CN108624598A - Application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance - Google Patents
Application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance Download PDFInfo
- Publication number
- CN108624598A CN108624598A CN201810573735.1A CN201810573735A CN108624598A CN 108624598 A CN108624598 A CN 108624598A CN 201810573735 A CN201810573735 A CN 201810573735A CN 108624598 A CN108624598 A CN 108624598A
- Authority
- CN
- China
- Prior art keywords
- tppf
- plant
- trehalose
- gene
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention provides application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance, and the TPPF gene orders are as shown in SEQ ID NO.1.A kind of method for reducing plant leaf blade conductivity, improving plant leaf blade content of trehalose and improving plant drought ability is disclosed simultaneously, is improved in plantTPPFThe expression of gene.Present invention demonstrates that arabidopsisTPPFGene plays an important role in the content of trehalose and raising plant drought ability of control plant leaf blade.
Description
Technical field
The present invention relates to a kind of application of TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance, belong to
In biotechnology.
Background technology
Arid is to influence a major reason of crop yield.When soil drought, plant moisture is lost seriously, and cell loses
Tension, blade is sagging, and plant growth is difficult or stops growing and temporary wilting occurs, if plant cannot obtain absorbable water
Point, plant then can become permanent wilting from temporary wilting, until plant is dead.Plant in environment complicated and changeable, in order to
Normal growth and development can be carried out, develops and forms a series of strategies for resisting drought stress.It wherein include just osmotic adjustment.
Particular by a series of stress damage for adjusting the relevant gene of metabolism and metabolic pathways are reduced or rehabilitation plant is subject to, dimension
Hold a series of physiological activities of plant.
Plant is by accumulating gas chromatography and inorganic matter（Such as carbohydrate, amino acid, inorganic ions etc.）Concentration, reduce thin
The solute potential of intracellular improves intracellular water content to be called osmotic adjustment the phenomenon that coping with drought stress, it is a kind of important
Raising plant drought tolerance ability mode.Osmosis can maintain cell structure and photosynthetic in the low flow of water
Effect, Delaying Leaf-Senescence and death, can also promote the growth of root organ when water shortage situation is aggravated.It is related with osmosis
Organic matter mainly has mannitol, proline, trehalose, glycine betaine, fructose etc., these organic compounds can adjust oozing for cell
Pressure thoroughly protects cell membrane, the structure of enzyme is avoided to be destroyed.
Research before is it has also been found that trehalose may participate in response of the plant for drought stress, but we do not know
Plant is how to perceive the change of environment, and then regulate and control trehalose synthesis to protect cell membrane, finally improves plant drought resistance,
Therefore also need to carry out it deeper into careful research.
We have found that being improved in arabidopsisTPPFThe expression of gene can effectively improve containing for plant trehalose
Amount, adjusts the osmotic pressure of intraor extracellular, protects the integrality of cell membrane, reduces destruction of the drought stress to plant cell, in turn
Improve the drought-resistant ability of plant.
TPPFResearch of the gene in the synthesis of regulation and control trehalose and in terms of improving plant drought resistance is not yet reported that.
Invention content
The object of the present invention is to provide one kindTPPFGene is improving plant intracellular trehalose content, is reducing cell conductivity
And improve the application of plant drought resistance.
It is describedTPPFGene is arabidopsisTPPFGene；
It is describedTPPFIn gene cDNA sequence such as SEQ ID No.1 from 5 ' ends shown in the 32nd to the 1138th nucleotide.
The protein sequence of the TPPF coded by said gene is as shown in SEQ ID NO.2.
MakeTPPFGene method of high expression in plant is will be containing describedTPPFThe recombinant expression carrier of gene imports
In the plant；
The recombinant expression carrier is specifically willTPPFWhat the cloning site of the cDNA sequence insertion pMDC140 of gene obtained.
The plant is arabidopsis；
TPPFGene is improving plant content of trehalose, reduces the application in the drought-resistant ability of plant conductivity or raising plant
It belongs to the scope of protection of the present invention.
The content of trehalose is specially the content of trehalose of the whole strain of the plant.
It is describedTPPFGene is arabidopsisTPPFGene；
The conductivity reduction is embodied as the reduction of blade conductivity.
Present invention demonstrates that arabidopsisTPPFGene has played important function in adjusting content of trehalose and improving drought resistance.
The advantage of the invention is that：
It is an advantage of the current invention that only needing to be overexpressed individual gene, i.e. arabidopsis TPPF genes, you can improve the drought resisting of plant
Property and content of trehalose, it is easy to operate, convenient for screening, can effectively reduce cost.
Description of the drawings
Fig. 1 is in transgenic arabidopsisTPPFThe detection of gene expression dose.WT is wild type wild-type, OE6, OE5
It is three different TPPF transgenic homozygous strains with OE9.
Fig. 2 isTPPFGene overexpression can improve arabidopsis drought-resistant ability.Control is wild type under normal circumstances
（WT）With the growing state of TPPF transgenic lines, Drought is arid 26 days and wild type of the rehydration after 2 days（WT）And TPPF
The growing state of transgenic line.
Fig. 3 isTPPFGene overexpression can improve arabidopsis content of trehalose.Transfer-gen plant after TPPF gene overexpressions
Content of trehalose measure, Control is wild type under normal circumstances（WT）It is surveyed with the content of trehalose of transgenic line OE9
Fixed, Drought is the wild type after PEG6000 Drought stress simulations（WT）It is measured with the content of trehalose of transgenic line OE9.
Fig. 4 isTPPFGene overexpression can reduce the conductivity of transgenic line.Transgenosis is planted after TPPF gene overexpressions
The conductance measurement of strain, Control are wild type under normal circumstances（WT）With the conductance measurement of transgenic line OE9,
Drought is the wild type after PEG6000 Drought stress simulations（WT）With the conductance measurement of transgenic line OE9.
Specific implementation mode
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
PMDC140 is in document " Eva M. Farre ' and Steve A. Kay (2007) PRR7 protein
levels are regulated by light and the circadian clock in Arabidopsis. Plant J
It is disclosed in 52,548-560. ", the public can obtain from straits joint study institute of University Of Agriculture and Forestry In Fujian.
Arabidopsis Col-0 is environmental（Arabidopsis thaliana, Columbia ecotype）Document " Wang,
L., Hua, D., He, J., Duan, Y., Chen, Z., Hong, X., and Gong, Z. (2011). Auxin
Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate
It is disclosed in abscisic acid response in Arabidopsis. PLoS genetics 7, e1002172. ",
The public can obtain from straits joint study institute of University Of Agriculture and Forestry In Fujian.
Gateway BP Clonase II Enzyme Mix are purchased from Invitrogen companies, and catalog number is
11789-020。
Gateway LR Clonase II Enzyme mix are purchased from Life Technologies companies, product mesh
Record number is 11791-020.
Embodiment 1,TPPFThe cDNA gene clonings of gene
One, the design and synthesis of primer
According toTPPFThe CDS sequence designs of gene carry the primer of Gateway connectors, and primer sequence is：
Forward primer：
5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATTTAAACTCAAACCACA-3' reverse primers：
5'- GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAAAAACTTGTTTTTGAACTTT -3'
Two, extraction arabidopsis Col-0 is environmental（Arabidopsis thalianaL.）Total serum IgE, obtained by reverse transcription
CDNA, using DNA molecular shown in above-mentioned as primer, carries out PCR amplification, obtains pcr amplification product using cDNA as template（Such as SEQ
Shown in ID No.1）,TPPFIn the cDNA sequence such as SEQ ID No.1 of gene from 5 ' ends the 32nd to the 1138th nucleosides
Shown in acid, TPPF protein sequences are as shown in SEQ ID No.2.
Three, using the II Enzyme Mix of BP Clonase in Gateway cloning entry kits by SEQ ID No.1
Shown in DNA molecular carry out BP recombining reactions with intermediate carrier pDONR207, recycle Gateway grams after identifying positive colony
Grand expression kit（Gateway® LR Clonase® II Enzyme mix）It connect, obtains with carrier pMDC140 large fragments
To recombinant plasmid, it is named as pMDC140-TPPF, send pMDC140-TPPF to sequencing, as a result correctly.
Embodiment 2,TPPFThe influence of gene pairs plant drought resistance
One,TPPFThe acquisition of gene overexpression plant
The pMDC140-TPPF that embodiment 1 obtains is transformed into C58 Agrobacteriums, it will using the method that Agrobacterium is infected
PMDC140-TPPF plasmids are transferred to Col-0, and the plant after transfection is screened on the MS culture mediums of the hygromycin containing 30mg/L, is obtained
Homozygous positive plant with hygromycin resistance therefrom chooses the strain of 3 kinds of different expressions.
In transgenic line and the arabidopsis Col-0 ecotypesTPPFThe expression quantity of gene as shown in Figure 1, wherein OE6 with
Wild type expression level is suitable, a little higher than wild types of OE5, OE9 expression quantity highests.EIF-4A genes ensure cDNA as internal reference
Original amounts it is consistent
Two,TPPFIt is overexpressed the drought resisting phenotypic analysis of plant
Transgenic line OE5, OE6 and OE9 and arabidopsis Col-0 are environmental（Arabidopsis thaliana, Columbia
ecotype）（Hereinafter referred to as Col）It is cultivated on MS solid mediums, the seedling of 8DAG (days after germination)
Son is transplanted seedlings to be grown into soil, compares drought resistance, the results are shown in Figure 2.
The result shows that compared with wildtype Arabidopsis thaliana,TPPFGene overexpression render transgenic strain OE5, OE6 and OE9 ratio
Col more drought resistings, explanationTPPFGene can improve plant drought resistance.
Embodiment 3,TPPFThe influence that gene overexpression synthesizes transgenic line trehalose
After transgenic arabidopsis OE9 and Col grow 2 weeks in mesh sheet, 5h is handled with MS+20% PEG6000, lotus throne blade is taken to survey
Determine content of trehalose, the results are shown in Figure 3.
Fig. 3 shows that, in the case where PEG6000 is handled, transgenic arabidopsis OE9 has accumulated more seas compared with Col
Algae sugar, and substantially without difference under collating condition.
Embodiment 4,TPPFInfluence of the gene overexpression to transgenic line conductivity
Arid carries out conductance measurement after 3 weeks in the soil after taking leaf disk with card punch by transgenic arabidopsis OE9 and Col, ties
Fruit is as shown in Figure 4.
The result shows that under drought condition, transgenic arabidopsis OE9 ratios Col has lower conductivity, and in control feelings
Substantially there is no difference both under condition.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification should all belong to the covering scope of the present invention.
SEQUENCE LISTING
<110>University Of Agriculture and Forestry In Fujian
<120>Application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance
<130> 4
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 1168
<212> DNA
<213>Artificial sequence
<400> 1
ggggacaagt ttgtacaaaa aagcaggctt catggattta aactcaaacc acaaatcctc 60
tgttcttaaa gatccttcac catcagttaa ccaatcaaga ctcggcgtgt ctagtagatt 120
tatgatgagt caatggaaga aacctgcgaa actcgatgat gttagatcca atggttggtt 180
agatgcaatg atttcatctt ctccaccgcg taagaagctt gtcaaagatt ttaatgttga 240
agttgctcct gaagatgatt ttgctcaacg tgcttggatg gtgaaatatc cttcggcgat 300
tagctcgttt gcgcatattg cagctcaagc aaagaagaaa aagattgctg tatttctaga 360
ttatgatggt actctttctc caatagttga tgatcctgat cgtgccatca tgtctgatgc 420
aatgcgttct gcggttaaag atgtcgcgag ttacttccca accgcaataa ttagcggtag 480
aagccgtgac aaggtttatc agttggtagg actaacagaa ctttattacg cgggtagtca 540
tggaatggac ataatgactt cttctgatgg tccgaattgt ttcaaatcca ctgaccaaca 600
gggtaaggaa gtgaatctgt ttcagcccgc gagagaattc ataccggtta tcgacgaggt 660
ttttagaacc cttgttgaga aaatgaaaga tatcaaaggt gcaaaagtag agaaccacaa 720
gttctgtgca tctgtacatt accgtaacgt tgacgaaaag gattggccta ttattgctca 780
gcgtgttcat gaccacttga aacaataccc tcgtttgcgt ctaactcatg ggaggaaggt 840
tttagaggtt cgtcctgtga tagactggaa caaaggaaga gcggtcgagt ttctattaga 900
atctctcgga ttaagcaata aagacgattt gcttcctatc tacattggtg atgacacaac 960
cgatgaagat gcgttcaagg tactgagaga tgggaaccga ggtttcggca tcctagtatc 1020
gtctataccg aaagaaagca atgcgtttta ctcccttaga gatccatccg aggtgaagaa 1080
gtttctaaag actttggtga aatgggcaaa gttggagaag aattctactg gtttttgaga 1140
cccagctttc ttgtacaaag tggtcccc 1168
<210> 2
<211> 368
<212> PRT
<213>Artificial sequence
<400> 2
Met Asp Leu Asn Ser Asn His Lys Ser Ser Val Leu Lys Asp Pro Ser
1 5 10 15
Pro Ser Val Asn Gln Ser Arg Leu Gly Val Ser Ser Arg Phe Met Met
20 25 30
Ser Gln Trp Lys Lys Pro Ala Lys Leu Asp Asp Val Arg Ser Asn Gly
35 40 45
Trp Leu Asp Ala Met Ile Ser Ser Ser Pro Pro Arg Lys Lys Leu Val
50 55 60
Lys Asp Phe Asn Val Glu Val Ala Pro Glu Asp Asp Phe Ala Gln Arg
65 70 75 80
Ala Trp Met Val Lys Tyr Pro Ser Ala Ile Ser Ser Phe Ala His Ile
85 90 95
Ala Ala Gln Ala Lys Lys Lys Lys Ile Ala Val Phe Leu Asp Tyr Asp
100 105 110
Gly Thr Leu Ser Pro Ile Val Asp Asp Pro Asp Arg Ala Ile Met Ser
115 120 125
Asp Ala Met Arg Ser Ala Val Lys Asp Val Ala Ser Tyr Phe Pro Thr
130 135 140
Ala Ile Ile Ser Gly Arg Ser Arg Asp Lys Val Tyr Gln Leu Val Gly
145 150 155 160
Leu Thr Glu Leu Tyr Tyr Ala Gly Ser His Gly Met Asp Ile Met Thr
165 170 175
Ser Ser Asp Gly Pro Asn Cys Phe Lys Ser Thr Asp Gln Gln Gly Lys
180 185 190
Glu Val Asn Leu Phe Gln Pro Ala Arg Glu Phe Ile Pro Val Ile Asp
195 200 205
Glu Val Phe Arg Thr Leu Val Glu Lys Met Lys Asp Ile Lys Gly Ala
210 215 220
Lys Val Glu Asn His Lys Phe Cys Ala Ser Val His Tyr Arg Asn Val
225 230 235 240
Asp Glu Lys Asp Trp Pro Ile Ile Ala Gln Arg Val His Asp His Leu
245 250 255
Lys Gln Tyr Pro Arg Leu Arg Leu Thr His Gly Arg Lys Val Leu Glu
260 265 270
Val Arg Pro Val Ile Asp Trp Asn Lys Gly Arg Ala Val Glu Phe Leu
275 280 285
Leu Glu Ser Leu Gly Leu Ser Asn Lys Asp Asp Leu Leu Pro Ile Tyr
290 295 300
Ile Gly Asp Asp Thr Thr Asp Glu Asp Ala Phe Lys Val Leu Arg Asp
305 310 315 320
Gly Asn Arg Gly Phe Gly Ile Leu Val Ser Ser Ile Pro Lys Glu Ser
325 330 335
Asn Ala Phe Tyr Ser Leu Arg Asp Pro Ser Glu Val Lys Lys Phe Leu
340 345 350
Lys Thr Leu Val Lys Trp Ala Lys Leu Glu Lys Asn Ser Thr Gly Phe
355 360 365
<210> 3
<211> 53
<212> DNA
<213>Artificial sequence
<400> 3
ggggacaagt ttgtacaaaa aagcaggctt catggattta aactcaaacc aca 53
<210> 4
<211> 52
<212> DNA
<213>Artificial sequence
<400> 4
ggggaccact ttgtacaaga aagctgggtc tcaaaaacca gtagaattct tc 52
Claims (3)
- Application of the 1.TPPF genes in improving plant content of trehalose, plant drought resistance and reduction plant leaf blade conductivity.
- 2. application according to claim 1, it is characterised in that：The TPPF gene orders are as shown in SEQ ID NO.1.
- 3. application according to claim 1, it is characterised in that：The protein sequence of the TPPF coded by said gene such as SEQ ID Shown in NO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810573735.1A CN108624598A (en) | 2018-06-06 | 2018-06-06 | Application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810573735.1A CN108624598A (en) | 2018-06-06 | 2018-06-06 | Application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108624598A true CN108624598A (en) | 2018-10-09 |
Family
ID=63691013
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810573735.1A Pending CN108624598A (en) | 2018-06-06 | 2018-06-06 | Application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108624598A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114591981A (en) * | 2022-03-25 | 2022-06-07 | 江苏师范大学 | Application of TPPI gene in regulating and controlling plant root system development and promoting plant jasmonic acid accumulation |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1292824A (en) * | 1998-03-11 | 2001-04-25 | 诺瓦提斯公司 | Expression of trehalose biosynthetic genes in plants |
| US20080009066A1 (en) * | 1999-03-31 | 2008-01-10 | Caimi Perry G | Plant gene encoding trehalose metabolism enzymes |
| CN101595222A (en) * | 2006-12-15 | 2009-12-02 | 克罗普迪塞恩股份有限公司 | Plant and preparation method thereof with seed production correlated character of improvement |
| US20130019342A1 (en) * | 2011-07-15 | 2013-01-17 | Syngenta Participations Ag | Polynucleotides encoding trehalose-6-phosphate phosphatase and methods of use thereof |
-
2018
- 2018-06-06 CN CN201810573735.1A patent/CN108624598A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1292824A (en) * | 1998-03-11 | 2001-04-25 | 诺瓦提斯公司 | Expression of trehalose biosynthetic genes in plants |
| US20080009066A1 (en) * | 1999-03-31 | 2008-01-10 | Caimi Perry G | Plant gene encoding trehalose metabolism enzymes |
| CN101595222A (en) * | 2006-12-15 | 2009-12-02 | 克罗普迪塞恩股份有限公司 | Plant and preparation method thereof with seed production correlated character of improvement |
| CN103710376A (en) * | 2006-12-15 | 2014-04-09 | 克罗普迪塞恩股份有限公司 | Plants having enhanced seed yield-related traits and a method for making the same |
| US20130019342A1 (en) * | 2011-07-15 | 2013-01-17 | Syngenta Participations Ag | Polynucleotides encoding trehalose-6-phosphate phosphatase and methods of use thereof |
Non-Patent Citations (1)
| Title |
|---|
| NCBI REFERENCE SEQUENCE: NM_117313.1: "Arabidopsis thaliana catalytic/ trehalose-phosphatase (AT4G12430) mRNA, complete cds", 《GENBANK》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114591981A (en) * | 2022-03-25 | 2022-06-07 | 江苏师范大学 | Application of TPPI gene in regulating and controlling plant root system development and promoting plant jasmonic acid accumulation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Abhinandan et al. | Abiotic stress signaling in wheat–an inclusive overview of hormonal interactions during abiotic stress responses in wheat | |
| Heuer et al. | Improving phosphorus use efficiency: a complex trait with emerging opportunities | |
| Voesenek et al. | Flooding tolerance: O2 sensing and survival strategies | |
| Kumar et al. | Functional screening of cDNA library from a salt tolerant rice genotype Pokkali identifies mannose-1-phosphate guanyl transferase gene (OsMPG1) as a key member of salinity stress response | |
| Min et al. | Coordinated mechanisms of leaves and roots in response to drought stress underlying full-length transcriptome profiling in Vicia sativa L | |
| Liu et al. | A novel Pro197Glu substitution in acetolactate synthase (ALS) confers broad-spectrum resistance across ALS inhibitors | |
| Chen et al. | Ubiquitin ligase OsRINGzf1 regulates drought resistance by controlling the turnover of OsPIP2; 1 | |
| Sečenji et al. | Differences in root functions during long‐term drought adaptation: comparison of active gene sets of two wheat genotypes | |
| CN109306353A (en) | Sesame anti-drought gene SiSAM1 and its application | |
| Zhao et al. | Overexpression of a TIFY family gene, GsJAZ2, exhibits enhanced tolerance to alkaline stress in soybean | |
| Sun et al. | Sensitivity of translation initiation factor eIF1 as a molecular target of salt toxicity to sodic-alkaline stress in the halophytic grass Leymus chinensis | |
| Zhu et al. | OsSAP6 positively regulates soda saline–alkaline stress tolerance in rice | |
| US20230054349A1 (en) | Application of EMBP1 Gene or Protein Thereof | |
| Yu et al. | Genome-wide identification of calcineurin B-like protein-interacting protein kinase gene family reveals members participating in abiotic stress in the ornamental woody plant Lagerstroemia indica | |
| CN108624598A (en) | Application of the TPPF genes in the synthesis of regulation and control plant trehalose and in improving plant drought resistance | |
| Adak et al. | An updated overview of the physiological and molecular responses of rice to anoxia | |
| Wang et al. | Overexpression of the pitaya phosphoethanolamine N-methyltransferase gene (HpPEAMT) enhanced simulated drought stress in tobacco | |
| Ziyuan et al. | Molecular cloning and functional analysis of lotus salt-induced NnDREB2C, NnPIP1-2 and NnPIP2-1 in Arabidopsis thaliana | |
| Chen et al. | Genome-wide association study presents insights into the genetic architecture of drought tolerance in maize seedlings under field water-deficit conditions | |
| CN106432449B (en) | Drought tolerance in plants GAP-associated protein GAP VPS23A and its encoding gene and application | |
| CN102643856B (en) | Applications of At-ACA8 gene of arabidopsis thaliana for enhancing plant stress resistance and regulating plant growing development | |
| Pathan et al. | Molecular dissection of abiotic stress tolerance in sorghum and rice | |
| CN109161537B (en) | Application of TPPI gene in regulating and controlling plant stomata opening and improving plant drought resistance | |
| Hu et al. | A transcriptional regulation of ERF15 contributes to ABA‐mediated cold tolerance in tomato | |
| CN110791506B (en) | Nitcipk 11 gene of tangut bur, and expression protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181009 |
|
| RJ01 | Rejection of invention patent application after publication |