser Gly Met Asn Val Gly Val Ser
35 40 45
Arg Leu Lys Ile Glu Glu Val Leu Val Asn Gly Leu Leu Asp Ala Met
50 55 60
Lys Ser Ser Ser Pro Arg Arg Arg Leu Asn Val Ala Phe Gly Glu Asp
65 70 75 80
Asn Ser Ser Glu Glu Glu Asp Pro Ala Tyr Ser Ala Trp Met Ala Lys
85 90 95
Cys Pro Ser Ala Leu Ala Ser Phe Lys Gln Ile Val Ala Ser Ala Gln
100 105 110
Gly Lys Lys Ile Ala Val Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro
115 120 125
Ile Val Asp Asp Pro Asp Lys Ala Val Met Ser Pro Val Met Arg Ala
130 135 140
Ala Val Arg Asn Val Ala Lys Tyr Phe Pro Thr Ala Ile Val Ser Gly
145 150 155 160
Arg Ser Arg Asn Lys Val Phe Glu Phe Val Lys Leu Lys Glu Leu Tyr
165 170 175
Tyr Ala Gly Ser His Gly Met Asp Ile Met Ala Pro Ser Ala Asn His
180 185 190
Glu His Ser Ala Glu Lys Ser Lys Gln Ala Asn Leu Phe Gln Pro Ala
195 200 205
His Asp Phe Leu Pro Met Ile Asp Glu Val Thr Lys Ser Leu Leu Gln
210 215 220
Val Val Ser Gly Ile Glu Gly Ala Thr Val Glu Asn Asn Lys Phe Cys
225 230 235 240
Val Ser Val His Tyr Arg Asn Val Ala Glu Lys Asp Trp Lys Leu Val
245 250 255
Ala Arg Leu Val Asn Glu Val Leu Glu Ala Phe Pro Arg Leu Lys Val
260 265 270
Thr Asn Gly Arg Met Val Leu Glu Val Arg Pro Val Ile Asp Trp Asp
275 280 285
Lys Gly Lys Ala Val Glu Phe Leu Leu Gln Ser Leu Gly Leu Asn Asp
290 295 300
Ser Glu Asn Val Ile Pro Ile Tyr Ile Gly Asp Asp Arg Thr Asp Glu
305 310 315 320
Asp Ala Phe Lys Val Leu Arg Gln Arg Asn Cys Gly Tyr Gly Ile Leu
325 330 335
Val Ser Gln Val Pro Lys Glu Thr Glu Ala Phe Tyr Ser Leu Arg Asp
340 345 350
Pro Ser Glu Val Met Glu Phe Leu Asn Phe Leu Val Arg Trp Lys Lys
355 360 365
His Ser Val
370
<210>47
<211>1423
<212>DNA
＜213〉rice
<400>47
ctctcaaact ctcggagaag cgagcacaca cactcactcc ctgtctcctc ctcctcctcc 60
tcccttgagg ctgttcgtct cgacgagtgc ttggctttgt gtttgtggtg tgtgatcatg 120
acgaaccagg acgtggtggt ttctgagatg ggcatcgcgg caggcgcggc gctgccggga 180
ggaccggccg gcccggcggg cggcctcttc gcgtgccgca gcgcggccgc gtcgatgagg 240
cagacgtacc tcgacctcgc cgcggcggcg gtggcggcgc gctccgcgag ctgcaccagc 300
tgggccgacg ccatgcgcgc ctcctccccc acccgctcgt cccgctccgc ctccgacgtc 360
gacgagttca ccgcctgggt gaggaagcac ccgtcggcgc ttagcaagtt cgaggagatc 420
gccgccaagt ccagggggaa gaagatcgta atgttcatgg actacgacgg cacgctctct 480
cccatcgtcg ccgaccccga cacggcctac atgagcgacg cgatgagggc ggcggtgcgc 540
gaagtcgcca agaccttccc gacggcgatc gtcagcgggc ggtgccgcga caaggttcgc 600
aacttcgtcg gcctctccga cctctactac gccggcagcc atggcatgga catcaaggga 660
ccaagctcca acccggagtc tgccctttgc cagccagcaa gcgagttcct ccccatgatc 720
gacgaggtgt acaagacgct ggtggaaaag acgaaatcta cacctggagc caaggtggag 780
aacaacaagt tctgcctgtc cgtccacttc agatgtgtag atgaaaagag atggaatgct 840
ttgggggagc aggtcaaggc cgtgatcaag gaatacccaa agttgaagct tacccaagga 900
aggaaggttt tggagatcag gccgagcatt gagtgggaca agggcaaggc tctggagttc 960
ttgcttgaat cgctgggatt cgccaactgc ggcgacgtca tgccggtgta catcggtgac 1020
gaccgcaccg acgaggacgc cttcaaggtg ttgagaaaga gaggtcaggg cctgggaatc 1080
ctagtctcca agtgccccaa ggacaccaac gcctcctact ctctccagga cccaacagag 1140
gtgatggagt tcttgctcag gctggtggag tggaagcgga agtcgtcgtc gtcgtcgttg 1200
atgattcgtc cgagagtgta gcggcgacac ggtgtagagg ccgtaagaaa ctgaaactaa 1260
gatggtcaat catgcgaaca tgcgaacata ccccaccaac accacgtact acccccattt 1320
ttttccgatg atttctgtgg ttggcctctg cgacggactc gtggtggtta cacgctagct 1380
gttcgattcc gtcccctgtg ccgccgagga aaaggagacc acc 1423
<210>48
<211>367
<212>PRT
＜213〉rice
<400>48
Met Thr Asn Gln Asp Val Val Val Ser Glu Met Gly Ile Ala Ala Gly
1 5 10 15
Ala Ala Leu Pro Gly Gly Pro Ala Gly Pro Ala Gly Gly Leu Phe Ala
20 25 30
Cys Arg Ser Ala Ala Ala Ser Met Arg Gln Thr Tyr Leu Asp Leu Ala
35 40 45
Ala Ala Ala Val Ala Ala Arg Ser Ala Ser Cys Thr Ser Trp Ala Asp
50 55 60
Ala Met Arg Ala Ser Ser Pro Thr Arg Ser Ser Arg Ser Ala Ser Asp
65 70 75 80
Val Asp Glu Phe Thr Ala Trp Val Arg Lys His Pro Ser Ala Leu Ser
85 90 95
Lys Phe Glu Glu Ile Ala Ala Lys Ser Arg Gly Lys Lys Ile Val Met
100 105 110
Phe Met Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Ala Asp Pro Asp
115 120 125
Thr Ala Tyr Met Ser Asp Ala Met Arg Ala Ala Val Arg Glu Val Ala
130 135 140
Lys Thr Phe Pro Thr Ala Ile Val Ser Gly Arg Cys Arg Asp Lys Val
145 150 155 160
Arg Asn Phe Val Gly Leu Ser Asp Leu Tyr Tyr Ala Gly Ser His Gly
165 170 175
Met Asp Ile Lys Gly Pro Ser Ser Asn Pro Glu Ser Ala Leu Cys Gln
180 185 190
Pro Ala Ser Glu Phe Leu Pro Met Ile Asp Glu Val Tyr Lys Thr Leu
195 200 205
Val Glu Lys Thr Lys Ser Thr Pro Gly Ala Lys Val Glu Asn Asn Lys
210 215 220
Phe Cys Leu Ser Val His Phe Arg Cys Val Asp Glu Lys Arg Trp Asn
225 230 235 240
Ala Leu Gly Glu Gln Val Lys Ala Val Ile Lys Glu Tyr Pro Lys Leu
245 250 255
Lys Leu Thr Gln Gly Arg Lys Val Leu Glu Ile Arg Pro Ser Ile Glu
260 265 270
Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly Phe
275 280 285
Ala Asn Cys Gly Asp Val Met Pro Val Tyr Ile Gly Asp Asp Arg Thr
290 295 300
Asp Glu Asp Ala Phe Lys Val Leu Arg Lys Arg Gly Gln Gly Leu Gly
305 310 315 320
Ile Leu Val Ser Lys Cys Pro Lys Asp Thr Asn Ala Ser Tyr Ser Leu
325 330 335
Gln Asp Pro Thr Glu Val Met Glu Phe Leu Leu Arg Leu Val Glu Trp
340 345 350
Lys Arg Lys Ser Ser Ser Ser Ser Leu Met Ile Arg Pro Arg Val
355 360 365
<210>49
<211>1511
<212>DNA
＜213〉rice
<400>49
cacaaccaaa tcaacaacca cgccattgcc gttctctcct cctttccttc cacaacccat 60
ctcttcctca tcctcctcct cctcttcctg ctgctctctc gctctcgttg gattcggttt 120
ggtttggttt gggccatgac gaagcacggc gcggtggttg tcccggtcgc cgccgccgcc 180
gccgacgcgg agcacgacga gtggatggag aagcacccgt cggcattggg gaagttcgag 240
gcgctggcgg cggcggcgaa ggggaagcgg atcgtcgtct tcctcgacta cgacggcacg 300
ctgtcgccga tcgtcgagga ccccgaccgc gccgtcatga cggacgagat gagggacgcc 360
gtgcgcggcg tggcggcgcg attcccaacg gcgatcgtca gcggccgctg cagagacaag 420
gtgttgagct tcgtggggct ggaggagctc tactacgcgg gtagccacgg gatggacatc 480
caagggccca ccaacgccgc cgcctccaag ggaggagagg aggaggagga gtcggtgctg 540
tgccagccgg cgagggagtt cctgccgatg atcggggagg cgtacgcggc gctggtggag 600
aaggtggagg gggtgatccc gggggcgaag gtggagaaca acaagttctg cctctccgtc 660
cacttccgcc gcgtcgacga gcgccggtgg ggcgccgtcg ccgaccaggt cagggcggtg 720
ctccggggct acccgcgcct ccgcctcacg cagggccgca aggtgctcga ggtcaggccc 780
gccatcaagt gggacaaggg cgaggccctc cgcttcctcc tctccgccct cggcttctcc 840
gccgccggag acgtagaaga cgacggcgac gacgacgacg cgttccccat ctacatcggc 900
gacgaccgca ccgacgagga cgcgttccgg gtgctccgag cgagggggca cggcgccggc 960
atcctggtgt cgaggttccc caaggacacc tgcgcctcct tctccctccg cgaccccggc 1020
gaggtcaagg acttcctccg caagctcgtc acctgcgctg ccgcatgacg tcaccttcac 1080
ctgaccacag tgacactaat tggcttcctc ctcctccacg ggaaagagaa agagagagag 1140
agaaataatt aaggatcttg attagtcaat tagcggttac taatccctgt attaatttta 1200
gccggtcact tcatttcttc ttcttctttt tttatgtgtt tctgttcttg ctctgcggct 1260
gccatcttga ttgatcgatc gatctcacag gccacagtgt gacagctcga tctgaaggtt 1320
tctctattat ccttaacctt cctccagctg atccaaggcc ttgtaattag tcgtcaattt 1380
ttagcagttt gttgtctgtc tgtctgtcac tgaaacggga cgaattaatc cgaattaata 1440
cgatccattt ccacctaatt tcagtttgta ctgtaccgtt taatttccat ctaaattcag 1500
ctttgcactg t 1511
<210>50
<211>310
<212>PRT
＜213〉rice
<400>50
Met Thr Lys His Gly Ala Val Val Val Pro Val Ala Ala Ala Ala Ala
1 5 10 15
Asp Ala Glu His Asp Glu Trp Met Glu Lys His Pro Ser Ala Leu Gly
20 25 30
Lys Phe Glu Ala Leu Ala Ala Ala Ala Lys Gly Lys Arg Ile Val Val
35 40 45
Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Glu Asp Pro Asp
50 55 60
Arg Ala Val Met Thr Asp Glu Met Arg Asp Ala Val Arg Gly Val Ala
65 70 75 80
Ala Arg Phe Pro Thr Ala Ile Val Ser Gly Arg Cys Arg Asp Lys Val
85 90 95
Leu Ser Phe Val Gly Leu Glu Glu Leu Tyr Tyr Ala Gly Ser His Gly
100 105 110
Met Asp Ile Gln Gly Pro Thr Asn Ala Ala Ala Ser Lys Gly Gly Glu
115 120 125
Glu Glu Glu Glu Ser Val Leu Cys Gln Pro Ala Arg Glu Phe Leu Pro
130 135 140
Met Ile Gly Glu Ala Tyr Ala Ala Leu Val Glu Lys Val Glu Gly Val
145 150 155 160
Ile Pro Gly Ala Lys Val Glu Asn Asn Lys Phe Cys Leu Ser Val His
165 170 175
Phe Arg Arg Val Asp Glu Arg Arg Trp Gly Ala Val Ala Asp Gln Val
180 185 190
Arg Ala Val Leu Arg Gly Tyr Pro Arg Leu Arg Leu Thr Gln Gly Arg
195 200 205
Lys Val Leu Glu Val Arg Pro Ala Ile Lys Trp Asp Lys Gly Glu Ala
210 215 220
Leu Arg Phe Leu Leu Ser Ala Leu Gly Phe Ser Ala Ala Gly Asp Val
225 230 235 240
Glu Asp Asp Gly Asp Asp Asp Asp Ala Phe Pro Ile Tyr Ile Gly Asp
245 250 255
Asp Arg Thr Asp Glu Asp Ala Phe Arg Val Leu Arg Ala Arg Gly His
260 265 270
Gly Ala Gly Ile Leu Val Ser Arg Phe Pro Lys Asp Thr Cys Ala Ser
275 280 285
Phe Ser Leu Arg Asp Pro Gly Glu Val Lys Asp Phe Leu Arg Lys Leu
290 295 300
Val Thr Cys Ala Ala Ala
305 310
<21O>51
<211>1791
<212>DNA
＜213〉rice
<400>51
atgacgaacc aggacgtggt gatgccggac atcgcggcgg ccgcggccat gccggggtca 60
tccggccgcg cgccgctctt cgcgtgccgt ggcgccgcgg ccgtgtcggc gtcctccatg 120
ctcggcggcg gcggcgcggc gtaccaggcc gcggtggtgg cgcacgtggc gccggtgcca 180
gctatcaggc cgtgcgccag ctgggtcgtc gaggccatgc gcgcgtcgtc gccgacacgg 240
cccgccgccg ccgcggtcga cgccgagtac gacgcgtgga cgcagaggaa gcacccgtcg 300
gcgctgggca gcttcgagca ggtggccgcg gcggcgagcg ggaagcgcgt cgtcgtgttc 360
ctcgactacg acggcaccct ctcccccatc gtcgccgacc ccgacatggc cttcatgtcc 420
gacgagatga gggcggccgt gcgcgacgtg gcggagcact tcccggcggc gatcgtgacc 480
gggcgctgcg tcgacaaggt gcagagcttc gtcggcctcc cggagctcta ctacgccggc 540
agccatggca tggacatcaa gggccccagc tccaacgagg aagaagacac caagatcctc 600
ttgcagccag ctcgcgagtt cctcccggtg atcaacaagg cttacaaggc tttgatggag 660
aagacgaaga gcacgcctgg ggccagagtg gagaacaaca agttctgcct ctccgtgcac 720
ttcagatgcg tcgatgagaa gagatggaat ccgttggcag agcaagtgaa ggccgtgctc 780
cgggactacc ccgagctcaa actcacccaa ggaagaaagg tcctggagat ccggccgtcg 840
atcatgtggg acaagggcaa ggcggtggag ttcttgctga aatctctcgg attcgacgac 900
gaccgccgcg acgtcctgcc ggtgtacatc ggagacgacc ggaccgacga agatgctttc 960
aaggtgttga gaaagagagg tcaagggttg ggaattcttg tctccaagtg tgccaaggag 1020
actgacgcct cgtactctct ccaggaccca gcagagaagt acaccaacgc cggggcgcac 1080
gtgttcgtga cgatgctcct gaccgtggtg ttcacggcag ctgtggcgtt ggctcttgtc 1140
aacgccgtca actcgcatga cttcgcagca cacctcgccg gcgtggactg ccgcatgggg 1200
ctagctggtc cagtacgatg cccagcctcg ggcttcgtgg agctcctcgt gctggcgcta 1260
catgtgatgc gtgctcgcca tcttagatcg cctgcatgcc tgcctaatgt cgccctcgct 1320
acagctttcg attgcatctc catgtacgtg cgccggtggc agcgcggcga agtgaccaat 1380
gtacatgaag tatacgtgct aagtaggatc gaatttgttc cttatatggc aagcaccggt 1440
gaacaaagaa gtactggcga gacggccgtc ggcgccgccg ccgccggaat gtatcggatg 1500
gtgcccttgc acgcggcaaa atggggagac aaatggagaa tgagtgggga aagaatggcc 1560
gccggagtag actgccggcg gcgcgaggat ttgccgagca gtggagatgg ctaccgtcag 1620
gaggagatcg acggtggtca tggagttcct tgttcgattg gtgcagtgga agcttcggcg 1680
atcatcgtca gcgatgcgcc cgagggttta attagtacac tgacgacgga tcatatatac 1740
tatatgacag tcttccctgc taagctagct ctgacttctg aagaagtttg a 1791
<210>52
<211>596
<212>PRT
＜213〉rice
<400>52
Met Thr Asn Gln Asp Val Val Met Pro Asp Ile Ala Ala Ala Ala Ala
1 5 10 15
Met Pro Gly Ser Ser Gly Arg Ala Pro Leu Phe Ala Cys Arg Gly Ala
20 25 30
Ala Ala Val Ser Ala Ser Ser Met Leu Gly Gly Gly Gly Ala Ala Tyr
35 40 45
Gln Ala Ala Val Val Ala His Val Ala Pro Val Pro Ala Ile Arg Pro
50 55 60
Cys Ala Ser Trp Val Val Glu Ala Met Arg Ala Ser Ser Pro Thr Arg
65 70 75 80
Pro Ala Ala Ala Ala Val Asp Ala Glu Tyr Asp Ala Trp Thr Gln Arg
85 90 95
Lys His Pro Ser Ala Leu Gly Ser Phe Glu Gln Val Ala Ala Ala Ala
100 105 110
Ser Gly Lys Arg Val Val Val Phe Leu Asp Tyr Asp Gly Thr Leu Ser
115 120 125
Pro Ile Val Ala Asp Pro Asp Met Ala Phe Met Ser Asp Glu Met Arg
130 135 140
Ala Ala Val Arg Asp Val Ala Glu His Phe Pro Ala Ala Ile Val Thr
145 150 155 160
Gly Arg Cys Val Asp Lys Val Gln Ser Phe Val Gly Leu Pro Glu Leu
165 170 175
Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro Ser Ser Asn
180 185 190
Glu Glu Glu Asp Thr Lys Ile Leu Leu Gln Pro Ala Arg Glu Phe Leu
195 200 205
Pro Val Ile Asn Lys Ala Tyr Lys Ala Leu Met Glu Lys Thr Lys Ser
210 215 220
Thr Pro Gly Ala Arg Val Glu Asn Asn Lys Phe Cys Leu Ser Val His
225 230 235 240
Phe Arg Cys Val Asp Glu Lys Arg Trp Asn Pro Leu Ala Glu Gln Val
245 250 255
Lys Ala Val Leu Arg Asp Tyr Pro Glu Leu Lys Leu Thr Gln Gly Arg
260 265 270
Lys Val Leu Glu Ile Arg Pro Ser Ile Met Trp Asp Lys Gly Lys Ala
275 280 285
Val Glu Phe Leu Leu Lys Ser Leu Gly Phe Asp Asp Asp Arg Arg Asp
290 295 300
Val Leu Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe
305 310 315 320
Lys Val Leu Arg Lys Arg Gly Gln Gly Leu Gly Ile Leu Val Ser Lys
325 330 335
Cys Ala Lys Glu Thr Asp Ala Ser Tyr Ser Leu Gln Asp Pro Ala Glu
340 345 350
Lys Tyr Thr Asn Ala Gly Ala His Val Phe Val Thr Met Leu Leu Thr
355 360 365
Val Val Phe Thr Ala Ala Val Ala Leu Ala Leu Val Asn Ala Val Asn
370 375 380
Ser His Asp Phe Ala Ala His Leu Ala Gly Val Asp Cys Arg Met Gly
385 390 395 400
Leu Ala Gly Pro Val Arg Cys Pro Ala Ser Gly Phe Val Glu Leu Leu
405 410 415
Val Leu Ala Leu His Val Met Arg Ala Arg His Leu Arg Ser Pro Ala
420 425 430
Cys Leu Pro Asn Val Ala Leu Ala Thr Ala Phe Asp Cys Ile Ser Met
435 440 445
Tyr Val Arg Arg Trp Gln Arg Gly Glu Val Thr Asn Val His Glu Val
450 455 460
Tyr Val Leu Ser Arg Ile Glu Phe Val Pro Tyr Met Ala Ser Thr Gly
465 470 475 480
Glu Gln Arg Ser Thr Gly Glu Thr Ala Val Gly Ala Ala Ala Ala Gly
485 490 495
Met Tyr Arg Met Val Pro Leu His Ala Ala Lys Trp Gly Asp Lys Trp
500 505 510
Arg Met Ser Gly Glu Arg Met Ala Ala Gly Val Asp Cys Arg Arg Arg
515 520 525
Glu Asp Leu Pro Ser Ser Gly Asp Gly Tyr Arg Gln Glu Glu Ile Asp
530 535 540
Gly Gly His Gly Val Pro Cys Ser Ile Gly Ala Val Glu Ala Ser Ala
545 550 555 560
Ile Ile Val Ser Asp Ala Pro Glu Gly Leu Ile Ser Thr Leu Thr Thr
565 570 575
Asp His Ile Tyr Tyr Met Thr Val Phe Pro Ala Lys Leu Ala Leu Thr
580 585 590
Ser Glu Glu Val
595
<210>53
<211>3384
<212>DNA
＜213〉rice
<400>53
ggttgatcga ggtgagcgtt tcctgaccta cttgctcgga ttaattacaa attgatttga 60
tcacgtagat aattacatca tcatcatatt gatggatgga tgcttgcaca tatatgcatg 120
cgttttgaat ctggtgatgt aatgatatcc aattaataat cttgctgcaa cacgaaagct 180
cagccagttt aattgatttg atttagttaa tgccatcgat ctcaggcttg attatcgatt 240
ggctgttgaa tgcacggatt aatcaaatag gttgaaggca cgcaatgcaa aattccaaat 300
tgattgtgga cctcttcggt ttctccttgt ataagacctt gaatttagaa attattagtg 360
agctatcgaa agttttcagt ggcatcacat attatctgct tacttggaac atatagaaaa 420
atagaattat taattaataa attaattgta ttgagcatta tacttcctta gtctgagagt 480
atatagcatt gggcataaag ttagtattaa ctattcacca tgtaactagc ttcttagtaa 540
aggtacaaat taaggactga agagaaactc cagactttta atcttcaaac tgaaggcaag 600
taatacattt tcagcccttc catttagttc cttggaggat caaattcaaa tgttgcgacg 660
gatgaagacg cacgaaattt gatgctttta tcgcacgttc atgtagtatt tggtcaatcg 720
atctctgcat catgccttga ccaagatgca tatttagttt gatgatctct gttgcttcca 780
attgcactcc attaattgtt tgaactaata gtcgttttgc ttcatgtaat cgaatgcttc 840
ctgcgttcga ttggtgagag aagtgcactc caatgctgta ccaacagtac tcttgggttt 900
ttctcttagg agagctttat ttagagtgaa agggacttcc taattaagat ttctttattt 960
tgaaagaagc tagtaattaa gatttcttaa catatgcaca cgtgaagtta taaaacatga 1020
ctcaaatctg atgttgatgt gtgttcgacc aagtccctaa tcagtttttg cactttttct 1080
tctgatttct cacgccaact gatcaattaa ggcaagtagg attttagttg tgttcttttc 1140
ttattgtttt cctttctctt gcttttcgct ttctcacctc ctacctcctt ggagacagtc 1200
cacaattgtg aattttcaac attagaaaaa taatcacaat tttgtggaaa tgattgaaaa 1260
actaattaat aggttgcatt tcacatgaac atagttaatt agagaacaaa atgcatacac 1320
taggtgttag agcagtacaa aagttataga agatgtcact gcttactgca tgagtatctt 1380
tcttcacaat cccattccat cataaatatt gcctaaacaa ttccactcaa ccttgttgct 1440
tgttcaactt taattctttc ataacttgat atgaaggtca ggacaattac tgtagactag 1500
tttcttcatg gttgcacgct gaataatcgt acacagatgc ccttgctgtc tctgaattct 1560
caaacactga acatatattg tagaacattt tacacctatt cctgtctgat ctcttgctgt 1620
gtgtgtacgg agcatgctgc cgttcttccc aagactttgt gtctcaattg gttatttttg 1680
acttgaagcg atccgtttcg gtagtccctg aggcagctag cgtaagcctc ttttgacttc 1740
caagcacaca agttacttgc tgcctcagat tcatcagcaa gtcactagta cttttcggta 1800
tctagatgaa gcatatatat aaaccacaag aaaagcggct gcccatttgt gttctgatca 1860
tgaggagatt caggtggttt cttgaaagga tgtgaatctg tggttgcaag atactgaaga 1920
aagtaataag gtggttcttc aatcttcata ggcttcagag ttcagagttg agttaatgtt 1980
tttgcaaaca aggtgtctgc tgacagtttg acagtaaaaa gatctgtata tatgggttcc 2040
tgcggtaacg gtagaagctc tgaatatgat gatcctgcat cattagagaa gatggaggaa 2100
ctggttttac ctctgaaatt gatgccctta cacaccaatg gccggttgta tgacatgagg 2160
ttgtcctcac ctactgctac ctgtgtgatc aatagttcat ctggttcatt cgacccgatc 2220
taccgagctt ggacgaagaa gtatccttca gctctaaatg cctttgacca cattgttgcc 2280
tatggcaaag ggaagaagat agcgctgttt ttggactacg acggtacact gtcgccaatt 2340
gtcgatgaac ctgacaatgc tatcatgtct gaccagatgc gcgaggtggt gaggaatgct 2400
gccttgcatc tacccactgc gattatcagt ggaaggtctc gtgataaggt gtttgatttt 2460
gttaaactaa cagaattgta ctatgctggt agccatggaa tggacatcat gggtccagtt 2520
ggggaacatg attcagttac taaccatagg agctccatta actcaaatag aaagcagggc 2580
aagggagtga agatcttcca ggctggtact gaattcttac caatgatcaa tgaggttttt 2640
agattgctca tcgataagac aaaggcaatc gacggtgtga aaattgagaa caacaagttc 2700
tgtgtatcgg tgcactaccg caatgttgag gagaagaatt ggcaacttgt ttctcaatgc 2760
acaaatgatg tcctaaaagt ctaccctcgc ctccgattga ctcatggacg aaaagttttg 2820
gaaattcgtc cagtgataga ctggaacaag gggaaggctg tggagttctt gctggactcc 2880
ctagatctag ctagctgtaa aaatgttctc cctatttaca tcggggatga ttgtaccgac 2940
gaggatgctt ttaaggttct tcgtgacgat aaaaggggtt tcgggattct ggtgtcatct 3000
gtaccaaagg attctcatgc cctatattct ctgattgatc catctgaggt tatggaattc 3060
ttgaaaagac tagtgatgtg gaagaacgaa gaagcatcac ataataagta gattataaat 3120
atatctgatg tttactctag ggtagatttc tgaattctga caaagagaat aagcagaagg 3180
gcaacagaat taacttggac atagtggaca gttgtacatc atatagttaa tccattttct 3240
tagcctagca agtggcaaaa taaaagtaat tgccatgttg tacaagaatg cgaagcattc 3300
tgcacaagtc cagttctttg aataatggtc tcagttgtag aatggtgtaa cttgttaatg 3360
aactgtgata taaatttttg ggct 3384
<210>54
<211>359
<212>PRT
＜213〉rice
<400>54
Met Gly Ser Cys Gly Asn Gly Arg Ser Ser Glu Tyr Asp Asp Pro Ala
1 5 10 15
Ser Leu Glu Lys Met Glu Glu Leu Val Leu Pro Leu Lys Leu Met Pro
20 25 30
Leu His Thr Asn Gly Arg Leu Tyr Asp Met Arg Leu Ser Ser Pro Thr
35 40 45
Ala Thr Cys Val Ile Asn Ser Ser Ser Gly Ser Phe Asp Pro Ile Tyr
50 55 60
Arg Ala Trp Thr Lys Lys Tyr Pro Ser Ala Leu Asn Ala Phe Asp His
65 70 75 80
Ile Val Ala Tyr Gly Lys Gly Lys Lys Ile Ala Leu Phe Leu Asp Tyr
85 90 95
Asp Gly Thr Leu Ser Pro Ile Val Asp Glu Pro Asp Asn Ala Ile Met
100 105 110
Ser Asp Gln Met Arg Glu Val Val Arg Asn Ala Ala Leu His Leu Pro
115 120 125
Thr Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Phe Asp Phe Val
130 135 140
Lys Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Met
145 150 155 160
Gly Pro Val Gly Glu His Asp Ser Val Thr Asn His Arg Ser Ser Ile
165 170 175
Asn Ser Asn Arg Lys Gln Gly Lys Gly Val Lys Ile Phe Gln Ala Gly
180 185 190
Thr Glu Phe Leu Pro Met Ile Asn Glu Val Phe Arg Leu Leu Ile Asp
195 200 205
Lys Thr Lys Ala Ile Asp Gly Val Lys Ile Glu Asn Asn Lys Phe Cys
210 215 220
Val Ser Val His Tyr Arg Asn Val Glu Glu Lys Asn Trp Gln Leu Val
225 230 235 240
Ser Gln Cys Thr Asn Asp Val Leu Lys Val Tyr Pro Arg Leu Arg Leu
245 250 255
Thr His Gly Arg Lys Val Leu Glu Ile Arg Pro Val Ile Asp Trp Asn
260 265 270
Lys Gly Lys Ala Val Glu Phe Leu Leu Asp Ser Leu Asp Leu Ala Ser
275 280 285
Cys Lys Asn Val Leu Pro Ile Tyr Ile Gly Asp Asp Cys Thr Asp Glu
290 295 300
Asp Ala Phe Lys Val Leu Arg Asp Asp Lys Arg Gly Phe Gly Ile Leu
305 310 315 320
Val Ser Ser Val Pro Lys Asp Ser His Ala Leu Tyr Ser Leu Ile Asp
325 330 335
Pro Ser Glu Val Met Glu Phe Leu Lys Arg Leu Val Met Trp Lys Asn
340 345 350
Glu Glu Ala Ser His Asn Lys
355
<210>55
<211>1517
<212>DNA
＜213〉rice
<400>55
accttcccct gtcatctcct cctcctccac caccacctcg ccgtcgccgt caccgcgcca 60
ccgtctcctc gatctctcac tcccacagct cgctggttgc ttcggcttcc gctgctcggt 120
cgcggttgat tttgggggat gacgaaccac gccggcttcg ccgcggacga cgcggtcacc 180
gcggccgtgc cggtgcaggc ggcgcagggc gggcggcatt tcccgccgtt cctggcgccg 240
tcgtccaggc tcaccgactg caagaaggcg gcggcgcacg tggacctcgc cggcgcgggc 300
ggggtggcga cggtgcccgg atcttggccg cgccacgcca agcccgtctc cggcgccgag 360
ctcgacgact ggatggagaa gcacccgtcg gcattggcat ggttcgagtc cgtcgccgcc 420
gcggcgaagg gcaaggagat cgtcgtgttc ctcgactacg acggcaccct ctcccccatc 480
gtcgccgacc ccgaccgcgc cttcatgtcc gacgaaatga gagaggcggt gagaggcgtg 540
gcgaagcact tcccgacggc gatcgtgagc gggaggtgca tcgacaaggt gttcgacttt 600
gtgaagctgg aggagctgta ctacgccggg agccatggaa tggacatcag gggccccacc 660
gcggcagcgt cggagtacaa ccacaacatg aaggcaaagc agggtgatgc tgttactttc 720
cagccggccg ccgatttcct gcccgtcatc gaggaggtgt atcatgtgct gaaggagagg 780
atggcgagta taaggggttc gctggtggag aacaacaagt tttgcctttc cgtgcactac 840
cgctgcgtcg acgaggcgga atggggcgtg ctggacggca aggtgagggc ggtgatagag 900
ggctacccgg atctccgtct cagcaagggg agaaaggtgc tggagatccg ccctgtcatc 960
gactgggaca aaggctccgc actccagttc ctgctcaaat ctctcggtta tgaggggcgc 1020
aacaatgttt tcccgatata cattggagat gaccgcaccg acgaggatgc tttcaaggtg 1080
ttgcgcaaca tgggacaggg cataggaatc cttgtgacca aggtcccaaa ggagacagct 1140
gcatcctaca ctctgcgaga gccatccgag gtgaaggagt tcctgcgcaa gttggtgaag 1200
attaagatca acggggacaa agggctgatt ggcaagtagc tgatccaagg catatagcta 1260
gctagctagc tttttgttcc ttaatttgtc tctttccttt tggtccatta gaagaagaag 1320
aagaacaaca acaagagtta tatgcatgga tggtaactga tcatgcatga tcgatgcatg 1380
cggtggtgaa aacccgggct tttggctttg aaggtgtcta ttaccgtatc cttctggcca 1440
aggtcctgta attaaatttt gctgccgtga caacagaaat ctcagcaaga gggacacaag 1500
tgtggcccct tttcttt 1517
<210>56
<21l>366
<212>PRT
＜213〉rice
<400>56
Met Thr Asn His Ala Gly Phe Ala Ala Asp Asp Ala Val Thr Ala Ala
1 5 10 15
Val Pro Val Gln Ala Ala Gln Gly Gly Arg His Phe Pro Pro Phe Leu
20 25 30
Ala Pro Ser Ser Arg Leu Thr Asp Cys Lys Lys Ala Ala Ala His Val
35 40 45
Asp Leu Ala Gly Ala Gly Gly Val Ala Thr Val Pro Gly Ser Trp Pro
50 55 60
Arg His Ala Lys Pro Val Ser Gly Ala Glu Leu Asp Asp Trp Met Glu
65 70 75 80
Lys His Pro Ser Ala Leu Ala Trp Phe Glu Ser Val Ala Ala Ala Ala
85 90 95
Lys Gly Lys Glu Ile Val Val Phe Leu Asp Tyr Asp Gly Thr Leu Ser
100 105 110
Pro Ile Val Ala Asp Pro Asp Arg Ala Phe Met Ser Asp Glu Met Arg
115 120 125
Glu Ala Val Arg Gly Val Ala Lys His Phe Pro Thr Ala Ile Val Ser
130 135 140
Gly Arg Cys Ile Asp Lys Val Phe Asp Phe Val Lys Leu Glu Glu Leu
145 150 155 160
Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Arg Gly Pro Thr Ala Ala
165 170 175
Ala Ser Glu Tyr Asn His Asn Met Lys Ala Lys Gln Gly Asp Ala Val
180 185 190
Thr Phe Gln Pro Ala Ala Asp Phe Leu Pro Val Ile Glu Glu Val Tyr
195 200 205
His Val Leu Lys Glu Arg Met Ala Ser Ile Arg Gly Ser Leu Val Glu
210 215 220
Asn Asn Lys Phe Cys Leu Ser Val His Tyr Arg Cys Val Asp Glu Ala
225 230 235 240
Glu Trp Gly Val Leu Asp Gly Lys Val Arg Ala Val Ile Glu Gly Tyr
245 250 255
Pro Asp Leu Arg Leu Ser Lys Gly Arg Lys Val Leu Glu Ile Arg Pro
260 265 270
Val Ile Asp Trp Asp Lys Gly Ser Ala Leu Gln Phe Leu Leu Lys Ser
275 280 285
Leu Gly Tyr Glu Gly Arg Asn Asn Val Phe Pro Ile Tyr Ile Gly Asp
290 295 300
Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Asn Met Gly Gln
305 310 315 320
Gly Ile Gly Ile Leu Val Thr Lys Val Pro Lys Glu Thr Ala Ala Ser
325 330 335
Tyr Thr Leu Arg Glu Pro Ser Glu Val Lys Glu Phe Leu Arg Lys Leu
340 345 350
Val Lys Ile Lys Ile Asn Gly Asp Lys Gly Leu Ile Gly Lys
355 360 365
<210>57
<211>1395
<212>DNA
＜213〉rice
<400>57
atggcgaagg cgagcgtggt ggtgcctgag caggtgggcg cggcggcggc ggcgcaggtg 60
gggtgcccct gtccgggcac gacgctgttc ccgtacccgc cgccgcgcgc cgggatcgcc 120
gtgcggcgca agtgcctgca ggcggcgcag cagctggagc tcggcgccgg gctgcgcggc 180
ggctgggtgg agtccatgcg ggcgtcgtcg cccacccacg ccaaggccgc cgccgccctc 240
gccgccggcg tcgacgagga gcacgccgcc tggatggtcc gtttccgttc accgattgat 300
cgatgttcgt cgcgttcttg gcgcgcgcgc gctgacactg acatgaaccg tgcatttccg 360
ttcgtctttg tgcaggcgag gcacccgtcg gcgctgggcg agttcgagaa ggtggtggcg 420
gcgtcgaagg ggaagcagat cgtcatgttc ctcgactacg acggcaccct ctcccccatc 480
gtcgacgacc ccgacgccgc cttcatgagc gagacggtga gcttgagctc ccctcccctg 540
tcacctactc tgctcctcca ctcatcatca tctcacacct ctctccttcc tcatcagatg 600
cggatggccg tgcgcagcgt ggcgaagcac ttcccgacgg cgatcgtgag cgggcggtgc 660
cgcgacaagg tgttcgagtt cgtgaagctc gccgagctgt actacgcggg gagccacggc 720
atggacatca agggccccgc ctcccgccac gccgccgcca agtctcctcc ccacaacaag 780
ggagtcctct tccagccggc cagcgagttc ctccccatga tcgagcaggt gcaccagcga 840
ctcgagcagg ccaccagctc catcccgggc gccaaggtcg agaacaacaa gttctgcgtc 900
tccgtccact tccggtgcgt cgacgagaag agttgggggg cgttggcgga gacggtgagg 960
agggtggtga gggagttccc gcggctgcgg ctgagccagg ggaggatggt gttcgaggtg 1020
cggccgacca tcaagtggga caagggcaag gccctcgagt tcctcctcga ctcgctcggt 1080
ttcgccgact gcagcgacgt gctgccggtc tacatcggcg acgaccgcac ggacgaggac 1140
gcgttcaagg ttttgcggcg gcgtgggcag ggcgtgggga tcctggtgtc caagcacccc 1200
aaggagacga gcgcctcctt ctccctccag gagcccgccg agctgaagaa aagctcagtg 1260
cactacccac tgccggcaca acgtagcaac aggctgaacc gcatattggt caattggtgg 1320
ggtgaaggac ttaaggacaa attgtgtgct ttggagccaa gccatgagag ggaggggtgc 1380
atggcccccc actag 1395
<210>58
<211>464
<212>PRT
＜213〉rice
<400>58
Met Ala Lys Ala Ser Val Val Val Pro Glu Gln Val Gly Ala Ala Ala
1 5 10 15
Ala Ala Gln Val Gly Cys Pro Cys Pro Gly Thr Thr Leu Phe Pro Tyr
20 25 30
Pro Pro Pro Arg Ala Gly Ile Ala Val Arg Arg Lys Cys Leu Gln Ala
35 40 45
Ala Gln Gln Leu Glu Leu Gly Ala Gly Leu Arg Gly Gly Trp Val Glu
50 55 60
Ser Met Arg Ala Ser Ser Pro Thr His Ala Lys Ala Ala Ala Ala Leu
65 70 75 80
Ala Ala Gly Val Asp Glu Glu His Ala Ala Trp Met Val Arg Phe Arg
85 90 95
Ser Pro Ile Asp Arg Cys Ser Ser Arg Ser Trp Arg Ala Arg Ala Asp
100 105 110
Thr Asp Met Asn Arg Ala Phe Pro Phe Val Phe Val Gln Ala Arg His
115 120 125
Pro Ser Ala Leu Gly Glu Phe Glu Lys Val Val Ala Ala Ser Lys Gly
130 135 140
Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile
145 150 155 160
Val Asp Asp Pro Asp Ala Ala Phe Met Ser Glu Thr Val Ser Leu Ser
165 170 175
Ser Pro Pro Leu Ser Pro Thr Leu Leu Leu His Ser Ser Ser Ser His
180 185 190
Thr Ser Leu Leu Pro His Gln Met Arg Met Ala Val Arg Ser Val Ala
195 200 205
Lys His Phe Pro Thr Ala Ile Val Ser Gly Arg Cys Arg Asp Lys Val
210 215 220
Phe Glu Phe Val Lys Leu Ala Glu Leu Tyr Tyr Ala Gly Ser His Gly
225 230 235 240
Met Asp Ile Lys Gly Pro Ala Ser Arg His Ala Ala Ala Lys Ser Pro
245 250 255
Pro His Asn Lys Gly Val Leu Phe Gln Pro Ala Ser Glu Phe Leu Pro
260 265 270
Met Ile Glu Gln Val His Gln Arg Leu Glu Gln Ala Thr Ser Ser Ile
275 280 285
Pro Gly Ala Lys Val Glu Asn Asn Lys Phe Cys Val Ser Val His Phe
290 295 300
Arg Cys Val Asp Glu Lys Ser Trp Gly Ala Leu Ala Glu Thr Val Arg
305 310 315 320
Arg Val Val Arg Glu Phe Pro Arg Leu Arg Leu Ser Gln Gly Arg Met
325 330 335
Val Phe Glu Val Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu
340 345 350
Glu Phe Leu Leu Asp Ser Leu Gly Phe Ala Asp Cys Ser Asp Val Leu
355 360 365
Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val
370 375 380
Leu Arg Arg Arg Gly Gln Gly Val Gly Ile Leu Val Ser Lys His Pro
385 390 395 400
Lys Glu Thr Ser Ala Ser Phe Ser Leu Gln Glu Pro Ala Glu Leu Lys
405 410 415
Lys Ser Ser Val His Tyr Pro Leu Pro Ala Gln Arg Ser Asn Arg Leu
420 425 430
Asn Arg Ile Leu Val Asn Trp Trp Gly Glu Gly Leu Lys Asp Lys Leu
435 440 445
Cys Ala Leu Glu Pro Ser His Glu Arg Glu Gly Cys Met Ala Pro His
450 455 460
<210>59
<211>1878
<212>DNA
＜213〉rice
<400>59
gctccgccat cttctctcct ctcccctctc actcctccca aatcccctcc attgccttcc 60
tcgcttcgca tcgccgctcc cgccgccgcc gtcgggctgc tcgccggcat tgggtgttgg 120
ttgtgaccgt atacaattat tgtttttgga gctgagcgat cagatgcatg agccttcctt 180
ttaaatgatc tgtgtccacc atggcgatga accaaatgca ggaacttccc gcttaatggg 240
ctggatgcgt tgtatgcacg tttgcagtga caagaagaca ttgaaacgtt ggttttttat 300
tgacaagagg gttggttgag tgtctaactc ttaaggaatc ctatagtcta cttgcttgct 360
cttgtgttgt tagtaactgt tcttacaaca actctgcgga gagttctgtt gatggatttg 420
aagacaagca actctcctgt tattgctgat cctctcccta aattagcctt gccatctgct 480
gtgatgacgt acactacacc tacgagtttc ccctctaccg ggctgtactt gaacactccg 540
aaaaagaagc ctctgcctgg aaagatcgaa gaagtccgcg ccgctggatg gcttgatctc 600
atgctggcct cctcgccacc tcgcaagagg cagactaagg actttgccaa tgatgttcaa 660
gctgacgagc ttgatttgct ataccgtaat tgggtggtga accatccatc tgctttaaca 720
tcatttgagg atattgttaa tcttgccaga ggtaaaagat tggcactgtt ccttgattat 780
gatggaactc tttcaccgat tgtggacaat cctgaaaatg cagtaatgtc tgacgagatg 840
cgctctgctg tgaagcatgt ggcatcactt tttcccactg cgatcattag tggaagatct 900
cgtgataagg tttttgactt tgtgaaacta actgaactgt attacgctgg aagtcatgga 960
atggatatca tggggcctgt taggaagtct gattcgagtg gtcagcatgt ggaatgtatc 1020
aggtccactg attcagaggg taaagaggtc aacctcttcc aacctgcaag tgagttttta 1080
cctatgatta gcgaggtgta caaaaagctc agtgaaagta ttaaggacat tgatggtgca 1140
aggatggaag ataacaaatt ctgtgtgtcc gttcattacc gcaatgtagc accacatgac 1200
tacggagaag ttcatcaacg tgtgactgcc gtcctgaaga attacccttg tctaaggctt 1260
acccatggga gaaaggttct tgaggttcga cctgtgatag actggaacaa ggggaaagct 1320
gtggaatttt tgctggagtc acttggacta tgtgggaaag aagatgttct tcctatctat 1380
gttggagatg acaagactga tgaggatgca ttcaaggttc tgaaggcaaa cagcattggc 1440
tttggaattt tggtgtcatc tgtgcccaag gatactgatg ctttctattc cgtacgggac 1500
ccagctgagg tgatggaatt cctgaagaaa ctggcatctt ggaaggagga atccacttaa 1560
gcagaaggga ggaacataac agaatcgttt tttgaggata tggagaagta ccaactataa 1620
atacgagcaa aatatacact gctaacaaat aagtctggcc aaaatgtttt tgatttggca 1680
tcctattata taagaggctc cctaaaccac ccttttttgg tctcactttc atcttatgtt 1740
tctgggattc tgagacattt cattctttta ttagttctgt tcctttagta tatataaaat 1800
atatacacat gtatgctgaa aaattttggt tcctgtccct gtcgtcttag gcaattattt 1860
attctaccgg caagttgt 1878
<210>60
<211>382
<212>PRT
＜213〉rice
<400>60
Met Asp Leu Lys Thr Ser Asn Ser Pro Val Ile Ala Asp Pro Leu Pro
1 5 10 15
Lys Leu Ala Leu Pro Ser Ala Val Met Thr Tyr Thr Thr Pro Thr Ser
20 25 30
Phe Pro Ser Thr Gly Leu Tyr Leu Asn Thr Pro Lys Lys Lys Pro Leu
35 40 45
Pro Gly Lys Ile Glu Glu Val Arg Ala Ala Gly Trp Leu Asp Leu Met
50 55 60
Leu Ala Ser Ser Pro Pro Arg Lys Arg Gln Thr Lys Asp Phe Ala Asn
65 70 75 80
Asp Val Gln Ala Asp Glu Leu Asp Leu Leu Tyr Arg Asn Trp Val Val
85 90 95
Asn His Pro Ser Ala Leu Thr Ser Phe Glu Asp Ile Val Asn Leu Ala
100 105 110
Arg Gly Lys Arg Leu Ala Leu Phe Leu Asp Tyr Asp Gly Thr Leu Ser
115 120 125
Pro Ile Val Asp Asn Pro Glu Asn Ala Val Met Ser Asp Glu Met Arg
130 135 140
Ser Ala Val Lys His Val Ala Ser Leu Phe Pro Thr Ala Ile Ile Ser
145 150 155 160
Gly Arg Ser Arg Asp Lys Val Phe Asp Phe Val Lys Leu Thr Glu Leu
165 170 175
Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Met Gly Pro Val Arg Lys
180 185 190
Ser Asp Ser Ser Gly Gln His Val Glu Cys Ile Arg Ser Thr Asp Ser
195 200 205
Glu Gly Lys Glu Val Asn Leu Phe Gln Pro Ala Ser Glu Phe Leu Pro
210 215 220
Met Ile Ser Glu Val Tyr Lys Lys Leu Ser Glu Ser Ile Lys Asp Ile
225 230 235 240
Asp Gly Ala Arg Met Glu Asp Asn Lys Phe Cys Val Ser Val His Tyr
245 250 255
Arg Asn Val Ala Pro His Asp Tyr Gly Glu Val His Gln Arg Val Thr
260 265 270
Ala Val Leu Lys Asn Tyr Pro Cys Leu Arg Leu Thr His Gly Arg Lys
275 280 285
Val Leu Glu Val Arg Pro Val Ile Asp Trp Asn Lys Gly Lys Ala Val
290 295 300
Glu Phe Leu Leu Glu Ser Leu Gly Leu Cys Gly Lys Glu Asp Val Leu
305 310 315 320
Pro Ile Tyr Val Gly Asp Asp Lys Thr Asp Glu Asp Ala Phe Lys Val
325 330 335
Leu Lys Ala Asn Ser Ile Gly Phe Gly Ile Leu Val Ser Ser Val Pro
340 345 350
Lys Asp Thr Asp Ala Phe Tyr Ser Val Arg Asp Pro Ala Glu Val Met
355 360 365
Glu Phe Leu Lys Lys Leu Ala Ser Trp Lys Glu Glu Ser Thr
370 375 380
<210>61
<211>1830
<212>DNA
＜213〉aquilegia species (Aquilegia spp.)
<400>61
tctctctctc tctctctctc gctcgctcgc tctctgtgat ttctaggttt ttcttttcgc 60
tcttattgct tctaaaggtt agttttcgat ttcgttttca acgatttgaa gattggatca 120
agttctgtgt tgatttcttc aaagaaaaga aacagaatcg gtttctgaat attcagatat 180
cagacaatat cttcgtaagc tacatatttc ctccacttgt tttgtttaca aaatgtctgg 240
tcatcttcat taaatgctgt gtatctttgg agatgaaaag ctttcaggaa gcctgcactt 300
gatggactgc atgcccaata gcagtgataa gaaaactttg aagagaactt acaaaccgaa 360
aaaacttaat ctggatccaa tggatataaa gtcaaaccat gctgcacctg ttctcactga 420
ccctgtcccc ataaccaaat caagattagg cattcattct agcttgttgc cttactcgcc 480
gggagccacg ttttcttctg gcatgtacat aacaattcct agaaggaagg tcattcctag 540
caagcttgat gacattcgtt ccagtgggtg gctagatgcg atgaaatcct catcccctcc 600
tcgcaaaaag ctaactaaag attccaatat tgaggttgct gctgatgata gccaactcgt 660
ttaccgctca tggatgctca agtatccatc agcacttgcc tcttttgagc aaattatgaa 720
ttatgcaaag gggaagagga ttgcattgtt tctggattat gatggcacac tttcaccaat 780
cgtagatgac cctgagcgtg cttttatgtc aactgctatg cgttctgctg tgaaaaatgt 840
cgcagtgtgt ttccccactg caataattag tggaagaagt cgtgataagg tatacgagtt 900
tgtaggacta acagaactct attatgctgg cagtcatgga atggatataa tgggacctgt 960
aagacagtcc gatactggcg ataaccattc aaactgtatt agatctactg acaagcaggg 1020
taaagaagta aatcttttcc aacctgctag tgaattttta ccgatgatcg atgaggtttt 1080
tagctccctt gtcgaattta ctaaaggaat tgaaggtgca aaagttgaaa ataacaagtt 1140
ttgtgtctct gtacattacc gcaatgttga cgagaagaat tggactacag ttgcacatgg 1200
tgttcatggc atcttgaagg attaccctcg tctgcggtta actcatggga ggaaggtttt 1260
agaggttcgt cccgtgattg actgggacaa gggaaaggca gtagagtttc tgcttgattc 1320
acttggattg agtgaaagtg atgacgtgct ccccatatat gttggtgatg accggacaga 1380
tgaagatgcc tttaaggttt tgagggagaa gaatagaggt tatggcattt tagtgtcatc 1440
tgtgccaaag gaaagtaatg ctttctattc tctcaaagat ccatccgagg ttatgtcatt 1500
tctcaaatcg ttggtaagat ggaagaagtc cagaatataa aggaaggaat taaccagttt 1560
aggtagaagt tctatagtct gaactctgaa gattctaaca aataaatcaa gatggagctg 1620
cgctgttgag gtgttttctt gacactgtgg aactggatga aattgttggg gtttataagc 1680
tctcttacat ttttgtaaat cctttctgag gctcgtgttt agcgattttc ttatctatga 1740
aagttaattt ttttgttctg tgttgcaatt ttggtccatt attttaggtc tctgagggaa 1800
atttttactt aatcttataa atataagatg 1830
<210>62
<211>428
<212>PRT
＜213〉aquilegia species
<400>62
Met Leu Cys Ile Phe Gly Asp Glu Lys Leu Ser Gly Ser Leu His Leu
1 5 10 15
Met Asp Cys Met Pro Asn Ser Ser Asp Lys Lys Thr Leu Lys Arg Thr
20 25 30
Tyr Lys Pro Lys Lys Leu Asn Leu Asp Pro Met Asp Ile Lys Ser Asn
35 40 45
His Ala Ala Pro Val Leu Thr Asp Pro Val Pro Ile Thr Lys Ser Arg
50 55 60
Leu Gly Ile His Ser Ser Leu Leu Pro Tyr Ser Pro Gly Ala Thr Phe
65 70 75 80
Ser Ser Gly Met Tyr Ile Thr Ile Pro Arg Arg Lys Val Ile Pro Ser
85 90 95
Lys Leu Asp Asp Ile Arg Ser Ser Gly Trp Leu Asp Ala Met Lys Ser
100 105 110
Ser Ser Pro Pro Arg Lys Lys Leu Thr Lys Asp Ser Asn Ile Glu Val
115 120 125
Ala Ala Asp Asp Ser Gln Leu Val Tyr Arg Ser Trp Met Leu Lys Tyr
130 135 140
Pro Ser Ala Leu Ala Ser Phe Glu Gln Ile Met Asn Tyr Ala Lys Gly
145 150 155 160
Lys Arg Ile Ala Leu Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile
165 170 175
Val Asp Asp Pro Glu Arg Ala Phe Met Ser Thr Ala Met Arg Ser Ala
180 185 190
Val Lys Asn Val Ala Val Cys Phe Pro Thr Ala Ile Ile Ser Gly Arg
195 200 205
Ser Arg Asp Lys Val Tyr Glu Phe Val Gly Leu Thr Glu Leu Tyr Tyr
210 215 220
Ala Gly Ser His Gly Met Asp Ile Met Gly Pro Val Arg Gln Ser Asp
225 230 235 240
Thr Gly Asp Asn His Ser Asn Cys Ile Arg Ser Thr Asp Lys Gln Gly
245 250 255
Lys Glu Val Asn Leu Phe Gln Pro Ala Ser Glu Phe Leu Pro Met Ile
260 265 270
Asp Glu Val Phe Ser Ser Leu Val Glu Phe Thr Lys Gly Ile Glu Gly
275 280 285
Ala Lys Val Glu Asn Asn Lys Phe Cys Val Ser Val His Tyr Arg Asn
290 295 300
Val Asp Glu Lys Asn Trp Thr Thr Val Ala His Gly Val His Gly Ile
305 310 315 320
Leu Lys Asp Tyr Pro Arg Leu Arg Leu Thr His Gly Arg Lys Val Leu
325 330 335
Glu Val Arg Pro Val Ile Asp Trp Asp Lys Gly Lys Ala Val Glu Phe
340 345 350
Leu Leu Asp Ser Leu Gly Leu Ser Glu Ser Asp Asp Val Leu Pro Ile
355 360 365
Tyr Val Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg
370 375 380
Glu Lys Asn Arg Gly Tyr Gly Ile Leu Val Ser Ser Val Pro Lys Glu
385 390 395 400
Ser Asn Ala Phe Tyr Ser Leu Lys Asp Pro Ser Glu Val Met Ser Phe
405 410 415
Leu Lys Ser Leu Val Arg Trp Lys Lys Ser Arg Ile
420 425
<210>63
<211>1648
<212>DNA
＜213〉aquilegia species
<400>63
ccttcactaa gcttttctca gtttctctct ttctttctaa actctttctt tctctgttct 60
tctaattata atctttattt tggttctcat tagttgtttc ttttaactga acttcagaga 120
acttttctta atatctcttc tgtgaatctt tagtctttct tgaaagaaaa atccaatctt 180
tttacaagtt gtggtttgat ttggggtttt agaatctgaa ctaaaaacct caaatctagt 240
tgaatttcct gtttgggtgg ttatttatag tacatttggt taaagatgac taagcaaaat 300
gtggtggttt cagatgtaaa atctgggtta gcaataacag ttgcagtgtc gaattcgtct 360
ctgttttctt ctgctgtgca gaaaccatta acaacacctg gaggttatat aactatatct 420
cgtagcaagc ttttaaagaa gcttgaagaa acaggtggag ttacagaagg gagaattaat 480
gcttgggttg aatccatgag agcatcttct cctactcgta ttagaccggc agtttctttg 540
actccaaaca gagatgaaaa ctcatggatg ctcaaacatc cttcagcact taatatgttt 600
gaagaaataa caaatgcttc taaagggaag caaattgtga tgttcttaga ttatgatggt 660
actctttctc ctattgtcga cgatccagat cgtgctttca tgtctgaatc gatgagaaga 720
gctgttagag atgttgcaag atactttcct actgcaattg tgagcgggag atgcagagat 780
aaggtgtata gctttgtacg cttagcagaa ctgtactatg ctggaagtca tggtatggac 840
attaaaggac caaccaaaag ttacaaaaac aagaaaagga accaacctgt attgtttcaa 900
ccagcaaatg agtttttgcc catgattgat gaggtttaca aagcattgtt agagaaaacc 960
aaatcaactc caggtgctaa agtggagaac aataggttct gtgtatctgt gcattttaga 1020
tgtgtggatg aaaagagttg gactgaacta gcagaacaag ttagatcagt tcttaaagaa 1080
tacccaaagc ttagactgac tcaaggaaga aaggtactag agatccgtcc tactattaaa 1140
tgggacaaag ggaaggctct tgaatttttg ttagagtctc ttggattcgc caactgcaac 1200
aatgttctgc cactgtacat tggagacgat cgaaccgatg aagacgcctt taaggtcttg 1260
cgcgatagag gacaaggatt cggcattctc gtttctaaag ttccaaaaga aacaaatgct 1320
tcttattctc ttcaagaacc ttcagaggtt atggatttcc ttcaccggtt agttgaatgg 1380
aagcgtatgt cagttcgagg gcattctaga gtatagtaaa agagcaactt tcccatctag 1440
gagtgacaat gatccaagac tggggaaaat tatatgtatt ttcctttgtt caggaaaaaa 1500
gttaaaagaa aaaaaaaagg cttttctcct ttgcttttct ttgggtttgg gggcctcctt 1560
gtaagttgta actactgatg tacaagggga aatgttttca ccaaagcagc ctaatcccat 1620
tatcagggga aggcaaacat tacatttg 1648
<210>64
<211>376
<212>PRT
＜213〉aquilegia species
<400>64
Met Thr Lys Gln Asn Val Val Val Ser Asp Val Lys Ser Gly Leu Ala
1 5 10 15
Ile Thr Val Ala Val Ser Asn Ser Ser Leu Phe Ser Ser Ala Val Gln
20 25 30
Lys Pro Leu Thr Thr Pro Gly Gly Tyr Ile Thr Ile Ser Arg Ser Lys
35 40 45
Leu Leu Lys Lys Leu Glu Glu Thr Gly Gly Val Thr Glu Gly Arg Ile
50 55 60
Asn Ala Trp Val Glu Ser Met Arg Ala Ser Ser Pro Thr Arg Ile Arg
65 70 75 80
Pro Ala Val Ser Leu Thr Pro Asn Arg Asp Glu Asn Ser Trp Met Leu
85 90 95
Lys His Pro Ser Ala Leu Asn Met Phe Glu Glu Ile Thr Asn Ala Ser
100 105 110
Lys Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser
115 120 125
Pro Ile Val Asp Asp Pro Asp Arg Ala Phe Met Ser Glu Ser Met Arg
130 135 140
Arg Ala Val Arg Asp Val Ala Arg Tyr Phe Pro Thr Ala Ile Val Ser
145 150 155 160
Gly Arg Cys Arg Asp Lys Val Tyr Ser Phe Val Arg Leu Ala Glu Leu
165 170 175
Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro Thr Lys Ser
180 185 190
Tyr Lys Asn Lys Lys Arg Asn Gln Pro Val Leu Phe Gln Pro Ala Asn
195 200 205
Glu Phe Leu Pro Met Ile Asp Glu Val Tyr Lys Ala Leu Leu Glu Lys
210 215 220
Thr Lys Ser Thr Pro Gly Ala Lys Val Glu Asn Asn Arg Phe Cys Val
225 230 235 240
Ser Val His Phe Arg Cys Val Asp Glu Lys Ser Trp Thr Glu Leu Ala
245 250 255
Glu Gln Val Arg Ser Val Leu Lys Glu Tyr Pro Lys Leu Arg Leu Thr
260 265 270
Gln Gly Arg Lys Val Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp Lys
275 280 285
Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly Phe Ala Asn Cys
290 295 300
Asn Asn Val Leu Pro Leu Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp
305 310 315 320
Ala Phe Lys Val Leu Arg Asp Arg Gly Gln Gly Phe Gly Ile Leu Val
325 330 335
Ser Lys Val Pro Lys Glu Thr Asn Ala Ser Tyr Ser Leu Gln Glu Pro
340 345 350
Ser Glu Val Met Asp Phe Leu His Arg Leu Val Glu Trp Lys Arg Met
355 360 365
Ser Val Arg Gly His Ser Arg Val
370 375
<210>65
<211>1116
<212>DNA
＜213〉rape (Brassica campestris)
<400>65
atggagaaac caaacaggat gtcagagagt caaaacgttg tcgtctcaga ggcggcaagg 60
tctatcatcc ccaacaactc ttcggctcct cctggtttca tctcaatctc caagaaaaag 120
cttctcaaga acctagaaat catcaatgat ggcgaaagaa tcaacgcttg ggtagattca 180
atgcgagctt cttctcctac tcatccaaaa tcactccctt cttccatctc ctcagagcaa 240
caactcagtt catggatcat gcagcatcct tctgcattag aaatgtttga gaaaatcaca 300
gaagcttcgg gagggaaaca aatcgtaata tttctagatt atgacggtac tctctctccc 360
atcgttgatg atccagacag agctttcatg tcaagcaaga tgagaagaac agtaaaaaaa 420
ctggctaagt gttttccaac tgctatagtt actggtagat gcctagacaa ggtgtataac 480
tttgtcaagc tagctgagct gtattatgct ggcagccatg gcatggacat taaagggcca 540
gcaaaaggct tctccagaca caagagggtt aaacagtctc ttctgtacca accagccagt 600
gattatcttc ccatgatcga tgaagtctat agacaacttt tggagaaaac caaatcaact 660
cctggagtca tagtagaaaa caacaagttc tgtgcttctg tgcactttcg ttgcgtcgat 720
gagaagaaat ggagcgaact ggttctacag gttcggtcgg tattaaatga ataccctagg 780
cttaaactga accaaggtcg aaaggttttc gaaatacgtc ctatgattga atgggataaa 840
ggaaaagctc ttgagttctt gttagagtca cttgggtttg gaaactctaa caacgttttc 900
ccagtttaca tcggtgatga ccggaccgac gaagatgcat ttaagctgct acgagacaga 960
ggtgaaggct gtggcgttct tgtctccaaa ttccccaaag atacggatgc ttcatattat 1020
ttgcaagatc cgtccgaggc aagtgatgaa tttcttgcaa cgattggtgg cgtggaaaca 1080
aatgcagcca agagtgtgaa gaggatgtat gtataa 1116
<210>66
<211>371
<212>PRT
＜213〉rape
<400>66
Met Glu Lys Pro Asn Arg Met Ser Glu Ser Gln Asn Val Val Val Ser
1 5 10 15
Glu Ala Ala Arg Ser Ile Ile Pro Asn Asn Ser Ser Ala Pro Pro Gly
20 25 30
Phe Ile Ser Ile Ser Lys Lys Lys Leu Leu Lys Asn Leu Glu Ile Ile
35 40 45
Asn Asp Gly Glu Arg Ile Asn Ala Trp Val Asp Ser Met Arg Ala Ser
50 55 60
Ser Pro Thr His Pro Lys Ser Leu Pro Ser Ser Ile Ser Ser Glu Gln
65 70 75 80
Gln Leu Ser Ser Trp Ile Met Gln His Pro Ser Ala Leu Glu Met Phe
85 90 95
Glu Lys Ile Thr Glu Ala Ser Gly Gly Lys Gln Ile Val Ile Phe Leu
100 105 110
Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Arg Ala
115 120 125
Phe Met Ser Ser Lys Met Arg Arg Thr Val Lys Lys Leu Ala Lys Cys
130 135 140
Phe Pro Thr Ala Ile Val Thr Gly Arg Cys Leu Asp Lys Val Tyr Asn
145 150 155 160
Phe Val Lys Leu Ala Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp
165 170 175
Ile Lys Gly Pro Ala Lys Gly Phe Ser Arg His Lys Arg Val Lys Gln
180 185 190
Ser Leu Leu Tyr Gln Pro Ala Ser Asp Tyr Leu Pro Met Ile Asp Glu
195 200 205
Val Tyr Arg Gln Leu Leu Glu Lys Thr Lys Ser Thr Pro Gly Val Ile
210 215 220
Val Glu Asn Asn Lys Phe Cys Ala Ser Val His Phe Arg Cys Val Asp
225 230 235 240
Glu Lys Lys Trp Ser Glu Leu Val Leu Gln Val Arg Ser Val Leu Asn
245 250 255
Glu Tyr Pro Arg Leu Lys Leu Asn Gln Gly Arg Lys Val Phe Glu Ile
260 265 270
Arg Pro Met Ile Glu Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu
275 280 285
Glu Ser Leu Gly Phe Gly Asn Ser Asn Asn Val Phe Pro Val Tyr Ile
290 295 300
Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Leu Leu Arg Asp Arg
305 310 315 320
Gly Glu Gly Cys Gly Val Leu Val Ser Lys Phe Pro Lys Asp Thr Asp
325 330 335
Ala Ser Tyr Tyr Leu Gln Asp Pro Ser Glu Ala Ser Asp Glu Phe Leu
340 345 350
Ala Thr Ile Gly Gly Val Glu Thr Asn Ala Ala Lys Ser Val Lys Arg
355 360 365
Met Tyr Val
370
<210>67
<211>1098
<212>DNA
＜213〉overgrown with weeds blue or green (Brassica rapa)
<400>67
atggtgagct ttgtcgtgga gaaaccacag agaatgtcaa acggtgtcgt atcagagacc 60
acaaggttaa gtatcatccc taacaactct tcctctgctc agaaaacgct tctcaagaac 120
ctcgagatca tcaatggtgg acaaagagtc aacgcttggg tcgattcaat gcgggcttct 180
tctcctactc atctcaaatc actaccttct tctgtctcct cagagaaaca cctcagctca 240
tggatcatgc agcatccttc agcattagaa atgtttgaga agatcacaca ggcttcagga 300
gggaaacaaa tcgtaatgtt tcttgattat gatggtactc tctctcccat cgttgatgat 360
ccagacaaag ctttcatgtc aagcaagatg agaagaactg tgaaaaaatt ggctaaatgt 420
ttcccaactg caatagttac cggtagatgc atagacaagg tgtataactt tgtgaagctg 480
gctgagctgt attatgctgg aagccatggc atggacatta aaggtccagc aaaaggtttc 540
tccagacaca agagggttaa acagtctctg ttgtaccaac cagccagtga ctatcttccc 600
atgatcgatg aagtctataa acagctcttg gagaaaacta aatcaactcc tggagtcata 660
gtagaaaacc acaagtttac cgcttctgtg cactttcgtt gcgtggaaga gaagaaatgg 720
agcgaactgg ttctacaggt tcggtcggta ttagagaaat atcctacgct caaactgagc 780
caaggtcgga aggttttcga aatccgtcct atgatcgatt gggataaagg aaaagctctt 840
gagttcttgt tagagtcact tgggtttggg aactctaaca acgttttccc ggtttacatc 900
ggcgacgatc ggaccgacga agatgcattt aagatgctac gagtcagggg tgaaggcttt 960
ggcatacttg tctccaaatt tcccaaggat acagatgctt cgtattctct gcaagatccg 1020
tccgaggcaa gtccacacac gcgtatatta tacctttctg ttcctaaata taagatgttt 1080
agcagggccg atttataa 1098
<210>68
<211>362
<212>PRT
＜213〉overgrown with weeds blue or green
<400>68
Met Val Ser Phe Val Val Glu Lys Pro Gln Arg Met Ser Asn Gly Val
1 5 10 15
Val Ser Glu Thr Thr Arg Leu Ser Ile Ile Pro Asn Asn Ser Ser Ser
20 25 30
Ala Gln Lys Thr Leu Leu Lys Asn Leu Glu Ile Ile Asn Gly Gly Gln
35 40 45
Arg Val Asn Ala Trp Val Asp Ser Met Arg Ala Ser Ser Pro Thr His
50 55 60
Leu Lys Ser Leu Pro Ser Ser Val Ser Ser Glu Lys His Leu Ser Ser
65 70 75 80
Trp Ile Met Gln His Pro Ser Ala Leu Glu Met Phe Glu Lys Ile Thr
85 90 95
Gln Ala Ser Gly Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly
100 105 110
Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Lys Ala Phe Met Ser Ser
115 120 125
Lys Met Arg Arg Thr Val Lys Lys Leu Ala Lys Cys Phe Pro Thr Ala
130 135 140
Ile Val Thr Gly Arg Cys Ile Asp Lys Val Tyr Asn Phe Val Lys Leu
145 150 155 160
Ala Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro
165 170 175
Ala Lys Gly Phe Ser Arg His Lys Arg Val Lys Gln Ser Leu Leu Tyr
180 185 190
Gln Pro Ala Ser Asp Tyr Leu Pro Met Ile Asp Glu Val Tyr Lys Gln
195 200 205
Leu Leu Glu Lys Thr Lys Ser Thr Pro Gly Val Ile Val Glu Asn His
210 215 220
Lys Phe Thr Ala Ser Val His Phe Arg Cys Val Glu Glu Lys Lys Trp
225 230 235 240
Ser Glu Leu Val Leu Gln Val Arg Ser Val Leu Glu Lys Tyr Pro Thr
245 250 255
Leu Lys Leu Ser Gln Gly Arg Lys Val Phe Glu Ile Arg Pro Met Ile
260 265 270
Asp Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly
275 280 285
Phe Gly Asn Ser Asn Asn Val Phe Pro Val Tyr Ile Gly Asp Asp Arg
290 295 300
Thr Asp Glu Asp Ala Phe Lys Met Leu Arg Val Arg Gly Glu Gly Phe
305 310 315 320
Gly Ile Leu Val Ser Lys Phe Pro Lys Asp Thr Asp Ala Ser Tyr Ser
325 330 335
Leu Gln Asp Pro Ser Glu Ala Ser Pro His Thr Arg Ile Leu Tyr Leu
340 345 350
Ser Val Pro Lys Tyr Lys Met Phe Ser Arg
355 360
<210>69
<211>1280
<212>DNA
＜213〉upland cotton (Gossypium hirsurum)
<400>69
cgccgccggt caaaatggtc tctgatccaa actctgcaca gaaaccaccg gcaccacctg 60
ggttttatat ccatttccag aaagaaattg cttcaaaacc ttgaaatcaa tgccggagct 120
agagttaatt catgggtcga ttccatgaga gcttcttctc caactcatat gaaatcagca 180
ccgtccattg ctgatgatca aggttcctgg aatctaaacc atccatcagc actagatatg 240
ttcgaacaga taatcgatgc atcaaaaggg aaacaaatcg taatgtttct tgattacgat 300
ggcactcttt caccaatcgt agccgatcca gatcgggctt tcatgtctaa gaagatgaga 360
aagacagtga gaaagctagc caaatgtttc cctacagcta tagtgagtgg cagatgcagg 420
gacaaggtgt ataattttgt caaattagct gagctatact atgctggaag ccatggcatg 480
gacattaaag gccctgaaaa aggttccaaa tctaacaaag atactgaatc tgttcttttc 540
caaccagcta gtgaatttct tcccatgatt gatgaggttt ataaacagtt ggttgaaact 600
acaaaatcaa caccaggtgc taaagtggag aacaacaagt tttgtctctc agtacacttc 660
cgttgtgttg atgaaaagaa atggagtgaa ttggcacaac aagtgaagtc tgttttaaaa 720
gactacccca agcttcggct aactcaaggc cgaaaggttt tggaaatccg tcctacaatc 780
aaatgggaca aagggaaagc ccttgaattt ttgttagaat ctcttggatt tgctaactgt 840
accgatgtct ttcccgttta tatcggagat gatcggaccg atgaagatgc attcaagata 900
ttgagggaca gaggccaagg ttttggtatt cttgtatcca agttccccaa agacactaat 960
gcatcctatt cattacaaga accagatgag gtcatggact ttttacgacg tctggttgaa 1020
tggaaagaat tatctctaag aactcagtcg agaatgtaga agaaaataag acagtggaag 1080
taaatatttg tgcaccctag caaagaaatt gtaaaggggg gtgtgagatt aaagtagtaa 1140
aattattgtt ttaagatgag agaaatgatt ataaaagctt tgtacatctt tgtaactagt 1200
tggggtacaa agggtcaagt cttgtagctt cataacttgt ctattaatgc ataggaaagc 1260
aatggtttcg gattaatgtt 1280
<210>70
<211>304
<212>PRT
＜213〉upland cotton
<400>70
Met Arg Ala Ser Ser Pro Thr His Met Lys Ser Ala Pro Ser Ile Ala
1 5 10 15
Asp Asp Gln Gly Ser Trp Asn Leu Asn His Pro Ser Ala Leu Asp Met
20 25 30
Phe Glu Gln Ile Ile Asp Ala Ser Lys Gly Lys Gln Ile Val Met Phe
35 40 45
Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Ala Asp Pro Asp Arg
50 55 60
Ala Phe Met Ser Lys Lys Met Arg Lys Thr Val Arg Lys Leu Ala Lys
65 70 75 80
Cys Phe Pro Thr Ala Ile Val Ser Gly Arg Cys Arg Asp Lys Val Tyr
85 90 95
Asn Phe Val Lys Leu Ala Glu Leu Tyr Tyr Ala Gly Ser His Gly Met
100 105 110
Asp Ile Lys Gly Pro Glu Lys Gly Ser Lys Ser Asn Lys Asp Thr Glu
115 120 125
Ser Val Leu Phe Gln Pro Ala Ser Glu Phe Leu Pro Met Ile Asp Glu
130 135 140
Val Tyr Lys Gln Leu Val Glu Thr Thr Lys Ser Thr Pro Gly Ala Lys
145 150 155 160
Val Glu Asn Asn Lys Phe Cys Leu Ser Val His Phe Arg Cys Val Asp
165 170 175
Glu Lys Lys Trp Ser Glu Leu Ala Gln Gln Val Lys Ser Val Leu Lys
180 185 190
Asp Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys Val Leu Glu Ile
195 200 205
Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu
210 215 220
Glu Ser Leu Gly Phe Ala Asn Cys Thr Asp Val Phe Pro Val Tyr Ile
225 230 235 240
Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Ile Leu Arg Asp Arg
245 250 255
Gly Gln Gly Phe Gly Ile Leu Val Ser Lys Phe Pro Lys Asp Thr Asn
260 265 270
Ala Ser Tyr Ser Leu Gln Glu Pro Asp Glu Val Met Asp Phe Leu Arg
275 280 285
Arg Leu Val Glu Trp Lys Glu Leu Ser Leu Arg Thr Gln Ser Arg Met
290 295 300
<210>71
<211>1509
<212>DNA
＜213〉barley (Hordeum vulgare)
<400>71
cagccctcca ccgcatccgg gccggagaca cctccctggc cgccatcgag catgccggtc 60
gtgtcagagg tgggcatcac ggtgaccgcg gccacggcca cggcgtgccc ctgcccgggg 120
tcgctgttcc cgtacccgcc gccgcgtgcc gggatggccg tgagccggaa gtgcctgcgg 180
gcggcgcagg cggagcttgg cgcggggatg ctcagtggcc tggtcgagtc catgcgggcg 240
tcgtccccca cgcacgccag ggccgctgcc gccctcgctg ccggcgtccg acgacgagca 300
cgcggcctgg atggccaggc acccctccgc cttggccaag ttcgaggaga tcgtggccgc 360
ctccaaaggg aagcagatcg tcatgttcct cgactacgac ggcacactgt cccccatcgt 420
cgatgacccc gacgccgcct tcatgagcga gacgatgcgg atggccgtgc gcagcgtggc 480
caagcacttc ccgacggcga tcgtcagtgg tcggtgccgc gacaaggtgt ttgagttcgt 540
gaagctggcg gagctctact acgccggcag ccacggcatg gacatcaagg gcccggccaa 600
atcctcttcc gggcacgcaa agtccaaggc caaaggagtt ctcttccaac cagcaagcga 660
gttcctgccc atgatagaag aggtgcatca acgcctgata gaggagacca agcacgtagc 720
cggcgccaag gtggagaaca acaagttctg cgtctccgtc cacttcagat gcgtcgacga 780
aaagagctgg ggcgcgctgg cggagacggt gaagggggtg atgcgggagt acccgaagct 840
gcgcatgtcg caggggcgga tggtgttcga ggtgcggccc accatcaagt gggacaaggg 900
caaggccctc gagttcctgc tcgagtcgct gggcttcgcc gactgcagca acgtgctgcc 960
cgtctacatc ggcgacgacc gcaccgacga ggacgccttc aaggtgctgc ggcggagggg 1020
ccagggcgtc gggatcctcg tctccaagca ccccaaggac accagcgcat ccttctcgct 1080
gcaggagccc gccgaggtca tggagttcct cctccgcctc gtcgagtgga agcagctctc 1140
cagggcgcgc ctcaggctgc ggcgacaggc ccacgcctga tcggacgacc acgaggatcg 1200
gccggccggg ctaattaatt cactacgcgt agcttagtta gttgatgaat cccctgctca 1260
tcgtcatcgt atgaaagcca aaggctacgt ggatgagaag aaggaaccgt accacggcga 1320
gcctgtgggg cattgtggcg ccacatgctg tgttctaacc acgcccttct ttttctgggg 1380
atgtatacct accgagtaac gactatgcat gcatgtaaat taccctggta cgtccacgta 1440
caaggggagg aaccatggaa taaagaaaca gaaacctgag taaatagcaa caaccaagcc 1500
ttttgcctc 1509
<210>72
<211>289
<212>PRT
＜213〉barley
<400>72
Met Ala Arg His Pro Ser Ala Leu Ala Lys Phe Glu Glu Ile Val Ala
1 5 10 15
Ala Ser Lys Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr
20 25 30
Leu Ser Pro Ile Val Asp Asp Pro Asp Ala Ala Phe Met Ser Glu Thr
35 40 45
Met Arg Met Ala Val Arg Ser Val Ala Lys His Phe Pro Thr Ala Ile
50 55 60
Val Ser Gly Arg Cys Arg Asp Lys Val Phe Glu Phe Val Lys Leu Ala
65 70 75 80
Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro Ala
85 90 95
Lys Ser Ser Ser Gly His Ala Lys Ser Lys Ala Lys Gly Val Leu Phe
100 105 110
Gln Pro Ala Ser Glu Phe Leu Pro Met Ile Glu Glu Val His Gln Arg
115 120 125
Leu Ile Glu Glu Thr Lys His Val Ala Gly Ala Lys Val Glu Asn Asn
130 135 140
Lys Phe Cys Val Ser Val His Phe Arg Cys Val Asp Glu Lys Ser Trp
145 150 155 160
Gly Ala Leu Ala Glu Thr Val Lys Gly Val Met Arg Glu Tyr Pro Lys
165 170 175
Leu Arg Met Ser Gln Gly Arg Met Val Phe Glu Val Arg Pro Thr Ile
180 185 190
Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly
195 200 205
Phe Ala Asp Cys Ser Asn Val Leu Pro Val Tyr Ile Gly Asp Asp Arg
210 215 220
Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Arg Arg Gly Gln Gly Val
225 230 235 240
Gly Ile Leu Val Ser Lys His Pro Lys Asp Thr Ser Ala Ser Phe Ser
245 250 255
Leu Gln Glu Pro Ala Glu Val Met Glu Phe Leu Leu Arg Leu Val Glu
260 265 270
Trp Lys Gln Leu Ser Arg Ala Arg Leu Arg Leu Arg Arg Gln Ala His
275 280 285
Ala
<210>73
<211>1945
<212>DNA
＜213〉puncture vine clover (Medicago truncatula)
<400>73
tgtctctctc tagttctaaa tattccctat ctctcttttg cctcttcaat ttcccttctt 60
cctcttttgc attccattgc aattatccac ttctcacacc ccacctcttt aacctatttt 120
ctatttgttt cctcacaaac cctaagtgaa gatgactcaa aagaatgtgg ttgtgtctga 180
gaccaaaacc ggaatcaatg gtagcggtac tattaccgtg gcacagaagc caccggcagc 240
acccggtgga tacgttcaca ttccaaggag gagaattttg aagaatcttg aaatcaatgg 300
aggacaaaga atcaatacat ggattgattc tatgagagct tcttctccaa ctcatgtcaa 360
atcttctcct tctttagctg aagaatacaa ttcttggatt cttcgccatc catctgcatt 420
agatatgttt gaacaaatta tggatgctgc aaaaggaaaa cagattgtta tgtttttgga 480
ctatgatggt actttgtcac ctattgtcga tgaccctgac cgtgctttca tgtctgaatc 540
gatgaggaaa acagttaaga aacttgcaag gtgttttcct actgcaattg ttactggaag 600
atgcatagat aaagtgtaca attttgtccg tttggatgaa ctatattatg ctggaagtca 660
tggcatggat attaaagggc caacaaaaga gtccaaatac aacaaaaata acaaagctga 720
ggaagtactt tttcaacctg ccagagaatt tgttcccatg ataaatgagg tgtacgaaca 780
actagttgag aaaacaaaat caactcctgg tgccagagtt gagaaccaca agttctgcac 840
ctctgttcat tttagatgtg ttgatgaaaa gagatgggtt gaattggcac agcaagtaaa 900
atccgtgtta aaagagtacc cgaagcttcg tctaacacaa ggaagaaagg tattggagat 960
tcgtcccgca attaaatggg acaagggcaa ggccctcgaa tttttgctag agtcacttgg 1020
atttgccaac tgtaacgatg tatttcctgt ttatattggt gatgatagaa ccgatgaaga 1080
tgcattcaag aaattaagag acatagatca aggttttgga attctagtct ctaagtttcc 1140
aaaagacaca gctgctgcat actctttaca agagcctaat gaggttatgg agttccttca 1200
gcgtttggtg gagtggaaaa aaacatctcc aagatcacgt tctagggtgt aaatgaagac 1260
tttgtacatc cctgactggc cataaaatac atgacccata ttcatttttt aatttgtcca 1320
tcaattttct aactaataaa tcctagagtc aacaggattt gccaactgta acgatgtatt 1380
tcctgtttat attggtgatg atagaaccga tgaagatgca ttcaagaaat taagagacat 1440
agatcaaggt tttggaattc tagtctctaa gtttccaaaa gacacagctg ctgcatactc 1500
tttacaagag cctaatgagg ttatggagtt ccttcagcgt ttggtggagt ggaaaaaaac 1560
atctccaaga tcacgttcta gggtgtaaat gaagactttg tacatccctg actggccata 1620
aaatacatga ccttttttat ttttctttct atgttttgtt cagattagta caaaagagca 1680
aaaatgtatg gaaaaaaaaa atgaaagaca aaagtgtctt tctgagtttg aagctcgatt 1740
gtctacattg atgtaattag cttagccaag tagtaattac taattagtac ggggggaaag 1800
tatatgtact aaccatatca gatcagatca gatgaagtga ttctgaatgg gttaaaattt 1860
gtacccttat gattatgatg attaaatatt ataaggttac gtatcaaaag atatgtattt 1920
atagtgacat gcttattaag tactt 1945
<210>74
<211>366
<212>PRT
＜213〉puncture vine clover
<400>74
Met Thr Gln Lys Asn Val Val Val Ser Glu Thr Lys Thr Gly Ile Asn
1 5 10 15
Gly Ser Gly Thr Ile Thr Val Ala Gln Lys Pro Pro Ala Ala Pro Gly
20 25 30
Gly Tyr Val His Ile Pro Arg Arg Arg Ile Leu Lys Asn Leu Glu Ile
35 40 45
Asn Gly Gly Gln Arg Ile Asn Thr Trp Ile Asp Ser Met Arg Ala Ser
50 55 60
Ser Pro Thr His Val Lys Ser Ser Pro Ser Leu Ala Glu Glu Tyr Asn
65 70 75 80
Ser Trp Ile Leu Arg His Pro Ser Ala Leu Asp Met Phe Glu Gln Ile
85 90 95
Met Asp Ala Ala Lys Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp
100 105 110
Gly Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Arg Ala Phe Met Ser
115 120 125
Glu Ser Met Arg Lys Thr Val Lys Lys Leu Ala Arg Cys Phe Pro Thr
130 135 140
Ala Ile Val Thr Gly Arg Cys Ile Asp Lys Val Tyr Asn Phe Val Arg
145 150 155 160
Leu Asp Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Lys Gly
165 170 175
Pro Thr Lys Glu Ser Lys Tyr Asn Lys Asn Asn Lys Ala Glu Glu Val
180 185 190
Leu Phe Gln Pro Ala Arg Glu Phe Val Pro Met Ile Asn Glu Val Tyr
195 200 205
Glu Gln Leu Val Glu Lys Thr Lys Ser Thr Pro Gly Ala Arg Val Glu
210 215 220
Asn His Lys Phe Cys Thr Ser Val His Phe Arg Cys Val Asp Glu Lys
225 230 235 240
Arg Trp Val Glu Leu Ala Gln Gln Val Lys Ser Val Leu Lys Glu Tyr
245 250 255
Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys Val Leu Glu Ile Arg Pro
260 265 270
Ala Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser
275 280 285
Leu Gly Phe Ala Asn Cys Asn Asp Val Phe Pro Val Tyr Ile Gly Asp
290 295 300
Asp Arg Thr Asp Glu Asp Ala Phe Lys Lys Leu Arg Asp Ile Asp Gln
305 310 315 320
Gly Phe Gly Ile Leu Val Ser Lys Phe Pro Lys Asp Thr Ala Ala Ala
325 330 335
Tyr Ser Leu Gln Glu Pro Asn Glu Val Met Glu Phe Leu Gln Arg Leu
340 345 350
Val Glu Trp Lys Lys Thr Ser Pro Arg Ser Arg Ser Arg Val
355 360 365
<210>75
<211>1583
<212>DNA
4213〉puncture vine clover
<400>75
aacacaccca tctctctgtt cttctctgtc ttttccctct ctagtttttt ttcttattct 60
caatttctca taacaatgac taaccagaat atgttgggaa agtcacgtgt gattgtgaat 120
gagaagatat tggaattagc aatgtcgatt tcaaactcta atgttttacc aagaacttca 180
atgcctgaat taatggcttt gtttgatggg cttttaggcc agcgcaaaaa caatctcatt 240
aagcctttgg aagatgataa tgatcacaaa ggagcaacta aagttaacgc gtggattgat 300
tccatgagag cttcatctcc tactcgaacc agacacgatt cagaaaatcg tgaccagact 360
cattggactc ttttccatcc ttctgcgttg aacatgttca gtaaaataat gtacaataca 420
aatgggaaac aaattgttgt ttttcttgac tatgatggaa ctctctcccc aattgtagca 480
gatccagata aagcctacat gagcaaaaag atgagagtga cattgaagga catagcaaga 540
cattttccca ctgccattgt tagtggaagg tgcttaaaca agctatttag ctttgtaagg 600
ttggctgaat tatactatgc tggaagccat gggatggata ttaagggtcc aacaaatagg 660
agaagcacta aaaaaggtaa taatgatggg gtacttttgc agcctgctag tgaatttttg 720
cccatgatca atgaggttta taagatcttg gtggagaaaa caaagtgtgt tccaggggct 780
atggtggaaa ataacaagtt ttgtttatct gtgcattttc ggaacgttga cgaaaagagt 840
tgggaagcat tgggtgaaca agtaagctta gtgatgaatg attacccaaa actaaagcta 900
acacaaggga gaaaagtgtt ggaaattcga ccaattatta aatgggacaa aggaagggct 960
cttgaatttt tgctagagtc acttggtttt gcaaattcta aaggagtatt tccaatctat 1020
attggtgacg atagaaccga cgaagatgct tttaaggttt tacgcaatag gggccaaggg 1080
tgtgggattc ttgtttcaaa aatttcaaaa gaaactaatg cttcttacac tttgcaagat 1140
ccatctgagg ttggagaatt tttgcggcat ttggtggatt ggaaaagaac aagttctcgt 1200
tctcacaagt tgtagagaga gctaggaatc tataaatgag tttagggatt tgacaccgac 1260
ccaagaatct ggtcaagggg tagttaaaat ggcatccctt gtttgaaaat aggaaaatag 1320
tacattttat tgttccataa ttttaatatt ttagggacta gaaagtccaa atagattctc 1380
tttttctttt tttccttttc ttgtttcaat gtataattct attcttgatc tttcacacgt 1440
ttgcatgcgc atgcggatag tgaaagacat atgttttatg cctcatttgt tatatgagac 1500
attataactt tcttactctc tactgtactt aatgtacgtt tggcaaatgt aatactcata 1560
atgaaaattg ccaatttcat ctt 1583
<210>76
<211>379
<212>PRT
＜213〉puncture vine clover
<400>76
Met Thr Asn Gln Asn Met Leu Gly Lys Ser Arg Val Ile Val Asn Glu
1 5 10 15
Lys Ile Leu Glu Leu Ala Met Ser Ile Ser Asn Ser Asn Val Leu Pro
20 25 30
Arg Thr Ser Met Pro Glu Leu Met Ala Leu Phe Asp Gly Leu Leu Gly
35 40 45
Gln Arg Lys Asn Asn Leu Ile Lys Pro Leu Glu Asp Asp Asn Asp His
50 55 60
Lys Gly Ala Thr Lys Val Asn Ala Trp Ile Asp Ser Met Arg Ala Ser
65 70 75 80
Ser Pro Thr Arg Thr Arg His Asp Ser Glu Asn Arg Asp Gln Thr His
85 90 95
Trp Thr Leu Phe His Pro Ser Ala Leu Asn Met Phe Ser Lys Ile Met
100 105 110
Tyr Asn Thr Asn Gly Lys Gln Ile Val Val Phe Leu Asp Tyr Asp Gly
115 120 125
Thr Leu Ser Pro Ile Val Ala Asp Pro Asp Lys Ala Tyr Met Ser Lys
130 135 140
Lys Met Arg Val Thr Leu Lys Asp Ile Ala Arg His Phe Pro Thr Ala
145 150 155 160
Ile Val Ser Gly Arg Cys Leu Asn Lys Leu Phe Ser Phe Val Arg Leu
165 170 175
Ala Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro
180 185 190
Thr Asn Arg Arg Ser Thr Lys Lys Gly Asn Asn Asp Gly Val Leu Leu
195 200 205
Gln Pro Ala Ser Glu Phe Leu Pro Met Ile Asn Glu Val Tyr Lys Ile
210 215 220
Leu Val Glu Lys Thr Lys Cys Val Pro Gly Ala Met Val Glu Asn Asn
225 230 235 240
Lys Phe Cys Leu Ser Val His Phe Arg Asn Val Asp Glu Lys Ser Trp
245 250 255
Glu Ala Leu Gly Glu Gln Val Ser Leu Val Met Asn Asp Tyr Pro Lys
260 265 270
Leu Lys Leu Thr Gln Gly Arg Lys Val Leu Glu Ile Arg Pro Ile Ile
275 280 285
Lys Trp Asp Lys Gly Arg Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly
290 295 300
Phe Ala Asn Ser Lys Gly Val Phe Pro Ile Tyr Ile Gly Asp Asp Arg
305 310 315 320
Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Asn Arg Gly Gln Gly Cys
325 330 335
Gly Ile Leu Val Ser Lys Ile Ser Lys Glu Thr Asn Ala Ser Tyr Thr
340 345 350
Leu Gln Asp Pro Ser Glu Val Gly Glu Phe Leu Arg His Leu Val Asp
355 360 365
Trp Lys Arg Thr Ser Ser Arg Ser His Lys Leu
370 375
<210>77
<211>1665
<212>DNA
＜213〉Ben Shi tobacco (Nicotiana benthamiana)
<400>77
gatcttcatc cctaactcct attccaatcc caatttgtct tcctactttt ttttttctag 60
cattgcgagt aaagaaacct ttcttcggct tcgtcttaac ccaactctca ttcccattcc 120
ccatttttct tttgctacaa aacagagtga aagcagagta cactatcccc tgttcttcaa 180
gattgtatta actgattagt tgaacataat ttaggagtga cgatgactca gcagaatgtg 240
gtagcgtccg accctaaatc cggtattaat ttggcaatac cagtgaaggt acaagtacca 300
tcaaactccc ccgcgctgtt cacgacagtg gcacagaagc cgccaccggc accggggagt 360
tgtatcacca tttcaagaaa aacacttgtt gaaatcaatg ggaataacac tggtgctaga 420
atcaactctt gggttgattc aatgagagct tcctctccta ctcatcacaa gtccactcct 480
cctctttctg atgacatcaa ttcttggatg gtgcaacatc catcagcact ggatatgttt 540
gagcagataa taagtgcttc aaagggaaag caaatagtga tgtttttaga ctatgacggc 600
acactctccc ccattgttga ggatcctgac caagctttca tgtctgatgc tatgagagca 660
acagtgagaa agcttgctag atatttccct actgcaatag tgagtggaag gtgcagagac 720
aaggtataca actttgtacg attggcagag ttgtactacg ctggaagcca tggaatggat 780
ataaaaggac catcaaaagg ttccaaatac aagaaaggag cagaagctgt tctttgccaa 840
ccagcaagtg aatttctacc aatgattgat gaggtttaca aagcattaat tgatgcaaca 900
aaatctacag aaggagttat agtggagaat aacaagtttt gtgcctctgt gcatttccgc 960
tgtgttgatg aaaagaaatg gggtgaacta gcacaagtcg taaggtcagt gcttaaagaa 1020
tatccaaagc tgagattaac acaaggaaga aaagtatttg agatccgtcc tactattaaa 1080
tgggacaaag gcaaagctct tgaattcttg cttgaatccc ttggatatgc taactgtact 1140
gatgtatttc ctgtatatat tggtgatgac cgaaccgatg aagatgcttt taaggttcta 1200
cgagaaagag gacagggttt tggcattctt gtctccaaaa ttccaaaaga cacacatgca 1260
tcttattctt tacaagaacc atctgaggtt atggtgtttt tacgacgctt ggtagagtgg 1320
aaaaagttgt cgttaagaag acagtttaga attcgaaggc aaattgaaga gataaaagca 1380
tctctacgga actaatgaag aattattgtc caaaagtaat ggacttaatg atgcatataa 1440
tgtattttcc ttttataaat ataacaaaag aagttgtaaa agaaaaggtg gaaaagatag 1500
gctttttaat ccttttctat ttggctttaa ggccttgtac atctttgtaa ctagctctgt 1560
acaagggtaa attgtaattt tctagtctta gctaatgcat atattggaag ttctctctct 1620
aagtacatat atactcccta aattgaaaga tgacacattt cgctt 1665
<210>78
<211>390
<212>PRT
＜213〉Ben Shi tobacco
<400>78
Met Thr Gln Gln Asn Val Val Ala Ser Asp Pro Lys Ser Gly Ile Asn
1 5 10 15
Leu Ala Ile Pro Val Lys Val Gln Val Pro Ser Asn Ser Pro Ala Leu
20 25 30
Phe Thr Thr Val Ala Gln Lys Pro Pro Pro Ala Pro Gly Ser Cys Ile
35 40 45
Thr Ile Ser Arg Lys Thr Leu Val Glu Ile Asn Gly Asn Asn Thr Gly
50 55 60
Ala Arg Ile Asn Ser Trp Val Asp Ser Met Arg Ala Ser Ser Pro Thr
65 70 75 80
His His Lys Ser Thr Pro Pro Leu Ser Asp Asp Ile Asn Ser Trp Met
85 90 95
Val Gln His Pro Ser Ala Leu Asp Met Phe Glu Gln Ile Ile Ser Ala
100 105 110
Ser Lys Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu
115 120 125
Ser Pro Ile Val Glu Asp Pro Asp Gln Ala Phe Met Ser Asp Ala Met
130 135 140
Arg Ala Thr Val Arg Lys Leu Ala Arg Tyr Phe Pro Thr Ala Ile Val
145 150 155 160
Ser Gly Arg Cys Arg Asp Lys Val Tyr Asn Phe Val Arg Leu Ala Glu
165 170 175
Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Lys Gly Pro Ser Lys
180 185 190
Gly Ser Lys Tyr Lys Lys Gly Ala Glu Ala Val Leu Cys Gln Pro Ala
195 200 205
Ser Glu Phe Leu Pro Met Ile Asp Glu Val Tyr Lys Ala Leu Ile Asp
210 215 220
Ala Thr Lys Ser Thr Glu Gly Val Ile Val Glu Asn Asn Lys Phe Cys
225 230 235 240
Ala Ser Val His Phe Arg Cys Val Asp Glu Lys Lys Trp Gly Glu Leu
245 250 255
Ala Gln Val Val Arg Ser Val Leu Lys Glu Tyr Pro Lys Leu Arg Leu
260 265 270
Thr Gln Gly Arg Lys Val Phe Glu Ile Arg Pro Thr Ile Lys Trp Asp
275 280 285
Lys Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly Tyr Ala Asn
290 295 300
Cys Thr Asp Val Phe Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu
305 310 315 320
Asp Ala Phe Lys Val Leu Arg Glu Arg Gly Gln Gly Phe Gly Ile Leu
325 330 335
Val Ser Lys Ile Pro Lys Asp Thr His Ala Ser Tyr Ser Leu Gln Glu
340 345 350
Pro Ser Glu Val Met Val Phe Leu Arg Arg Leu Val Glu Trp Lys Lys
355 360 365
Leu Ser Leu Arg Arg Gln Phe Arg Ile Arg Arg Gln Ile Glu Glu Ile
370 375 380
Lys Ala Ser Leu Arg Asn
385 390
<210>79
<211>1675
<212>DNA
＜213〉tobacco (Nicotiana tabacum)
<400>79
ctggctgcag tgataaggtt acttcgaaga ggtggttttt cattgacaaa agggttggtt 60
agaagtgtgt gagacattct aattagtaaa ccgtcgtcaa ctgtttgcat agttgataaa 120
cttgtattct gccataaaaa gatattgggc acaatggacc tgaaatcaaa tacttcccca 180
gttgttactg atcctgcccc aatgactcag tccagattgg gcacccactc tgctttgatg 240
ccatactcac cgactggggc aactttctct cccacactat tccttactat cccaaggaag 300
aagccaggaa tcctagatga tgttagatca aacacttggt tggacgccat gaaatcgtca 360
tctcctacac atagcaagaa aaataaggac tccaatgctg aactaacagc aaatgaaagt 420
gatcttgcct accgcatttg gatgctcaag tacccctcag cactttcatc atttgagcaa 480
atcaccaatt atgcaaaagg caaaaggata gcactctttt tggactatga tgggacttta 540
tcaccaattg tagatgatcc agatcgagcc ttcatgtctg gtgctatgcg cgctactgtg 600
aggaatgtgg ctaaatattt tcccacagca attattagtg ggagaagccg agataaggta 660
tatgactttg tcggactagc agaactttac tatgctggta gtcatgggat ggatataatg 720
ggtcctgttc gatccgtttc tgatgactat agttgtatta gatctactaa caagcagggc 780
aaggaagtta atcttttcca acctgctggt gagttcttac caatgattga tgaggttttt 840
agatctctta ttgagctcac aaaagacatc acgggagcaa aggttgagaa caacaaattc 900
tgtgtttctg tacactatcg taacgtagat gagaagagtt ggtcagctat tggagaatct 960
gttgatgaac tgttaaaaca ctacccacgt ctgcgattga cacatggccg gaaggtttta 1020
gaagtcaggc ctgtgcttaa ctgggacaag gggaaagctg ttgagttctt acttgaatct 1080
ttggggttga aaaattgtga tgatgttctt cccatatacg ttggagatga tcgtacagat 1140
gaagatgcat tcaaggtctt gagagaggga aataaaggct acggaatctt agtatcttct 1200
gcaccaaaag aaagcagtgc gttttactct ctgagggatc catctgaggt gatggaattc 1260
ctcaagtgct tggtatcatg gaagaagtca agtggtttta gctattaaca aggagtacca 1320
ttcaacaaca catatacccc attttgttga attcttttca tatgaagatc taatgacttg 1380
cggatggttt agggagcaga ggtgcttagt gaagcttcta gagacagcaa cagggattca 1440
agtttactgt ttctgctcag agtttttctt tgtaaattcc ttttcgtaat tgccgcatca 1500
aggatgccct taagtcaatg tatagtcatc ttcgtatttt atttttcaag ttgtatgttg 1560
ttttaacttt ggcgtcagtt ctccccaagg gagagtgtac caacaactga aatgcttaat 1620
acatcaagta cgaacttaat ttagtaaaaa aaaaaaaaaa aaaaaaaaaa aaaaa 1675
<210>80
<211>384
<212>PRT
＜213〉tobacco
<400>80
Met Asp Leu Lys Ser Asn Thr Ser Pro Val Val Thr Asp Pro Ala Pro
1 5 10 15
Met Thr Gln Ser Arg Leu Gly Thr His Ser Ala Leu Met Pro Tyr Ser
20 25 30
Pro Thr Gly Ala Thr Phe Ser Pro Thr Leu Phe Leu Thr Ile Pro Arg
35 40 45
Lys Lys Pro Gly Ile Leu Asp Asp Val Arg Ser Asn Thr Trp Leu Asp
50 55 60
Ala Met Lys Ser Ser Ser Pro Thr His Ser Lys Lys Asn Lys Asp Ser
65 70 75 80
Asn Ala Glu Leu Thr Ala Asn Glu Ser Asp Leu Ala Tyr Arg Ile Trp
85 90 95
Met Leu Lys Tyr Pro Ser Ala Leu Ser Ser Phe Glu Gln Ile Thr Asn
100 105 110
Tyr Ala Lys Gly Lys Arg Ile Ala Leu Phe Leu Asp Tyr Asp Gly Thr
115 120 125
Leu Ser Pro Ile Val Asp Asp Pro Asp Arg Ala Phe Met Ser Gly Ala
130 135 140
Met Arg Ala Thr Val Arg Asn Val Ala Lys Tyr Phe Pro Thr Ala Ile
145 150 155 160
Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr Asp Phe Val Gly Leu Ala
165 170 175
Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Met Gly Pro Val
180 185 190
Arg Ser Val Ser Asp Asp Tyr Ser Cys Ile Arg Ser Thr Asn Lys Gln
195 200 205
Gly Lys Glu Val Asn Leu Phe Gln Pro Ala Gly Glu Phe Leu Pro Met
210 215 220
Ile Asp Glu Val Phe Arg Ser Leu Ile Glu Leu Thr Lys Asp Ile Thr
225 230 235 240
Gly Ala Lys Val Glu Asn Asn Lys Phe Cys Val Ser Val His Tyr Arg
245 250 255
Asn Val Asp Glu Lys Ser Trp Ser Ala Ile Gly Glu Ser Val Asp Glu
260 265 270
Leu Leu Lys His Tyr Pro Arg Leu Arg Leu Thr His Gly Arg Lys Val
275 280 285
Leu Glu Val Arg Pro Val Leu Asn Trp Asp Lys Gly Lys Ala Val Glu
290 295 300
Phe Leu Leu Glu Ser Leu Gly Leu Lys Asn Cys Asp Asp Val Leu Pro
305 310 315 320
Ile Tyr Val Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu
325 330 335
Arg Glu Gly Asn Lys Gly Tyr Gly Ile Leu Val Ser Ser Ala Pro Lys
340 345 350
Glu Ser Ser Ala Phe Tyr Ser Leu Arg Asp Pro Ser Glu Val Met Glu
355 360 365
Phe Leu Lys Cys Leu Val Ser Trp Lys Lys Ser Ser Gly Phe Ser Tyr
370 375 380
<210>81
<211>1471
<212>DNA
＜213〉tobacco
<400>81
ctttgttcct tacttctcta ttttctttca cttaaacaca cagaagcaga gaagtttaat 60
tattcatttc tctgactctg tgtttctcta atttcttctc ttacggattc caattcctct 120
gtttttttaa tcttttcaag ggtaattttg tgttgccaaa tgacgaacca gaatgtgatt 180
gtttctgacc caagatcagg gttggagtct tctttcttat cgttctcacc ggcggtaccc 240
ggtccactac cgccgccggg gagattcatc gccgttccgg caaagaaatc atttaagaac 300
attgagtctg ctgccggaga tcatggagct aataggatta ctgctttact tgattccatg 360
agagcttctt ccccacctcg tagatcctct gaaactgaga atctcaagtc ttggattgtt 420
catcatccct cagctttgaa catgttcgag gaaattataa atgcttcaaa agggaaacaa 480
ataataatgt ttttggacta tgatggtaca ttgtctccta ttgttgatga tcctgacaaa 540
gcctttatga ctgctgagat gagggaagca gtgagagaca catccaagta ttttcctaca 600
gcaatagtga gtggaagatg cagagcaaaa gtctttaatt tcgtaaagtt atcagaactg 660
tattatgctg gaagtcatgg aatggacatt aaggcgcctg ctaaaggacg caaatataga 720
aatggaaata atcgaactgt tctctgccaa cctgccagag aatttttacc catgattgat 780
gaggtatata aatctttagt ggagaaaaca aaatctatag caggagctaa agtggaaaac 840
aacaaattct gcttatccgt acatttccgt cgtgttgaag agaaggtgtg gactgaatta 900
gctgagcaag tgaagtcagt gactaaggaa tacccaaaac ttcgattaac tcaaggaaga 960
aaggttttgg agattcgtcc cagcattaaa tgggacaagg gaaaggcact tgaatttttg 1020
ttggaatcat tagggtatgc taattcaaat gatgttctgc ctatatacat tggcgatgat 1080
cgaacagatg aagatgcttt caaggttttg cgtgacagag gacaaggttt tggaatatta 1140
gtgtccaaag cacctaaaga aacgaatgct tcctattctt tgcaagagcc attagaggtt 1200
atgtactttt taaatcgttt tgtggagtgg aaaagatcgt cctcgcaaag atatcagagg 1260
aaataaaatc cagaagagta gctcacacca agagttgacc ctttaaccct ggaagttttg 1320
ttggggatgg gtttagaaat taaagagctt taatttgtag caccttttct ttttggaaga 1380
ctcaactgta attgaaaaaa tggagaaatt tttgtaattt tccgagtata aattcaataa 1440
gaaagtattg tgcacttctc acttatatcc t 1471
<210>82
<211>368
<212>PRT
＜213〉tobacco
<400>82
Met Thr Asn Gln Asn Val Ile Val Ser Asp Pro Arg Ser Gly Leu Glu
1 5 10 15
Ser Ser Phe Leu Ser Phe Ser Pro Ala Val Pro Gly Pro Leu Pro Pro
20 25 30
Pro Gly Arg Phe Ile Ala Val Pro Ala Lys Lys Ser Phe Lys Asn Ile
35 40 45
Glu Ser Ala Ala Gly Asp His Gly Ala Asn Arg Ile Thr Ala Leu Leu
50 55 60
Asp Ser Met Arg Ala Ser Ser Pro Pro Arg Arg Ser Ser Glu Thr Glu
65 70 75 80
Asn Leu Lys Ser Trp Ile Val His His Pro Ser Ala Leu Asn Met Phe
85 90 95
Glu Glu Ile Ile Asn Ala Ser Lys Gly Lys Gln Ile Ile Met Phe Leu
100 105 110
Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Lys Ala
115 120 125
Phe Met Thr Ala Glu Met Arg Glu Ala Val Arg Asp Thr Ser Lys Tyr
130 135 140
Phe Pro Thr Ala Ile Val Ser Gly Arg Cys Arg Ala Lys Val Phe Asn
145 150 155 160
Phe Val Lys Leu Ser Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp
165 170 175
Ile Lys Ala Pro Ala Lys Gly Arg Lys Tyr Arg Asn Gly Asn Asn Arg
180 185 190
Thr Val Leu Cys Gln Pro Ala Arg Glu Phe Leu Pro Met Ile Asp Glu
195 200 205
Val Tyr Lys Ser Leu Val Glu Lys Thr Lys Ser Ile Ala Gly Ala Lys
210 215 220
Val Glu Asn Asn Lys Phe Cys Leu Ser Val His Phe Arg Arg Val Glu
225 230 235 240
Glu Lys Val Trp Thr Glu Leu Ala Glu Gln Val Lys Ser Val Thr Lys
245 250 255
Glu Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys Val Leu Glu Ile
260 265 270
Arg Pro Ser Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu
275 280 285
Glu Ser Leu Gly Tyr Ala Asn Ser Asn Asp Val Leu Pro Ile Tyr Ile
290 295 300
Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Asp Arg
305 310 315 320
Gly Gln Gly Phe Gly Ile Leu Val Ser Lys Ala Pro Lys Glu Thr Asn
325 330 335
Ala Ser Tyr Ser Leu Gln Glu Pro Leu Glu Val Met Tyr Phe Leu Asn
340 345 350
Arg Phe Val Glu Trp Lys Arg Ser Ser Ser Gln Arg Tyr Gln Arg Lys
355 360 365
<210>83
<211>1609
<212>DNA
＜213〉dichromatism chinese sorghum (Sorghum bicolor)
<220>
＜221〉variation
<222>(1582)..(1582)
＜223 〉/replace=" c "/replace=" g "/replace=" t "
<400>83
gcacgaggac caatcatttc tttccaacaa atctccagcc tctgctgctg ctaataaact 60
gatcgatcgc gttgttcttg ataatcatca gtcgaccgat cgcgatcggg atggcgaagc 120
ctagcgtggc ggcggtgccg gaggttgttg gcgtgccagc agcagcgcag gcgacgacgc 180
tgttcccgta cccgccaccg cgtggcgccg ggatcacagc cgccgtcgtg cgccgcaagt 240
gcctgcaggt ggagctcggc gcgggggcgg ccgggccgct gctgggcggc gcgtgctggg 300
gcgtggagtc gatgcgcgcg tcgtccccca cgcacgccaa ggccgccgcc gcgctcgccg 360
ccggcgtcga cgaggagcgc cgcgccgcct ggacggtgcg gcacccgtcg gcgctgggca 420
agttcgagca gatcgtggcg gcgtccgagg gcaagcggat cgtcatgttc ctcgactacg 480
acggcacgct gtcgcccatc gtggacgacc ccgacgccgc cttcatgagc gagacgatgc 540
ggatggccgt gcgtagcgtc gccaagcatt tcccgacggc gatcgtgagc gggcggtgcc 600
gggacaaggt gttcgagttc gtgaagctgg cggagctgta ctacgccggc agccacggca 660
tggacatcag aggcccagcc aaggcctctt cccggcacgc aaaggccaag gcaaaaggcg 720
ttctgttcca gccggcgagc gagttcctgc ccatgatcga ggaggtgcac gaccgccttg 780
tcgagacgac gcgctgcatc ccgggggcca aggtggagaa caacaagttc tgcgtctccg 840
tccacttcag atgcgtcgac gaaaagatgt ggggcgagct gtcagagtcg gtgaagggcg 900
tgctgcggga gtacccgaag ctgcggctga cacaggggcg gatggtgttc gaggtgcgtc 960
ccaccatcaa atgggacaag ggcaaggccc tcgagttcct gctcgagtcg ctcggcttcg 1020
cggactgcag caacgtcctg cccgtgtaca tcggcgacga ccgcaccgac gaggacgcct 1080
tcaaggtgct gcggcgccgg ggccagggcc acggcgtcgg gatcctcgtg tccaagcacc 1140
ccaaggagac gtccgcctcc tactccctcc aagagcccgc cgaggtgatg gagttcttgc 1200
tgcggctcgt cgagtggaag caactctcca gggcaaggct catcaggctg caatgagatt 1260
gagatggacg acgcaacgga tcaagctaac tgtcaggtgc taattaagag atcctgctac 1320
gtgaaatcgt gaatggcaga gaatctggca ctgtattgtg tcttctctac tgtcccgtag 1380
tcatctgttt tcctctccct tctctgtacg tgttccctgg gaacctctct ggcctctgct 1440
aggcgtgtgt gtaagtgttt aacaagcatg catgtacatt agtattacct aatagtagtt 1500
aacttatatg ctacatatat atatatatat atgtagtaca gtatatacaa gagggaagaa 1560
tatatgaagc aacgaagacc gaaaaaaatt atgtctcgtt caaggtttt 1609
<210>84
<211>381
<212>PRT
＜213〉dichromatism chinese sorghum
<400>84
Met Ala Lys Pro Ser Val Ala Ala Val Pro Glu Val Val Gly Val Pro
1 5 10 15
Ala Ala Ala Gln Ala Thr Thr Leu Phe Pro Tyr Pro Pro Pro Arg Gly
20 25 30
Ala Gly Ile Thr Ala Ala Val Val Arg Arg Lys Cys Leu Gln Val Glu
35 40 45
Leu Gly Ala Gly Ala Ala Gly Pro Leu Leu Gly Gly Ala Cys Trp Gly
50 55 60
Val Glu Ser Met Arg Ala Ser Ser Pro Thr His Ala Lys Ala Ala Ala
65 70 75 80
Ala Leu Ala Ala Gly Val Asp Glu Glu Arg Arg Ala Ala Trp Thr Val
85 90 95
Arg His Pro Ser Ala Leu Gly Lys Phe Glu Gln Ile Val Ala Ala Ser
100 105 110
Glu Gly Lys Arg Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser
115 120 125
Pro Ile Val Asp Asp Pro Asp Ala Ala Phe Met Ser Glu Thr Met Arg
130 135 140
Met Ala Val Arg Ser Val Ala Lys His Phe Pro Thr Ala Ile Val Ser
145 150 155 160
Gly Arg Cys Arg Asp Lys Val Phe Glu Phe Val Lys Leu Ala Glu Leu
165 170 175
Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Arg Gly Pro Ala Lys Ala
180 185 190
Ser Ser Arg His Ala Lys Ala Lys Ala Lys Gly Val Leu Phe Gln Pro
195 200 205
Ala Ser Glu Phe Leu Pro Met Ile Glu Glu Val His Asp Arg Leu Val
210 215 220
Glu Thr Thr Arg Cys Ile Pro Gly Ala Lys Val Glu Asn Asn Lys Phe
225 230 235 240
Cys Val Ser Val His Phe Arg Cys Val Asp Glu Lys Met Trp Gly Glu
245 250 255
Leu Ser Glu Ser Val Lys Gly Val Leu Arg Glu Tyr Pro Lys Leu Arg
260 265 270
Leu Thr Gln Gly Arg Met Val Phe Glu Val Arg Pro Thr Ile Lys Trp
275 280 285
Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly Phe Ala
290 295 300
Asp Cys Ser Asn Val Leu Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp
305 310 315 320
Glu Asp Ala Phe Lys Val Leu Arg Arg Arg Gly Gln Gly His Gly Val
325 330 335
Gly Ile Leu Val Ser Lys His Pro Lys Glu Thr Ser Ala Ser Tyr Ser
340 345 350
Leu Gln Glu Pro Ala Glu Val Met Glu Phe Leu Leu Arg Leu Val Glu
355 360 365
Trp Lys Gln Leu Ser Arg Ala Arg Leu Ile Arg Leu Gln
370 375 380
<210>85
<211>1333
<212>DNA
＜213〉potato (Solanum tuberosum)
<400>85
gcccaaatcc ggtattaatc tgacaatacc ggtatcgaac tcgtcggcgt tatttacgac 60
ggcagctcag aagccaccgc cagggccggg gagttgtata actatttcaa gaaagacact 120
tgttgaaatt aatgggaata atagtgctag aatcaattct tgggttgaat caatgagagc 180
ttcctctcct actcatcata agtccagtcc tgctctttca gatgacttga attcttggat 240
ggtgcaacat ccatcagcac tggatatgtt tgagcagata atcagtgctt caaagggaaa 300
acaaattgtg atgtttttag actatgatgg cactctttcc cccattgttg aagatcctga 360
tcaagctttc atgtctgatg ctatgcgagc aacagtgaga aaacttgcta gatatttccc 420
tactgcaata gtgagtggaa ggtgcagaga caaggtatac agctttgtac gattggcaga 480
gttgtactat gctggtagcc atggaatgga tataaaaggg ccatcaaaag gttccaaata 540
caagaaagga gcgcaagctg ttcttttcca accagcaagt gaatttctcc ctatgattga 600
tgaggtttac aaaaaacttg tagatataac aaaatctaca gaaggagtta gagttgaaaa 660
taacaagttt tgtgcctctg tacatttccg ctgtgttgat gaaaagaaat ggggtgaact 720
agcacaagta gtaagatcag tgcttaaaga atacccaaag cttcgattga cacaaggaag 780
aaaagtatta gagattcgtc caactattaa atgggacaag ggcaaagctc tcgaattctt 840
gctcgaatca cttggatatg ctaactgtac tgatgtcttt cctgtatata ttggtgatga 900
tcgaaccgat gaagatgctt tcaaggtcct aagagaaaga gatcaaggtt ttggcattct 960
tgtctccaaa actccaaaag acacacacgc atcttattct ttgcaagaac catctgaggt 1020
tatggtgttt ctacgacgtt tggtagagtg gaaaaagttg tcattaagaa gacaatttcg 1080
aattcgaaga caaattgagg agatgaaagc atctctaagg aactaagaat ttgtccaaag 1140
tgaatatgga cttaatgatg catataatgt attttccttt tatcaaatat aacaaagaag 1200
tattaagaaa gaaaaaggta aaaaagaaat taaaagcttt tttttttatc cttttctctt 1260
tggctttaag gccttgtaca tctttgtaat tttcccagtc ttgcctaaat gcatataatg 1320
gaagttctct ctc 1333
<210>86
<211>317
<212>PRT
＜213〉potato
<400>86
Met Arg Ala Ser Ser Pro Thr His His Lys Ser Ser Pro Ala Leu Ser
1 5 10 15
Asp Asp Leu Asn Ser Trp Met Val Gln His Pro Ser Ala Leu Asp Met
20 25 30
Phe Glu Gln Ile Ile Ser Ala Ser Lys Gly Lys Gln Ile Val Met Phe
35 40 45
Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Glu Asp Pro Asp Gln
50 55 60
Ala Phe Met Ser Asp Ala Met Arg Ala Thr Val Arg Lys Leu Ala Arg
65 70 75 80
Tyr Phe Pro Thr Ala Ile Val Ser Gly Arg Cys Arg Asp Lys Val Tyr
85 90 95
Ser Phe Val Arg Leu Ala Glu Leu Tyr Tyr Ala Gly Ser His Gly Met
100 105 110
Asp Ile Lys Gly Pro Ser Lys Gly Ser Lys Tyr Lys Lys Gly Ala Gln
115 120 125
Ala Val Leu Phe Gln Pro Ala Ser Glu Phe Leu Pro Met Ile Asp Glu
130 135 140
Val Tyr Lys Lys Leu Val Asp Ile Thr Lys Ser Thr Glu Gly Val Arg
145 150 155 160
Val Glu Asn Asn Lys Phe Cys Ala Ser Val His Phe Arg Cys Val Asp
165 170 175
Glu Lys Lys Trp Gly Glu Leu Ala Gln Val Val Arg Ser Val Leu Lys
180 185 190
Glu Tyr Pro Lys Leu Arg Leu Thr Gln Gly Arg Lys Val Leu Glu Ile
195 200 205
Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu
210 215 220
Glu Ser Leu Gly Tyr Ala Asn Cys Thr Asp Val Phe Pro Val Tyr Ile
225 230 235 240
Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Glu Arg
245 250 255
Asp Gln Gly Phe Gly Ile Leu Val Ser Lys Thr Pro Lys Asp Thr His
260 265 270
Ala Ser Tyr Ser Leu Gln Glu Pro Ser Glu Val Met Val Phe Leu Arg
275 280 285
Arg Leu Val Glu Trp Lys Lys Leu Ser Leu Arg Arg Gln Phe Arg Ile
290 295 300
Arg Arg Gln Ile Glu Glu Met Lys Ala Ser Leu Arg Asn
305 310 315
<210>87
<211>1594
<212>DNA
＜213〉common wheat
<400>87
ccacgcgtcc gtttcctctt cactgtctct tctccttttc tgccttccaa ccaaagcccc 60
atcccttgat tcgatcgatc gggatcctcc tctcgcgcgc ttctaggacc tgcccctcga 120
agcttctcct tctccttgga cccgtgcttg gtatggcgca gacgactgtg gtggtgccgg 180
aggtgggcat gacggctgcc acgcccactg cgtgcccctg ccctgggtcg ctgttcccgt 240
acccgccgcc gcgtgccggg atggccgtga gccgcaagtg cctgcgggcg gcgcaggcgg 300
agcttggcgc ggggatgctc agtggcctgg tcgagtccat gcgggcgtcc tcccccacgc 360
acgccagggc cgccgccgcc ctcgccgccg gcgtcgacga cgagcacgcc gcctggatgg 420
caaggcaccc gtccgccctg ggaaagttcg aggagatcgt ggccgcgtcc aaggggaagc 480
agatcgtcat gttcctggac tacgacggca cgctgtcccc catcgtcgat gaccccgacg 540
ccgccttcat gagcgagacg atgcggatgg cagtgcgcag cgtggccaag cacttcccga 600
cggcgatcgt gagcggtcgg tgccgcgaca aggtgtttga gttcgtgaag ctggcggagc 660
tctactacgc cggcagccac ggcatggaca tcaagggccc ggccaaatcc tcaaagtcca 720
aggccaaagg agttctcttc caaccagcaa gcgagttcct gcccatgata gaagaggtgc 780
atcagcggct gatagaggag acgaagcacg tagccggggc caaggtggag aacaacaagt 840
tctgcgtgtc cgtccacttc agatgcgtcg acgaaaagag ctggggcgcg ctggcggaga 900
cggtgaaggg cgtgatgcgg gagtacccga agctgcgcat gtcgcagggg cggatggtgt 960
tcgaggtgcg gcccaccatc aagtgggaca agggcaaggc cctcgagttc ctgctcgagt 1020
cgctgggctt cgccgactgc cccaacgtgc tccccgtcta catcggcgac gaccgcaccg 1080
acgaggacgc cttcaaggtg ctgcgccggc ggggccaggg cgtcgggatc ctcgtctcca 1140
agcaccccaa ggacaccagc gcctccttct cgctgcagga gccggccgag gtcatggagt 1200
tcctgctccg cctcgtcgag tggaagcagc tctccaaggc gcgcctcagg ctgcggcggc 1260
aggccgacgc ctgatcggac gacgaggatc ggccggccgg cgggaatggc cgaactaatt 1320
atttcactgc tacgtgtagc ttagctagtt aatgaaaatc ccctgcttgc tcatccgaac 1380
aaagccaaag gctacgtacg tggatgggaa gaaggaacgt actacggcga acctgcggag 1440
cattgttgcg ccacatgttg tgttctaatt aaccgtcctt ctttttctgg ggatgtatac 1500
cgtacctacc gattatgcat gcatgtaaat tacctttgtc cacgtacaag gggaggaacc 1560
atggaataaa caaagagaaa catgagtaaa tagc 1594
<210>88
<211>373
<212>PRT
＜213〉common wheat
<400>88
Met Ala Gln Thr Thr Val Val Val Pro Glu Val Gly Met Thr Ala Ala
1 5 10 15
Thr Pro Thr Ala Cys Pro Cys Pro Gly Ser Leu Phe Pro Tyr Pro Pro
20 25 30
Pro Arg Ala Gly Met Ala Val Ser Arg Lys Cys Leu Arg Ala Ala Gln
35 40 45
Ala Glu Leu Gly Ala Gly Met Leu Ser Gly Leu Val Glu Ser Met Arg
50 55 60
Ala Ser Ser Pro Thr His Ala Arg Ala Ala Ala Ala Leu Ala Ala Gly
65 70 75 80
Val Asp Asp Glu His Ala Ala Trp Met Ala Arg His Pro Ser Ala Leu
85 90 95
Gly Lys Phe Glu Glu Ile Val Ala Ala Ser Lys Gly Lys Gln Ile Val
100 105 110
Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp Asp Pro
115 120 125
Asp Ala Ala Phe Met Ser Glu Thr Met Arg Met Ala Val Arg Ser Val
130 135 140
Ala Lys His Phe Pro Thr Ala Ile Val Ser Gly Arg Cys Arg Asp Lys
145 150 155 160
Val Phe Glu Phe Val Lys Leu Ala Glu Leu Tyr Tyr Ala Gly Ser His
165 170 175
Gly Met Asp Ile Lys Gly Pro Ala Lys Ser Ser Lys Ser Lys Ala Lys
180 185 190
Gly Val Leu Phe Gln Pro Ala Ser Glu Phe Leu Pro Met Ile Glu Glu
195 200 205
Val His Gln Arg Leu Ile Glu Glu Thr Lys His Val Ala Gly Ala Lys
210 215 220
Val Glu Asn Asn Lys Phe Cys Val Ser Val His Phe Arg Cys Val Asp
225 230 235 240
Glu Lys Ser Trp Gly Ala Leu Ala Glu Thr Val Lys Gly Val Met Arg
245 250 255
Glu Tyr Pro Lys Leu Arg Met Ser Gln Gly Arg Met Val Phe Glu Val
260 265 270
Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu
275 280 285
Glu Ser Leu Gly Phe Ala Asp Cys Pro Asn Val Leu Pro Val Tyr Ile
290 295 300
Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Arg Arg
305 310 315 320
Gly Gln Gly Val Gly Ile Leu Val Ser Lys His Pro Lys Asp Thr Ser
325 330 335
Ala Ser Phe Ser Leu Gln Glu Pro Ala Glu Val Met Glu Phe Leu Leu
340 345 350
Arg Leu Val Glu Trp Lys Gln Leu Ser Lys Ala Arg Leu Arg Leu Arg
355 360 365
Arg Gln Ala Asp Ala
370
<210>89
<2ll>1086
<212>DNA
＜213〉Zea mays (Zea mays)
<400>89
atgacgaagc acgccgccta ctccagcgag gacgtggtcg cggccgtggc ggcgccggcg 60
ccggccggcc ggcatttcac gtcgttccag gcgctgaagg gcgcgcccct cgactgcaag 120
aagcacgccg ccgtggacct gtccgcgtcc ggggcggccg tcgtgggcgg cggcccctgg 180
tttgagtcca tgaaggcttc gtcgccgcgg cgcgccgccg acgccgagca cggcgactgg 240
atggagaagc acccgtccgc attggcccag ttcgagccgc tgcttgccgc cgccaagggg 300
aagcagatcg tgatgttcct ggactacgac ggcaccctgt caccgatcgt cgaggacccc 360
gaccgcgccg tcatgtcgga ggagatgaga gaagccgtgc ggcgcgtcgc cgagcacttc 420
cccaccgcga ttgtgagcgg aagatgcagg gacaaggtgc tcaacttcgt gaagctgacg 480
gagctgtact acgccgggag ccatggcatg gacatccagg gccccgccgc ctgcaggcag 540
cccaaccacg tccagcaggc tgaagccgca gctgtccatt accaagctgc gagtgagttc 600
ctgccggtca tcgaagaggt gttccgcacg ctgacggcca agatggagtc catcgccggc 660
gccagggtgg agcacaacaa gtactgcctg tccgtccact tccgctgcgt ccgggaggag 720
gaatggaatg ccgtgaacga ggaggtcagg tcggtgctca gggagtaccc gaacctcaag 780
ctcactcacg gcagaaaggt gctggagatt cgtccgtcca tcaagtggga caagggcaag 840
gccctcgagt tcttgctcaa gtctcttggc tatgctgggc gcaacgacgt cttcccgatt 900
tacatcggag atgatcgcac tgacgaggac gctttcaagg tgctccgcaa catggggcag 960
ggcatcggaa tcctggtgtc caagcttcct aaggagacgg cggcatccta ctcgctgagt 1020
gaccctgccg aggtcaagga gttcctccgc aagctggcca ataagaaggg ggcgcgccaa 1080
ccatga 1086
<210>90
<211>361
<212>PRT
＜213〉Zea mays
<400>90
Met Thr Lys His Ala Ala Tyr Ser Ser Glu Asp Val Val Ala Ala Val
1 5 10 15
Ala Ala Pro Ala Pro Ala Gly Arg His Phe Thr Ser Phe Gln Ala Leu
20 25 30
Lys Gly Ala Pro Leu Asp Cys Lys Lys His Ala Ala Val Asp Leu Ser
35 40 45
Ala Ser Gly Ala Ala Val Val Gly Gly Gly Pro Trp Phe Glu Ser Met
50 55 60
Lys Ala Ser Ser Pro Arg Arg Ala Ala Asp Ala Glu His Gly Asp Trp
65 70 75 80
Met Glu Lys His Pro Ser Ala Leu Ala Gln Phe Glu Pro Leu Leu Ala
85 90 95
Ala Ala Lys Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr
100 105 110
Leu Ser Pro Ile Val Glu Asp Pro Asp Arg Ala Val Met Ser Glu Glu
115 120 125
Met Arg Glu Ala Val Arg Arg Val Ala Glu His Phe Pro Thr Ala Ile
130 135 140
Val Ser Gly Arg Cys Arg Asp Lys Val Leu Asn Phe Val Lys Leu Thr
145 150 155 160
Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Gln Gly Pro Ala
165 170 175
Ala Cys Arg Gln Pro Asn His Val Gln Gln Ala Glu Ala Ala Ala Val
180 185 190
His Tyr Gln Ala Ala Ser Glu Phe Leu Pro Val Ile Glu Glu Val Phe
195 200 205
Arg Thr Leu Thr Ala Lys Met Glu Ser Ile Ala Gly Ala Arg Val Glu
210 215 220
His Asn Lys Tyr Cys Leu Ser Val His Phe Arg Cys Val Arg Glu Glu
225 230 235 240
Glu Trp Asn Ala Val Asn Glu Glu Val Arg Ser Val Leu Arg Glu Tyr
245 250 255
Pro Asn Leu Lys Leu Thr His Gly Arg Lys Val Leu Glu Ile Arg Pro
260 265 270
Ser Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu Phe Leu Leu Lys Ser
275 280 285
Leu Gly Tyr Ala Gly Arg Asn Asp Val Phe Pro Ile Tyr Ile Gly Asp
290 295 300
Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Asn Met Gly Gln
305 310 315 320
Gly Ile Gly Ile Leu Val Ser Lys Leu Pro Lys Glu Thr Ala Ala Ser
325 330 335
Tyr Ser Leu Ser Asp Pro Ala Glu Val Lys Glu Phe Leu Arg Lys Leu
340 345 350
Ala Asn Lys Lys Gly Ala Arg Gln Pro
355 360
<210>91
<211>1066
<212>DNA
＜213〉Zea mays
<400>91
atgacgaagc gcaccgcctt cgccgcggac gacgcgatca tcgccgccgc cgccgccgtc 60
acgtcgcagc ccggccggcg gttcacgtcg tacccgccgg cgagggcgcg cggcggatgc 120
aggctggccc cggcggcggc ggcgcgccag gccacggacg accccggcgc cgctgggtcc 180
tggccagaac tagtcgtgcc gcggcacgcc gacttcgacg actggatgga gaagcacccg 240
tcggcattgg ccgcgttcga gtcggtgctg gccgccgcca aaggcaagaa gatcgtcatg 300
ttcctcgact acgacggcac cctgtcgccg atcgtcaggg accccgacag cgccgtcatg 360
tccgaggaga tgcgggacgc ggtgagaggc gtggccgagc acttcccgac ggcgatcgtg 420
agcgggaggt gtagagacaa ggtgttcaac ttcgtgaagc tggcggagct gtactacgcc 480
gggagccacg gcatggacat caagggcccc acagcacagt ccaagcacac caaggcaaag 540
gccggagccg ttctatgcca acctgcgagg gcgttcctgc cggtcattga ggaggtgtac 600
cgcgcgctga cggcgagcac ggcgccgatc cccggcgcga cggtggagaa caacaagttc 660
tgcctctccg tccacttccg ctgcgtccag gaggagaaat ggcgcgctct ggaggagcag 720
gtccggtcgg tgctcaagga gtacccggac ctccgcctca ccaagggcag gaaggtcctc 780
gagatccggc cgtccatcaa gtgggacaag ggcaacgccc tgcagttctt gctcgagtct 840
ctcggttttg ctggcagtaa cagtgtcttc ccgatatata tcggagacga tagcaccgac 900
gaggacgcgt tcaaggtcct gcgcaacttg gggcaaggga tcgggatcct ggtgagcaag 960
attccgaagg agacccgcgc atcctactcc ctgcgtgaac cttctgaggt ggaggagttc 1020
ctgcgcaagt tggtcagctg gtccaaggag agcaggcaac gggact 1066
<210>92
<211>355
<212>PRT
＜213〉Zea mays
<400>92
Met Thr Lys Arg Thr Ala Phe Ala Ala Asp Asp Ala Ile Ile Ala Ala
1 5 10 15
Ala Ala Ala Val Thr Ser Gln Pro Gly Arg Arg Phe Thr Ser Tyr Pro
20 25 30
Pro Ala Arg Ala Arg Gly Gly Cys Arg Leu Ala Pro Ala Ala Ala Ala
35 40 45
Arg Gln Ala Thr Asp Asp Pro Gly Ala Ala Gly Ser Trp Pro Glu Leu
50 55 60
Val Val Pro Arg His Ala Asp Phe Asp Asp Trp Met Glu Lys His Pro
65 70 75 80
Ser Ala Leu Ala Ala Phe Glu Ser Val Leu Ala Ala Ala Lys Gly Lys
85 90 95
Lys Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val
100 105 110
Arg Asp Pro Asp Ser Ala Val Met Ser Glu Glu Met Arg Asp Ala Val
115 120 125
Arg Gly Val Ala Glu His Phe Pro Thr Ala Ile Val Ser Gly Arg Cys
130 135 140
Arg Asp Lys Val Phe Asn Phe Val Lys Leu Ala Glu Leu Tyr Tyr Ala
145 150 155 160
Gly Ser His Gly Met Asp Ile Lys Gly Pro Thr Ala Gln Ser Lys His
165 170 175
Thr Lys Ala Lys Ala Gly Ala Val Leu Cys Gln Pro Ala Arg Ala Phe
180 185 190
Leu Pro Val Ile Glu Glu Val Tyr Arg Ala Leu Thr Ala Ser Thr Ala
195 200 205
Pro Ile Pro Gly Ala Thr Val Glu Asn Asn Lys Phe Cys Leu Ser Val
210 215 220
His Phe Arg Cys Val Gln Glu Glu Lys Trp Arg Ala Leu Glu Glu Gln
225 230 235 240
Val Arg Ser Val Leu Lys Glu Tyr Pro Asp Leu Arg Leu Thr Lys Gly
245 250 255
Arg Lys Val Leu Glu Ile Arg Pro Ser Ile Lys Trp Asp Lys Gly Asn
260 265 270
Ala Leu Gln Phe Leu Leu Glu Ser Leu Gly Phe Ala Gly Ser Asn Ser
275 280 285
Val Phe Pro Ile Tyr Ile Gly Asp Asp Ser Thr Asp Glu Asp Ala Phe
290 295 300
Lys Val Leu Arg Asn Leu Gly Gln Gly Ile Gly Ile Leu Val Ser Lys
305 310 315 320
Ile Pro Lys Glu Thr Arg Ala Ser Tyr Ser Leu Arg Glu Pro Ser Glu
325 330 335
Val Glu Glu Phe Leu Arg Lys Leu Val Ser Trp Ser Lys Glu Ser Arg
340 345 350
Gln Arg Asp
355
<210>93
<211>277
<212>PRT
＜213〉artificial sequence
<220>
＜223〉total treahalose phosphate phosphatase domain
<220>
＜221〉uncertain
<222>(1)..(1)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(10)..(10)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(12)..(14)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜22l〉uncertain
<222>(16)..(17)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(19)..(20)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(22)..(24)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(26)..(28)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜22l〉uncertain
<222>(30)..(31)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(35)..(39)
＜223〉xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(41)..(41)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(47)..(50)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(52)..(66)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(68)..(69)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(71)..(71)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(78)..(79)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(82)..(114)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(116)..(116)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜22l〉uncertain
<222>(118)..(120)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(122)..(123)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(126)..(129)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(131)..(131)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜22l〉uncertain
<222>(136)..(136)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(139)..(139)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(141)..(142)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(150)..(150)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(153)..(159)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜22l〉uncertain
<222>(161)..(162)
＜223〉xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(164)..(166)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(168)..(176)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(178)..(178)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(180)..(181)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(184)..(184)
＜223〉xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(191)..(193)
＜223〉xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(195)..(195)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(198)..(198)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(201)..(202)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(205)..(206)
＜223〉xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(208)..(230)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(233)..(233)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(238)..(239)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(246)..(247)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(249)..(261)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜22l〉uncertain
<222>(265)..(270)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(272)..(272)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(274)..(276)
＜223〉Xaa can be the amino acid of any natural generation
<400>93
Xaa Leu Asp Tyr Asp Gly Thr Leu Ser Xaa Ile Xaa Xaa Xaa Pro Xaa
1 5 10 15
Xaa Ala Xaa Xaa Ser Xaa Xaa Xaa Leu Xaa Xaa Xaa Leu Xaa Xaa Leu
20 25 30
Ala Ser Xaa Xaa Xaa Xaa Xaa Val Xaa Ile Val Ser Gly Arg Xaa Xaa
35 40 45
Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
50 55 60
Xaa Xaa Val Xaa Xaa Leu Xaa Leu Ala Ala Glu His Gly Xaa Xaa Ile
65 70 75 80
Arg Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
85 90 95
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
100 105 110
Xaa Xaa Leu Xaa Trp Xaa Xaa Xaa Val Xaa Xaa Ile Leu Xaa Xaa Xaa
115 120 125
Xaa Glu Xaa Thr Pro Gly Ser Xaa Ile Glu Xaa Lys Xaa Xaa Ala Leu
130 135 140
Ala Trp His Tyr Arg Xaa Ala Asp Xaa Xaa Xaa Xaa Xaa Xaa Xaa Ala
145 150 155 160
Xaa Xaa Val Xaa Xaa Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
165 170 175
Leu Xaa Val Xaa Xaa Gly Lys Xaa Val Val Glu Val Arg Pro Xaa Xaa
180 185 190
Xaa Val Xaa Lys Gly Xaa Ala Leu Xaa Xaa Ile Leu Xaa Xaa Leu Xaa
195 200 205
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
210 215 220
Xaa Xaa Xaa Xaa Xaa Xaa Val Leu Xaa Ile Gly Asp Asp Xaa Xaa Thr
225 230 235 240
Asp Glu Asp Met Phe Xaa Xaa Ile Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
245 250 255
Xaa Xaa Xaa Xaa Xaa Ile Leu Val Xaa Xaa Xaa Xaa Xaa Xaa Thr Xaa
260 265 270
Ala Xaa Xaa Xaa Leu
275
<210>94
<211>251
<212>PRT
＜213〉artificial sequence
<220>
＜223〉the treahalose phosphate phosphatase domain among the SEQ ID NO 2
<400>94
Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro
1 5 10 15
Ile Val Glu Asp Pro Asp Lys Ala Phe Ile Thr His Glu Met Arg Glu
20 25 30
Val Val Lys Asp Val Ala Ser Asn Phe Pro Thr Ala Ile Val Thr Gly
35 40 45
Arg Ser Ile Glu Lys Val Arg Ser Phe Val Gln Val Asn Glu Ile Tyr
50 55 60
Tyr Ala Gly Ser His Gly Met Asp Ile Glu Gly Pro Thr Asn Glu Asn
65 70 75 80
Ser Asn Gly Gln Ser Asn Glu Arg Val Leu Phe Gln Pro Ala Arg Glu
85 90 95
Phe Leu Pro Met Ile Glu Lys Val Val Asn Ile Leu Glu Glu Lys Thr
100 105 110
Lys Trp Ile Pro Gly Ala Met Val Glu Asn Asn Lys Phe Cys Leu Ser
115 120 125
Val His Phe Arg Arg Val Asp Glu Lys Arg Trp Pro Ala Leu Ala Glu
130 135 140
Val Val Lys Ser Val Leu Ile Asp Tyr Pro Lys Leu Lys Leu Thr Gln
145 150 155 160
Gly Arg Lys Val Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp Lys Gly
165 170 175
Gln Ala Leu Asn Phe Leu Leu Lys Ser Leu Gly Tyr Glu Asn Ser Asp
180 185 190
Asp Val Val Pro Val Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala
195 200 205
Phe Lys Val Leu Arg Glu Arg Gly Gln Gly Phe Gly Ile Leu Val Ser
210 215 220
Lys Val Pro Lys Asp Thr Asn Ala Ser Tyr Ser Leu Gln Asp Pro Ser
225 230 235 240
Gln Val Asn Lys Phe Leu Glu Arg Leu Val Glu
245 250
<210>95
<211>19
<212>PRT
＜213〉artificial sequence
<220>
＜223〉be rich in the ser structure territory
<220>
＜221〉uncertain
<222>(2)..(3)
＜223〉Xaa can be the amino acid of any natural generation
<220>
＜221〉uncertain
<222>(16)..(17)
＜223〉Xaa can be the amino acid of any natural generation
<400>95
Arg Xaa Xaa Ser Trp Val Asp Ser Met Arg Ala Ser Ser Pro Thr Xaa
1 5 10 15
Xaa Lys Ser
<210>96
<211>10
<212>PRT
＜213〉artificial sequence
<220>
＜223〉B-Phosphoric acid esterase frame
<220>
＜221〉variant
<222>(6)..(6)
＜223 〉/replace=" Glu "
<400>96
Gly Asp Asp Arg Thr Asp Gln Asp Ala Phe
1 5 10
<210>97
<211>12
<212>PRT
＜213〉artificial sequence
<220>
＜223〉A-Phosphoric acid esterase frame
<400>97
Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Asp
1 5 10
<210>98
<211>2193
<212>DNA
＜213〉rice
<400>98
aatccgaaaa gtttctgcac cgttttcacc ccctaactaa caatataggg aacgtgtgct 60
aaatataaaa tgagacctta tatatgtagc gctgataact agaactatgc aagaaaaact 120
catccaccta ctttagtggc aatcgggcta aataaaaaag agtcgctaca ctagtttcgt 180
tttccttagt aattaagtgg gaaaatgaaa tcattattgc ttagaatata cgttcacatc 240
tctgtcatga agttaaatta ttcgaggtag ccataattgt catcaaactc ttcttgaata 300
aaaaaatctt tctagctgaa ctcaatgggt aaagagagag atttttttta aaaaaataga 360
atgaagatat tctgaacgta ttggcaaaga tttaaacata taattatata attttatagt 420
ttgtgcattc gtcatatcgc acatcattaa ggacatgtct tactccatcc caatttttat 480
ttagtaatta aagacaattg acttattttt attatttatc ttttttcgat tagatgcaag 540
gtacttacgc acacactttg tgctcatgtg catgtgtgag tgcacctcct caatacacgt 600
tcaactagca acacatctct aatatcactc gcctatttaa tacatttagg tagcaatatc 660
tgaattcaag cactccacca tcaccagacc acttttaata atatctaaaa tacaaaaaat 720
aattttacag aatagcatga aaagtatgaa acgaactatt taggtttttc acatacaaaa 780
aaaaaaagaa ttttgctcgt gcgcgagcgc caatctccca tattgggcac acaggcaaca 840
acagagtggc tgcccacaga acaacccaca aaaaacgatg atctaacgga ggacagcaag 900
tccgcaacaa ccttttaaca gcaggctttg cggccaggag agaggaggag aggcaaagaa 960
aaccaagcat cctcctcctc ccatctataa attcctcccc ccttttcccc tctctatata 1020
ggaggcatcc aagccaagaa gagggagagc accaaggaca cgcgactagc agaagccgag 1080
cgaccgcctt cttcgatcca tatcttccgg tcgagttctt ggtcgatctc ttccctcctc 1140
cacctcctcc tcacagggta tgtgcccttc ggttgttctt ggatttattg ttctaggttg 1200
tgtagtacgg gcgttgatgt taggaaaggg gatctgtatc tgtgatgatt cctgttcttg 1260
gatttgggat agaggggttc ttgatgttgc atgttatcgg ttcggtttga ttagtagtat 1320
ggttttcaat cgtctggaga gctctatgga aatgaaatgg tttagggtac ggaatcttgc 1380
gattttgtga gtaccttttg tttgaggtaa aatcagagca ccggtgattt tgcttggtgt 1440
aataaaagta cggttgtttg gtcctcgatt ctggtagtga tgcttctcga tttgacgaag 1500
ctatcctttg tttattccct attgaacaaa aataatccaa ctttgaagac ggtcccgttg 1560
atgagattga atgattgatt cttaagcctg tccaaaattt cgcagctggc ttgtttagat 1620
acagtagtcc ccatcacgaa attcatggaa acagttataa tcctcaggaa caggggattc 1680
cctgttcttc cgatttgctt tagtcccaga attttttttc ccaaatatct taaaaagtca 1740
ctttctggtt cagttcaatg aattgattgc tacaaataat gcttttatag cgttatccta 1800
gctgtagttc agttaatagg taatacccct atagtttagt caggagaaga acttatccga 1860
tttctgatct ccatttttaa ttatatgaaa tgaactgtag cataagcagt attcatttgg 1920
attatttttt ttattagctc tcaccccttc attattctga gctgaaagtc tggcatgaac 1980
tgtcctcaat tttgttttca aattcacatc gattatctat gcattatcct cttgtatcta 2040
cctgtagaag tttctttttg gttattcctt gactgcttga ttacagaaag aaatttatga 2100
agctgtaatc gggatagtta tactgcttgt tcttatgatt catttccttt gtgcagttct 2160
tggtgtagct tgccactttc accagcaaag ttc 2193
<210>99
<211>56
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prm05451
<400>99
ggggacaagt ttgtacaaaa aagcaggctt aaacaatgac taaccagaat gtcatc 56
<210>100
<211>50
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prm05452
<400>100
ggggaccact ttgtacaaga aagctgggtt gtaattatgt tgcatgtctt 50
<210>101
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPA-5
<400>101
ggaagatcta tggacatgaa atctggtcac tc 32
<210>102
<211>30
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPA-3
<400>102
aaggcctacc cattgatctc ttccatgtca 30
<210>103
<211>3l
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPB-5
<400>103
ggaattcatg actaaccaga atgtcatcgt t 31
<210>104
<211>29
<212>DNA
＜213〉artificial sequence
<220>
4223〉primer: prmAtTPPB-3
<400>104
aaggcctctc ttctcccact gtcttcctc 29
<210>105
<211>31
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPC-5
<400>105
cgggatccat gaagattacg gatatttccg g 31
<210>106
<211>30
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPC-3
<400>106
aaggcctttc tccaagtgtt tgtttcttcc 30
<210>107
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPD-5
<400>107
cgggatccat gacaaaccat aatgccttaa tc 32
<210>108
<2ll>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPD-3
<400>108
aaggccttct tcctcttagt gacatttgtt tc 32
<210>109
<21l>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPE-5
<400>109
cgggatccat gttcgaagaa atacttcata aatc 34
<210>110
<211>29
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPE-3
<400>110
aaggccttgc cccacacctt gactgtttc 29
<210>111
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPF-5
<400>111
catgccatgg atttaaactc aaaccacaaa tc 32
<210>112
<211>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPF-3
<400>112
tcccccggga aaaccagtag aattcttctc caac 34
<210>113
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPG-5
<400>113
catgccatgg atttgaatat aaacaagacg ac 32
<210>114
<211>35
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPG-3
<400>114
aaggcctaaa acttgttttt gaactttcca tcttc 35
<210>115
<211>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPH-5
<400>115
cgggatccat ggttagattc atagaagaaa acac 34
<210>116
<211>30
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPH-3
<400>116
aaggccttgc tccagatctc aattgtttcc 30
<210>117
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPI-5
<400>117
cgggatccat gtcagctagt caaaacattg tc 32
<210>118
<211>30
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPI-3
<400>118
aaggcctcat tcttggctgc atttgtttcc 30
<210>119
<211>30
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPJ-5
<400>119
cgggatccat ggtgagccaa aacgtcgtcg 30
<210>120
<211>29
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer: prmAtTPPJ-3
<400>120
aaggcctttg ctgcatctgt ttccactcc 29
<210>121
<211>1494
<212>DNA
＜213〉soybean
<400>121
ctcttctctt ctcttcactt tgatttcatt gcaattacct ctttttgttg ggatcttctt 60
cccttctctg ttctaaaaaa gaacacggct gatctgggct cgactaaaac aaatcactaa 120
gtaaaaatga cgcagaatgc gatagtgtcc aagacaaaat cggggatcaa ccgggacata 180
accgtgccac aaaagccact ggcggcggcg gcggcggcgg gggggtacat tcccattccg 240
aggaggaggg ttttgaagaa cctggaaatc aatgcatggg ttgattccat gagatcctct 300
tctccaacca attccaaatc cacctcttct ctcgcagaag aacacagcac ttggattctt 360
cgccacccct cagcattaga catgttcgag caaattatgg atgcgtcccg gggaaagcaa 420
attgtcatgt ttctcgacta tgatggtact ttgtcgccta ttgttgatga cccagaccgt 480
gctttcatgt cggattcgat gaggagaacg gtgaggaaac ttgcaaggtg ttttcctact 540
gctatagtta ccggcagatg caaagacaag gtttacaatt ttgttcgctt ggctgagcta 600
tattatgctg gaagccatgg catggatatt caagggccaa caagagactg caaatacagc 660
aaagacaaag gagagccagt tctttttcaa cctgccagtg aatttcttcc catgattgat 720
gaggtgtacc atcaattagt tgagaaaatg aaatcaattc ctggagccat ggtggagaac 780
aacaagttct gctgttctgt tcattttcgc tgcgttgatg aaaagaaatg gagtgaactg 840
gcacaggaag tgagatcagt attaaaagag tacccgaagc ttcgtcttaa ccaaggaagg 900
aaggtattag agattcgtcc atctattaaa tgggacaaag ggaaggcgct ggaatttttg 960
ttagagtcac ttggatttgc caactgtaac gatgtctttc ctgtttacat tggagatgat 1020
aaaaccgatg aagatgcatt caagaaatta agagacagag gacaaggttt tgggattctt 1080
gtctcgaaat ttccaaagga cactactgca tcatactctt tacaagaacc aaacgaggtg 1140
atggatttcc ttcaacgttt ggtggagtgg aaacaagtat ccctccgact cagaacacgt 1200
tctcgggtgt aaatggatag aatgataatg tacatcccta ccctgccata aaaaatggag 1260
ttcagctagg gtagcatata ggaccctttt ttctatgttt tgttcagatt agaacagaga 1320
acaaaaatgt atggaaaaag gaaagacaaa agtgtctttc tgagtttgaa gcacgtctac 1380
atggatgtaa ttagccacgt agtttttgta gtacagggga aacgtctctg ttgcatcaaa 1440
tgtaattctg aatggaaaat aacatgttac gtatcgaaaa atatatatta ttgt 1494
<210>122
<211>36l
<212>PRT
＜213〉soybean
<400>122
Met Thr Gln Asn Ala Ile Val Ser Lys Thr Lys Ser Gly Ile Asn Arg
1 5 10 15
Asp Ile Thr Val Pro Gln Lys Pro Leu Ala Ala Ala Ala Ala Ala Gly
20 25 30
Gly Tyr Ile Pro Ile Pro Arg Arg Arg Val Leu Lys Asn Leu Glu Ile
35 40 45
Asn Ala Trp Val Asp Ser Met Arg Ser Ser Ser Pro Thr Asn Ser Lys
50 55 60
Ser Thr Ser Ser Leu Ala Glu Glu His Ser Thr Trp Ile Leu Arg His
65 70 75 80
Pro Ser Ala Leu Asp Met Phe Glu Gln Ile Met Asp Ala Ser Arg Gly
85 90 95
Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile
100 105 110
Val Asp Asp Pro Asp Arg Ala Phe Met Ser Asp Ser Met Arg Arg Thr
115 120 125
Val Arg Lys Leu Ala Arg Cys Phe Pro Thr Ala Ile Val Thr Gly Arg
130 135 140
Cys Lys Asp Lys Val Tyr Asn Phe Val Arg Leu Ala Glu Leu Tyr Tyr
145 150 155 160
Ala Gly Ser His Gly Met Asp Ile Gln Gly Pro Thr Arg Asp Cys Lys
165 170 175
Tyr Ser Lys Asp Lys Gly Glu Pro Val Leu Phe Gln Pro Ala Ser Glu
180 185 190
Phe Leu Pro Met Ile Asp Glu Val Tyr His Gln Leu Val Glu Lys Met
195 200 205
Lys Ser Ile Pro Gly Ala Met Val Glu Asn Asn Lys Phe Cys Cys Ser
210 215 220
Val His Phe Arg Cys Val Asp Glu Lys Lys Trp Ser Glu Leu Ala Gln
225 230 235 240
Glu Val Arg Ser Val Leu Lys Glu Tyr Pro Lys Leu Arg Leu Asn Gln
245 250 255
Gly Arg Lys Val Leu Glu Ile Arg Pro Ser Ile Lys Trp Asp Lys Gly
260 265 270
Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly Phe Ala Asn Cys Asn
275 280 285
Asp Val Phe Pro Val Tyr Ile Gly Asp Asp Lys Thr Asp Glu Asp Ala
290 295 300
Phe Lys Lys Leu Arg Asp Arg Gly Gln Gly Phe Gly Ile Leu Val Ser
305 310 315 320
Lys Phe Pro Lys Asp Thr Thr Ala Ser Tyr Ser Leu Gln Glu Pro Asn
325 330 335
Glu Val Met Asp Phe Leu Gln Arg Leu Val Glu Trp Lys Gln Val Ser
340 345 350
Leu Arg Leu Arg Thr Arg Ser Arg Val
355 360
<210>123
<211>1441
<212>DNA
＜213〉soybean
<400>123
acggctgatc tgggctcgac taaaacaaat cactaagtaa aaatgacgca gaatgcgata 60
gtgtccaaga caaaatcggg gatcaaccgg gacataaccg tgccacaaaa gccactggcg 120
gcggcggcgg cggcgggggg gtacattccc attccgagga ggagggtttt gaagaacctg 180
gaaatcaatg catgggttga ttccatgaga tcctcttctc caaccaattc caaatccacc 240
tcttctctcg cagaagaaca cagcacttgg attcttcgcc acccctcagc attagacatg 300
ttcgagcaaa ttatggatgc gtcccgggga aagcaaattg tcatgtttct cgactatgat 360
ggtactttgt cgcctattgt tgatgaccca gaccgtgctt tcatgtcgga ttcgatgagg 420
agaacggtga ggaaacttgc aaggtgtttt cctactgcta tagttaccgg cagatgcaaa 480
gacaaggttt acaattttgt tcgcttggct gagctatatt atgctggaag ccatggcatg 540
gatattcaag ggccaacaag aacctccaaa tacagcaaca aagataaagg agagcctgtt 600
ctttttcaac ctgctagtga atttcttccc atgattgatg aggtgtacca tcaattagtt 660
gagaaaatga aatcaattcc tggagccatg gtggagaaca acaagttctg ctgttctgtt 720
cattttcgct gcgttgatga aaagaaatgg agtgaactgg cacaggaagt gagatcagta 780
ttaaaagagt acccgaagct tcgtcttaac caaggaagga aggtattaga gattcgtcca 840
tctattaaat gggacaaagg gaaggcgctg gaatttttgt tagagtcact tggatttgcc 900
aactgtaacg atgtctttcc tgtttacatt ggagatgata aaaccgatga agatgcattc 960
aagaaattaa gagacagagg acaaggtttt gggattcttg tctcgaaatt tccaaaggac 1020
actactgcat catactcttt acaagaacca aacgaggtga tggatttcct tcaacgtttg 1080
gtggagtgga aacaagtatc cctccgactc agaacacgtt ctcgggtgta aatggataga 1140
atgataatgt acatccctac cctgccataa aaaatggagt tcagctaggg tagcatatag 1200
gacccttttt tctatgtttt gttcagatta gaacagagaa caaaaatgta tggaaaaagg 1260
aaagacaaaa gtgtctttct gagtttgaag cacgtctaca tggatgtaat tagccacgta 1320
gtttttgtag tacaggggaa acgtctctgt tgcatcaaat gtaattctga atggaaaata 1380
acatgttacg tatcgaaaaa tatatattat tgtatactct cttaagaaaa aaaaaaaaaa 1440
a 1441
<210>124
<211>362
<212>PRT
＜213〉soybean
<400>124
Met Thr Gln Asn Ala Ile Val Ser Lys Thr Lys Ser Gly Ile Asn Arg
1 5 10 15
Asp Ile Thr Val Pro Gln Lys Pro Leu Ala Ala Ala Ala Ala Ala Gly
20 25 30
Gly Tyr Ile Pro Ile Pro Arg Arg Arg Val Leu Lys Asn Leu Glu Ile
35 40 45
Asn Ala Trp Val Asp Ser Met Arg Ser Ser Ser Pro Thr Asn Ser Lys
50 55 60
Ser Thr Ser Ser Leu Ala Glu Glu His Ser Thr Trp Ile Leu Arg His
65 70 75 80
Pro Ser Ala Leu Asp Met Phe Glu Gln Ile Met Asp Ala Ser Arg Gly
85 90 95
Lys Gln Ile Val Met Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile
100 105 110
Val Asp Asp Pro Asp Arg Ala Phe Met Ser Asp Ser Met Arg Arg Thr
115 120 125
Val Arg Lys Leu Ala Arg Cys Phe Pro Thr Ala Ile Val Thr Gly Arg
130 135 140
Cys Lys Asp Lys Val Tyr Asn Phe Val Arg Leu Ala Glu Leu Tyr Tyr
145 150 155 160
Ala Gly Ser His Gly Met Asp Ile Gln Gly Pro Thr Arg Thr Ser Lys
165 170 175
Tyr Ser Asn Lys Asp Lys Gly Glu Pro Val Leu Phe Gln Pro Ala Ser
180 185 190
Glu Phe Leu Pro Met Ile Asp Glu Val Tyr His Gln Leu Val Glu Lys
195 200 205
Met Lys Ser Ile Pro Gly Ala Met Val Glu Asn Asn Lys Phe Cys Cys
210 215 220
Ser Val His Phe Arg Cys Val Asp Glu Lys Lys Trp Ser Glu Leu Ala
225 230 235 240
Gln Glu Val Arg Ser Val Leu Lys Glu Tyr Pro Lys Leu Arg Leu Asn
245 250 255
Gln Gly Arg Lys Val Leu Glu Ile Arg Pro Ser Ile Lys Trp Asp Lys
260 265 270
Gly Lys Ala Leu Glu Phe Leu Leu Glu Ser Leu Gly Phe Ala Asn Cys
275 280 285
Asn Asp Val Phe Pro Val Tyr Ile Gly Asp Asp Lys Thr Asp Glu Asp
290 295 300
Ala Phe Lys Lys Leu Arg Asp Arg Gly Gln Gly Phe Gly Ile Leu Val
305 310 315 320
Ser Lys Phe Pro Lys Asp Thr Thr Ala Ser Tyr Ser Leu Gln Glu Pro
325 330 335
Asn Glu Val Met Asp Phe Leu Gln Arg Leu Val Glu Trp Lys Gln Val
340 345 350
Ser Leu Arg Leu Arg Thr Arg Ser Arg Val
355 360
<210>125
<211>1729
<212>DNA
＜213〉soybean
<400>125
ttcccggcct cactcacccc tcccttttat ttccattatt attctgccta agcagtttct 60
tccaaacttc cttttacatt tccaatttct ctattctatc aaaagggttt gaactttgaa 120
gggaaaggaa gaaagatatg atgacgaacc aaaatgtggt gactcatgag gttattaaca 180
cgttgattgc cgtggcagct tccatttcaa actcaaccgc gttgccaagt gcaacagtgc 240
cagaatccat ggctgtgctt ggtgggtttt gggggctgcc ccataataaa aatcttgtga 300
aaaggttgga aggagctaaa gttagtgctt ggattgattc aatgagagct tcttccccaa 360
ctcgtgccaa atcagaaagc caagaaaaaa gatcttggat tctttatcac ccttcagctc 420
tgaacacgtt tgagcaaata gtatgtagtg ccaaaggaaa gcaagtcgta gtttttcttg 480
actacgatgg aactctctcc ccaattgttg cagatccgga taaagctttc atgactagaa 540
agatgagagc aacgctaaag ggcatagcaa ggcattttcc cacagcaata gtgaccggaa 600
ggtgcagaga caaggtatat aactttgtaa aattggcaga actttactat gccggaagcc 660
atggcatgga catcaagggt ccaacaaaaa gccaaagtcc aaagcaaggt aataataata 720
aagcagtgct gttccaaccc gcgagtcaat tcctgccaat gatcgatgag gtgtacaaga 780
tcttgttaga aaaaacaaag actgtcccag gggctaatgt tgagaacaat aagttttgct 840
tgtccgtgca ctttcgttgt gttgacgaaa agagttgggc agcgttggcg gagaaagtta 900
gattggtgct caatgattac ccacaactta ggctaaccca agggagaaaa gtgctagaga 960
ttcgtccaac catcaaatgg gacaagggca aggctcttga atttttgtta gaatcattag 1020
gatacgagaa ttcgaatgat gtatttccaa tatatattgg tgatgatcga actgatgagg 1080
atgcttttaa ggttttgcgc agtaggggtc aaggaattgg gattcttgtt tctagagttg 1140
caaaagaaac agatgcttcc tataccttgc aagatccatc agaggcaagt gctatatatt 1200
ccatccagta caatttattc tatataatat ttttaatgtt taattcgggc atcaatgttg 1260
tatatcttta ttgtgaatgg tgaatctgag aaatatataa tgtaattaat taacaaatat 1320
ctttatggcc acatttacag gttgagcaat tcttgcggcg tctggtggag tggaaaagac 1380
cgagtactgt gactcccaca agtgtataga gagtttgtag aatgtagatg atcacttcaa 1440
agaattgaca ccaccaccac cttagaatgg tgaagaggtg gatcgaattg tatcactttt 1500
ttttattgtt gaaaatggaa atagcactat tccataattt aaatttatta aggacaaagt 1560
ccgaacaaat agattcctac acacgtttgc atgcgcatgc ggatagggaa aggcagatgt 1620
tttatgccgc agttgcaaat ggcccgtcaa ctttgttgct aagaattgta cttatcgtac 1680
atgtggccaa tatattctga aaaagattac tacgaaaaaa aaaaaaaaa 1729
<210>126
<211>381
<212>PRT
＜213〉soybean
<400>126
Met Met Thr Asn Gln Asn Val Val Thr His Glu Val Ile Asn Thr Leu
1 5 10 15
Ile Ala Val Ala Ala Ser Ile Ser Asn Ser Thr Ala Leu Pro Ser Ala
20 25 30
Thr Val Pro Glu Ser Met Ala Val Leu Gly Gly Phe Trp Gly Leu Pro
35 40 45
His Asn Lys Asn Leu Val Lys Arg Leu Glu Gly Ala Lys Val Ser Ala
50 55 60
Trp Ile Asp Ser Met Arg Ala Ser Ser Pro Thr Arg Ala Lys Ser Glu
65 70 75 80
Ser Gln Glu Lys Arg Ser Trp Ile Leu Tyr His Pro Ser Ala Leu Asn
85 90 95
Thr Phe Glu Gln Ile Val Cys Ser Ala Lys Gly Lys Gln Val Val Val
100 105 110
Phe Leu Asp Tyr Asp Gly Thr Leu Ser Pro Ile Val Ala Asp Pro Asp
115 120 125
Lys Ala Phe Met Thr Arg Lys Met Arg Ala Thr Leu Lys Gly Ile Ala
130 135 140
Arg His Phe Pro Thr Ala Ile Val Thr Gly Arg Cys Arg Asp Lys Val
145 150 155 160
Tyr Asn Phe Val Lys Leu Ala Glu Leu Tyr Tyr Ala Gly Ser His Gly
165 170 175
Met Asp Ile Lys Gly Pro Thr Lys Ser Gln Ser Pro Lys Gln Gly Asn
180 185 190
Asn Asn Lys Ala Val Leu Phe Gln Pro Ala Ser Gln Phe Leu Pro Met
195 200 205
Ile Asp Glu Val Tyr Lys Ile Leu Leu Glu Lys Thr Lys Thr Val Pro
210 215 220
Gly Ala Asn Val Glu Asn Asn Lys Phe Cys Leu Ser Val His Phe Arg
225 230 235 240
Cys Val Asp Glu Lys Ser Trp Ala Ala Leu Ala Glu Lys Val Arg Leu
245 250 255
Val Leu Asn Asp Tyr Pro Gln Leu Arg Leu Thr Gln Gly Arg Lys Val
260 265 270
Leu Glu Ile Arg Pro Thr Ile Lys Trp Asp Lys Gly Lys Ala Leu Glu
275 280 285
Phe Leu Leu Glu Ser Leu Gly Tyr Glu Asn Ser Asn Asp Val Phe Pro
290 295 300
Ile Tyr Ile Gly Asp Asp Arg Thr Asp Glu Asp Ala Phe Lys Val Leu
305 310 315 320
Arg Ser Arg Gly Gln Gly Ile Gly Ile Leu Val Ser Arg Val Ala Lys
325 330 335
Glu Thr Asp Ala Ser Tyr Thr Leu Gln Asp Pro Ser Glu Ala Ser Ala
340 345 350
Ile Tyr Ser Ile Gln Tyr Asn Leu Phe Tyr Ile Ile Phe Leu Met Phe
355 360 365
Asn Ser Gly Ile Asn Val Val Tyr Leu Tyr Cys Glu Trp
370 375 380
<210>127
<211>1448
<212>DNA
＜213〉colea (Brassica napus)
<400>127
ttaacttctg cctcgcctct cgttctcaac acttgtgaga aatatgatga accagaatgt 60
catcgtctcc gacagaaaag ccatcttggg ttcgaaaacc atcactgtct ctaactctcc 120
cctgttctct tctcctccca cttactttac ctttcctcgt cataagttct tggagcttct 180
cgaagcagcc gataaaaaca gcaacagcat caacaagaac aatcttggtg ctggtaagat 240
tgcatcttgg gtcgattcca tgcgtgattc ttctcctaca cgtctcagac cctcttcacg 300
tgactctgtg tcagacaacg accataaaac atcttggatc gttcgatttc catcggcttt 360
aaatatgttt gatgagattg tgaatgctgc aaaagggaaa caaattgtta tgtttcttga 420
ttacgatggg acgctctctc ccatagttga agatcctgac aaagcttaca taacacatga 480
gatgcgagaa gttgtaaaga atgtggctct aaacttccca actgctatag tcactggaag 540
atccattgat aaggttcgtg gttttgtcaa actcgatgag atttactacg ctggaagcca 600
tggcatggac attgaaggcc cgaccagcga atatgcttat ggtggcgaga gtaatcaagg 660
agtgctcttt caacctgctc gtgaatttgt acccacgatc gagaaggtgt ataagatatt 720
agaggaaaag actaaatgga tccctggggc tatggtggag aacaacaagt tttgtctgtc 780
cgtacatttt cgacgtgttg atgagaaaag atgggccgga ttagccgaac aagtaaaatc 840
agttctaatt gattatccac agctgaaact aacccaaggt agaaaggtgc ttgaaatccg 900
tcctacgatc aaatgggaca agggccaggc tctcaatttt ttgctaaaat cattagggtt 960
tgaaaagtcg gaagatgttg ttcctgtgta tattggagat gacctcaccg acgaagatgc 1020
gtttaaggtt ttacgtgagc ggggacaagg ttttgggatt ctagtctcaa aagttccaaa 1080
ggaaaccaat gcctcttact ctctccaaga cccttctcag gttaatgagt ttctgaggcg 1140
tttagtagag tggaagagga agacagtcgg ggaagcttga aaaacaaaca tgcaacatta 1200
ataacacctg agtttatttt ataaatcttg aggagaaaat aatcggtata tatagacaac 1260
cttctaaaaa actagtacta gtactagatt cgtagagggt gtttttttgg aactttacct 1320
agagaggtgt cttggccaga agcatcttta cttttctaca tcgatcgaga aattgtaaat 1380
ttcgtgtaac gattcagaaa atgaagaaaa cacaactaat atcatttcca cgcaaaaaaa 1440
aaaaaaaa 1448
<210>128
<211>378
<212>PRT
＜213〉colea
<400>128
Met Met Asn Gln Asn Val Ile Val Ser Asp Arg Lys Ala Ile Leu Gly
1 5 10 15
Ser Lys Thr Ile Thr Val Ser Asn Ser Pro Leu Phe Ser Ser Pro Pro
20 25 30
Thr Tyr Phe Thr Phe Pro Arg His Lys Phe Leu Glu Leu Leu Glu Ala
35 40 45
Ala Asp Lys Asn Ser Asn Ser Ile Asn Lys Asn Asn Leu Gly Ala Gly
50 55 60
Lys Ile Ala Ser Trp Val Asp Ser Met Arg Asp Ser Ser Pro Thr Arg
65 70 75 80
Leu Arg Pro Ser Ser Arg Asp Ser Val Ser Asp Asn Asp His Lys Thr
85 90 95
Ser Trp Ile Val Arg Phe Pro Ser Ala Leu Asn Met Phe Asp Glu Ile
100 105 110
Val Asn Ala Ala Lys Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp
115 120 125
Gly Thr Leu Ser Pro Ile Val Glu Asp Pro Asp Lys Ala Tyr Ile Thr
130 135 140
His Glu Met Arg Glu Val Val Lys Asn Val Ala Leu Asn Phe Pro Thr
145 150 155 160
Ala Ile Val Thr Gly Arg Ser Ile Asp Lys Val Arg Gly Phe Val Lys
165 170 175
Leu Asp Glu Ile Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Glu Gly
180 185 190
Pro Thr Ser Glu Tyr Ala Tyr Gly Gly Glu Ser Asn Gln Gly Val Leu
195 200 205
Phe Gln Pro Ala Arg Glu Phe Val Pro Thr Ile Glu Lys Val Tyr Lys
210 215 220
Ile Leu Glu Glu Lys Thr Lys Trp Ile Pro Gly Ala Met Val Glu Asn
225 230 235 240
Asn Lys Phe Cys Leu Ser Val His Phe Arg Arg Val Asp Glu Lys Arg
245 250 255
Trp Ala Gly Leu Ala Glu Gln Val Lys Ser Val Leu Ile Asp Tyr Pro
260 265 270
Gln Leu Lys Leu Thr Gln Gly Arg Lys Val Leu Glu Ile Arg Pro Thr
275 280 285
Ile Lys Trp Asp Lys Gly Gln Ala Leu Asn Phe Leu Leu Lys Ser Leu
290 295 300
Gly Phe Glu Lys Ser Glu Asp Val Val Pro Val Tyr Ile Gly Asp Asp
305 310 315 320
Leu Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Glu Arg Gly Gln Gly
325 330 335
Phe Gly Ile Leu Val Ser Lys Val Pro Lys Glu Thr Asn Ala Ser Tyr
340 345 350
Ser Leu Gln Asp Pro Ser Gln Val Asn Glu Phe Leu Arg Arg Leu Val
355 360 365
Glu Trp Lys Arg Lys Thr Val Gly Glu Ala
370 375
<210>129
<211>1448
<212>DNA
＜213〉colea
<400>129
ttaacttctg cctcgcctct cgttctcaac acttgtgaga aatatgatga accagaatgt 60
catcgtctcc gacagaaaag ccatcttggg ttcgaaaacc atcactgtct ctaactctcc 120
cctgttctct tctcctccca cttactttac ctttcctcgt cataagttct tggagcttct 180
cgaagcagcc gataaaaaca gcaacagcat caacaagaac aatcttggtg ctggtaagat 240
tgcatcttgg gtcgattcca tgcgtgattc ttctcctaca cgtctcagac cctcttcacg 300
tgactctgtg tcagacaacg accataaaac atcttggatc gttcgatttc catcggcttt 360
aaatatgttt gatgagattg tgaatgctgc aaaagggaaa caaattgtta tgtttcttga 420
ttacgatggg acgctctctc ccatagttga agatcctgac aaagcttaca taacacatga 480
gatgcgagaa gttgtaaaga atgtggctct aaacttccca actgctatag tcactggaag 540
atccattgat aaggttcgtg gttttgtcaa actcgatgag atttactacg ctggaagcca 600
tggcatggac attgaaggcc cgaccagcga atatgcttat ggtggcgaga gtaatcaagg 660
agtgctcttt caacctgctc gtgaatttgt acccacgatc gagaaggtgt ataagatatt 720
agaggaaaag actaaatgga tccctggggc tatggtggag aacaacaagt tttgtctgtc 780
cgtacatttt cgacgtgttg atgagaaaag atgggccgga ttagccgaac aagtaaaatc 840
agttctaatt gattatccac agctgaaact aacccaaggt agaaaggtgc ttgaaatccg 900
tcctacgatc aaatgggaca agggccaggc tctcaatttt ttgctaaaat cattagggtt 960
tgaaaagtcg gaagatgttg ttcctgtgta tattggagat gaccgtaccg acgaagatgc 1020
gtttaaggtt ttacgtgagc ggggacaagg ttttgggatt ctagtctcaa aagttccaaa 1080
ggaaaccaat gcctcttact ctctccaaga cccttctcag gttaatgagt ttctgaggcg 1140
tttagtagag tggaagagga agacagtcgg ggaagcttga aaaacaaaca tgcaacatta 1200
ataacacctg agtttatttt ataaatcttg aggagaaaat aatcggtata tatagacaac 1260
cttctaaaaa actagtacta gtactagatt cgtagagggt gtttttttgg aactttacct 1320
agagaggtgt cttggccaga agcatcttta cttttctaca tcgatcgaga aattgtaaat 1380
ttcgtgtaac gattcagaaa atgaagaaaa cacaactaat atcatttcca cgcaaaaaaa 1440
aaaaaaaa 1448
<210>130
<211>378
<212>PRT
＜213〉colea
<400>130
Met Met Asn Gln Asn Val Ile Val Ser Asp Arg Lys Ala Ile Leu Gly
1 5 10 15
Ser Lys Thr Ile Thr Val Ser Asn Ser Pro Leu Phe Ser Ser Pro Pro
20 25 30
Thr Tyr Phe Thr Phe Pro Arg His Lys Phe Leu Glu Leu Leu Glu Ala
35 40 45
Ala Asp Lys Asn Ser Asn Ser Ile Asn Lys Asn Asn Leu Gly Ala Gly
50 55 60
Lys Ile Ala Ser Trp Val Asp Ser Met Arg Asp Ser Ser Pro Thr Arg
65 70 75 80
Leu Arg Pro Ser Ser Arg Asp Ser Val Ser Asp Asn Asp His Lys Thr
85 90 95
Ser Trp Ile Val Arg Phe Pro Ser Ala Leu Asn Met Phe Asp Glu Ile
100 105 110
Val Asn Ala Ala Lys Gly Lys Gln Ile Val Met Phe Leu Asp Tyr Asp
115 120 125
Gly Thr Leu Ser Pro Ile Val Glu Asp Pro Asp Lys Ala Tyr Ile Thr
130 135 140
His Glu Met Arg Glu Val Val Lys Asn Val Ala Leu Asn Phe Pro Thr
145 150 155 160
Ala Ile Val Thr Gly Arg Ser Ile Asp Lys Val Arg Gly Phe Val Lys
165 170 175
Leu Asp Glu Ile Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Glu Gly
180 185 190
Pro Thr Ser Glu Tyr Ala Tyr Gly Gly Glu Ser Asn Gln Gly Val Leu
195 200 205
Phe Gln Pro Ala Arg Glu Phe Val Pro Thr Ile Glu Lys Val Tyr Lys
210 215 220
Ile Leu Glu Glu Lys Thr Lys Trp Ile Pro Gly Ala Met Val Glu Asn
225 230 235 240
Asn Lys Phe Cys Leu Ser Val His Phe Arg Arg Val Asp Glu Lys Arg
245 250 255
Trp Ala Gly Leu Ala Glu Gln Val Lys Ser Val Leu Ile Asp Tyr Pro
260 265 270
Gln Leu Lys Leu Thr Gln Gly Arg Lys Val Leu Glu Ile Arg Pro Thr
275 280 285
Ile Lys Trp Asp Lys Gly Gln Ala Leu Asn Phe Leu Leu Lys Ser Leu
290 295 300
Gly Phe Glu Lys Ser Glu Asp Val Val Pro Val Tyr Ile Gly Asp Asp
305 310 315 320
Arg Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Glu Arg Gly Gln Gly
325 330 335
Phe Gly Ile Leu Val Ser Lys Val Pro Lys Glu Thr Asn Ala Ser Tyr
340 345 350
Ser Leu Gln Asp Pro Ser Gln Val Asn Glu Phe Leu Arg Arg Leu Val
355 360 365
Glu Trp Lys Arg Lys Thr Val Gly Glu Ala
370 375
<210>131
<211>1130
<212>DNA
＜213〉rice
<400>131
catgcggcta atgtagatgc tcactgcgct agtagtaagg tactccagta cattatggaa 60
tatacaaagc tgtaatactc gtatcagcaa gagagaggca cacaagttgt agcagtagca 120
caggattaga aaaacgggac gacaaatagt aatggaaaaa caaaaaaaaa caaggaaaca 180
catggcaata taaatggaga aatcacaaga ggaacagaat ccgggcaata cgctgcgaaa 240
gtactcgtac gtaaaaaaaa gaggcgcatt catgtgtgga cagcgtgcag cagaagcagg 300
gatttgaaac cactcaaatc caccactgca aaccttcaaa cgaggccatg gtttgaagca 360
tagaaagcac aggtaagaag cacaacgccc tcgctctcca ccctcccacc caatcgcgac 420
gcacctcgcg gatcggtgac gtggcctcgc cccccaaaaa tatcccgcgg cgtgaagctg 480
acaccccggg cccacccacc tgtcacgttg gcacatgttg gttatggttc ccggccgcac 540
caaaatatca acgcggcgcg gcccaaaatt tccaaaatcc cgcccaagcc cctggcgcgt 600
gccgctcttc cacccaggtc cctctcgtaa tccataatgg cgtgtgtacc ctcggctggt 660
tgtacgtggg cgggttaccc tgggggtgtg ggtggatgac gggtgggccc ggaggaggtc 720
cggccccgcg cgtcatcgcg gggcggggtg tagcgggtgc gaaaaggagg cgatcggtac 780
gaaaattcaa attaggaggt ggggggcggg gcccttggag aataagcgga atcgcagata 840
tgcccctgac ttggcttggc tcctcttctt cttatccctt gtcctcgcaa ccccgcttcc 900
ttctctcctc tcctcttctc ttctcttctc tggtggtgtg ggtgtgtccc tgtctcccct 960
ctccttcctc ctctcctttc ccctcctctc ttcccccctc tcacaagaga gagagcgcca 1020
gactctcccc aggtgaggtg agaccagtct ttttgctcga ttcgacgcgc ctttcacgcc 1080
gcctcgcgcg gatctgaccg cttccctcgg ccttctcgca ggattcagcc 1130

Claims (18)

1. increase the method for plant seed output with respect to control plant, it comprises the expression of coding nucleic acid in plant of regulating III class treahalose phosphate Phosphoric acid esterase (TPP) polypeptide, described adjusting is expressed by the nucleic acid of introducing in plant and express coding III class TPP polypeptide and is realized, the seed production of wherein said increase be following one or more:
(i) seed number of every strain plant increase;
(ii) the full seed number of every strain plant increase;
(iii) seed weight of every strain plant increase, wherein said III class TPP polypeptide is by SEQ ID NO:1,9,11,15,17,19,21,23,25 or 27 codings.
2. the process of claim 1 wherein that described nucleotide sequence effectively is connected with constitutive promoter.
3. the method for claim 2, wherein said constitutive promoter is the GOS2 promotor.
4. the vegetable cell that obtains by each method among the claim 1-3, wherein said vegetable cell comprise the recombinant nucleic acid of coding III class TPP protein.
5. the purposes of the nucleic acid molecule that separates, it is used for increasing plant seed output with respect to control plant, and the nucleic acid molecule of described separation is:
(i) nucleic acid shown in the SEQ ID NO:1,9,11,15,17,19,21,23,25 or 27;
(ii) complement of the arbitrary SEQ ID NO that provides in (i),
The seed production of wherein said increase be following one or more:
(a) seed number of every strain plant increase;
(b) the full seed number of every strain plant increase;
(c) seed weight of every strain plant increase.
6. the purposes of isolated polypeptide, it is used for increasing plant seed output with respect to control plant, and described isolated polypeptide is the aminoacid sequence shown in any among the SEQ ID NO:2,10,12,16,18,20,22,24,26 or 28,
The seed production of wherein said increase be following one or more:
(a) seed number of every strain plant increase;
(b) the full seed number of every strain plant increase;
(c) seed weight of every strain plant increase.
7. construct, it comprises:
(a) nucleic acid SEQ ID NO:1,9,11,15,17,19,21,23,25 or 27;
(b) one or more regulating and controlling sequences that can drive the nucleotide sequences expression of (a); With optional
(c) transcription termination sequence.
8. the construct of claim 7, wherein said one or more regulating and controlling sequences are constitutive promoter at least.
9. the construct of claim 8, wherein said constitutive promoter is the GOS2 promotor.
10. the purposes of each construct among the claim 7-9, it is for the preparation of the plant that has the seed production of increase with respect to control plant.
11. the purposes of claim 10, the seed production of wherein said increase be following one or more:
(i) seed number of every strain plant increase;
(ii) the full seed number of every strain plant increase;
(iii) the seed gross weight of every strain plant increase.
12. vegetable cell, it is transformed by each construct among the claim 7-9.
13. for the preparation of the method for the transgenic plant of the seed production with increase, described method comprises:
(i) in plant or vegetable cell, introduce and express nucleic acid SEQ ID NO:1,9,11,15,17,19,21,23,25 or 27; With
(ii) culturing plants cell or plant under the condition of Promoting plant growth and growth,
The seed production of wherein said increase be following one or more:
(a) seed number of every strain plant increase;
(b) the full seed number of every strain plant increase;
(c) the seed gross weight of every strain plant increase.
14. the vegetable cell of claim 4 or 12, wherein said plant is monocotyledons.
15. the vegetable cell of claim 4 or 12, wherein said monocotyledons is crop plants.
16. the vegetable cell of claim 4 or 12, wherein said monocotyledons is cereal.
17. the vegetable cell of claim 4 or 12, wherein said monocotyledons are rice, corn, wheat, barley, grain, rye, Chinese sorghum or oat.
18. the purposes of the nucleic acid of coding III class TPP protein, it is used for when introducing and when plant is expressed, and increases the seed production of described plant with respect to control plant, the seed production of wherein said increase be following one or more:
(i) seed number of every strain plant increase;
(ii) the full seed number of every strain plant increase;
(iii) the seed gross weight of every strain plant increase,
Wherein said nucleic acid is SEQ ID NO:1,9,11,15,17,19,21,23,25 or 27.
CN2007800463872A 2006-12-15 2007-12-13 Plants having enhanced seed yield-related traits and a method for making the same Expired - Fee Related CN101595222B (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
EP06126279.6 2006-12-15
EP06126279 2006-12-15
EP061262796 2006-12-15
US88316807P 2007-01-03 2007-01-03
US60/883,168 2007-01-03
PCT/EP2007/063890 WO2008071767A1 (en) 2006-12-15 2007-12-13 Plants having enhanced seed yield-related traits and a method for making the same

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN201310421114.9A Division CN103710376A (en) 2006-12-15 2007-12-13 Plants having enhanced seed yield-related traits and a method for making the same

Publications (2)

Publication Number Publication Date
CN101595222A CN101595222A (en) 2009-12-02
CN101595222B true CN101595222B (en) 2013-10-16

Family

ID=37888232

Family Applications (2)

Application Number Title Priority Date Filing Date
CN2007800463872A Expired - Fee Related CN101595222B (en) 2006-12-15 2007-12-13 Plants having enhanced seed yield-related traits and a method for making the same
CN201310421114.9A Pending CN103710376A (en) 2006-12-15 2007-12-13 Plants having enhanced seed yield-related traits and a method for making the same

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201310421114.9A Pending CN103710376A (en) 2006-12-15 2007-12-13 Plants having enhanced seed yield-related traits and a method for making the same

Country Status (3)

Country Link
CN (2) CN101595222B (en)
BR (1) BRPI0720084A2 (en)
ES (1) ES2544249T3 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112014000580A2 (en) * 2011-07-15 2017-03-01 Syngenta Participations Ag methods for increasing yield and stress tolerance in a plant
US11267850B2 (en) * 2016-08-12 2022-03-08 Agriculture Victoria Services Pty Ltd Metabolite production in endophytes
CN108624598A (en) * 2018-06-06 2018-10-09 福建农林大学 Application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance
CN114591981B (en) * 2022-03-25 2023-05-26 江苏师范大学 Application of TPPI gene in aspects of regulating and controlling plant root system development and promoting plant jasmonic acid accumulation
CN114921472B (en) * 2022-04-15 2023-09-12 贵州省旱粮研究所(贵州省高粱研究所)(贵州省玉米工程技术研究中心) Gene for controlling sorghum grain shape, and separation and cloning methods and applications thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1221454A (en) * 1996-05-03 1999-06-30 莫根国际股份有限公司 Regulating metabolism by modifying level of trehalose-6-phosphate
US20040229364A1 (en) * 1999-03-31 2004-11-18 Caimi Perry G. Plant genes encoding trehalose metabolism enzymes
WO2006060376A2 (en) * 2004-12-03 2006-06-08 Syngenta Participations Ag Stress tolerance in plants through selective inhibition of trehalose-6-phosphate phosphatase
US20060191040A1 (en) * 2005-01-07 2006-08-24 Jackson David P Nucleotide sequences encoding RAMOSA3 and sister of RAMOSA3 and methods of use for same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1221454A (en) * 1996-05-03 1999-06-30 莫根国际股份有限公司 Regulating metabolism by modifying level of trehalose-6-phosphate
US20040229364A1 (en) * 1999-03-31 2004-11-18 Caimi Perry G. Plant genes encoding trehalose metabolism enzymes
WO2006060376A2 (en) * 2004-12-03 2006-06-08 Syngenta Participations Ag Stress tolerance in plants through selective inhibition of trehalose-6-phosphate phosphatase
US20060191040A1 (en) * 2005-01-07 2006-08-24 Jackson David P Nucleotide sequences encoding RAMOSA3 and sister of RAMOSA3 and methods of use for same

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
A trehalose metabolic enzyme controls inflorescence architecture in maize;Satoh-Nagasawa Namiko,等;《Nature》;20060511;第441卷(第7090期);227－230 *
Satoh-Nagasawa Namiko,等.A trehalose metabolic enzyme controls inflorescence architecture in maize.《Nature》.2006,第441卷(第7090期),227－230.
Schluepmann Henriette，等.Trehalose 6-phosphate is indispensable forcarbohydrate utilization and growth in Arabidopsis thaliana.《Proceedings Of The National Academy Of Sciences Of The United States Of America》.2003,第100卷(第11期),6849－6854. *
Trehalose metabolism in Arabidopsis: occurrence of trehalose and molecular cloning and characterization of trehalose-6-phosphate synthase homologues;Vogel G.,等;《Journal of Experimental Botany》;20010930;第362卷(第52期);第1817－1826 *
Vogel G.,等.Trehalose metabolism in Arabidopsis: occurrence of trehalose and molecular cloning and characterization of trehalose-6-phosphate synthase homologues.《Journal of Experimental Botany》.2001,第362卷(第52期),第1817－1826.

Also Published As

Publication number Publication date
BRPI0720084A2 (en) 2014-01-21
CN101595222A (en) 2009-12-02
CN103710376A (en) 2014-04-09
ES2544249T3 (en) 2015-08-28

Similar Documents

Publication Publication Date Title
CN101495640B (en) Plants having enhanced yield-related traits and a method formaking the same
CN101842489B (en) Plants having enhanced yield-related traits and a method for making the same
CN101415829B (en) Plants having enhanced yield-related traits and method for making same
CN101365786B (en) Plants having improved growth characteristics and methods for making same
CN101952441B (en) Plants having enhanced yield-related traits and a method for making the same
CN101583720A (en) Plants having enhanced yield-related traits and a method for method for making the same
CN101981195B (en) Plants having increased yield-related traits and method for making same
CN102027120A (en) Plants having enhanced yield-related traits and a method for making the same
CN101883783A (en) Has plant of enhanced yield correlated character and preparation method thereof
CN101868544A (en) Plants having increased yield-related traits and a method for making the same
CN102143971A (en) Plants having enhanced yield-related traits and a method for making the same by overexpressing a polynucleotide encoding a TFL1-like protein
CN101627125A (en) Plants having enhanced yield-related traits and a method for making the same
BRPI0718977A2 (en) METHOD FOR INCREASING SEED Yield IN PLANTS IN RELATION TO CONTROL PLANTS, CONSTRUCTION, USE OF THE SAME, PLANT, PART OF PLANT OR PLANT CELL, METHOD FOR THE PRODUCTION OF A TRANSGENIC PLANT HAVING INCREASE IN PLANT SEED CONTROL , Transgenic plant, harvestable parts of a plant, products, and use of a nucleic acid
CN104024415A (en) Plants having enhanced yield-related traits and a method for making the same
CN102066568A (en) Plants having enhanced yield-related traits and a method for making the same
CN102066569A (en) Plants having enhanced yield-related traits and a method for making the same
CN101688214A (en) Plant and the method that is used to produce this plant with enhanced yield correlated character
CN101765609A (en) Plants having enhanced yield-related traits and a method for making the same
CN102257142A (en) Plants having enhanced yield-related traits and a method for making the same
CN103502456A (en) Plants having enhanced yield-related traits and producing methods thereof
CN102300991A (en) Plants Having Enhanced Abiotic Stress Tolerance And/or Enhanced Yield-related Traits And A Method For Making The Same
CN103119167A (en) Plants with enhanced yield-related traits and producing method thereof
CN103068992A (en) Plants having enhanced yield-related traits and method for making the same
CN103154254A (en) Plants having enhanced yield-related traits and method for making the same
CN101969759A (en) Plants having enhanced yield-related traits and a method for making the same

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20131016

Termination date: 20171213

CF01 Termination of patent right due to non-payment of annual fee