ES2544249T3 - Plants that have traits related to improved seed yield and a production procedure - Google Patents

Abstract

A procedure for increasing seed yield in plants with respect to control plants, wherein said increased seed yield is one or more of the following: (i) Increased number of seeds per plant; (ii) Increased number of full seeds per plant; (iii) Increased weight of seeds per plant; comprising increasing the expression in a plant of a nucleic acid encoding a class III trehalose phosphate phosphate (TPP) polypeptide, wherein said increased expression is effected by introducing and expressing in a plant a nucleic acid encoding a TPP polypeptide of class III, wherein said nucleic acid encodes a class III TPP polypeptide having at least 85% sequence identity with the amino acid sequence SEQ ID NO: 4, or wherein said class III TPP polypeptide comprises: (i) a trelalosa-PPase domain having at least 50% amino acid sequence identity with SEQ ID NO: 93 or SEQ ID NO: 94, wherein said trehalose-PPase domain comprises: a. a phosphatase A box having at least 50% sequence identity with SEQ ID NO: 96 and / or b. a phosphatase B box that has at least 50% sequence identity with SEQ ID NO: 97 and / or (ii) a serine rich domain that has at least 50% sequence identity with SEQ ID NO: 95 , wherein said control plants are corresponding wild-type plants or corresponding plants without said nucleic acid encoding said class III trehalose phosphate polypeptide.

Description

Plants that have traits related to improved seed yield and a production procedure

The growing world population and the reduction of the supply of arable land available for agricultural fuels promote research towards increasing the effectiveness of agriculture. Conventional means for crop and horticultural improvements use selective breeding techniques to identify plants that have desirable characteristics. However, such selective breeding techniques have several drawbacks, namely that these techniques usually require a large amount of labor and result in plants that often contain heterogeneous genetic components that do not always result in the trait. desired is transmitted from parent plants. Advances in molecular biology have allowed humanity to modify the germplasm of animals and plants. Plant genetic engineering involves the isolation and manipulation of genetic material (usually in the form of DNA or RNA) and the subsequent introduction of that genetic material into a plant. Such technology has the ability to provide crops or plants that have various economic, agronomic or horticultural features improved.

A feature of particular economic interest is the increase in yield. Yield is usually defined as the measurable product of economic value of a crop. This can be defined in terms of quantity and / or quality. The yield depends directly on various factors, for example the number and size of the organs, the architecture of the plant (for example, the number of branches), the production of seeds, the senescence of the leaves and other factors. Root development, nutrient absorption, stress tolerance and early vigor can also be important factors in determining performance. The optimization of the factors mentioned above can therefore contribute to increasing crop yields.

Seed yield is a particularly important feature, because the seeds of many plants are important for human and animal nutrition. Crops such as corn, rice, wheat, rapeseed and soybeans account for more than half of total human caloric consumption, either through direct consumption of the seeds themselves or through the consumption of meat products from animals raised with processed seeds. They are also a source of sugars, oils and many types of metabolites used in industrial processes. The seeds contain an embryo (the source of new shoots and roots) and an endosperm (the source of nutrients for embryo growth during germination and during early seedling growth). The development of a seed involves many genes and requires the transfer of metabolites from the roots, leaves and trunk to the growing seed. The endosperm, in particular, assimilates the metabolic precursors of carbohydrates, oils and proteins and synthesizes them by giving storage macromolecules to fill the grain.

Another important feature for many crops is early vigor. Improving early vigor is an important objective of modern rice cultivation programs in rice cultivation varieties of temperate and tropical climates. Long roots are important for proper anchorage to the ground in water-seeded rice. When rice is planted directly in waterlogged fields and when plants must quickly emerge through water, larger shoots are associated with vigor. When sowing with drilling is practiced, larger mesocotyls and coleoptils are important for a good seedling emergence. The ability to achieve early vigor in plants would be of great importance in agriculture. For example, poor early vigor has been a limitation to the introduction of corn hybrids (Zea mays L.) based on germplasm of the Corn Belt in the European Atlantic.

Another important feature is that of improved tolerance to abiotic stress. Abiotic stress is a leading cause of crop losses throughout the world, reducing average yields for most major crop plants by more than 50% (Wang et al., Plant (2003) 218: 1- 14). Abiotic stress can be caused by drought, salinity, extreme temperatures, chemical toxicity and oxidative stress. The ability to improve the plant's tolerance to abiotic stress would be a great economic advantage for farmers around the world and would allow the cultivation of crop plants in adverse conditions and in territories where the cultivation of crop plants would not be possible to another way. Another important feature related to yield is plant biomass, particularly in the case of forage crops, such as alfalfa, silage corn and hay. A larger plant with a larger leaf area can normally absorb more light and more carbon dioxide than a smaller plant and, therefore, will probably gain more weight during the same period (Fasoula and Tollenaar 2005 Maydica 50:39).

The capacity to increase the yield of plants would have many applications in sectors such as agriculture, which include the production of ornamental plants, arboriculture, horticulture and forestry. The increase in yield can also be used in the production of algae for use in bioreactors (for the biotechnological production of substances such as pharmaceuticals, antibodies or vaccines, or for bioconversion of organic wastes) and other sectors of this type.

Plant breeders are often interested in improving specific aspects of yield depending on the crop or plant in question, and the part of that plant or crop that has economic value. For example, for certain crops, or for certain end uses, a plant breeder can search

specifically improvements in plant biomass (weight) of one or more parts of a plant, which may include aerial parts (collectibles) and / or underground parts (collectibles). This is particularly relevant when the aerial parts or underground parts of a plant are for consumption. For many crops, particularly cereals, this is an improvement in seed yield that is very desirable. The increased seed yield can manifest itself in many ways, each individual aspect of seed yield being of variable importance to a plant breeder, depending on the crop or plant in question and its final use.

It would be very advantageous for a plant breeder to be able to choose and select the yield or seed yield aspects to be modified. It would be highly desirable if it were able to select, so to speak, a gene suitable for altering a particular aspect, or component, of seed yield. For example, an increase in the filling rate, in combination with an increased weight of one thousand grains, would be very desirable for a crop such as corn. For rice and wheat, a combination of increased fill rate, a crop index and weight of one thousand grains would be highly desirable.

It has been found that modulation of the expression in a plant of a nucleic acid encoding a class III trehalose phosphate phosphate (TPP) polypeptide provides plants that have various increased performance related traits.

Trehalose, a non-reducing disaccharide consisting of two glucose molecules linked by alpha-1,1 bonds, is found in various realms of living beings. In bacteria, fungi and insects, trehalose has been shown to have a carbohydrate storage function and that it has a role in stress tolerance. In plants, it was initially thought that trehalose was confined to endophytes, such as the Selaginella lepidophylla resurrection plant, but it is now accepted that trehalose metabolism is omnipresent in the plant kingdom.

Trehalose is synthesized from UDP-glucose and glucose-6-phosphate in two enzymatic reactions. In a first stage, UDP-glucose and glucose-6-phosphate are converted to UDP (uridine diphosphate) and alpha, alpha-trehalose 6-phosphate (T-6-P) by the enzyme TPS, trehalose phosphate synthase. In a second stage, which is catalyzed by the TPP enzyme (trehalose phosphate phosphatase), T-6-P is dephosphorylated to produce trehalose and orthophosphate.

In yeasts, enzymatic activities (activity of TPS and TPP) reside in large protein complexes, which contain the active subunits, TPS1 and TPS2, and the regulatory subunits, having TPS1 activity of TPS and TPS2 of TPP. In E. coli, the two enzymatic activities are found in separate protein complexes. In plants, the protein complex has not been characterized to date.

In Arabidopsis thaliana, trehalose biosynthetic enzymes have been classified into three classes:

Class I: which contains four genes, AtTPS1 to AtTPS4, which have a high similarity with ScTPS1;

Class II: which has seven members, AtTPS5 to AtTPS11, with a high sequence similarity with ScTPS2; Y

Class III :, which contains 10 members, AtTPPA to AtTPPJ, which encode proteins similar to E. coli TPS2 and the C-terminal end of ScTPS2 proteins.

The genes that encode proteins within these classes are also present in other plant species.

Within class I and class II, enzymatic activity has only been determined unambiguously for AtTPS1, which shows TPS activity (Blazquez et al. Plant J. 1998 Mar; 13 (5): 685-9.) . Surprisingly, no TPP activity has been reported to date for any of the other TPS class II proteins. In contrast, the activity of TPP for AtTPPA and AtTPPB, two of the class III members (Vogel et al. Plant J. 1998, March; 13 (5): 673-83), has been previously described. Vegetable Class III TPPs contain two consensus phosphatase sequence motifs found in all TPP enzymes described to date (Thaller et al. Protein Sci. 1998, July; 7 (7): 1647-52).

It has been reported that genetic manipulation of trehalose biosynthesis genes results in improved stress tolerance in plants, and also causes striking developmental disorders. It has been reported that overexpression of the E.coli OtsA and OtsB genes in transgenic tobacco and potato plants causes abnormalities in root and leaf development and plant atrophy. Few seeds have been produced in transgenic tobacco plants with OtsA and the transgenic potato plants with OtsB did not produce tubers (Goddijn et al. Plant Physiol. 1997, January; 113 (1): 181-90). Similar results have been described by other researchers (Holmstrom et al. Nature, 379, 683-684; Romero et al. Planta, 201, 293-297; Pilont-Smits et al. 1998; J Plant Physiol. 152: 525 -532; Schluepmann et al. Proc Natl Acad Sci USA. 2003; 100 (11): 6849-54). Mutants lacking TPS and TPP genes have also allegedly shown developmental defects. Mutants with TPS1 deactivated in Arabidopsis showed an altered embryo development (Eastmond et al. Plant J. 2002, January; 29 (2): 225-35).

US20040229364 discloses nucleic acids encoding, among others, trehalose 6-phosphate phosphatases. The document says nothing about seed yield.

WO97 / 42326 discloses that the flow of carbon through glycolysis can be stimulated by increasing the intracellular level of trehalose 6-phosphate phosphatases.

WO2006 / 060376 discloses downregulation of an endogenous trehalose 6-phosphate phosphatase gene in corn.

United States patent application published US 20060191040, on behalf of Jackson et al. It mentions the isolation and characterization of a corn gene, RAMOSA3 (RA3), which has been reported to be responsible for the development of meristem and the development of inflorescence that include branching. It has been suggested that the gene, gene product and regulatory regions can be used to manipulate branching, meristem growth, development and arrangement of inflorescences and, finally, to improve plant yield. Although the altered architecture (due to a change in branching or a change in the structure of the inflorescences) may in some cases contribute to an increase in yield or an increase in seed yield, this is not entirely clear. The presence of many other components would be necessary before an increase in seed yield or yield could be made. For example, without seed production, seed filling, plant fertility, etc., there would be no increase in seed yield. . In addition, Jackson et al. They do not mention what aspects of yield should be improved, if the biomass of specific parts of a plant, improved seed yield (which could be the size of the seed, the number of seeds, the weight of a thousand grains, the harvest index or other parameters related to seed yield). Therefore, it has been surprising to find that modulating expression in a plant of a class III TPP polynucleotide provides plants that have various traits related to increased yield, particularly increased seed yield with respect to control plants.

Accordingly, the present invention relates to a method of increasing seed yield in plants with respect to control plants, wherein said increased seed yield is one or more of the following:

(i)

 Increased number of seeds per plant;

(i)

 Increased number of full seeds per plant;

(iii) Increased weight of seeds per plant;

comprising increasing the expression in a plant of a nucleic acid encoding a class III trehalose phosphate phosphate (TPP) polypeptide, wherein said increased expression is effected by introducing and expressing in a plant a nucleic acid encoding a TPP polypeptide of class III, wherein said nucleic acid encodes a class III TPP polypeptide having at least 85% sequence identity with the amino acid sequence SEQ ID NO: 4, or

wherein said class III TPP polypeptide comprises:

(i)

a trelalosa-PPase domain having at least 50% amino acid sequence identity with SEQ ID NO: 93 or SEQ ID NO: 94, wherein said trehalose-PPase domain comprises:

to.

 a phosphatase A box having at least 50% sequence identity with SEQ ID NO: 96 and / or

b.

 a phosphatase B box that has at least 50% sequence identity with SEQ ID NO: 97 and / or

(ii)

 a serine rich domain that has at least 50% sequence identity with SEQ ID NO: 95, wherein said control plants are corresponding wild type plants or corresponding plants without said nucleic acid encoding said trehalose phosphate polypeptide Class III

In addition, the present invention relates to an isolated nucleic acid molecule comprising:

(i)

 a nucleic acid of SEQ ID NO: 3;

(ii)

 the complement of SEQ ID NO indicated in (i);

(iii) a nucleic acid encoding a class III TPP protein that has at least 90% sequence identity with the amino acid sequence provided in SEQ ID NO: 4,

(iv)

In addition, the present invention relates to an isolated polypeptide comprising:

(i)

 an amino acid sequence of SEQ ID No. 4;

(ii)

an amino acid sequence that has at least 90% sequence identity with the amino acid sequence provided in SEQ ID NO: 4;

In addition, this refers to a construct comprising:

(to)

 a nucleic acid encoding a class III TPP polypeptide according to claim 6; Y

(b)

 one or more control sequences capable of controlling the expression of the nucleic acid sequence of (a), wherein said, one, control sequence is a GOS2 promoter; Y

(C)

 optionally a transcription termination sequence.

In addition, the present invention relates to the use of said construct in a process of producing plants that have an increased seed yield with respect to control plants, wherein said seed yield is one or more of the following:

(i)

 Increased number of seeds per plant;

(i)

 Increased number of full seeds per plant;

(iii) Increased (total) weight of seeds per plant;

wherein said control plants are corresponding wild type plants or corresponding plants without said nucleic acid encoding said class III trehalose phosphate polypeptide.

A plant, part of a plant or plant cell transformed with said construct is also provided, in which said construct is integrated into the genome of the plant, part of the plant or plant cell.

In addition, the present invention relates to a production process of a transgenic plant having increased seed yield, wherein said seed yield is one or more of the following:

(i)

 Increased number of seeds per plant;

(i)

 Increased number of full seeds per plant;

(iii) Increased (total) weight of seeds per plant; which includes:

(i)

introducing and expressing in a plant a nucleic acid encoding a class III TPP protein according to claim 1 or 6 and

(ii)

 Cultivate the plant cell under conditions that promote plant growth and development.

A transgenic plant is also provided that has increased seed yield with respect to control plants, said seed yield being increased as a result of an increased expression of an introduced nucleic acid encoding a class III TPP protein as defined in the claim 6, or a transgenic plant cell that can be obtained from said transgenic plant, said transgenic plant being a crop or a monocot plant or a cereal, such as rice, corn, wheat, barley, millet, rye, sorghum or oats , or a transgenic plant cell derived from said transgenic plant, wherein said control plants are corresponding wild-type plants or corresponding plants without said nucleic acid encoding said class III trehalose phosphate polypeptide.

In addition, the present invention relates to the use of a nucleic acid encoding a class III TPP protein according to claim 1 or 6 to increase seed yield in plants with respect to control plants when introduced and expressed in said plants. , wherein said seed yield is one or more of the following:

(i)

 Increased number of seeds per plant;

(i)

 Increased number of full seeds per plant;

(iii) Increased (total) weight of seeds per plant;

wherein said control plants are corresponding wild-type plants or corresponding plants with plants without said nucleic acid encoding said class III trehalose phosphate polypeptide.

Any reference hereinafter to a "protein useful in the methods of the invention" is taken to mean a class III TPP polypeptide as in the claims. Any reference hereinafter to a "nucleic acid useful in the methods of the invention" is taken to mean a nucleic acid capable of encoding said class III TPP polypeptide. The terms "polypeptide" and "protein" are used interchangeably herein and refer to amino acids in a polymeric form of any length. The terms and expressions "polynucleotide (s)",

"nucleic acid sequence (s)", "nucleotide sequence (s)", "polynucleotide molecule (s)" are used interchangeably herein and refer either to ribonucleotides or to deoxyribonucleotides or a combination thereof , in a polymeric form of any length.

The choice of suitable control plants is a routine part of an experimental setup and these may include corresponding wild type plants or corresponding plants without the gene of interest. The control plant is usually of the same plant species or even of the same variety as the plant to be evaluated. The control plant can also be a nulicigoto of the plant to be evaluated. A "control plant", as used herein refers not only to whole plants, but also to parts of plants, including seeds and parts of seeds.

A preferred method for increasing the expression of a nucleic acid encoding a protein useful in the methods of the invention is to introduce and express into a plant a nucleic acid encoding a protein useful in the methods of the invention as defined below.

The nucleic acid to be introduced into a plant (and, therefore, useful in carrying out the methods of the invention) is any nucleic acid encoding the type of protein, which will now be described, also referred to herein as "Class III TPP nucleic acid" or "Class III TPP gene" or a "Class III TPP polynucleotide".

A "class III TPP polypeptide", as disclosed herein, refers to any polypeptide with trehalose-6-phosphate phosphatase activity comprising at least one trehalose phosphatase (trehalose-PPase) domain.

Trehalose-PPase domains are normally between 200 and 250 amino acids in length and normally comprise a consensus sequence motif of phosphatase found in all TTP enzymes described to date (Thaller et al. 1998). A representative consensus sequence for the trehalose-PPase domain is provided in SEQ ID NO: 93. The amino acid sequence for the trehalose-PPase domain comprised in SEQ ID NO: 2 is provided in SEQ ID NO: 94. An expert in The technique will be able to easily identify the presence of a trehalose-PPase domain using tools and techniques known in the art. Examples 2, 3 and 4 of this document provide additional details regarding the identification of a trehalose-PPase domain. In TPP class III polypeptides, this phosphatase consensus sequence motif typically comprises two phosphatase boxes, called phosphatase box A and B. SEQ ID NO: 96 represents a consensus sequence for phosphatase box A and SEQ ID Nº: 97 represents a consensus sequence for phosphatase box B.

Nucleic acids useful in the methods of the invention encode class III TPP polypeptides comprising at least one trehalose-PPase domain, which domain preferably has, in increasing order of preference, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more amino acid sequence identity with either SEQ ID NO: 93 or SEQ ID NO: 94. More preferably, the trehalose-PPase domain comprises at least one (preferably two) phosphatase box (s) having, in increasing order of preference, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more of amino acid sequence identity with either SEQ ID NO: 96 or SEQ ID NO: 97.

TPP class III polypeptides may also comprise a serine-rich region, normally located at the N-terminal end of the trehalose-PPase domain. SEQ ID NO: 95 represents a consensus sequence for the serine rich domain. Preferably, the nucleic acids useful in the methods of the invention encode class III TPP polypeptides comprising a serine rich domain that has, in increasing order of preference, at least 50%, 55%, 60%, 65%, 70 %, 75%, 80%, 85%, 90%, 95% or 98% or more of amino acid sequence identity with SEQ ID NO: 95.

Preferably, the nucleic acid to be introduced into a plant encodes a class III TPP protein that has, in increasing order of preference, at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID No. 4. Most preferably, the class III TPP nucleic acid is that represented by SEQ ID No. 3.

Typically, a class III TPP polypeptide, when used in the construction of a TPP / TPS phylogenetic tree, such as that depicted in Fig. 2A, tends to group with the group of class III TPP proteins comprising the sequence of amino acids represented by SEQ ID NO: 2 more than with any other group.

Examples of proteins useful in the methods of the invention and the nucleic acids encoding them are provided herein in Table A of Example 1.

Homologues of any of the amino acid sequences provided in Table A of Example 1 are also useful in the disclosed methods. "Homologues" of a protein encompasses peptides, oligopeptides, polypeptides, proteins and enzymes having substitutions, deletions and / or insertions of amino acids with respect to the unmodified protein in question and having a biological and functional activity similar to that of the unmodified protein from which they are derived.

A deletion refers to the elimination of one or more amino acids from the protein.

An insertion refers to the introduction of one or more amino acid residues at a predetermined site of a protein. The inserts may comprise N-terminal and / or C-terminal fusions, as well as intrasequential insertions of one or multiple amino acids. In general, the insertions within the amino acid sequence will be smaller than N- fusions. or C-terminals, of the order of approximately 1 to 10 residues. Examples of non-C-terminal fusion proteins or peptides include the binding domain or the activation domain of a transcriptional activator as used in the system of two yeast hybrids, phage coating proteins, (histidine) tail. -6, glutathione tail S-transferase, protein A, maltose binding protein, dihydrofolate reductase, epitope Tag • 100, epitope cmyc, epitope FLAG®, lacZ, CMP (calmodulin binding peptide), epitope HA, epitope of protein C and epitope VSV.

A substitution refers to the replacement of amino acids in the protein with other amino acids that have similar properties (such as hydrophobicity, hydrophilicity, antigenicity, propensity similar to forming or breaking licohelicoidal structures or -laminar structures). The amino acid substitutions are normally of a single residue, but can be grouped according to the functional restrictions arranged in the polypeptide; the inserts will usually be of the order of approximately 1 to 10 amino acid residues. Amino acid substitutions are preferably conservative amino acid substitutions. Conservative substitution tables are well known in the art (see, for example, Creighton (1984) Proteins. W.H. Freeman and company and Table 1 below).

Table 1: Examples of conserved amino acid substitutions

Residue

Conservative substitutions  Residue Conservative substitutions

To

Be Leu Ile; Val

Arg

Lys Lys Arg; Gln

Asn

Gln; His Met Leu; Ile

Asp

Glu Phe Met; Leu; Tyr

Gln

Asn Be Thr; Gly

Cys

Be Thr Be; Val

Glu

Asp Trp Tyr

Gly

Pro Tyr Trp; Phe

His

Asn; Gln Val Ile; Leu

Ile

Leu; Val

Substitutions, deletions and / or insertions of amino acids can be easily performed using peptide synthesis techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulation. Methods of manipulating DNA sequences to produce substitution, insertion or deletion variants of a protein are well known in the art. For example, substitution mutations production techniques at predetermined sites of DNA are well known to those skilled in the art and include M13 mutagenesis, T7 gene in vitro mutagenesis (USB, Cleveland, OH, United States), site directed mutagenesis. QuickChange site (Stratagene, San Diego, CA, United States), site-directed mutagenesis mediated by PCR or other site-directed mutagenesis protocols.

Also useful in the methods of the invention are derivatives of any one of the polypeptides provided in Table A of Example 1 or orthologs or paralogs of any of the polypeptides provided in Table A of Example 1 or derivatives of any orthologs or paralogs provided in Table A. "Derivatives" includes peptides, oligopeptides, polypeptides that may, in comparison to the amino acid sequence of the naturally occurring form of the protein, such as that presented in SEQ ID NO: 2, comprise amino acid substitutions for residues of amino acids of unnatural origin, or additions of amino acid residues of unnatural origin. Derivatives of the polypeptides provided in Table A of Example 1 are other examples that may be suitable for use in the methods of the invention. The derivatives useful in the processes of the present invention preferably have a biological and functional activity similar to that of the unmodified protein from which they are derived.

The "derivatives" of a polypeptide include peptides, oligopeptides, polypeptides that may, in comparison to the amino acid sequence of the naturally occurring form of the protein, such as the protein of interest, comprise amino acid substitutions for amino acid residues of origin. unnatural, or additions of amino acid residues of unnatural origin. The "derivatives" of a protein also encompass peptides, oligopeptides, polypeptides comprising amino acid residues of modified natural origin (glycosylated, acylated, prenylated, phosphorylated, myristoylated, sulfated, etc.) or of unnatural origin modified compared to the sequence of amino acids of a naturally occurring form of the polypeptide. A derivative can also comprise one or more substituents or non-amino acid additions compared to the amino acid sequence from which it is derived, for example a communicating molecule or other ligand, covalently or non-covalently bound to the

amino acid sequence, such as a communicating molecule that binds to facilitate its detection, and amino acid residues of unnatural origin with respect to the amino acid sequence of a naturally occurring protein. In addition, "derivatives also include fusions of the naturally occurring form of the protein with label peptides such as FLAG, HIS6 or thioredoxin (for a review of the label peptides see Terpe, Appl. Microbiol. Biotechnol. 60, 523- 533, 2003).

The invention is illustrated by the transformation of plants with the Arabidopsis thaliana nucleic acid sequence represented by SEQ ID NO: 1, which encodes the polypeptide sequence SEQ ID NO: 2; however, the embodiment of the invention is not restricted to these sequences. The methods of the invention can be advantageously performed using any nucleic acid encoding a protein useful in the methods of the invention as defined herein, including nucleic acids encoding orthologs, paralogs and homologs of SEQ ID NO: 2, such as (but not limited to) any of the amino acid sequences provided in Table A of Example 1.

The amino acid sequences provided in Table A of Example 1 are examples of orthologs and paralogs of the class III TPP polypeptide represented by SEQ ID NO: 2, and the nucleic acids encoding it are useful in the methods of the invention. Orthologs and paralogs encompass evolutionary concepts used to describe the ancestral relationship of genes. Paralogs are genes within the same species that have originated by duplication of an ancestral gene and orthologs are genes from different organisms that have originated by speciation and are also derived from a common ancestral gene.

Orgologists and paralogs can easily be found by performing a blast search called reciprocal. Normally, this implies a first BLAST that involves submitting a query sequence to BLAST (for example using any of the sequences listed in Table A of Example 1) against any sequence database, such as the available NCBI database publicly BLASTN or TBLASTX (using standard defaults) are generally used when starting from a nucleotide sequence and BLASTP or TBLASTN (using standard defaults) when starting from a protein sequence. BLAST results can optionally be filtered. Then, the full length sequences of either filtered results or unfiltered results are resubmitted to BLAST (second BLAST) against sequences of the organism from which the query sequence is derived (the query sequence being SEQ ID NO: one

or SEQ ID NO: 2, the second being BLAST, therefore, against Arabidopsis thaliana sequences). Then, the results of the first and second BLAST are compared. A paralog is identified if a high ranking success of the first blast is of the same species from which the query sequence is derived, then a new BLAST results, ideally, the query sequence among the greatest success; an ortholog is identified if a high ranking success in the first blast is not of the same species from which the query sequence is derived and, preferably, the results being after a new BLAST in the query sequence among the greatest hits .

High ranking successes are those with a low E value. The lower the value of E, the more significant the classification will be (or, in other words, the lower the chance of finding the chance coincidentally). The calculation of the value of E is well known in the art. In addition to E values, comparisons are also classified by percent identity. Percent sequence identity refers to the number of identical nucleotides (or amino acids) between the two nucleic acid sequences (or polypeptides) compared over a particular length. In the case of large families, ClustalW can be used, followed by a neighbor binding tree, to help visualize the clustering of related genes and to identify ortholog and paralogs.

Table A of Example 1 provides orthologs and paralogs of class III TPP protein represented by SEQ ID NO. 2. Other orthologs and paralogs can be readily identified using the BLAST procedure described above.

The proteins of the disclosure can be identified by the presence of the conserved trehalose PPase domain (s) (shown in Figure 1 and in Example 4). The term "domain" refers to a set of amino acids conserved at specific positions along an alignment of evolutionarily related protein sequences. Although amino acids from other positions may vary between homologs, amino acids that are highly conserved at specific positions indicate amino acids that are essential in the structure, stability or function of a protein. Identified by their high degree of conservation in aligned sequences of a family of protein homologs, they can be used as identifiers to determine if any polypeptide in question belongs to a previously identified family of polypeptides (in this case, the proteins useful in the methods of the invention and nucleic acids encoding them as defined herein). The term "motif" or "consensus sequence" or "signature" refers to a conserved region short in the sequence of evolutionarily related proteins. Motifs are often highly conserved parts of domains, but they can also include only part of the domain, or be located outside the conserved domain (if all amino acids in the motif are outside a defined domain).

There are also specialized databases for domain identification, for example, SMART (Schultz et al. (1998) Proc. Natl. Acad. Sci. USA 95: 5857-5864; Letunic et al. (2002) Nucleic Acids Res 30 , 242-244, InterPro

(Mulder et al., (2003) Nucl. Acids. Res. 31, 315-318, Prosite (Bucher and Bairoch (1994), A generalized profile syntax for biomolecular sequences motifs and its function in automatic sequence interpretation. (In) ISMB -94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology, Altman R., Brutlag D., Karp P., Lathrop R., Searls D., Eds., Pages 53-61, AAAIPress, Menlo Park; Hulo et al. ., Nucl. Acids. Res. 32: D134-D137. (2004) or Pfam (Bateman et al., Nucleic Acids Research 30 (1): 276-280 (2002). A series of tools for computer analysis of Protein sequences are available on the ExPASY proteomic server (provided by the Swiss Institute of Bioinformatics (Gasteiger et al., ExPASy: the proteomics server for in-depth protein knowledge and analysis, Nucleic Acids Res. 31: 3784-3788 (2003)) .

Domains can also be identified using routine techniques, such as sequence alignment. Methods for sequence alignment for comparison are well known in the art; Such procedures include GAP, BESTFIT, BLAST, FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch ((1970) J Mol Biol 48: 443-453) to find the global alignment (that is, that encompasses the complete sequences) of two sequences that maximizes the number of matches and minimizes the number of spaces The BLAST algorithm (Altschul et al. (1990) J Mol Biol 215: 403-10) calculates the percentage of sequence identity and performs a statistical analysis of the similarity between the two sequences. The software to perform the BLAST analysis is publicly available through the National Center for Biotechnology Information (NCBI). Homologues can be easily identified using, for example, the ClustalW multiple sequence alignment algorithm (version 1.83) with the default peer alignment parameters, and a percentage classification procedure. The overall similarity and identity percentages can also be determined using one of the procedures available in the MatGAT software package (Campanella et al., BMC Bioinformatics. 2003, July, 10; 4: 29. MatGAT: an application that generates similarity matrices / identity using protein or DNA sequences.). A secondary manual edition can be performed to optimize the alignment between preserved motifs, as will be apparent to one skilled in the art. In addition, instead of using full length sequences for homolog identification, specific domains (such as the trehalose-PP domain or one of the motifs defined above) can also be used. Sequence identity values, which are indicated in Example 3 as a percentage, were determined throughout the entire nucleic acid or amino acid sequence and along selected domains or conserved motif (s). , using the programs mentioned above using the default parameters.

In addition, class III TPP proteins (at least in their native form) normally have trehalose phosphatase activity. Polypeptides with trehalose phosphatase activity belong to the EC enzyme class: 3.1.3.12, according to the classification of the Enzyme Commission of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB). Class EC enzymes: 3.1.3.12 catalyze the reaction: trehalose-6 phosphate + H2O = trehalose + phosphate.

The activity of a trehalose phosphatase protein can be measured by determining the levels of the processed substrate and the accumulated product levels in an in vitro reaction, that is, determining the level of trehalose-6-phosphate and the accumulation of trehalose from the reaction. Enzymatic procedures for measuring trehalose can be based on the hydrolyzing of trehalose to give glucose, such as those described by Van Dijck et al. Biochem J. 2002, August, 15; 366 (Pt 1): 63-71 and Zentella et al. Plant Physiol., April, 1999; 119 (4): 1473-82.

Trehalose-6-phosphate levels can also be measured by HPLC (high performance liquid chromatography) procedures such as those described by Avonce et al. Plant Physiol 2004, November; 136 (3): 3649-59; Schluepmann et al. 2003. Alternative procedures based on the determination of inorganic phosphate release from trehalose-6-phosphate by Klutts et al. J Biol Chem. 2003, January, 24; 278 (4): 2093-100. An alternative procedure for determining levels of trehalose-6-phosphate using liquid chromatography coupled to EM-Q3 (triple quadrupole MS) has been described by Lunn et al. Biochem J. 2006, July, 1; 397 (1): 139-48. Additional details are provided in Example 5 and Example 6.

Examples of suitable nucleic acids for use in performing the methods of the invention include the amino acid sequences provided in Table A of Example 1, but are not limited to these sequences. Nucleic acid variants may also be useful in the practice of the invention. Examples of such variants of nucleic acids include portions of nucleic acids encoding a protein useful in the methods of the invention, hybridization of nucleic acids to nucleic acids encoding a protein useful in the methods of the invention, spindle variants of nucleic acids encoding a protein useful in the methods of the invention, allelic variants of nucleic acids encoding a protein useful in the methods of the invention and variants of nucleic acids encoding a protein useful in the methods of the invention that are obtained by gene transposition . The terms and expressions portion, hybridization sequence, ayuste variant, allelic variant and gene transposition will now be described.

Nucleic acids encoding proteins useful in the methods of the disclosure do not need to be full-length nucleic acids, because performing the methods of the disclosure does not depend on the use of full-length nucleic acid sequences. The portions useful in the methods of the disclosure encode a polypeptide that is included in the definition of a nucleic acid that encodes a protein useful in the methods of the disclosure as defined herein and that has substantially the same biological activity as the amino acid sequences provided in Table A of Example 1.

Preferably, the portion is a portion of any one of the nucleic acids provided in Table A of Example 1. The portion is normally at least 625 consecutive nucleotides in length, preferably at least 825 consecutive nucleotides in length, more preferably at least 1025 nucleotides consecutive lengths and most preferably at least 1125 consecutive length nucleotides, the consecutive nucleotides being any one of the nucleic acid sequences provided in Table A of Example 1. Most preferably, the portion is a portion of the acid nucleus of SEQ ID NO: 1. Preferably, the portion encodes an amino acid sequence that when used in the construction of a phylogenetic tree TPP / TPS, such as that depicted in Fig. 2A, tends to cluster with the protein group Class III TPP comprising the amino acid sequence represented by SEQ ID NO: 2 more than with qua Any other group.

A portion of a nucleic acid encoding a class III TPP protein as defined herein can be prepared, for example, by producing one or more deletions to the nucleic acid. The portions can be used in isolation or can be fused with other coding (or non-coding) sequences to produce, for example, a protein that combines several activities. When fused with other coding sequences, the resulting polypeptide produced after translation may be larger than predicted for the class III TPP protein portion.

According to the present disclosure, there is provided a method for improving traits related to plant yield, particularly for improving seed yield, which comprises introducing and expressing in a plant a portion of any one of the nucleic acid sequences provided in the Table. A of Example 1, or a portion of a nucleic acid encoding an ortholog, paralog or homologue of any of the amino acid sequences provided in Table A of Example 1.

Another variant of nucleic acids useful in the processes of the invention is a nucleic acid capable of hybridizing under conditions of reduced stringency, preferably under stringent conditions, with a nucleic acid encoding a class III TPP protein as defined herein. , or with a portion as defined herein.

Hybridization sequences useful in the methods of the invention encode a polypeptide having a trehalose-PPase domain (see alignment of Fig. 2A and Fig. 3) and having substantially the same biological activity as TPP proteins of Class III represented by any of the amino acid sequences provided in Table A of Example 1. The hybridization sequence is normally at least 625 consecutive nucleotides in length, preferably at least 825 consecutive nucleotides in length, more preferably at least 1025 consecutive nucleotides of length and most preferably at least 1125 consecutive nucleotides in length, the consecutive nucleotides being any one of the nucleic acid sequences provided in Table A of Example 1. Preferably, the hybridization sequence is one that is capable of hybridizing with any of the nucleic acids provided in the Table A of Example 1, or with a portion of any of these sequences, a portion being defined as defined above. Most preferably, the hybridization sequence is capable of hybridizing to a nucleic acid represented by SEQ ID NO: 1 or with a portion thereof.

Preferably, the hybridization sequence encodes an amino acid sequence when used in the construction of a phylogenetic tree TPP / TPS, such as that depicted in Fig. 2A, tends to group with the group of TPP class III proteins comprising the amino acid sequence represented by SEQ ID NO: 2 more than with any other group.

Most preferably, the isolated polynucleotide molecule is capable of hybridizing under stringent conditions with a sequence represented by one of SEQ ID NO: 4, 6 and 8.

According to the present disclosure, there is provided a method for improving plant performance-related traits, particularly for improving seed yield, which comprises introducing and expressing in a plant a nucleic acid capable of hybridizing with any one of the nucleic acids provided in Table A of Example 1, or comprising introducing and expressing in a plant a nucleic acid capable of hybridizing with a nucleic acid encoding an ortholog, paralogue or homologue of any of the amino acid sequences provided in Table A of Example 1.

The term "hybridization," as defined herein, is a procedure in which substantially homologous complementary nucleotide sequences hybridize to each other. The hybridization process can take place entirely in solution, that is, the complementary nucleic acids are in solution. The hybridization process can also take place with one of the complementary nucleic acids immobilized in a matrix such as magnetic beads, sepharose beads or any other resin. The hybridization process can also take place with one of the complementary nucleic acids immobilized on a solid support such as a nitrocellulose or nylon membrane by, for example, photolithography on, for example, a siliceous glass support (known as this last as provisions of amino acids or microdispositions

or as nucleic acid chips). To allow hybridization to take place, nucleic acid molecules are denatured, in general, thermally or chemically, to undo a double chain into two single chains and / or to remove hairpins or other secondary structures of single stranded nucleic acids.

The term "stringency" refers to the conditions under which hybridization takes place. The stringency of the hybridization is influenced by conditions such as temperature, salt, concentration, ionic strength and composition of the hybridization buffer. Generally, high stringency conditions are selected to be approximately 30 ° C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The conditions of medium stringency are when the temperature is 20 ° C lower than Tm, and the conditions of high stringency is when the temperature is 10 ° C lower than Tm. High stringency hybridization conditions are normally used to isolate hybridization sequences that have a high sequence similarity to the target nucleic acid sequence. However, the nucleic acid sequence can be varied and still encode a substantially identical polypeptide, due to the degeneracy of the genetic code. Therefore, medium stringency hybridization conditions may sometimes be needed to identify such nucleic acid molecules. The Tm is the defined ionic strength temperature and pH at which 50% of a target sequence hybridizes with a perfectly matching probe. The Tm depends on the solution conditions and the basic composition and length of the probe. For example, larger sequences specifically hybridize at higher temperatures. The maximum hybridization rate is obtained from approximately 16 ° C to 32 ° C below Tm. The presence of monovalent cations in the hybridization solution reduces electrostatic repulsion between the two nucleic acid chains, thereby promoting hybrid formulation; This effect is visible for sodium concentrations higher than 0.4 M (for higher concentrations, this effect can be ignored). Formamide reduces the melting temperature of the DNA-DNA and DNA-RNA duplex by 0.6 to 0.7 ° C for each percentage of formamide, and the addition of 50% formamide allows hybridization at 30 to 45 ° C, although the hybridization rate will be reduced. Incorrect pairings of base pairs reduce the hybridization rate and thermal stability of duplexes. On average and for large probes, the Tm decreases approximately 1 ° C by% of incorrect base pairing. The Tm can be calculated using the following equations, depending on the types of hybrids:

1) DNA-DNA hybrids (Meinkoth and Wahl, Anal. Biochem., 138: 267-284, 1984):

81.5 ° C + 16.6xlog10 [Na +] at + 0.41x% [G / Cb] -500x [Lc] -1 -0.61x% formamide

2) DNA-RNA or RNA-RNA hybrids:

Tm = 79.8 + 18.5 (log10 [Na +] a) + 0.58 (% G / Cb) + 11.8 (% G / Cb) 2-820 / Lc

3) oligo-DNA or oligo-dRNA hybrids:

For <20 nucleotides: Tm = 2 (ln)

For 20-35 nucleotides: Tm = 22 + 1.46 (ln)

a or for another monovalent cation, but accurate only in the range of 0.01-0.4 M.

b exact only for% GC in the range of 30% to 75%.

c L = length of duplex in base pairs.

d Oligo, oligonucleotides; ln, effective primer length = 23 (No. of G / C) + (No. of A / T).

Non-specific binding can be controlled using any one of a number of known techniques such as, for example, membrane blockage with solutions containing proteins, heterologous RNA, DNA and SDS additions to the hybridization buffer and Rnasa treatment. For non-homologous probes, a series of hybridizations can be performed by varying one of (i) progressively reducing the hybridization temperature (for example from 68 ° C to 42 ° C) or (ii) progressively reducing the concentration of formamide (for example 50 % to 0%). The expert is aware that various parameters can be altered during hybridization and that the stringent conditions will be maintained or changed.

In addition to the hybridization conditions, the specificity of hybridization also depends, normally, on the function of post-hybridization washes. To remove the bottom resulting from non-specific hybridization, the samples are washed with dilute saline solutions. Critical factors of such washes include the ionic strength and the temperature of the final wash solution: the lower the salt concentration and the higher the wash temperature, the greater the washing rigor. Washing conditions are normally performed at hybridization or lower stringency. A positive hybridization provides a signal that is at least twice that of the background. In general, the stringent conditions suitable for nucleic acid hybridization assays or gene amplification detection procedures are as set forth above. More or less stringent conditions can also be selected. The expert is aware that various parameters can be modified during washing and that the stringent conditions will be maintained or changed.

For example, typical high stringency hybridization conditions for DNA hybrids with more than 50 nucleotides include hybridization at 65 ° C in 1x SSC or 42 ° C in 1x SSC and 50% formamide, followed by washing at 65 ° C in 0.3 x SSC. Examples of medium stringency hybridization conditions for hybrids of

DNA with more than 50 nucleotides encompasses hybridization at 50 ° C in 4x SSC or at 40 ° C in 6x SSC and 50% formamide, followed by washing at 50 ° C in 2x SSC. The length of the hybrid is the expected length for nucleic acid hybridization. When nucleic acids of known sequence hybridize, the hybridization length can be determined by aligning the sequences and identifying the conserved regions described herein. 1x SSC is 0.15 M NaCl and 15 mM sodium citrate; The hybridization solution and wash solutions may additionally include 5x Denhardt reagent, 0.5-1.0% SDS, 100 µg / ml denatured fragmented salmon sperm DNA, 0.5% pyrophosphate sodium.

To define the level of rigor, reference can be made to Sambrook et al. (2001) Molecular Cloning: a laboratory manual, 3rd edition, Cold Spring Harbor Laboratory Press, CSH, New York or a Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989 and annual updates).

Another variant of nucleic acids useful in the methods of the disclosure is a spindle variant that encodes a class III TPP protein as defined hereinbefore. The term "ayuste variant", as used herein, encompasses variants of a nucleic acid sequence in which the selected introns and / or exons have been cleaved, replaced or added, or in which the introns are They have shortened or lengthened. Said variants will be ones in which the biological activity of the protein is substantially conserved; This can be achieved by selectively conserving functional segments of the protein. Such variants of ayuste can be found in nature or can be produced by humans. Methods for predicting and isolating such spindle variants are well known in the art (see, for example, Foissac and Schiex, BMC Bioinformatics. 2005; 6: 25).

According to the present disclosure, there is provided a method for improving traits related to plant yield, particularly for improving seed yield, which comprises introducing and expressing in a plant a variant of aid of any one of the nucleic acid sequences provided in Table A of Example 1, or a spindle variant of a nucleic acid encoding an ortholog, paralog or homologue of any of the amino acid sequences provided in Table A of Example 1.

Preferred spindle variants are spindle variants of a nucleic acid represented by SEQ ID NO: 1 or a spindle variant of a nucleic acid encoding an ortholog or paralog of SEQ ID NO: 2. Preferably, the amino acid sequence encoded by the ayuste variant comprises one or more of any of the reasons

or domains as defined herein. Preferably, the amino acid sequence encoded by the splice variant, when used in the construction of a phylogenetic tree TPP / TPS, such as that depicted in Fig. 2A, tends to group with the group of class III TPP proteins that it comprises the amino acid sequence represented by SEQ ID NO: 2 more than with any other group.

Another variant of nucleic acids useful in the methods of the disclosure is an allelic variant of a nucleic acid encoding a class III TPP protein as defined hereinbefore. Allelic alleles or variants are alternative forms of a given gene, located in the same chromosomal position. Allelic variants exist in nature and the use of these natural alleles is encompassed within the procedures of the present disclosure. Allelic variants encompass mononucleotide polymorphisms (SNPs), as well as small insertion / deletion polymorphisms (INDEL). The size of INDEL is usually less than 100 bp. SNPs and INDELs form the largest set of sequence variants in natural polymorphic strains of most organisms. The allelic variants useful in the methods of the present disclosure have substantially the same biological activity as the class III TPP protein of SEQ ID NO: 2.

According to the present disclosure, a method is provided to improve plant performance-related traits, particularly to improve seed yield, which comprises introducing and expressing in an plant an allelic variant of any one of the nucleic acid sequences provided in the plant. Table A of Example 1, or comprising introducing and expressing in an plant an allelic variant of a nucleic acid encoding an ortholog, paralog or homologue of any of the amino acid sequences provided in Table A of Example 1.

Preferably, the allelic variant is an allelic variant of SEQ ID NO: 1 or an allelic variant of a nucleic acid encoding an ortholog or paralog of SEQ ID NO: 2. Preferably, the amino acid sequence encoded by the allelic variant comprises one or plus any of the motives or domains as defined in this document. Preferably, the amino acid sequence encoded by the allelic variant, when used in the construction of a TPS / TPP phylogenetic tree, such as that depicted in Fig. 2A, tends to cluster with the group of class III TPP proteins comprising the amino acid sequence represented by SEQ ID NO: 2 more than with any other group.

Another variant of nucleic acids useful in the methods of the disclosure is a variant of nucleic acids obtained by gene transposition. Gene transposition or directed evolution can also be used to generate nucleic acid variants encoding class III TPP proteins as defined above. This consists of iterations of DNA transposition followed by screening and / or selection to generate variants of nucleic acids or portions thereof encoding class III TPP proteins such as

They have been previously defined as having a modified biological activity (Castle et al. (2004) Science 304 (5674): 1151-4; U.S. Patent Nos. 5,811,238 and No. 6,395,547).

According to the present disclosure, there is provided a method for improving performance-related traits in plants comprising introducing and expressing in a plant a variant of any one of the nucleic acid sequences provided in Table A of Example 1 or comprising introducing and express in a plant a variant of a nucleic acid encoding an ortholog, paralogue or homologue of any of the amino acid sequences provided in Table A of Example 1, the nucleic acid variant being obtained by gene transposition.

Preferably, the amino acid variant obtained by gene transposition encodes an amino acid sequence comprising one or more of any of the motifs or domains as defined herein. Preferably, the amino acid sequence encoded by the nucleic acid variant obtained by gene transposition, when used in the construction of a TPS / TPP phylogenetic tree, such as that depicted in Fig. 2A, tends to group with the protein group Class III TPP comprising the amino acid sequence represented by SEQ ID NO: 2 more than with any other group.

In addition, variants of nucleic acids can also be obtained by site-directed mutagenesis. Several procedures are available to achieve site-directed mutagenesis, the most common being PCR-based procedures (Current Protocols in Molecular Biology. Wiley Eds.).

Nucleic acids encoding class III TPP proteins can be derived from any natural or artificial source. The nucleic acid can be modified from its native form in its composition and / or genomic environment by deliberate human manipulation. Preferably, the nucleic acid encoding TPP class III is from a plant, more preferably from a dicot plant, more preferably from the Brassicaceae family, most preferably the nucleic acid is from Arabidopsis thaliana.

Any reference herein to a class III TPP protein is therefore taken to mean a class III TPP protein as defined above. Any nucleic acid encoding said class III TPP protein is suitable for use in carrying out the disclosure procedures.

The present disclosure also covers plants or parts thereof (including seeds) that can be obtained by the procedures according to the present disclosure. The plants or parts thereof comprise a nucleic acid transgene encoding a class III TPP protein as defined above.

The invention also provides TPP class III nucleic acid sequences and TPP class III protein sequences unknown to date. These sequences are also useful in performing the methods of the invention.

According to another embodiment of the present invention, there is therefore provided an isolated nucleic acid molecule comprising:

(i)

 a nucleic acid represented by SEQ ID NO: 3;

(ii)

 the complement of any one of SEQ ID NO indicated in (i);

(iii) a nucleic acid encoding a class III TPP protein that has, in increasing order of preference, at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identity of sequence with the amino acid sequence provided in SEQ ID NO: 4.

According to another embodiment of the present invention, an isolated polypeptide is also provided comprising:

(i)

 an amino acid sequence represented by SEQ ID No. 4;

(ii)

 an amino acid sequence that has, in increasing order of preference, at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the amino acid sequence provided in SEQ ID Nº: 4.

The invention also provides genetic constructs and vectors to facilitate the introduction and / or expression of nucleic acid sequences useful in the processes according to the invention in a plant. Gene constructs can be inserted into vectors, which may be commercially available, suitable for plant transformation and suitable for expression of the gene of interest in transformed cells. The invention also provides the use of a gene construct as defined herein in the methods of the invention.

More specifically, the present invention provides a constructor comprising:

(a) a nucleic acid encoding the class III TPP protein as defined above;

(b)

 one or more control sequences capable of directing the expression of the nucleic acid sequence of (a), wherein said, one, control sequence is a GOS2 promoter; and optionally

(C)

 a sequence of transcription termination.

The nucleic acid present in the construct according to the invention is a polynucleotide molecule encoding a class III TPP protein with a sequence of amino acids in increasing order of preference of at least 90%, 95%, 96%, 97%, 98% , 99% or 100% sequence identity with a sequence represented by SEQ ID NO: 4. Most preferably, the class III TPP polynucleotide molecule is the nucleotide sequence of SEQ ID NO: 3.

Plants are transformed with a vector comprising the sequence of interest (ie, a nucleic acid encoding a class III TPP polypeptide as defined herein. The expert is aware of the genetic elements that must be present in the vector for successfully transforming, selecting and propagating host cells containing the sequence of interest The sequence of interest is operatively linked to one or more control sequences (at least one promoter) The expressions "regulatory element", "sequence of control "and" promoter "are all used interchangeably herein and can be taken in a broad context so that they refer to nucleic acid sequences capable of effecting the expression of the sequences to which they are linked. The term" promoter " normally refers to a nucleic acid control sequence located upstream from the transcriptional start of a gene and that is involved in the recognition and binding of RNA polymerase and other proteins, thereby directing the transcription of an operably linked nucleic acid. Covered by the expressions mentioned above are regulatory transcriptional sequences derived from a classic eukaryotic genomic gene (including the TATA box that is required for the initiation of appropriate transcription, with or without CCAAT box sequence) and additional regulatory elements (i.e., activator, enhancer and upstream silencer sequences) that alter gene expression in response to developmental and / or external stimuli, or in a specific tissue mode. Also included within the term is a transciptional regulatory sequence of a classic prokaryotic gene, in which case it can include a -35 box sequence and / or -10 box transcriptional regulatory sequences. The term "regulatory element" also encompasses a synthetic fusion molecule or a derivative that confers, activates or enhances the expression of a nucleic acid molecule in a cell, a tissue or an organ. The term "operably linked", as used herein, refers to a functional link between the promoter sequence and the gene of interest, so that the promoter sequence is capable of initiating transcription of the gene of interest.

Advantageously, any type of promoter can be used to direct the expression of the nucleic acid sequence. The term "promoter" normally refers to a nucleic acid control sequence located upstream from the transcriptional start of a gene and that is involved. in the recognition and binding of RNA polymerase and other proteins, thereby directing the transcription of an operably linked nucleic acid. A "plant" promoter comprises regulatory elements that mediate the expression of a segment of coding sequence in plant cells. Consequently, a plant promoter does not need to be of plant origin, but can originate from viruses or microorganisms, for example from viruses that attack plant cells. The "plant promoter" can also originate from a plant cell, for example from the plant that is transformed with the nucleic acid sequence to be expressed. This also applies to other "vegetable" regulatory signals, such as "vegetable" terminators. The upstream promoters of nucleotide sequences useful in the methods of the present invention can be modified by one or more nucleotide substitutions, insertions and / or deletions without interfering with the functionality or activity of any of the promoters, the reading frame. Open (ORF) or the 3 'regulatory region such as terminators or other 3' regulatory regions that are located outside the ORF. It is also possible that the activity of the promoters is increased by modification of their sequence, or that they are completely replaced by more active promoters, including promoters of heterologous organisms. For expression in plants, the nucleic acid molecule is operably linked to a suitable promoter.

The promoter can be a constitutive promoter, which refers to a promoter that is transcriptionally active during most, but not necessarily all, stages of its growth and development and in the most environmental conditions, in at least one cell, a tissue or organ Alternatively, the promoter can be an inducible promoter, that is, it has an induced or increased transcription initiation in response to a chemical stimulus (for a review, see, Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48: 89-108), environmental or physical. Another example of an inducible promoter is a stress inducible promoter, that is, a promoter that is activated when a plant is exposed to various stress conditions, or a pathogen-induced promoter.

Additionally or alternatively, the promoter may be an organ specific or tissue specific promoter, that is, one that is capable of initiating transcription preferentially in certain organs or tissues, such as leaves, roots, seed tissues, etc .; or the promoter can be a ubiquitous promoter, which is active in substantially all of the tissues or cells of an organism, or the promoter can be regulated in development, therefore being active during certain stages of development or in parts of the plant that undergo development changes Promoters capable of initiating transcription only in certain organs or tissues are referred to herein as "organ specific" or "tissue specific" respectively; similarly, the

Promoters capable of initiating transcription only in certain cells are referred to herein as "cell specific."

Preferably, the class III TPP nucleic acid or a variant thereof is operably linked to a constitutive promoter. A preferred constitutive promoter is one that is also expressed substantially ubiquitously. More preferably, the promoter is derived from a plant, more preferably from a monocot plant. It is most preferred the use of a GOS2 promoter, preferably a rice GOS2 promoter, most preferably a promoter substantially represented by SEQ ID NO: 98. It should be clarified that the applicability of the present invention is not restricted to the TPP nucleic acid of class III represented by SEQ ID NO: 1, nor is the applicability of the invention restricted to the expression of a class III TPP nucleic acid when

10 is directed by means of a GOS2 promoter. According to another preferred feature of the invention, the constitutive promoter is a high mobility group protein (HMGP) promoter, preferably a rice HMGP promoter, more preferably substantially similar to SEQ ID NO: 131, most preferably identical to SEQ ID NO: 131. Examples of other constitutive promoters that can also be used to direct the expression of a class III TPP nucleic acid are shown in Table 2 below.

15 Table 2: Examples of constitutive promoters

Gene source

Reference

Actina

McElroy et al., Plant Cell, 2: 163-171, 1990

CAMV 35S

Odell et al, Nature, 313: 810-812, 1985

CaMV 19S

Nilsson et al., Physiol. Plant 100: 456-462, 1997

GOS2

de Pater et al., Plant J, Nov; 2 (6): 837-44, 1992, WO 2004/065596

Ubiquitin

Christensen et al., Plant Mol. Biol. 18: 675-689, 1992

Rice cyclophilin

Buchholz et al., Plant Mol Biol. 25 (5): 837-43, 1994

H3 corn histone

Lepetit et al., Mol. Gen. Genet. 231: 276-285, 1992

Alfalfa H3 histone

Wu et al. Plant Mol. Biol. 11: 641-649, 1988

Actina 2

An et al., Plant J. 10 (1); 107-121, 1996

34S FMV

Sanger et al., Plant. Mol. Biol., 14, 1990: 433-443

Small subunit Rubisco

US 4,962,028

SCO

Leisner (1988) Proc Natl Acad Sci USA 85 (5): 2553

SAD1

Jain et al., Crop Science, 39 (6), 1999: 1696

SAD2

Jain et al., Crop Science, 39 (6), 1999: 1696

us

Shaw et al. (1984) Nucleic Acids Res. 12 (20): 7831-7846

V-ATPase

WO 01/14572

Superpromotor

WO 95/14098

G-box proteins

WO 94/12015

For the identification of functionally equivalent promoters, the promoter strength and / or the expression pattern of an experimental promoter can be analyzed, for example, by operative binding of the promoter to a communicating gene and evaluating the level and pattern of expression of the gene. communicator in various tissues of the plant. Suitable 20 well-known communicating genes include, for example, beta-glucuronidase or beta-galactosidase. Promoter activity is evaluated by measuring the enzymatic activity of beta-glucuronidase or beta-galactosidase. The promoter force and / or the expression pattern can be compared to those of a reference promoter (such as that used in the methods of the present invention). Alternatively, the promoter force can be evaluated by quantifying mRNA levels or by comparing mRNA levels of the nucleic acid used in the methods of the present invention with mRNA levels of domestic genes such as 18S mRNA, using methods known in the art such as immunoblotting. (Northern) with densitometric analysis of autoradiograms, real-time PCR or quantitative RT-PCR (Heid et al., 1996 Genome Methods 6: 986-994). Generally the

"weak promoter" refers to a promoter that directs the expression of a coding sequence at a low level, levels of about 1 / 10,000 transcribed to about 1 / 100,000 transcribed, at about 1 / 500,000 transcribed per cell. Conversely, a "strong promoter" controls the expression of a coding sequence at a high level, or at about 1/10 transcribed at about 1/100 transcribed at about 1/1000 transcribed per cell.

Optionally, one or more terminator sequences may be used in the construct introduced into a plant. The term "terminator" encompasses a control sequence that is a DNA sequence at the end of a transcriptional unit that signals the processing and 3 ′ polyadenylation of a primary transcript and the termination of the transcription. The terminator can be derived from the natural gene, from a variety of other plant genes or from DNA-

T. The terminator to be added may be derived from, for example, the nopaline synthase or octopine synthase genes, or as an alternative to another plant gene, or less preferably from any other eukaryotic gene. Additional regulatory elements may include transcriptional enhancers, as well as translational enhancers. Those skilled in the art are aware of the terminator and enhancer sequences that may be suitable for use in carrying out the invention. Such sequences would be known or can be easily obtained by one skilled in the art.

An intron sequence can also be added to the 5 ’untranslated region (UTR) or in the coding sequence to increase the amount of the mature message that accumulates in the cytosol. It has been shown that the inclusion of an aytable intron in the transcription unit in both plant and animal expression constructs increases gene expression in both mRNA and protein levels up to 1000 times (Buchman and Berg, Mol. Cell Biol. 8: 4395-4405 (1988); Callis et al., Genes Dev. 1: 1183-1200 (1987)). The intron potentiation of gene expression is usually the highest when it is located near the 5 ’end of the transcription unit. Using the corn introns Adh1-S 1, 2 and 6, the Bronze-1 intron is known in the art. For general information, see The Maize Handbook, chapter 116, Freeling and Walbot, Eds., Springer, N.Y. (1994).

Other control sequences (apart from promoter, enhancer, silencer, intron sequences, 3’UTR and / or 5’UTR regions) may be proteins and / or RNA stabilizing elements. Such sequences would be known or can be easily obtained by one skilled in the art.

The genetic constructs of the invention may additionally include an origin of replication sequence that is necessary for maintenance and / or replication in a specific cell type. An example is when it is necessary to maintain a genetic construct in a bacterial cell as an episomal genetic element (for example, plasmid or cosmid molecule). Preferred origins of replication include, but are not limited to, f1-ori and colE1.

For the detection of the successful transfer of nucleic acid sequences as used in the methods of the invention and / or the selection of transgenic plants comprising these nucleic acids, marker genes (or communicating genes) are advantageously used. Therefore, the genetic construct may additionally comprise a selection marker gene. As used herein, the term "selectable marker", selectable marker gene "or" communicator gene "includes any gene that confers a phenotype to a cell in which it is expressed to facilitate the identification and / or selection of cells which are transfected or transformed with a nucleic acid construct of the invention. These marker genes enable the identification of a successful transfer of nucleic acid molecules through a series of different principles. Suitable markers can be selected from markers that confer resistance to antibiotics or herbicides, that introduce a new metabolic trait or that allow visual selection. Examples of selectable marker genes include genes that confer resistance to antibiotics (such as nptII that phosphorylates neomycin and kanamycin, or hpt, that phosphorylates hygromycin, or genes that confer resistance to, for example, bleomycin, streptomycin, tetracycline, chloramphenicol, ampicillin, gentamicin, geneticin (G418), spectinomycin or blasticidine), to herbicides (e.g. bar that provides resistance to Basta®; aroA or gox that provide resistance to glyphosate, or genes that confer resistance to, for example, imidazolinone, phosphinothricin or sulfonylurea), or genes that provide a metabolic trait (such as manA that allows plants to use mannose as the sole source of carbon or xylose isomerase for the use of xylose, or antinutritive markers such as resistance to 2-deoxyglucose). The expression of visual marker genes that results in the formation of color (for example -glucuronidase, GUS or -galactosidase with their colored substrates, for example X-Gal), luminescence (such as the luciferin / luciferase system) or fluorescence (green fluorescent protein, GFP, and derivatives thereof). This list only represents a small number of possible markers. The expert is familiar with these markers. Different markers are preferred, depending on the organism and the selection procedure.

It is known that after the stable or transient integration of nucleic acids into plant cells, only a minority of the cells capture the foreign DNA and, if desired, integrate it into their genome, depending on the expression vector used and the technique of used transfection. To identify and select these members, a gene that encodes a selection marker (such as those described above) is usually introduced into host cells along with the gene of interest. These markers can be used, for example, in mutants in which these genes are not functional, for example, deletion by conventional methods. In addition, nucleic acid molecules encoding a selection marker can be introduced into a host cell in the same vector.

which comprises the sequence encoding the polypeptides of the invention or is used in the methods of the invention, or if not in a separate vector. Cells that have been stably transfected with the introduced nucleic acid can be identified, for example, by selection (for example, cells that have integrated the selectable marker survive, while the other cells die.

Since marker genes, particularly genes that confer resistance to antibiotics and herbicides, are no longer needed or not desired in the transgenic host cell once nucleic acids have been successfully introduced, the method according to the invention for the introduction of acids Nucleic advantageously uses techniques that allow the elimination or excision of these marker genes. One such procedure is known as cotransformation. The cotransformation method uses two vectors simultaneously for transformation, a vector that carries the nucleic acid according to the invention and a second that carries the marker gene or the marker genes. A large proportion of transformants receives or, in the case of plants, comprises (up to 40% or more of the transformants) both vectors. In case of transformation with Agrobacteria, the transformants usually receive only a part of the vector, that is, the sequence flanked by the T-DNA, which usually represents the expression cassette. Marker genes can subsequently be removed from the transformed plant by performing crosses. In another procedure, the marker genes integrated into a transposon are used for transformation together with the desired nucleic acid (known as Ac / Ds technology). The transformants can cross with a source of transposase or the transformants are transformed with a nucleic acid construct that confers the expression of a transposase, transiently or stably. In some cases (approximately 10%), the transposon jumps from the genome of the host cell once the transformation has been successful and is lost. In another case series, the transposon jumps to a different location. In these cases, the marker gene must be removed by crossing. In microbiology, the techniques were developed to enable, or facilitate, the detection of such events. An additional advantageous method is based on what is known as recombination systems, which have the advantage that elimination can be dispersed by cross-linking. The best known system of this type is what is known as the Cre / Iox system. Cre1 is a recombinase that eliminates sequences located between IoxP sequences. If the marker gene is integrated between the IoxP sequences, it is removed once the transformation has taken place successfully, by expression of the recombinase. Other recombination systems are the HIN / HIX, FLP / FRT and REP / STB systems (Tribble et al., J. Biol. Chem., 275, 2000: 22255-22267; Velmurugan et al., J. Cell Biol., 149, 2000: 553566). A specific integration of the site into the plant genome of the nucleic acid sequences according to the invention is possible. Naturally, these procedures can also be applied to microorganisms such as yeasts, fungi or bacteria.

The invention also provides a method of producing transgenic plants that have traits related to enhanced seed yield with respect to control plants, comprising the introduction and expression in a plant of any nucleic acid encoding a class TPP protein. III as defined in the claims. Said increased seed yield is any one or more of the following:

(i)

 Increased number of seeds per plant;

(i)

 Increased number of full seeds per plant;

(iii) Increased weight of seeds per plant.

For the purposes of the invention, "transgenic", "transgenic" or "recombinant" means with respect to, for example, a nucleic acid sequence, an expression cassette, a gene construct or a vector comprising the nucleic acid sequence. or an organism transformed with the sequences of nucleic acids, expression cassettes or vectors according to the invention, all those constructions made by recombinant methods in which

(to)

 nucleic acid sequences encoding proteins useful in the methods of the invention, or

(b)

the genetic control sequence or sequences that are operatively linked to the nucleic acid sequence according to the invention, for example a promoter, or

(C)

 a) and b)

they are not located in their natural genetic environment or have been modified by recombinant procedures, it being possible that the modification takes the form of, for example, a substitution, an addition, a deletion, an inversion or an insertion of one or more nucleotide residues . It is understood that the natural genetic environment means the natural genomic or chromosomal locus of the original plant or the presence of a genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably conserved, at least in part. The environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, most preferably at least 5000 bp. An expression cassette of natural origin (for example the combination of natural origin of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a polypeptide useful in the methods of the present invention, as defined above. ) becomes a cassette of

transgenic expression when this expression cassette is modified by unnatural, synthetic ("artificial") procedures such as, for example, mutagenic treatment. Suitable procedures are described, for example, in US 5,565,350 or WO 00/15815.

More specifically, the present invention provides a method of producing transgenic plants that have increased yield, a process comprising:

(i)

 introducing and expressing in a plant, plant part or plant cell a class III TPP nucleic acid as defined in the claims; Y

(ii)

 Cultivate the plant cell under conditions that promote plant growth and development.

Said seed yield is any one or more of the following:

(i)

 Increased number of seeds per plant;

(i)

 Increased number of full seeds per plant;

(iii) Increased (total) weight of seeds per plant;

The nucleic acid can be introduced directly into a plant cell or into the plant itself (including introduction into a tissue, organ or any other part of a plant). According to a preferred feature of the present invention, the nucleic acid is preferably introduced into a plant by transformation.

The term "introduction" or "transformation," as referred to herein, encompasses the transfer of an exogenous polynucleotide to a host cell, regardless of the method used for the transfer. Plant tissue capable of subsequent clonic propagation, either by organogenesis or embryogenesis, can be transformed with a genetic construct of the present invention and a whole plant can be regenerated therefrom. The particular tissue chosen will vary depending on the clonic propagation systems available for, and better adapted to, the particular species to be transformed. Exemplary tissue targets include discs of leaves, pollen, embryos, cotyledons, hypocotyls, megegametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds and root meristems) and induce meristematic tissue (e.g., cotyledon meristem and hypocotyl meristem) The polynucleotide can be introduced transiently or stably into the host cell and can remain non-integrated, for example as a plasmid. As an alternative it can be integrated into the host genome. The resulting transformed plant cell can then be used to regenerate a transformed plant in a manner known to those skilled in the art.

The transfer of genes external to the genome of a plant is called transformation. The transformation of plant species is currently a fairly routine technique. Advantageously, any of several transformation methods can be used to introduce the gene of interest into a suitable ancestor cell. The procedures described for the transformation and regeneration of plants from plant tissues or plant cells can be used for a transient or stable transformation. Transformation procedures include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of DNA directly to the plant, particle gun bombardment, transformation using virus or pollen and microprojection. The procedures can be selected from the calcium / polyethylene glycol process for protoplasts (Krens, F.A. et al. (1982) Nature 296, 72-74; Negrutiu I et al. 1987 Plant Mol. Biol. 8: 363-373); electroporation of protoplasts (Shillito R.D. et al. (1985) Bio / Technol 3, 1099-1102); microinjection in plant material (Crossway A et al., (1986) Mol. Gen Genet 202: 179-185); bombardment of particles coated with DNA or RNA (Klein TM et al. (1987) Nature 327: 70) infection with viruses (non-integrative) and the like. Transgenic plants, including transgenic crop plants, are preferably produced by Agrobacterium-mediated transformation. An advantageous transformation procedure is the in-plant transformation. For this purpose it is possible, for example, to allow the agrobacteria to act on plant seeds or to inoculate the meristem of the agrobacteria plant. It has been particularly conveniently tested according to the invention to allow a suspension of transformed agrobacteria to act on the intact plant or at least on the flower primordia. Subsequently, the plant is grown until the seeds of the treated plant are obtained (Clough and Bent, Plant J. (1998) 16, 735-743). Agrobacterial-mediated rice transformation procedures include well-known procedures for rice transformation, such as those described in any of the following: European Patent Application EP 1198985 A1, Aldemite and Hodges (Plant

199: 612-617, 1996); Chan et al. (Plant Mol Biol 22 (3): 491-506, 1993), Hiei et al. (Plant J 6 (2): 271-282, 1994). In the case of corn transformation, the preferred procedure is as described well by Ishida et al. (Nat. Biotechnol 14 (6): 745-50, 1996) or by Frame et al. (Plant Physiol 129 (1): 13-22, 2002). Such procedures are further described by way of example by B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds. S.D. Kung and R. Wu, Academic Press (1993) 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec Biol. 42 (1991) 205-225). The nucleic acids of the construct to be expressed are preferably cloned into a vector that is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984) 8711). The agrobacterium transformed by said vector can then be used in a known manner for the transformation of plants, such as plants used as

model, such as Arabidopsis (Arabidopsis thaliana is not considered within the scope of the present invention as a crop plant), or crop plants such as, for example, tobacco plants, for example by dipping beaten leaves or cut leaves in an agrobacterial solution and then cultivating them in appropriate media. The transformation of plants by means of Agrobacterium tumefaciens is described, for example, by Höfgen and Willmitzer in Nucl. Acids Res. (1988) 16, 9877 or is known for, among others, F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, eds. S.D. Kung and R. Wu, Academic Press, 1993, pages 15-38.

In addition to the transformation of somatic cells, which must then be regenerated in intact plants, it is also possible to transform the cells of plant meristems and in particular those cells that develop into gametes. In this case, the transformed gametes follow the natural development of the plant, giving rise to transgenic plants. Thus, for example, Arabidopsis seeds are treated with agrobacteria and seeds are obtained from developing plants from which a certain proportion is transformed and, therefore, is transgenic [Feldman, KA and Marks MD (1987). Mol Gen Genet 208: 274-289; Feldmann K (1992). In: C Koncz, N-H Chua and J Shell, eds, Methods in Arabidopsis Research. Word Scientific, Singapore, pages 274-289]. The alternative procedures are based on the repeated elimination of the inflorescences and incubation of the cleavage sites in the center of the rosette with transformed agrobacteria, whereby the transformed seeds can also be obtained at a later time point (Chang (1994). Plant J. 5: 551-558; Katavic (1994). Mol Gen Genet, 245: 363-370). However, an especially effective procedure is the vacuum infiltration procedure with its modifications such as the “floral immersion” procedure. In the case of Arabidopsis vacuum infiltration, intact plants are treated under reduced pressure with an agrobacterial suspension [Bechthold , N (1993) CR Acad Sci Paris Life Sci, 316: 1194-1199], while in the case of the "floral immersion" procedure the developing floral tissue is briefly incubated with a surfactant treated agrobacterial suspension [Clough , SJ and Bent, AF (1998) The Plant J. 16, 735-743] A certain proportion of transgenic seeds is collected in both cases and these seeds can be distinguished from non-transgenic seeds by cultivation under the selective conditions described above. In addition, the stable transformation of plastids is advantageous because plastids are inherited by the mother in most of the crops, reducing or eliminating the risk of transgenic flow through pollen. Chloroplast genome transformation is generally accomplished by a procedure that has been schematically represented by Klaus et al., 2004 [Nature Biotechnology 22 (2), 225-229]. Briefly, the sequences to be transformed are cloned together with a marker selection gene between homologs of sequences flanking the chloroplast genome. These homologous flanking sequences direct the specific integration of the site into the plastoma. The plastidic transformation has been described for many different plant species and an overview is provided in Bock (2001) Transgenic plastids in basic research and plant biotechnology. J Mol Biol. 2001, September, 21; 312 (3): 425-38 or Maliga, P (2003) Progress towards commercialization of plastid transformation technology. Trends Biotechnol. 21, 20-28. Recently, other biotechnological advances have been reported in the form of plastid transformants lacking markers that can be produced by a transient co-integrated marker gene (Klaus et al., 2004, Nature Biotechnology 22 (2), 225-229). Genetically modified plant cells can be regenerated by all the procedures with which the expert is familiar. Appropriate procedures can be found in the publications mentioned above by S.D. Kung and R. Wu, Potrykus or Höfgen and Willmitzer.

Generally, after transformation, plant cells or cell clusters are selected by the presence of one more markers that are encoded by genes that can be expressed in co-transferred plants with the gene of interest, following which the transformed material is regenerated into a complete plant.

To select transformed plants, the plant material obtained in the transformation is generally subjected to selective conditions, so that transformed plants can be distinguished from unprocessed plants. For example, the seeds obtained in the manner described above can be planted and, after an initial growth period, are subjected to a suitable selection by spraying. Another possibility is the cultivation of seeds, if appropriate after sterilization, on agar plates using a suitable selection agent so that only the transformed seeds can be grown to give plants. Alternatively, the transformed plants are screened according to the presence of a selection marker such as those described above.

Following the transfer and regeneration of DNA, putatively transformed plants can also be evaluated, for example using Southern analysis, to determine the presence of the gene of interest, the number of copies and / or genomic organization. Alternatively or additionally, the expression levels of the newly introduced DNA can be monitored using Northern and / or Western analysis, both techniques being well known to those skilled in the art.

The transformed plants generated can be propagated by a variety of means, such as by clonic propagation or classical reproduction techniques. For example, a first generation (or T1) transformed plant can reproduce asexually and select homozygous second generation (or T2) transformants, and T2 plants can subsequently be propagated by classical culture techniques.

The transformed organisms generated can take a variety of forms. For example, they can be transformed and unprocessed cell chimeras; clonic transformants (for example all cells

transformed to contain the expression cassette); grafts of transformed and unprocessed tissues (for example, in plants, a transformed rhizome grafted to an untransformed stem).

The present invention clearly extends to any plant cell or plant produced by any of the methods described herein and to all parts of plants and propagules thereof. The present invention is further expanded to encompass the progeny of a transformed, transfected cell, tissue, organ or whole plant that has been produced by any of the aforementioned methods, the only requirement that the progeny shows the same or the same characteristics. genotypic and / or phenotypic than those produced by the parent in the procedures according to the invention.

The disclosure also includes host cells containing an isolated nucleic acid encoding a class III TPP protein as defined hereinbefore. Preferred host cells according to the invention are plant cells.

The host plants for the nucleic acids or the vector used in the process according to the invention, the expression cassette or construct or vector are, in principle, advantageously all the plants that are capable of synthesizing the polypeptides used in the process of the invention.

A transgenic plant for the purposes of the invention is therefore understood to mean, as before, that the nucleic acids used in the process of the invention are not in their natural locus in the genome of said plant, it being possible that the nucleic acids are expressed homologously or heterologously. However, as mentioned, transgenic also means that while the nucleic acids according to the invention or used in the process of the invention are in their natural position in the genome of a plant, the sequence has been modified with respect to the natural sequence. and / or that the regulatory sequences of the natural sequences have been modified. It is preferably understood that transgenic means the expression of nucleic acids according to the invention in an unnatural locus of the genome, that is to say a homologous or, preferably, heterologous expression of nucleic acids. Preferred transgenic plants are mentioned herein.

The invention also extends to collectible parts of a plant such as, but not limited to, seeds, leaves, fruits, flowers, stems, rhizomes, tubers and bulbs. The collectible parts comprise a construct as defined in claim 7. The disclosure further relates to products derived, preferably directly derived, from a collectible part of said plant, such as dry granules or powders, oil, fat and fatty acids, starch or protein

The modulated expression is an augmented expression. Methods for increasing the expression of nucleic acids or genes, or gene products, are well documented in the art and include, for example, overexpression directed by appropriate promoters, the use of transcription enhancers or translation enhancers. Isolated nucleic acids that serve as promoter or enhancer elements can be introduced into a suitable position (usually upstream) in a non-heterologous form of a polynucleotide to regulate upward expression. For example, endogenous promoters can be modified in vivo by mutation, deletion and / or substitution (see Kmiec, U.S. Patent No. 5,565,350; Zarling et al., PCT / US93 / 03868), or isolated promoters can be introduced into a plant cell in proper orientation and distance from a gene of the present invention to control gene expression.

If expression of a polypeptide is desired, it is generally desirable to include a polyadenylation region at the 3 'end of a polynucleotide coding region. The polyadenylation region may be derived from the natural gene, from a variety of other plant or DNA genes. T. The 3 ′ end sequence to be added can be derived from, for example, the nopaline synthase or octopine synthase genes, or as an alternative to another plant gene, or less preferably from any other eukaryotic gene.

An intron sequence can also be used as described above.

Other control sequences (apart from promoter, enhancer, silencer, intron sequences, 3’UTR and / or 5’UTR regions, micro-RNA target sites) may be proteins and / or RNA stabilizing elements.

As mentioned above, a preferred method for increasing the expression of a nucleic acid encoding a class III TPP protein is to introduce and express into a plant a nucleic acid encoding a class III TPP protein; however, the effects of performing the procedure, that is, the enhancement of performance-related traits, can also be achieved using other well known techniques. A description of some of these techniques will be given below.

One such technique is the labeling of T-DNA activation (Hayashi et al. Science (1992) 1350-1353), which involves the insertion of T-DNA, which usually contains a promoter (it can also be a translation enhancer or an intron), in the genomic region of the gene of interest or 10 kb upstream or downstream of the coding region of a gene in a configuration so that the promoter directs the expression of the target gene. Normally, the regulation of the expression of the target gene by its natural promoter is interrupted and the gene falls under the control of the recently introduced promoter. The promoter is normally embedded in a T-DNA. This T-DNA is inserted

randomly in the genome of the plant, for example through infection with Agrobacterium and produces the modified expression of genes near the inserted T-DNA. The resulting transgenic plants show dominant phenotypes due to the modified expression of genes close to the introduced promoter.

The effects of the invention can also be reproduced using the technique of TILLING (Targeted Induced Local Lesions In Genomes). This is a mutagenesis technology useful for generating and / or identifying a nucleic acid encoding a class III TPP protein with expression and / or modified activity. TILLING also allows the selection of plants that carry these mutant variants. These mutant variants can show a modified expression, either in strength, either in location or in time (if mutations affect the promoter, for example). These mutant variants may show higher class III TPP protein activity than that shown by the gene in its natural form. TILLING combines high density mutagenesis with high performance screening procedures. The steps normally followed in TILLING with: (a) EMS mutagenesis (Redei GP and Koncz C (1992) in Methods in Arabidopsis Research, Koncz C, Chua NH, Schell J, eds. Singapore, World Scientific Publishing Co, pages 16-82; Feldmann et al. (1994) In Meyerowitz EM, Somerville CR, eds, Arabidopsis, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pages 137-172; Lightner J and Caspar T (1998) in J Martinez-Zapater, J Salinas, eds, Methods on Molecular Biology, Vol. 82. Humana Press, Totowa, NJ, pages 91-104); (b) DNA preparation and grouping of individuals; (c) PCR amplification of a region of interest; (d) denaturation and hybridization to allow heteroduplex formation; (e) DHPLC, in which the presence of a heteroduplex in a group is detected as an extra peak in the chromatogram; (f) identification of the individual mutant and (g) sequencing of the mutant PCR product. TILLING methods are well known in the art (McCallum et al. (2000) Nat Biotechnol 18: 455-457; reviewed by Stemple (2004) Nat Rev Genet 5 (2): 145-50).

The effects of the invention can also be reproduced using homologous recombination, which allows the introduction into a genome of a selected nucleic acid in a defined selected position. Homologous recombination is a standard technology routinely used in biological sciences for lower organisms such as yeasts or Physcomitrella mold. Homologous recombination procedures in plants have been described not only for model plants (Offringa et al. (1990) EMBO J 9 (10): 3077-84) but also for crop plants, for example rice (Terada y col. (2002) Nat Biotech 20 (10): 1030-4; lida and Terada (2004) Curr Opin Biotech 15 (2): 132-8).

Reference in this document to enhanced performance-related traits is taken to mean an increase in the biomass (weight) of one or more parts of a plant, which may include aerial (collectible) and / or underground parts ( collectibles).

In particular, said collectible parts are seeds and the performance of the methods of the invention results in plants having an increased seed yield with respect to the seed yield of suitable control plants.

The term "yield" generally means a measurable production of economic value, necessarily related to a specific crop, a crop area and a period of time. Parts of individual plants contribute directly to yield based on their number, size and / or weight, while the actual yield is the yield per area for one crop and year, which is determined by dividing the total production (including both collected production as assessed) by crop area.

The terms and expressions "increases", "improves" or "improves" are used interchangeably and shall mean within the meaning of the request at least 5%, 6%, 7%, 8%, 9% or 10%, preferably at minus 15% or 20%, more preferably 25%, 30%, 35% or 40% more yield and / or growth compared to the wild type plant as defined herein.

The increased seed yield may be manifested as one or more of the following: a) an increase in seed biomass (total seed weight) that may be based on individual seed and / or by plant and / or surface of cultivation; b) increased number of flowers per plant; c) increased number of seeds (full); d) increased seed filling rate (expressed as the ratio between the number of full seeds divided by the total number of seeds); e) increased harvest index, which is expressed as the ratio of the yield of collectible parts, such as seeds, divided by total biomass, and f) weight of one thousand grains (PMG) increased, which is extrapolated from the number of full seeds counted and its total weight. An increased PMG may be the result of increased seed size and / or seed weight, and may also be the result of an increase in the size of the embryo and / or endosperm.

An increase in seed yield can also manifest itself as an increase in seed size and / or seed volume. In addition, an increase in seed yield can also manifest itself as an increase in the surface area of the seed and / or the length of the seed and / or the width of the seed and / or the perimeter of the seed.

Taking corn as an example, an increase in yield may manifest itself as one or more of the following: increase in the number of plants established per crop area, increase in the number of

ears per plant, increase in the number of rows, number of grains per row, weight of the grain, weight of one thousand grains, length / diameter of the spike, increase in the rate of seed filling (which is the number of full seeds divided by the total number of seeds and multiplied by 100), among others. Taking rice as an example, an increase in yield can manifest itself in one or more of the following: number of plants per crop area, number of ears per plant, number of spikelets per ear, number of flowers (floret) by ear (expressed as the ratio of the number of full seeds to the number of primary ears), increase in the rate of seed filling (which is the number of full seeds divided by the total number of seeds and multiplied by 100), increase in weight of a thousand grains, among others.

Since the transgenic plants according to the present invention have an increased yield, it is likely that these plants show an increased growth rate (for at least a part of their life cycle), with respect to the growth rate of control plants in a corresponding stage of its life cycle. The increased growth rate may be specific to one or more parts of a plant (including seeds), or it may be substantially throughout the plant. Plants that have an increased growth rate may have a shorter life cycle. The life cycle of a plant can be taken in a way that means the time needed to grow from a dry mature seed to the stage in which the plant has produced dry mature seeds, similar to the starting material. This life cycle may be influenced by factors such as early vigor, growth rate, greenery index, flowering time and seed maturation rate. The increase in the growth rate can take place in one or more stages of the life cycle of a plant or during substantially the entire life cycle of the plant. An increased growth rate during the early stages of a plant's life cycle may reflect enhanced vigor. Increasing the growth rate can alter the harvest cycle of a plant, allowing plants to be sown later and / or harvested sooner than would otherwise be possible (a similar effect can be obtained with a time of bloom earlier). If the growth rate is sufficiently increased, it can allow additional sowing of seeds of the same plant species (for example, planting and harvesting of rice plants followed by sowing and harvesting of additional rice plants all within a period of conventional growth). Similarly, if the growth rate is sufficiently increased, it may allow additional planting of seeds of different plant species (for example, planting and harvesting of corn plants followed by, for example, planting and optional harvesting of soy, potato or any other suitable plant). Additional collection times for the same rhizome in the case of some crop plants is also possible. Altering a crop cycle of a plant can cause an increase in annual biomass production per crop area (due to an increase in the number of periods (that is, in a year) that any particular plant can be grown and harvested) . An increase in the growth rate may also allow the cultivation of transgenic plants in a wider geographical area than their wild-type counterparts, since territorial limitations to cultivate a crop are often determined by adverse environmental conditions well at the time of planting (early season) or at the time of collection (late season). Such adverse conditions can be avoided if the life cycle is shortened. The growth rate can be determined by deriving various parameters from growth curves, such parameters may be: T-Medium (the time required by plants to reach 50% of their maximum size) and T-90 (time required by the plants to reach 90% of their maximum size), among others.

The performance of the methods of the invention provides plants that have an increased growth rate with respect to control plants. Therefore, according to the present invention, there is provided a method for increasing the growth rate of plants, a process comprising modulating the expression, preferably increasing the expression, in a plant of a nucleic acid encoding a class III TPP protein such as defined in this document.

An increase in yield and / or growth rate occurs if the plant is not under stress conditions or if the plant is exposed to various types of stress compared to control plants. Plants usually respond to exposure to stress with slower growth. In conditions of acute stress, the plant can even stop its growth completely. This document defines mild stress, on the other hand, as any type of stress to which the plant is exposed that does not result in the plant ceasing to grow completely without the ability to resume growth. Slight stress in the sense of the invention causes a reduction in the growth of stressed plants of less than 40%, 35% or 30%, preferably less than 25%, 20% or 15%, more preferably less than 14 %, 13%, 12%, 11% or 10% or less compared to the control plant in non-stress conditions. Due to advances in agricultural practices (irrigation, fertilization, pesticide treatments), acute types of stress are not often found in cultivated crop plants. As a consequence, compromised growth induced by mild stress is often an unwanted feature for agriculture. Mild stress is the biotic and / or abiotic (environmental) stress to which the plant is exposed. Abiotic stress may be due to drought or excess water, anaerobic stress, saline stress, chemical toxicity, oxidative stress and hot, cold or freezing temperatures. Abiotic stress can be an osmotic stress caused by water stress (particularly due to drought), saline stress, oxidative stress

or an ionic stress. Biotic stress is usually a stress caused by pathogenic organisms, such as bacteria, viruses, fungi and insects. Another abiotic stress may be a consequence of a nutrient deficiency, such as a deficit of nitrogen, phosphorus and potassium.

In particular, the methods of the present invention can be performed under conditions of non-stress or in mild dry conditions giving plants that have an increased yield with respect to the control plants. As reported by Wang et al. (Planta (2003) 218: 1-14), abiotic stress produces a series of morphological, physiological, biochemical and molecular changes that adversely affect plant growth and productivity. It is known that drought, salinity, extreme temperatures and oxidative stress are interconnected and can induce growth damage and cell damage through similar mechanisms. Rabanni et al. (Plant Physiol (2003) 133: 1755-1767) describes a particularly degree of "interference" between drought stress and high salinity stress. For example, drought and / or salinization manifest primarily as osmotic stress, giving as a result, the interruption of homeostasis and the distribution of ions in the cell.Oxidative stress, which often accompanies stress due to high or low temperatures, salinity or drought, can cause the denaturation of functional and structural proteins. Types of environmental stress often activate cell signaling pathways and similar cellular responses, such as the production of stress proteins, up-regulation of antioxidants, the accumulation of compatible solutes and growth arrest. The term "non-stress conditions" ", as used herein, are the environmental conditions that allow for growth Optimum plant level The person skilled in the art is aware of the normal soil conditions and the climatic conditions of a given location.

The performance of the methods of the invention provides plants grown in non-stress conditions or in mild dry conditions with increased yield with respect to suitable control plants under comparable conditions. Therefore, according to the present invention, there is provided a method for enhancing features related to seed yield as defined in claim 1 in plants grown in non-stress conditions or in mild drought conditions, procedures comprising increasing the plant expression of a nucleic acid encoding a class III TPP polypeptide as defined in claim 1.

The trait related to enhanced performance is manifested as an increase in one or more of the following: total number of seeds per plant, number of full seeds per plant and weight of seeds per plant. Preferably, these increases are found in plants grown under non-stress conditions.

The processes of the invention can be applied advantageously to any plant.

The term "plant", as used herein, encompasses whole plants, ancestors and progeny of plants and parts of plants, including seeds, buds, stems, leaves, roots (including tubers), flowers and tissues and organs. , in which each of those mentioned above comprise the gene / nucleic acid of interest. The term "plant" also encompasses plant cells, suspension cultures, corpus callosum, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again in which those mentioned above comprise the gene / nucleic acid of interest.

Plants that are particularly useful in the processes of the invention include all plants belonging to the Viridiplantae superfamily, in particular monocotyledonous and dicotyledonous plants that include forage and forage legumes, ornamental plants, food crops, trees or shrubs selected from the list comprises Acer spp., Actinidia spp., Abelmoschus spp., Agropyron spp., Allium spp., Amaranthus spp., Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (for example, Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (for example, Brassica napus, Brassica rapa ssp. [canola, rapeseed, turnip]), Cadaba farinosa, Camellia sinensis, Canna indica, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (for example, Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eriogenrylo japonica unit , Fagopyrum spp., Fagus spp., Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (for example, Glycine max, Soy hispida or Soy max), Gossypium hirsutum, Helianthus spp. (for example, Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (eg Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (for example, Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp. spp., Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (eg, Oryza sativa, Oryza latifolia), Panicum miliaceum, Passiflora edulis, Pastinaca sativa, Persea spp., Petroselinum crispum, Phaseolus spp., Phoenix spp., Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp. , Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (for example, Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Triticosecale rimpaui, Triticum spp. (for example, Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum or Triticum vulgare), Tropaeolum minus, Tropaeolum

majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, Ziziphus spp., among others.

According to a preferred embodiment of the present invention, the plant is a cultivation plant. Examples of crop plants include soy, sunflower, canola, alfalfa, rapeseed, cotton, tomato, potato and tobacco. More preferably, the plant is a monocot plant. Examples of monocot plants include sugarcane. More preferably, the plant is a cereal. Examples of cereals include rice, corn, wheat, barley, millet, rye, sorghum and oats.

The present invention also encompasses the use of nucleic acids encoding the class III TPP protein described herein and the use of these class III TPP proteins to enhance performance-related traits in plants.

Nucleic acids encoding the class III TPP protein described herein, or the class III TPP proteins themselves, can be used in culture programs in which a DNA marker that can be genetically linked to a gene is identified. which encodes a class III TPP. Nucleic acids / genes, or TPP class III proteins themselves, can be used to define a molecular marker. This DNA or protein marker can then be used in breeding programs to select plants that have enhanced performance related traits as defined herein in the methods of the invention.

Allelic variants of a nucleic acid / gene encoding a class III TPP protein can also be used in marker assisted reproduction programs. Such breeding programs sometimes require the introduction of allelic variation by mutagenic treatment of plants, using, for example, EMS mutagenesis; alternatively, the program can start with a collection of allelic variants of origin called "natural" produced unintentionally. The identification of allelic variants then takes place, for example, by PCR. This operation is followed by a step by the selection of superior allelic variants of the sequence in question and which provides increased performance. Selection is usually carried out by monitoring the growth performance of plants containing different allelic variants of the sequence in question. Growth performance can be carried out in a greenhouse or in the field. Other optional stages include the crossing of plants in which the superior allelic variant is identified with another plant. This could be used, for example, to make a combination of interesting phenotypic characteristics.

Nucleic acids encoding class III TPP proteins can also be used as probes to genetically and physically map the genes that are part of, and as markers for traits associated with these genes. Such information may be useful in plant reproduction to develop lines with desired phenotypes. Said use of nucleic acids encoding class III TPP proteins requires only a nucleic acid sequence of at least 15 nucleotides in length. Nucleic acids encoding class III TPP proteins can be used as restriction fragment length polymorphism (RFLP) markers. Southern immunoblotting (Sambrook J, Fritsch EF and Maniatis T (1989) Molecular Cloning, A Laboratory Manual) of genomic DNA from plants digested by restriction with nucleic acids encoding class III TPP proteins can be performed. The resulting band patterns can then be subjected to genetic analysis using computer programs such as MapMaker (Lander et al. (1987) Genomics 1: 174-181) to construct a genetic map. In addition, nucleic acids can be used to make Southern blots containing genomic DNA treated with restriction endonucleases from a number of individuals representing the parents and the progeny of a defined genetic cross. Segregation of DNA polymorphisms is observed and used to calculate the position of the nucleic acid encoding class III TPP protein in the genetic map previously obtained using this population (Botstein et al. (1980) Am. J. Hum. Genet. 32: 314-331).

The production and use of probes derived from plant genes for use in genetic mapping is described by Bematzky and Tanksley (1986) Plant Mol. Biol. Reporter 4: 37-41. Numerous publications describe the genetic mapping of specific cDNA clones using the methodology mentioned above or variations thereof. For example, F2 intercross populations, backcross populations, randomly paired populations, nearby isogenic lines and other sets of individuals can be used for mapping. Such methodologies are well known to those skilled in the art.

Nucleic acid probes can also be used for physical mapping (i.e., sequence layout on physical maps; see Hoheisel et al. In: Non-mammalian Genomic Analysis: A Practical Guide, Academic press 1996, pages 319-346, and references cited therein).

In another embodiment, nucleic acid probes can be used in direct mapping of fluorescence in situ hybridization (FISH) (Trask (1991) Trends Genet. 7: 149-154). Although current FISH mapping procedures favor the use of large clones (several kb to several hundred kb; see Laan et al. (1995) Genome Res. 5: 13-20), sensitivity improvements may allow for the realization of FISH mapping using shorter probes.

Procedures based on nucleic acid amplification can be carried out for genetic and physical mapping using nucleic acids. Examples include allele specific amplification (Kazazian (1989) J. Lab.

Clin. Med 11: 95-96), PCR amplified fragment polymorphism (CAPS; Sheffield et al. (1993) Genomics 16: 325-332), specific allele ligation (Landegren et al. (1988) Science 241: 1077-1080 ), nucleotide extension reactions (Sokolov (1990) Nucleic Acid Res. 18: 3671), hybrid radiation mapping (Walter et al. (1997) Nat. Genet. 7: 22-28) and Happy mapping (Dear and Cook (1989) Nucleic Acid Res. 17: 6795-6807). For these procedures a nucleic acid sequence is used to design and produce primer pairs for use in the amplification reaction or in primer extension reactions. The design of such primers is well known to those skilled in the art. In procedures that use genetic mapping based on PCR, it may be necessary to identify differences in DNA sequence between the progenitors of the mapping junction in the region corresponding to the sequence of immediate nucleic acids. However, this is generally not necessary for mapping procedures.

The processes according to the present invention result in plants having enhanced performance related traits, as described hereinbefore. These features can also be combined with other economically advantageous features, such as additional performance enhancing features, tolerance to other types of abiotic and biotic stress, features that modify various architectural features and / or biochemical and / or physiological features.

Description of the figures

Fig. 1 is a schematic representation of the structural elements present in TPP class III polypeptides. The position of the characteristic elements: Trehalose phosphate phosphatase domain, BOX A and BOX B phosphatase and serine rich domain are indicated.

Fig. 2 is a sequence alignment and a phylogenetic tree of TPS / TPP polypeptides as described in Example 2. Figure 2A shows a phylogenetic tree of TPS / TPP polypeptides. Clades enclosed in the oval contain TPS class I and class II proteins. TPP class III proteins (within the rectangle) are grouped apart from the TPS class I and class II group. Figure 2B shows an alignment of class III TPP polypeptides of plant origin. The trehalose-PP domain region is highlighted in bold. The position of the region rich in serine and phosphatase boxes A and B are highlighted by a rectangle. Figure 2C shows a phylogenetic tree of class III TPP polypeptides of non-vegetable origin. Figure 2D shows an alignment of class III TPP polypeptides of non-plant origin.

Fig. 3 is an alignment of trahalose-PP domains found in TPP polypeptide class III.

Fig. 4 shows TPP activity measured by HPLC. The first graph in Fig. 4A corresponds to the pGEX control sample; The second graph in Fig. 4B corresponds to the TPPI sample.

Fig. 5 is a bar chart showing the quantification of TPP activity detected by HPLC for the control sample, pGEX and for the TPP sample.

Fig. 6 shows the complementation of the growth defect in yeast strain YSH448 (tps2A) by class III TPP polypeptides of Arabidopsis thaliana. The photograph in Fig. 6A corresponds to a plate of a Drop test at 30 ° C, which shows that all strains were viable at the non-restrictive temperature. Fig. 6B shows a plate at 37 ° C, showing that only strains transformed with a class III TPP polynucleotide grow well at the restrictive temperature of 37 ° C. Fig. 6C shows a plate of a Drop test at 39 ° C.

Fig. 7: Binary vector for the increased expression in Oryza sativa of a nucleic acid encoding class III TPP proteins of Arabidopsis thaliana under the control of a GOS2 promoter.

Fig. 8: List of sequences.

Examples

The present invention will now be described with reference to the following examples, which are presented by way of illustration only. The following examples are not intended to fully define or otherwise limit the scope of the invention.

Example 1: Identification of sequences related to SEQ ID NO: 1 and SEQ ID NO: 2

Sequences (full length cDNA, EST or genomic) related to SEQ ID NO: 1 and / or protein sequences related to SEQ ID NO: 2 were identified among those conserved in the Entrez Nucleotides database in the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the basic local alignment tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215: 403-410; and Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402). The program was used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences with sequence databases and calculating the statistical significance of the matches. The polypeptide encoded by SEQ ID NO: 1 was used for the TBLASTN algorithm, with default settings and the filter to ignore the low complexity sequences activated. The result of the analysis was observed by comparison in pairs and

classified according to the probability classification (value of E), in which the classification reflects the probability that a particular alignment takes place by chance (the lower the value of E, the more significant the success). In addition to E values, comparisons were also classified by percent identity. Percent sequence identity refers to the number of nucleotides (or amino acids) identical between the two sequences of

5 nucleic acids (or polypeptides) compared over a particular length In some cases, the default parameters were adjusted to modify the search rigor.

Table A provides a list of nucleic acid and protein sequences related to the nucleic acid sequence represented by SEQ ID NO: 1 and the protein sequence represented by SEQ ID NO: 2.

Table A: Nucleic acid sequences related to the nucleic acid sequence represented by SEQ ID NO: 1 useful in the methods of the present invention and the corresponding deduced polypeptides. For each sequence the accession number of the database is provided either the protein or the nucleic acid encoding said protein.

Denomination

Source body NT / PROT SEQ ID NO: Database access number State

> SEQ ID NO: 2

Arabidopsis thaliana nt one NA Full length

> SEQ ID NO: 2

Arabidopsis thaliana PROT 2 NA Full length

> Ta_contig10083 @ 1008

Triticum_aestivum nt 3 NA Full length

> Ta_contig10083 @ 1008

Triticum_aestivum PROT 4 NA Full length

> Gm_contig16565

Glycine_max nt 5 NA Full length

> Gm_contig16565

Glycine_max PROT 6 NA Full length

> TAG_Contig-7-M6b1

Tstes ssp nt 7 NA Full length

> TAG_Contig-7-M6b1

Tstes ssp PROT 8 NA Full length

> AT1G22210

Arabidopsis thaliana nt 9 AT1G22210 Full length

> AT1G22210

Arabidopsis thaliana PROT 10 AT1G22210 Full length

> AT1G35910

Arabidopsis thaliana nt eleven AT1G35910 Full length

> AT1G35910

Arabidopsis thaliana PROT 12 AT1G35910 Full length

> AT1G78090

Arabidopsis thaliana nt 13 AT1G78090 Full length

> AT1G78090

Arabidopsis thaliana PROT 14 AT1G78090 Full length

> AT2G22190

Arabidopsis thaliana nt fifteen AT2G22190 Full length

> AT2G22190

Arabidopsis thaliana PROT 16 AT2G22190 Full length

> AT4G 12430

Arabidopsis thaliana nt 17 AT4G12430 Full length

> AT4G12430

Arabidopsis thaliana PROT 18 AT4G12430 Full length

> AT4G22590

Arabidopsis thaliana nt 19 AT4G22590 Full length

> AT4G22590

Arabidopsis thaliana PROT twenty AT4G22590 Full length

> At4g39770

Arabidopsis thaliana nt twenty-one At4g39770 Full length

> At4g39770

Arabidopsis thaliana PROT 22 At4g39770 Full length

(continuation)

Denomination

Source body NT / PROT SEQ ID NO: Database access number State

> AT5G10100

Arabidopsis thaliana nt 2. 3 AT5G10100 Full length

> AT5G10100

Arabidopsis thaliana PROT 24 AT5G10100 Full length

> AT5G51460

Arabidopsis thaliana nt 25 AT5G51460 Full length

> AT5G51460

Arabidopsis thaliana PROT 26 AT5G51460 Full length

> AT5G65140

Arabidopsis thaliana nt 27 AT5G65140 Full length

> AT5G65140

Arabidopsis thaliana PROT 28 AT5G65140 Full length

> pOP-lcl | scaff_II.875

Populus trichocarpa nt 29 pOPlcl | scaff_II.875 Full length

> pOP-lcl | scaff_II.875

Populus trichocarpa PROT 30 pOPlcl | scaff_II.875 Full length

> pOP-lcl | scaff_V.739

Populus trichocarpa nt 31 pOPlcl | scaff_V.739 Full length

> pOP-lcl | scaff_V.739.

Populus trichocarpa PROT 32 pOPlcl | scaff_V.739 Full length

> pOP-lcl | scaff_VII.559

Populus trichocarpa nt 33 pOPlcl | scaff_VII.559 Full length

> pOP-lcl | scaff_VII.559

Populus trichocarpa PROT 3. 4 pOPlcl | scaff_VII.559 Full length

> pOP-llcl | scaff_127.52

Populus trichocarpa nt 35 pOPllcl | scaff_127.52 Full length

> pOP-llcl | scaff_127.52

Populus trichocarpa PROT 36 POPllcl | scaff_127 .52 Full length

> pOP-llcl | scaff_III.843

Populus trichocarpa nt 37 pOP-llcl | scaffIII.843 Full length

> pOP-llcl | scaff_III.843

Populus trichocarpa PROT 38 pOPllcl | scaff_III.843 Full length

> pOP-llcl | scaff_V.167

Populus trichocarpa nt 39 pOPllcl | scaff_V.167 Full length

> pOP-llcl | scaff_V.167

Populus trichocarpa PROT 40 pOPllcl | scaff_V.167 Full length

> pOP-llcl | scaff_XII.1254

Populus trichocarpa nt 41 pOPllcl | scaff_XII. 1254 Full length

> pOP-llcl | scaff_XII.1254

Populus trichocarpa PROT 42 pOPllcl | scaff_XII. 1254 Full length

> pOP-llcl | scaff_XV.1052

Populus trichocarpa nt 43 pOPllcl | scaff_XV. 1052 Full length

> pOP-llcl | scaff_XV.1052

Populus trichocarpa PROT 44 pOPllcl | scaff_XV. 1052 Full length

> 0s02g0661100

Oryza sativa nt Four. Five Os02g0661100 Full length

> 0s02g0661100

Oryza sativa PROT 46 Os02g0661100 Full length

> 0s02g0753000

Oryza sativa nt 47 Os02g0753000 Full length

> Os02g0753000

Oryza sativa PROT 48 Os02g0753000 Full length

> Os03g0386500

Oryza sativa nt 49 Os03g0386500 Full length

> Os03g0386500

Oryza sativa PROT fifty Os03g0386500 Full length

(continuation)

Denomination

Source body NT / PROT SEQ ID NO: Database access number State

> Os06g0222100

Oryza sativa nt 51 Os06g0222100 Full length

> Os06g0222100

Oryza sativa PROT 52 Os06g0222100 Full length

> Os07g0485000

Oryza sativa nt 53 Os07g0485000 Full length

> Os07g0485000

Oryza sativa PROT 54 Os07g0485000 Full length

> Os07g0624600

Oryza sativa nt 55 Os07g0624600 Full length

> Os07g0624600

Oryza sativa PROT 56 Os07g0624600 Full length

> Os09g0369400

Oryza sativa nt 57 Os09g0369400 Full length

> Os09g0369400

Oryza sativa PROT 58 Os09g0369400 Full length

> Os10g0553300

Oryza sativa nt 59 Os10g0553300 Full length

> Os10g0553300

Oryza sativa PROT 60 Os10g0553300 Full length

> Aquilegia_TC11239

Aquilegia ssp nt 61 Aquilegia_TC112 39 Full length

> Aquilegia_TC11239

Aquilegia ssp PROT 62 Aquilegia_TC112 39 Full length

> Aquilegia_TC17706

Aquilegia ssp nt 63 Aquilegia_TC177 06 Full length

> Aquilegia_TC17706

Aquilegia ssp PROT 64 Aquilegia_TC177 06 Full length

> Bc_Q4AC11

Brassica campestris nt 65 Bc_Q4AC11 Full length

> Bc_Q4AC11

Brassica campestris PROT 66 Bc_Q4AC11 Full length

> Br_Q4ABQ9

Brassica rapa nt 67 Br_Q4ABQ9 Full length

> Br_Q4ABQ9

Brassica rapa PROT 68 Br_Q4ABQ9 Full length

> Gh_TC35369

Gossypium_hirsutum nt 69 Gh_TC35369 Full length

> Gh_TC35369

Gossypium_hirsutum PROT 70 Gh_TC35369 Full length

> Hv_TC139314

Hordeum vulgare nt 71 HV_TC139314 Full length

> Hv_TC139314

Hordeum vulgare PROT 72 HV_TC139314 Full length

> Mt_TC108059

Medicago_truncatula nt 73 Mt_TC108059 Full length

> Mt_TC108059

Medicago_truncatula PROT 74 Mt_TC108059 Full length

> Mt_TC108097

Medicago_truncatula nt 75 Mt_TC108097 Full length

> Mt_TC108097

Medicago_truncatula PROT 76 Mt_TC108097 Full length

> Nb_TC7464

Nicotiana benthamiana nt 77 Nb_TC7464 Full length

> Nb_TC7464

Nicotiana benthamiana PROT 78 Nb_TC7464 Full length

(continuation)

Denomination

Source body NT / PROT SEQ ID NO: Database access number State

> Nt_Q3ZTF5

Nicotiana tabacum nt 79 nt_Q3ZTF5 Full length

> Nt_Q3ZTF5

Nicotiana tabacum PROT 80 nt_Q3ZTF5 Full length

> Nt_TC7310

Nicotiana tabacum nt 81 nt_TC7310 Full length

> Nt_TC7310

Nicotiana tabacum PROT 82 nt_TC7310 Full length

> Sb_TC17204

Sorghum_bicolor nt 83 Sb_TC17204 Full length

> Sb_TC17204

Sorghum_bicolor PROT 84 Sb_TC17204 Full length

> St_TC151769

Solanum_tuberosum nt 85 St_TC151769 Full length

> St_TC151769

Solanum_tuberosum PROT 86 St_TC151769 Full length

> Ta_TC252250

Triticum_aestivum nt 87 Ta_TC252250 Full length

> Ta_TC252250

Triticum_aestivum PROT 88 Ta_TC252250 Full length

> Zm_ABD92779

Zea mays nt 89 Zm_ABD92779 Full length

> Zm_ABD92779

Zea mays PROT 90 Zm_ABD92779 Full length

> Zm_ABD92780

Zea mays nt 91 Zm_ABD92780 Full length

> Zm_ABD92780

Zea mays PROT 92 Zm_ABD92780 Full length

NA: It does not apply. Not found in public databases nt: nucleotide sequence PROT: protein sequence

Example 2: Alignment of TPP class III polypeptide sequences

Sequence alignment of class III TPP polypeptides was performed using the AlignX program from

5 NTI vector (Invitrogen) and is based on the popular progressive alignment Clustal algorithm (Thompson et al. (1997) Nucleic Acids Res 25: 4876-4882; Chenna et al. (2003). Nucleic Acids Res 31: 3497- 3500). A phylogenetic tree was constructed using a neighbor-binding clustering algorithm, using default values (gap opening penalty of 10, gap extension penalty of 0.1 and selected weight matrix of Blosum 62 (if the polypeptides are aligned)).

Example 3: Calculation of the percentage of global identity between polypeptide sequences useful in performing the methods of the invention

The overall percentages of similarity and identity between some of the full-length polypeptide sequences given in Table A of Example 1 were determined using one of the procedures available in the art, the MatGAT software (global matrix alignment tool) ( BMC Bioinformatics 15 2003 4:29 MatGAT: an application that generates similarity / identity matrices using protein or DNA sequences Campanella JJ, Bitincka L, Smalley J; computer program provided by Ledion Bitincka). The MatGAT software generates similarity / identity matrices for DNA or protein sequences without requiring a pre-alignment of the data. The program was used to perform a series of pairwise alignments using the Myers and Miller global alignment algorithm (with a gap opening penalty of 12 and a gap extension penalty of 2) and to calculate the similarity and identity using Blosum 62 (for polypeptides) and arrange the results in a distance matrix. The sequence similarity is shown in the lower half of the dividing line and the sequence identity is shown in the upper half of the diagonal dividing line.

The parameters used in the comparison were:

Classification matrix: Blosum62

25 First gap: 12

Gap Extension: 2

The results of the computer analysis are shown in Table B for overall similarity and identity as represented below and above the diagonal respectively. The overall similarity of SEQ ID NO: 2 with the paralogic proteins shown in Table B1 is greater than 48% identity. The similarity of SEQ ID NO: 2 with the homologous plant sequences given in Tables B2 and B3 is greater than 40% identity for proteins originating in dicotyledonous plants and greater than 45% identity for monocotyledons.

Table B: MatGAT results for global similarity and identity along the full length of the polypeptide sequences.

Table B1. Global similarity and identity between TPP polypeptides class III paralogs in Arabidopsis thaliana.

one

2 3 4 5 6 7 8 9

1. AT2G22190

48.5 64 61.8 57.2 48.6 48.8 51.9 55.3

2. AT5G51460

65.2 48.6 48.6 51.5 59.1 61 Four. Five 48.2

3. AT5G65140

78.1 69.1 74.1 60.2 47.1 47.3 51.1 60.1

4. AT5G10100

75.6 66.5 88.4 57.3 45.7 47.2 50.3 55.1

5. AT1G35910

72.1 70.4 78.1 76.7 50.9 52 54.2 59.7

6. AT4G22590

65.5 77.1 67.9 67.9 69.5 81.2 45.8 47.7

7. AT4G12430

66.3 76.1 67.6 69.4 72.1 89.7 46.7 49.4

8. AT1G22210

67.5 60.3 66.8 65.3 68.8 61.5 63.3 58.5

9. AT1G78090

69.5 68.6 77 74.1 77.3 68.4 67.9 73.5

10. SEQ ID NO: 2

69.5 68.6 77 74.1 77.3 68.4 67.9 73.3 100

Example 4: Identification of domains comprising TPP class III polypeptides

The Integrated Resource of Protein Families, Domains and Sites (InterPro) database is an integrated interface for signature databases commonly used for text and sequence based search. The InterPro database combines these databases, which use different methodologies and varying degrees of well-characterized biological information on proteins to derive protein signatures. The collaborating databases include SWISS-PROT, PROSITE, TrEMBL, PRINTS, ProDom and Pfam, Smart and TIGRFAMs. Interpro is provided by the European Bioinformatics Institute in the United Kingdom.

The results of the InterPro scan of the polypeptide sequence represented by SEQ ID NO: 14 are shown in Table C.

Table C: Results of the InterPro scan of the polypeptide sequence represented by SEQ ID NO: 14.

Database

Access number Access Denomination Region of homology with the domain

TIGRFAMs

TIGR01484 HAD-SF-IIB: HAD superfamily hydrolases 119-332

Pfam

PF02358 Trehalosa_PPasa 121-354

TIGRFAMs

TIGR00685 T6PP: trehalose phosphatase 115-365

Example 5: Test of in vitro activity of trehalose phosphate phosphatase activity

Arabidopsis class III polynucleotide TPP corresponding to the coding region of the AtTPPI isoform was cloned into plasmid pGEX-4T-1 (Pharmacia), designed to create GST fusion proteins. The vector was introduced in E. coli. The expressed recombinant protein produced in the E. coli BL21 strain was purified and TPP activity was determined by HPLC.

E. coli expression

Supercompetent E. coli BL21 Star ™ (DE3) One Shot® (Invitrogen) strain cells were transformed with the pGEXGST construct and incubated overnight in plates with Luria Bertani (LB) + ampicillin (Amp) media 37 ° C Colonies were collected and transferred to 200 ml of LB + Amp and incubated with shaking at 37 ° C for 4 h before inducing expression by adding is-isopropyl thiogalactoside (IPTG, final concentration 0.3 mM). This was followed by another incubation period of 4 h at 30 ° C. The cells were collected by centrifugation at 4 ° C (30 min, 3000 rpm) and resuspended in 5 ml of 1x phosphate buffered saline buffer (PBS) cooled with ice (140 mM NaCl; 2.7 mM KCl; Na2HPO4 10 mM; 1.8 mM KH2PO4; pH 7.3), in aliquot parts in 5 tubes with frozen screw cap. After centrifugation at 4 ° C (5 min, 6000 rpm), the agglomerates were frozen in liquid nitrogen and stored at -80 ° C.

Protein purification

The cells were washed once with 5 ml of lysis buffer (1 x PBS; 0.4% Triton; 2 mM MgCl2, 1 mM EDTA, 2 mM dithiothreitol (DTT); 0.2 mg / ml lysozyme and 1 Protease-inhibitor mixture tablet in EDTA (Roche) / 10 ml lysis buffer) cooled with ice, incubated for 15 min on ice and sonicated with three 15 s sonication pulses (Sartorius Labsonic®P) . The lysates were removed at 4 ° C by centrifugation at 12,000 g. The supernatant fraction was mixed with 200 μl of glutathione-sepharose beads (Amersham Biosciences) that had been pre-equilibrated in wash buffer (1x PBS; 0.1% Triton; 2 mM MgCl2, 1 mM EDTA, 1 mM DTT) and incubated for 1 h at 4 ° C in a roller drum. The beads were collected by centrifugation at 4 ° C (1 min, 1800 rpm), washed five times with 1 ml of ice-cold wash buffer and stored at -20 ° C before taking measurements of TPP activity .

TPP activity measurement

Trehalose-6-phosphate phosphatase (TPP) activity was detected by measuring trehalose (T) produced after adding trehalose-6-phosphate (T6P) to protein samples. Samples were added to 150 μl of T6P assay buffer (2 mM T6P; 2 mM MgCl2; 10 μM validamicin and 45 mM Tris-ClH, pH 7.5) or without T6P (2 mM MgCl2; 10 μM validamicin and 45 mM Tris-ClH, pH 7.5). After incubating for 1-1.5 h at 37 ° C, the beads were collected by centrifugation (10 min; 1,200 g) and the supernatant was injected in HPLC, together with a dilution of standard T. Protein concentrations were measured by Bradford's procedure.

The results indicated in Figure 4 showed that TPPI has trehalose-6-phosphate phosphatase activity.

Example 6: In vivo activity assay of trehalose phosphate phosphatase

The activity of the enzyme represented by SEQ ID NO: 2 and that of its paralogic proteins having sequences represented by SEQ ID NO: 10, 12, 16, 18, 20, 22, 24, 26 and 28 was determined by functional complementation

of the yeast mutant tps2 according to the protocol described by Vogel et al. 1998 with secondary modifications. Briefly, a DNA fragment comprising the coding regions of any of the sequences represented by SEQ ID NO: 1, 9, 11, 15, 17, 19, 21, 23, 25 and 27 was amplified from Arabidopsis thaliana cDNA by polymerase chain reaction using the primers listed in Table D. The DNA fragments were subsequently cloned into the yeast expression vector pYX212. The constructs were introduced into the YSH448 yeast strain deficient in heat sensitive tps2. The transformed yeast strains were grown at the permissible temperature of 30 ° C and the restrictive conditions of 38 ° C and 39 ° C in SD-URA glucose medium. As shown in Figure 6 only the constructs that comprised the coding region of any of SEQ ID NO: 2, 10, 12, 16, 18, 20, 22, 24, 26 and 28 were able to restore yeast growth at the restrictive temperatures of 37 ºC and 39 ºC. The yeast transformants containing the empty vector pYX212 did not restore the growth of the strain deficient in tps2 YSH448. Yeast transformants expressing the wild-type yeast TPS2 gene from vector pYX212 and empty pYX212 were used as positive and negative controls respectively.

Table D: List of primers used in the PCR to amplify class III polypeptides of Arabidopsis thaliana. A detection codon was provided in the cloning vector.

Primer designation

origin SEQ ID NO. Sequence

> PrmAtTPPA-5

Synthetic 101 GGAAGATCTATGGACATGAAATCTGGTCACTC

> PrmAtTPPA-3

Synthetic 102 AAGGCCTACCCATTGATCTCTTCCATGTCA

> PrmAtTPPB-5

Synthetic 103 GGAATTCATGACTAACCAGAATGTCATCGTT

> PrmAtTPPB-3

Synthetic 104 AAGGCCTCTCTTCTCCCACTGTCTTCCTC

> PrmAtTPPC-5

Synthetic 105 CGGGATCCATGAAGATTACGGATATTTCCGG

> PrmAtTPPC-3

Synthetic 106 AAGGCCTTTCTCCAAGTGTTTGTTTCTTCC

> PrmAtTPPD-5

Synthetic 107 CGGGATCCATGACAAACCATAATGCCTTAATC

> PrmAtTPPD-3

Synthetic 108 AAGGCCTTCTTCCTCTTAGTGACATTTGTTTC

> PrmAtTPPE-5

Synthetic 109 CGGGATCCATGTTCGAAGAAATACTTCATAAATC

> PrmAtTPPE-3

Synthetic 110 AAGGCCTTGCCCCACACCTTGACTGTTTC

> PrmAtTPPF-5

Synthetic 111 CATGCCATGGATTTAAACTCAAACCACAAATC

> PrmAtTPPF-3

Synthetic 112 TCCCCCGGGAAAACCAGTAGAATTCTTCTCCAAC

> PrmAtTPPG-5

Synthetic 113 CATGCCATGGATTTGAATATAAACAAGACGAC

> PrmAtTPPG-3

Synthetic 114 AAGGCCTAAAACTTGTTTTTGAACTTTCCATCTTC

> PrmAtTPPH-5

Synthetic 115 CGGGATCCATGGTTAGATTCATAGAAGAAAACAC

> PrmAtTPPH-3

Synthetic 116 AAGGCCTTGCTCCAGATCTCAATTGTTTCC

> PrmAtTPPI-5

Synthetic 117 CGGGATCCATGTCAGCTAGTCAAAACATTGTC

> PrmAtTPPI-3

Synthetic 118 AAGGCCTCATTCTTGGCTGCATTTGTTTCC

> PrmAtTPPJ-5

Synthetic 119 CGGGATCCATGGTGAGCCAAAACGTCGTCG

> PrmAtTPPJ-3

Synthetic 120 AAGGCCTTTGCTGCATCTGTTTCCACTCC

Example 7: Cloning of a nucleic acid sequence represented by SEQ ID NO: 1

Unless otherwise indicated, recombinant DNA techniques were performed according to standard protocols described by Sambrook (2001), Molecular Cloning: a laboratory manual, 3rd edition, Cold Spring Harbor Laboratory Press, CSH, New York) or in the Volumes 1 and 2 by Ausubel et al. (1994), Current Protocols in Molecular Biology, Current Protocols. Standard materials and procedures for molecular work with plants are described in Plant Molecular Biology Labfax (1993) by R.D.D. Croy, published by BIOS Scientific Publications Ltd (United Kingdom) and Blackwell Scientific Publications (United Kingdom).

The class III TPP gene of Arabidopsis thaliana Class III TPP was amplified by PCR using as a template a cDNA library of Arabidopsis thaliana seedlings (Invitrogen, Paisley, United Kingdom). Primers prm05451 (SEQ ID NO: 99, primer; direct sense, start codon in bold, AttB1 site in italics: 5'-ggggacaagtttgtacaa aaaagcaggcttaaacaatgactaaccagaatgtcatc-3 '), and prm05452 (prm05452) were used for PCR amplification primer 2; reverse, complementary, AttB2 site in italics: 5'-ggggaccactttgtacaagaaagctgggttgtaattatgtt gcatgtctt-3 '), which included the AttB sites for Gateway recombination. PCR was performed using Taq DNA polymerase Hifi under standard conditions. A PCR fragment of the expected length was amplified and purified also using standard procedures. Then the first stage of the Gateway procedure, the BP reaction, was performed, during which the PCR fragment is recombined in vivo with plasmid pDONR201 to produce, according to Gateway terminology, an "input clone", pEC_TPP class III . Plasmid pDONR201 was purchased from Invitrogen, as part of Gateway® technology.

Example 8: Construction of the expression vector using the nucleic acid sequence represented by SEQ ID NO: 1

The class III pEC_TPP input clone was subsequently used in an LR reaction with a target vector used for the transformation of Oryza sativa. This vector contains as functional elements within the

T-DNA boundaries: a selectable plant marker, a screenable marker expression cassette and a Gateway cassette intended for LR recombination in vivo with the nucleic acid sequence of interest already cloned in the input clone. A GOS2 rice promoter (SEQ ID NO: 98) for constitutive expression was located upstream of this Gateway cassette.

After the LR recombination step, the resulting expression vector pXC_TPP class III (Figure 7) was transformed into the Agrobacterium strain LBA4044 according to procedures well known in the art.

Example 9: Plant transformation

Rice transformation

The Agrobacterium containing the expression vector was used to transform Oryza sativa plants. Ripe dried seeds of the Japanese Nipponbare rice crop were husked. Sterilization was carried out by incubating for one minute in 70% ethanol, operation followed by 30 minutes in 0.2% HgCl2, operation followed by washing 6 times for 15 minutes with sterile distilled water. The sterile seeds were then germinated in a medium containing 2,4-D (callus induction medium). After incubation in the dark for four weeks, the calli derived from embryonic sputum were extended and propagated in the same medium. After two weeks, the calluses multiplied or propagated by subculture in the same medium for another 2 weeks. Pieces of embryonic callus were subcultured in recent medium 3 days before coculture (to reinforce cell division activity).

The Agrobacterium strain LBA4404 containing the expression vector was used for coculture. Agrobacterium was inoculated in AB medium with the appropriate antibiotics and cultured for 3 days at 28 ° C. The bacteria were then collected and suspended in liquid coculture medium at a density (OD600) of about 1. The suspension was then transferred to a Petri dish and the calluses were immersed in the suspension for 15 minutes. The callous tissues were then dried by placing them on a filter paper and transferred to solidified coculture medium and incubated for 3 days in the dark at 25 ° C. Cocultured calluses were grown in a medium containing 2,4-D for 4 in the dark at 28 ° C in the presence of a selection agent. During this period, islands of growing resistant corns developed rapidly. After transferring this material to a regeneration and light incubation medium, the embryogenic potential was released and outbreaks developed in the next four to five weeks. The buds were absorbed from the calluses and incubated for 2 to 3 weeks in a medium containing auxin, from which they were transferred to the soil. Hardened shoots were grown in high humidity conditions and short days in a greenhouse.

Approximately 35 independent T0 rice transformants were generated for a construct. The primary transformants were transferred from a tissue culture chamber to a greenhouse. After a quantitative PCR analysis to verify the number of copies of the T-DNA insert, only a single copy of transgenic plants that showed tolerance to the selection agent was retained to collect the T1 seed. Then, the seeds were collected three to five months after transplantation. The procedure produced single site transformants at a rate of more than 50% (Aldemita and Hodges1996, Chan et al. 1993, Hiei et al. 1994).

Corn Transformation

The transformation of corn (Zea mays) is performed with a modification of the procedure described by Ishida et al. (1996) Nature Biotech 14 (6): 745-50. The transformation is genotype dependent on corn and only specific genotypes are susceptible to transformation and regeneration. The inbred line A188 (University of Minnesota) or hybrids with A188, as parents, are good sources of donor material for transformation, but other genotypes can also be used successfully. Spikes of corn plants are collected approximately 11 days after pollination (DAP) when the length of the immature embryo is approximately 1 to 1.2 mm. Immature embryos are cocultured with Agrobacterium tumefaciens containing the expression vector, and transgenic plants are recovered by organogenesis. Excited embryos are grown in callus induction medium, then in corn regeneration medium containing the selection agent (eg imidazolinone, but various selection markers can be used). Petri dishes are incubated in the light at 25 ° C for 2-3 weeks or until buds develop. Green shoots are transferred from each embryo to corn rooting medium and incubated at 25 ° C for 2-3 weeks, until roots develop. Rooted shoots are transplanted to the ground in the greenhouse. T1 seeds are produced from plants that show tolerance to the selection agent and that contain a single copy of the T-DNA insert.

Wheat transformation

The wheat transformation is carried out with the procedure described by Ishida et al. (1996) Nature Biotech 14 (6): 745-50. The Bobwhite crop variety (available from CIMMYT, Mexico) is normally used in the transformation. Immature embryos are cocultured with Agrobacterium tumefaciens containing the expression vector and transgenic plants are recovered by organogenesis. After incubation with Agrobacterium, embryos are cultured in vitro in callus induction medium, then in regeneration medium containing the selection agent (for example imidazolinone, but various selection markers can be used). Petri dishes are incubated in the light at 25 ° C for 2-3 weeks or until buds develop. The green shoots are transferred

from each embryo to rooting medium and incubate at 25 ° C for 2-3 weeks, until roots develop. Rooted shoots are transplanted to the ground in the greenhouse. T1 seeds are produced from plants that show tolerance to the selection agent and that contain a single copy of the T-DNA insert.

Soy Transformation

Soybeans are transformed according to a modification of the procedure described by Texas A&M, US Patent No. 5,164,310. Various commercial varieties of soybeans are susceptible to transformation by this procedure. The Jack crop variety (available from the Illinois Seed Foundation) is normally used for transformation. Soybeans are sterilized for in vitro planting. The hypocotyl, the radicle and a cotyledon excinen themselves of young seedlings of seven days of life. The epicotyl and the remaining cotyledon are further cultured to develop axillary nodes. These axillary nodes are excited and incubated with Agrobacterium tumefaciens containing the expression vector. After the coculture treatment, the explants are washed and transferred to selection medium. The regenerated buds are excited and arranged in a bud extension medium. Outbreaks not larger than 1 cm are arranged in rooting medium until root development. Rooted shoots were transplanted to the ground in the greenhouse. T1 seeds are produced from plants that show tolerance to the selection agent and that contain a single copy of the T-DNA insert.

Rapeseed / canola transformation

Cotyledonary and hypocotyl petioles of young plants 5-6 days old are used as explants for tissue culture and transformed according to Babic et al. (1998, Plant Cell Rep 17: 183-188). The Westar commercial crop variety (Agriculture Canada) is the standard variety used for transformation, but other varieties can also be used. Canola seeds are sterilized on the surface for in vitro planting. The explants of cotyledonous petioles with the attached cotyledon are excited from the seedlings in vitro and inoculated with Agrobacterium (containing the expression vector) by dipping the cut end of the petiole explant into the bacterial suspension. The explants are then grown for 2 days in MSBAP-3 medium containing 3 mg / l of BAP, 3% sucrose, 0.7% Fitagar at 23 ° C, 16 h of light. After two days of co-culture with Agrobacterium, the petiole explants are transferred to MSBAP-3 medium containing 3 mg / l of BAP, cefotaxime, carbenicillin or timentin (300 mg / l) for 7 days and then grown in MSBAP medium -3 with cefotaxime, carbenicillin or timentin and selection agent until the regeneration of the outbreak. When the shoots are 5 -10 mm long, they are cut and transferred to bud extension medium (MSBAP-0.5, which contains 0.5 mg / l of BAP). The shoots of approximately 2 cm in length are transferred to the rooting medium (MS0) for root induction. Rooted shoots are transplanted to the ground in the greenhouse. T1 seeds are produced from plants that show tolerance to the selection agent and that contain a single copy of the T-DNA insert.

Alfalfa transformation

An alfalfa regeneration clone (Medicago sativa) is transformed using the procedure of (McKersie et al., 1999 Plant Physiol 119: 839-847). Alfalfa regeneration and transformation are genotype dependent and, therefore, a regenerating plant is required. Procedures for obtaining regenerating plants have been described. For example, these can be selected from Rangelander (Agriculture Canada) or any other commercial alfalfa varieties such as those described by Brown DCW and A Atanassov (1985. Plant Cell Tissue Organ Culture 4: 111-112). Alternatively, the RA3 variety (University of Wisconsin) has been selected for use in tissue culture (Walker et al., 1978 Am J Bot 65: 654-659). Petiole explants are cocultured with overnight culture of Agrobacterium tumefaciens C58C1 pMP90 (McKersie et al., 1999 Plant Physiol 119: 839-847) or LBA4404 containing the expression vector. The explants are cocultivated for 3 d in the dark in SH induction medium containing 288 mg / l of Pro, 53 mg / l of thioproline, 4.35 g / l of K2SO4 and 100 µm of acetosyringinone. The explants are washed in medium strength Murashige-Skoog medium (Murashige and Skoog, 1962) and plated in the same SH induction medium without acetosyringinone, but with a suitable selection agent and antibiotic suitable to inhibit the growth of Agrobacterium. After several weeks somatic embryos are transferred to BOi2Y development medium that does not contain growth regulators or antibiotics and contains 50 g / l sucrose. Somatic embryos are subsequently germinated in medium strength Murashige-Skoog. Seedlings with roots were transplanted into pots and grown in a greenhouse. T1 seeds are produced from plants that show tolerance to the selection agent and that contain a single copy of the T-DNA insert.

Cotton transformation

Cotton is transformed using Agrobacterium tumefaciens according to the procedure described in US document.

5,159,135. Cotton seeds are surface sterilized in 3% sodium hypochlorite solution for 20 minutes and washed in distilled water with 500 μg / ml cefotaxime. The seeds are then transferred to SH medium with 50 μg / ml of benomyl for germination. Hypocotyls are removed from seedlings of 4 to 6 days of life, cut into 0.5 cm pieces and arranged in 0.8% agar. An Agrobacterium suspension (approximately 108 cells per ml, diluted from a overnight culture transformed with the gene of interest and suitable selection markers) is used for inoculation of the hypocotyl explants. After 3 days at room temperature and lighting, the tissues were transferred to a solid medium (1.6 g / l Gelrite) with Murashige salts and

Skoog with vitamins B5 (Gamborg et al., Exp. Cell Res. 50: 151-158 (1968)), 0.1 mg / l of 2,4-D, 0.1 mg / l of 6furfurylaminopurine and 750 μg / ml of MgCl2, and with 50 to 100 μg / ml of cefotaxime and 400-500 μg / ml of carbenicillin to destroy residual bacteria. Individual cell lines are isolated after two to three months (with subcultures every four to six weeks) and further grown in selective medium for tissue amplification (30 ° C, 16 h photoperiod). The transformed tissues are subsequently cultured further in non-selective medium for 2-3 months to obtain somatic embryos. Embryos that appear healthy at least 4 mm in length are transferred to tubes with SH medium in fine vermiculite, supplemented with 0.1 mg / l indole acetic acid, 6 furfurylaminopurine and gibberellic acid. The embryos are grown at 30 ° C with a 16-hour photoperiod, and the seedlings in the 2 to 3-leaf stage are transferred to pots with vermiculite and nutrients. The plants harden and subsequently move to the greenhouse for further cultivation.

Example 10: Phenotypic evaluation procedure

10.1 Evaluation configuration

Approximately 35 independent T0 rice transformants were generated. The primary transformants were transferred from a tissue culture chamber to a greenhouse for the cultivation and collection of T1 seeds. Five events were conserved, of which the T1 progeny segregated 3: 1 for the presence / absence of the transgenes. For each of these events, approximately 10 T1 seedlings containing the transgene (heterozygous and homozygous) and approximately 10 T1 seedlings lacking the transgene (nullicototes) were selected by monitoring the expression of the visual marker. The transgenic plants and the corresponding nulicygotes were grown side by side in random positions. The greenhouse conditions were short days (12 hours of light), 28 ° C in the light and 22 ° C in the dark and a relative humidity of 70%.

Four T1 events were additionally evaluated in the T2 generation following the same evaluation procedure as for the T1 generation but with more individuals per event. From the planting stage to the maturity stage the plants were passed several times through a digital imaging booth. At each time point digital images (2048 x 1536 pixels, 16 million colors) of each plant were taken in at least 6 different angles.

Drought Resistance Screening

T2 seed plants were grown in potted soil under normal conditions until they reached the spike stage. They were then transferred to a "dry" section, where they were deprived of irrigation. Moisture probes were inserted in randomly selected pots to track soil water content (SWC). When the SWC was below a certain threshold, the plants were watered automatically until a normal level was reached. The plants were then transferred back to normal conditions. The rest of the crop (plant maturation, seed collection) was the same as for uncultivated plants under conditions of abiotic stress. The culture and yield parameters were recorded as detailed for cultivation under normal conditions.

Nitrogen use efficiency screening

T2 seed plants were grown in potted soil under normal conditions except for the nutrient solution. The pots were watered from transplant to maturation with a specific nutrient solution containing a reduced N (N) nitrogen content, usually between 7 and 8 times less than normal (control) plants. The rest of the crop (plant maturation, seed collection) was the same as for uncultivated plants under conditions of abiotic stress. The culture and yield parameters are recorded as detailed for cultivation under normal conditions.

10.2 Statistical analysis: Test F

A two-factor ANOVA (variant analysis) was used as a statistical model for the general evaluation of phenotypic characteristics of the plant. An F test was carried out on all measured parameters of all plants of all events transformed with the gene of the present invention. The F test was carried out to verify an effect of the gene on all transformation events and to verify a general effect of the gene, also known as a global gene effect. The threshold for significance for a global gene effect was set at a probability level of 5% for the F test. A significant F test value points to a gene effect, which means that not only the mere presence or position of the gene. gene causes differences in phenotype.

10.3 Measured parameters

Measurement of parameters related to biomass

From the planting stage to the maturity stage the plants were passed several times through a digital imaging booth. At each time point digital images (2048 x 1536 pixels, 16 million colors) of each plant were taken in at least 6 different angles.

The area above the floor of the plant (or foliar biomass) was determined by counting the number of pixels in the digital images of discriminated plant aerial parts of the background. This value was averaged for photographs taken at the same time point from different angles and converted to a physical surface value expressed in square mm per calligration. Experiments showed that the area of the plant above the ground measured in this way correlates with the biomass of the parts of the plant above the ground. The area above the ground is the area measured at the time point at which the plant has reached its maximum foliar biomass.

The early vigor of the plant is estimated from the area above the soil of the plant (seedling) three weeks after germination. The increase in root biomass is expressed as an increase in the total root biomass (measured as the maximum root biomass observed during the exponential root growth phase); or as an increase in the root / bud index (measured as the ratio between root mass and shoot mass in the period of active growth of the root and the shoot).

Measurement of seed related parameters

The ripe primary cobs were collected, counted, bagged, labeled with bar codes and then dried for three days in an oven at 37 ° C. The ears were threshed afterwards and all the seeds were collected and counted. The filled shells were separated from the empty ones using an air blowing device. Empty shells were discarded and the remaining fraction was counted again. Full shells were weighed on an analytical balance. The number of full seeds was determined by counting the number of full shells that remain after the separation stage. The total seed yield was measured by weighing all the full shells collected from a plant. The total seed number per plant was measured by counting the number of shells collected from a plant. The weight of one thousand grains (TKW) is extrapolated from the number of full seeds counted and their total weight. The harvest index (CI) in the present invention is defined as the ratio between the total seed yield and the area above the surface (mm2), multiplied by a factor of 106. The total number of flowers per ear, such As defined in the present invention, it is the relationship between the total number of seeds and the number of mature primary cobs. The seed filling rate as defined in the present invention is the proportion (expressed as a%) of the number of seeds filled with respect to the total number of seeds (or florets).

Example 11: Results of the phenotypic evaluation of transgenic plants

The results of the evaluation of transgenic rice plants expressing the nucleic acid sequence SEQ ID NO: 1 under the control of a GOS2 promoter are presented in Table E. The percentage of difference between the transgenic and the corresponding nulicygotes is also shown. , with a P value from test F of less than 0.05.

The total seed yield, the number of full seeds, the seed filling rate and the harvest index were significantly increased in the transgenic plants that express the nucleic acid sequence of SEQ ID NO: 1, in comparison with the plants of control (in this case the nulicigotos).

Table E: Results of the evaluation of transgenic rice plants expressing the nucleic acid sequence SEQ ID NO: 1 under the control of a GOS2 promoter

Feature

% increase in transgenic plants versus control plants

Total seed yield

fifteen

Number of seeds filled

17

Total number of seeds

eleven

Harvest index

7

Flowers by cob

5

Above-ground biomass

6

Transgenic rice plants expressing the nucleic acid sequence of SEQ ID NO: 1 under the control of a GOS2 promoter were also subjected to drought resistance screening. The following parameters were increased compared to corresponding control plants and the parameters marked with * gave a P value from test F of less than 0.05. * Total seed yield (11% increase compared to control plants), * number of full seeds (10% increase compared to control plants), * harvest rate (11% increase compared to plants control), filling rate (8% increase compared to control plants).

Table F: Results of the evaluation of transgenic rice plants subjected to nitrogen efficiency screening that express the nucleic acid sequence SEQ ID NO: 1 under the control of a GOS2 promoter.

The plants subjected to nitrogen efficiency screening showed an increase in the parameters described in the table below compared to corresponding control plants.

Parameter

% increase

Above-ground biomass

9.8

Root biomass

11.4

Total seed yield

11.2

Number of seeds filled

25.9

Number of flowers per cob

6.1

Plant height

13.4

Total number of seeds

9.5

Table G: Results of the evaluation of transgenic rice plants subjected to nitrogen screening that express the nucleic acid sequence of SEQ ID NO: 1 under the control of an HMG promoter (high mobility group). 5

The plants subjected to nitrogen efficiency screening showed an increase in the parameters described in the table below compared to corresponding control plants.

Parameter

% Increase%

Vigor in emergency

18.2

Number of seeds filled

32.2

Claims (14)

1. A procedure for increasing seed yield in plants with respect to control plants, wherein said increased seed yield is one or more of the following:

(i)

 Increased number of seeds per plant;

(ii)

 Increased number of full seeds per plant;

(iii) Increased weight of seeds per plant; comprising increasing the expression in a plant of a nucleic acid encoding a class III trehalose phosphate phosphate (TPP) polypeptide, wherein said increased expression is effected by introducing and expressing in a plant a nucleic acid encoding a TPP polypeptide of class III, wherein said nucleic acid encodes a class III TPP polypeptide having at least 85% sequence identity with the amino acid sequence SEQ ID NO: 4, or wherein said class III TPP polypeptide comprises:

(i)

a trelalosa-PPase domain having at least 50% amino acid sequence identity with SEQ ID NO: 93 or SEQ ID NO: 94, wherein said trehalose-PPase domain comprises:

to.

 a phosphatase A box having at least 50% sequence identity with SEQ ID NO: 96 and / or

b.

 a phosphatase B box that has at least 50% sequence identity with SEQ ID NO: 97 and / or

(ii)

 a serine rich domain that has at least 50% sequence identity with SEQ ID NO: 95,

wherein said control plants are corresponding wild-type plants or corresponding plants without said nucleic acid encoding said class III trehalose phosphate polypeptide. 2. A method according to claim 1, wherein said nucleic acid encoding a class III TPP protein:

(i)

 is the nucleic acid having SEQ ID NO: 3 or a portion thereof having a length of at least 625 consecutive nucleotides, or a sequence capable of hybridizing under stringent conditions with a nucleic acid having SEQ ID NO: 4 and /or

(ii)

 encodes a class III TPP polypeptide having SEQ ID NO: 4.

3.

Process according to any one of claims 1 to 2, wherein said nucleic acid is operably linked to a constitutive promoter.

Four.

The plant or part thereof, including seeds, which can be obtained by a method according to any one of claims 1 to 4, said plant or part thereof comprising a recombinant nucleic acid encoding a class III TPP protein of SEQ ID Nº: 4 operatively linked to a constitutive promoter.

5.

An isolated nucleic acid molecule comprising:

(i)

 a nucleic acid of SEQ ID NO: 3;

(ii)

 the complement of SEQ ID NO provided in (i);

(iii) a nucleic acid encoding a class III TPP protein that has at least 90% sequence identity with the amino acid sequence provided in SEQ ID NO: 4,

6.

An isolated polypeptide comprising:

(i)

 an amino acid sequence of SEQ ID No. 4;

(ii)

an amino acid sequence that has at least 90% sequence identity with the amino acid sequence provided in SEQ ID NO: 4;

7.

Construct comprising:

(to)

 a nucleic acid encoding a class III TPP polypeptide according to claim 6; Y

(b)

 one or more control sequences capable of directing the expression of the nucleic acid sequence of (a), wherein said a control sequence is a GOS2 promoter; Y

(C)

 optionally a transcription termination sequence.

8. Use of a construct according to claim 7 in a method of producing plants having an increased seed yield with respect to control plants, wherein said seed yield is one or more of the following:

(i)

 Increased number of seeds per plant;

(ii)

 Increased number of full seeds per plant;

(iii) Increased (total) weight of seeds per plant; wherein said control plants are corresponding wild type plants or corresponding plants without said nucleic acid encoding said class III trehalose phosphate polypeptide.

9.

Plant, part of plant or plant cell transformed with a construct according to claim 7, wherein said construct is integrated into the genome of the plant, plant part or plant cell.

10.

Production procedure of a transgenic plant that has increased seed yield, in which said seed yield is one or more of the following:

(i)

 Increased number of seeds per plant;

(ii)

 Increased number of full seeds per plant;

(iii) Increased (total) weight of seeds per plant; which includes:

(i)

introducing and expressing in a plant a nucleic acid encoding a class III TPP protein according to claim 1 or 6 and

(ii)

 Cultivate the plant cell under conditions that promote plant growth and development.

11. A transgenic plant that has increased seed yield with respect to control plants, said seed yield being increased as a result of an increased expression of an introduced nucleic acid encoding a class III TPP protein as defined in the claim. 6, or a transgenic plant cell that can be obtained from said transgenic plant, wherein said transgenic plant is a crop plant or a monocot or cereal, such as rice, corn, wheat, barley, millet, rye, sorghum or oats, or a transgenic plant cell derived from said transgenic plant, wherein said control plants are corresponding wild-type plants or corresponding plants without said nucleic acid encoding said class III trehalose phosphate polypeptide.

12.

Collectible parts of a plant as defined in claim 11, wherein said collectible parts comprise a construct as defined in claim 7.

13.

Collectible parts according to claim 12, wherein said collectible parts are seeds.

14.

Use of a nucleic acid encoding a class III TPP protein according to claim 1 or 6 to increase seed yield in plants with respect to control plants when introduced and expressed in said plants, wherein said seed yield It is one or more of the following:

(i)

 Increased number of seeds per plant;

(ii)

 Increased number of full seeds per plant;

(iii) Increased (total) weight of seeds per plant; wherein said control plants are corresponding wild type plants or corresponding plants without said nucleic acid encoding said class III trehalose phosphate polypeptide.  FIGURE 2B (continued)  FIGURE 2B (continued)  FIGURE 2B (continued)  FIGURE 2B (continued)  FIGURE 2C    2D FIGURE    2D FIGURE (continued)  2D FIGURE (continued)  2D FIGURE (continued)  FIGURE3    FIGURE3 (continued)  FIGURE3 (continued)  Complementation of the growth defect in yeast strain YSH448 (tps2Δ) by TPP polypeptides class III representative of Arabidopsis thaliana SEQ ID NO: 01, DNA - Arabidopsis thaliana SEQ ID NO: 02, protein - Arabidopsis thaliana SEQ ID NO: 3, AND - Triticum aestivum  Figure 8 SEQ ID NO: 04, protein - Triticum aestivum SEQ ID NO: 05, DNA - Glycine max  Figure 8 (continued) SEQ ID NO: 06, protein –Glycine max SEQ ID NO: 07, DNA - Tagetes spp. SEQ ID NO: 08, protein - Tagetes spp.  Figure 8 (continued) SEQ ID NO: 09, DNA - Arabidopsis thaliana SEQ ID NO: 10, protein - Arabidopsis thaliana SEQ ID NO: 11, DNA - Arabidopsis thaliana  Figure 8 (continued) SEQ ID NO: 12, protein - Arabidopsis thaliana SEQ ID NO: 13, DNA - Arabidopsis thaliana SEQ ID NO: 14, protein - Arabidopsis thaliana SEQ ID NO: 15, DNA - Arabidopsis thaliana  Figure 8 (continued) SEQ ID NO: 16, protein - Arabidopsis thaliana SEQ ID NO: 17, DNA - Arabidopsis thaliana  Figure 8 (continued) SEQ ID NO: 18, protein - Arabidopsis thaliana SEQ ID NO: 19, DNA - Arabidopsis thaliana SEQ ID NO: 20, protein - Arabidopsis thaliana  Figure 8 (continued) SEQ ID NO: 21, DNA - Arabidopsis thaliana SEQ ID NO: 22, protein - Arabidopsis thaliana SEQ ID NO: 23, DNA - Arabidopsis thaliana  Figure 8 (continued) SEQ ID NO: 24, protein - Arabidopsis thaliana SEQ ID NO: 25, DNA - Arabidopsis thaliana SEQ ID NO: 26, protein - Arabidopsis thaliana  Figure 8 (continued) SEQ ID NO: 27, DNA - Arabidopsis thaliana SEQ ID NO: 28, protein - Arabidopsis thaliana SEQ ID NO: 29, DNA - Populus trichocarpa  Figure 8 (continued) SEQ ID NO: 30, protein - Populus trichocarpa SEQ ID NO: 31, DNA - Populus trichocarpa SEQ ID NO: 32, protein - Populus trichocarpa SEQ ID NO: 33, DNA - Populus trichocarpa  Figure 8 (continued) SEQ ID NO: 34, protein - Populus trichocarpa SEQ ID NO: 35, DNA - Populus trichocarpa  Figure 8 (continued) SEQ ID NO: 36, protein - Populus trichocarpa SEQ ID NO: 37, DNA - Populus trichocarpa SEQ ID NO: 38, protein - Populus trichocarpa SEQ ID NO: 39, DNA - Populus trichocarpa  Figure 8 (continued) SEQ ID NO: 40, protein - Populus trichocarpa SEQ ID NO: 41, DNA - Populus trichocarpa SEQ ID NO: 42, protein - Populus trichocarpa SEQ ID NO: 43, DNA - Populus trichocarpa SEQ ID NO: 44, protein - Populus trichocarpa SEQ ID NO: 45, DNA - Oryza sativa  Figure 8 (continued) SEQ ID NO: 46, protein –Oryza sativa SEQ ID NO: 47, DNA - Oryza sativa SEQ ID NO: 48, protein –Oryza sativa SEQ ID NO: 49, DNA - Oryza sativa SEQ ID NO: 50, protein –Oryza sativa SEQ ID NO: 51, DNA - Oryza sativa SEQ ID NO: 52, protein –Oryza sativa SEQ ID NO: 53, DNA - Oryza sativa  Figure 8 (continued) SEQ ID NO: 54, protein –Oryza sativa SEQ ID NO: 55, DNA - Oryza sativa  Figure 8 (continued) SEQ ID NO: 56, protein –Oryza sativa SEQ ID NO: 57, DNA - Oryza sativa SEQ ID NO: 58, protein –Oryza sativa SEQ ID NO: 59, DNA - Oryza sativa  Figure 8 (continued) SEQ ID NO: 61, DNA - Aquilegia spp. SEQ ID NO: 62, protein - Aquilegia spp.  Figure 8 (continued) SEQ ID NO: 64, protein - Aquilegia spp. SEQ ID NO: 65, DNA - Brassica campestris SEQ ID NO: 66, protein - Brassica campestris  Figure 8 (continued) SEQ ID NO: 67, DNA - Brassica rapa SEQ ID NO: 68, protein - Brassica rapa SEQ ID NO: 69, DNA - Gossypium hirsutum  Figure 8 (continued) SEQ ID NO: 70, protein –Gossypium hirsutum SEQ ID NO: 71, DNA - Bordeum vulgare SEQ ID NO: 72, protein - Bordeum vulgare  Figure 8 (continued) SEQ ID NO: 73, DNA - Medicago truncatula SEQ ID NO: 74, protein –Medicago truncatula SEQ ID NO: 75, DNA - Medicago truncatula  Figure 8 (continued) SEQ ID NO: 76, protein –Medicago truncatula SEQ ID NO: 77, DNA - Nicotiana benthamiana  Figure 8 (continued) SEQ ID NO: 78, protein - Nicotiana benthamiana SEQ ID NO: 79, DNA - Nicotiana tabacum SEQ ID NO: 80, protein - Nicotiana tabacum SEQ ID NO: 81, DNA - Nicotiana tabacum SEQ ID NO: 82, protein - Nicotiana tabacum SEQ ID NO: 83, DNA - Sorghum bicolor  Figure 8 (continued) SEQ ID NO: 84, protein - Sorghum bicolor SEQ ID NO: 85, DNA - Solanum tuberosum SEQ ID NO: 86, protein - Solanum tuberosum SEQ ID NO: 87, DNA - Triticum aestivum SEQ ID NO: 88, protein - Triticum aestivum SEQ ID NO: 89, DNA - Zea mays  Figure 8 (continued) SEQ ID NO: 90, protein - Zea mays SEQ ID NO: 91, DNA - Zea mays SEQ ID NO: 92, protein - Zea mays SEQ ID NO: 93, domain of Trehalosa Ppasa consensus  Figure 8 (continued) SEQ ID NO: 94, domain of Trehalosa Ppasa in SEQ ID NO: 2 SEQ ID NO: 95, serine rich domain SEQ ID NO: 96, Phosphatase B box SEQ ID NO: 97, Phosphatase A box SEQ ID NO: 98, DNA - Oryza sativa - GOS2 promoter SEQ ID NO: 99, primer prm05451 SEQ ID NO: 100, primer prm05452 SEQ ID NO: 101, prmAtTPPA-5 primer SEQ ID NO: 102, prmAtTPPA-3 primer SEQ ID NO: 103, prmAtTPPB-5 primer SEQ ID NO: 104, prmAtTPPB-3 primer SEQ ID NO: 105, prmAtTPPC-5 primer SEQ ID NO: 106, prmAtTPPC-3 primer SEQ ID NO: 107, prmAtTPPD-5 primer SEQ ID NO: 108, prmAtTPPD-5 primer SEQ ID NO: 109, prmAtTPPE-5 primer SEQ ID NO: 110, prmAtTPPE-3 primer SEQ ID NO: 111, prmAtTPPF-5 primer SEQ ID NO: 112, prmAtTPPF-3 primer SEQ ID NO: 113, prmAtTPPG-5 primer SEQ ID NO: 114, prmAtTPPG-3 primer  Figure 8 (continued) SEQ ID NO: 115, prmAtTPPH-5 primer SEQ ID NO: 116, prmAtTPPH-3 primer SEQ ID NO: 117, prmAtTPPI-5 primer SEQ ID NO: 118, prmAtTPPI-3 primer SEQ ID NO: 119, prmAtTPPJ-5 primer SEQ ID NO: 120, prmAtTPPJ-3 primer SEQ ID NO: 121, DNA - Glycine max SEQ ID NO: 122, protein –Glycine max SEQ ID NO .: 123, DNA - Glycine max SEQ ID NO: 124, protein –Glycine max SEQ ID NO: 125, DNA - Glycine max  Figure 8 (continued) SEQ ID NO: 126, protein –Glycine max SEQ ID NO: 127, DNA - Brassica napus  Figure 8 (continued) SEQ ID NO: 128, protein - Brassica napus SEQ ID NO: 129, DNA - Brassica napus SEQ ID NO: 130, protein - Brassica napus SEQ ID NO: 131, HMG promoter of Oryza sativa  Figure 8 (continued) Figure 8 (continued)