CN101061228A - Isopentenyl transferase sequences and methods of use - Google Patents

Isopentenyl transferase sequences and methods of use Download PDF

Info

Publication number
CN101061228A
CN101061228A CNA2005800393688A CN200580039368A CN101061228A CN 101061228 A CN101061228 A CN 101061228A CN A2005800393688 A CNA2005800393688 A CN A2005800393688A CN 200580039368 A CN200580039368 A CN 200580039368A CN 101061228 A CN101061228 A CN 101061228A
Authority
CN
China
Prior art keywords
plant
sequence
polynucleotide
ipt
promotor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA2005800393688A
Other languages
Chinese (zh)
Other versions
CN101061228B (en
Inventor
N·布鲁吉耶
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pioneer Hi Bred International Inc
Original Assignee
Pioneer Hi Bred International Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Hi Bred International Inc filed Critical Pioneer Hi Bred International Inc
Priority claimed from PCT/US2005/033693 external-priority patent/WO2006034286A2/en
Publication of CN101061228A publication Critical patent/CN101061228A/en
Application granted granted Critical
Publication of CN101061228B publication Critical patent/CN101061228B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Methods and compositions for modulating plant development are provided. Polynucleotide sequences and amino acid sequences encoding isopentenyl transferase (IPT) polypeptides are provided. The sequences can be used in a variety of methods including modulating root development, modulating floral development, modulating leaf and/or shoot development, modulating senescence, modulating seed size and/or weight, and modulating tolerance of plants to abiotic stress. Polynucleotides comprising an IPT promoter are also provided. The promoter can be used to regulate expression of a sequence of interest. Transformed plants, plant cell, tissues, and seed are also provided.

Description

Isopentenyl transferase sequences and using method thereof
Technical field
The present invention relates to the plant gene operation, particularly the regulatory gene activity is to influence the field of development of plants and growth.
Background of invention
Phytokinin is a class N 6The alternate purine plant hormone of deriving, adjustable cell fission and influence multiple growth incident, the for example growth of branch (shoot), storehouse are strong, control, the growth of leaf of the branch of root, branch apical dominance, chloroplast(id) is grown and (Mok et al. (1994) Cytokinins.Chemistry such as leaf senile, Action and Function.CRC Press, Boca Raton, FLA, pp.155-166; Horgan (1984) Advanced PlantPhysiology ed.MB., Pitman, London, UK, pp53-75; And Letham (1994) Annual Review of Plant Physiol 34:163-197).In corn, phytokinin (CK) has vital role (Cheikh et al. (1994) Plant Physiol.106:45-51 to aspects such as definite seed size, the abortion that reduces top grain and the sets of increase seed under the hostile environment condition; Dietrich et al. (1995) Plant Physiol Biochem33:327-36).Active cells mitogen pond (pool) is by the speed regulation and control of synthetic and degraded.
Up to date, people think that root is the main position of biosynthesizing phytokinin, but also evidence suggests other tissue, and for example the meristematic tissue of branch and developmental seed also have high phytokinin biosynthesizing activity.This shows that phytokinin is at the active qualification position synthetic of cell proliferation.Several AtIPT genes that exist in Arabidopsis and different expression patterns thereof may be relevant with realization this purpose.
Katalaze enzyme prenyltransferase (IPT) instructs the synthetic of phytokinin, and phytokinin has vital role aspect horizontal in the regulation and control plant tissue.The biosynthetic a plurality of approach of phytokinin have been proposed at present.Because some tRNA molecule contains isopentenyl adenosine (iPA) residue in contiguous anticodon site, so the degraded of transfer RNA may be the source (Swaminathan et al. (1977) Biochemistry 16:1355-1360) of phytokinin.Modification is by tRNA pentenyl transferring enzyme (tRNA IPT; EC 2.5.1.8) catalytic, this enzyme is identified (Bartz et al. (1972) Biochemie 54:31-39 in such as intestinal bacteria, yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), Lactobacterium acidophilum (Lactobacillus acidophilus), people (Homo sapiens) and corn multiple biologies such as (Zeamays); Kline et al. (1969) Biochemistry 8:4361-4371; Holtz et al. (1975) Hoppe-Seyler ' s Z.Physiol.Chem 356:1459-1464; Golovko et al. (2000) Gene 258:85-93; Holtz et al. (1979) Hoppe-Seyler ' s Z.Physiol.Chem359:89-101).But do not think that this approach is phytokinin synthetic main path (Chenet al. (1997) Physiol.Plant 101:665-673 McGraw et al. (1995) PlantHormones, Physiology, Biochemistry and Molecular Biology.Ed.Davies, 98-117, Kluwer Academic Publishers, Dordrecht).
Another that forms phytokinin may approach be to be that substrate passes through adenylic acid (AMP) prenyltransferase (IPT with dimethyl-allyl bisphosphate (DMAPP), AMP, ATP and ADP; EC 2.5.1.27) biosynthesizing iPMP from the beginning.We mainly are to obtain by possible homologous system in the Agrobacterium tumefaciems (Agrobacteriumtumefaciens) is studied reasoning at present about the biosynthetic knowledge of phytokinin in the plant.The Agrobacterium tumefaciems cell can infect specific floristics (VanMontagu et al. (1982) Curr Top Microbiol Immunol 96:237-254 by induce tumorigenesis in the host plant tissue; Hansen et al. (1999) .Curr Top Microbiol Immunol 240:21-57).In order to achieve this end, the synthetic justacrine mediation of Agrobacterium tumefaciems cell normal host plant tissue is converted into the phytokinin of knurl or callus (calli).The Agrobacterium tumefaciems knurl of gene that can be by containing necessary enzyme of Codocyte mitogen biosynthesizing and modulator induces plasmid to promote this process.Biochemical and genetics research shows that knurl induces gene 4 sequences encoding isopentenyl transferase (IPT) of plasmid, AMP and DMAPP can be changed into activity form---the isopentenyl adenosine-5 '-single phosphoric acid (iPMP) (Akiyoshi et al. (1984) Proc.Natl.Acad.Sci USA 81:5994-5998) of phytokinin.Shown that the overexpression of edaphic bacillus ipt gene in various transgenic plant can cause in host plant that the phytokinin level increases, and caused typical phytokinin and reply (Hansen et al. (1999) Curr Top MicrobiolImmunol 240:21-57).Therefore infer vegetable cell and use the phytokinin biosynthesizing mechanism similar to Agrobacterium tumefaciems.In Arabidopis thaliana and petunia, found Arabidopis thaliana IPT homologue (Takei et al. (2001) J.Biol.Chem.276:26405-26410 andKakimoto (2001) Plant Cell Physiol.42:677-685) recently.The overexpression of Arabidopis thaliana IPT homologue in plant improved the level of phytokinin, replys (Kakimoto (2001) Plant CellPhysiol.42:677-685) in caused typical phytokinin under the conditions of tissue culture in plant.
The member of the little multigene family that Arabidopis thaliana ipt gene is made up of 9 different genes, two coding tRNA prenyltransferases in this family, 7 codings have the gene product of phytokinin biological synthetic functional.The proteic biochemical analysis of reorganization AtIPT4 shows that opposite with the enzyme of bacterium, it is substrate that the enzyme of Arabidopis thaliana replaces AMP with ATP.Use the activation tagging strategy in Petunia hybrida, to identify another plant IPT gene (Sho) (Zubko etal. (2002) The Plant Journal 29:797-808).
Because phytokinin influence comprises various plants growth courses such as the growth, seed set of root formation, branch and leaf, can be in higher plant cell regulating cell mitogen level, thereby influence plant-growth and productivity strongly, important commercial value (Mok et al. (1994) Cytokinins.Chemistry is provided, Action and Function.CRC Press, BocaRaton, FLA, pp.155-166).
The concise and to the point description of invention
The compositions and methods of the invention comprise and use prenyltransferase (IPT) polypeptide and the polynucleotide of participation regulating development of plants, form and physiological process.
Composition further comprises expression cassette, plant, vegetable cell and the seed with IPT sequence of the present invention.With comparing with plant, vegetable cell or seed of modifying without the present invention, plant of the present invention, vegetable cell and seed can have phenotypic alternation, (increase or reduce) the phytokinin level that for example is conditioned; The growth of the flower that is conditioned; The growth of the root that is conditioned; The branch that changes and the ratio of root; The seed size that increases or the seed weight of increase; The plant biomass or the plant vigor that increase; Keep or improve stress-tolerance (for example, increase or keep the plant size, reduce top grain abortion, increase or keep the seed set); Reduce the growth of branch (shoot); Delay senility or the relevant variation of enhancing plant-growth.
Composition of the present invention also comprises the IPT promotor, contains the DNA construct of the IPT promotor that can be operatively connected with the purpose nucleotide sequence, the expression vector that contains these DNA construct, plant, vegetable cell and seed.
The method that reduces or remove IPT polypeptide active in the plant is provided, has comprised that the polynucleotide with screening import in the plant.In specific method, the polynucleotide that provide reduce the phytokinin level in the plant and/or regulate and control the growth of roots of plants.
Also be provided at the method that increases IPT polypeptide level in the plant, comprise that the polyn with screening imports in the plant.In specific method, the expression of IPT polynucleotide increases the level of phytokinin in the plant; Keep or improve the stress-tolerance of plant; Keep or increase the plant size; Reduce seeds abortion; Increase or keep the seed set; Increase the growth of branch; Increase seed volume or grain weight; Increase plant biomass or vigor; The growth of regulation and control flower; The growth of delay senility or increase leaf.
The method that also provides regulation and control purpose nucleotide sequence to express.This method comprises in plant to import and contains the DNA construct that can operate the allos purpose nucleotide sequence that links to each other with IPT promotor of the present invention.
Accompanying drawing is briefly described
Fig. 1 is the sequence alignment of the phytokinin biosynthetic enzyme of corn, petunia and Arabidopis thaliana.Aminoacid sequence in the comparison comprises ZmIPT1 (SEQ ID NO:23), ZmIPT2 (SEQ ID NO:2), ZmIPT4 (SEQ ID NO:6), ZmIPT5 (SEQ IDNO:9), ZmIPT6 (SEQ ID NO:12), ZmIPT7 (SEQ ID NO:15), ZmIPT8 (SEQ ID NO:18), AtIPT1 (SEQ ID NO:29), AtIPT3 (SEQID NO:34), AtIPT4 (SEQ ID NO:30), AtIPT5 (SEQ ID NO:35), AtIPT6 (SEQ ID NO:36), AtIPT7 (SEQ ID NO:37), AtIPT8 (SEQID NO:38) and Sho (SEQ ID NO:31).Asterisk is illustrated in a plurality of IPT albumen conservative amino acid, and underscore amino acid is represented the ATP/GTP binding site of inferring.
Fig. 2 is the structural representation of the ZmIPT1 gene (SEQ ID NO:21) from Mo17.The coding region is represented by thick arrow, and the TATA box that marks CAAT and infer.
Fig. 3 is the aminoacid sequence comparison of ZmIPT1 (SEQ ID NO:23 is expressed as ZmIPT-Mo17) and ZmIPT1 variant (SEQ ID NO:27 is expressed as ZmIPT-B73).Sequence has 98% amino acid sequence identity.Found the sequence same at SEQ ID NO:39 with the ZmIPT1 polypeptide.
Fig. 4 is the ppm value of different pollination back fates (DAP) ZmIPT1 in Lynx embryo library.
Shown in Fig. 5 A is to utilize RT-PCR to detect ZmIPT1 in different corn organs.
Shown in Fig. 5 B is to utilize RT-PCR to detect ZmIPT1 in the grain of growing.
Shown in Figure 6 is B73 or the genomic Southern trace of Mo17 that digests by 3 kinds of different restriction enzymes.Digest 40 μ g genomic dnas, electrophoresis in 0.8% sepharose is transferred on the nylon membrane then.With the ZmIPT2-B73 gene coded sequence is probe.
That shown in Figure 7 is the Northern trace and the relative expression of different pollination back fates (DAP) ZmIPT2 gene in different plant organs and whole grain.In leaf (L), stem (S), root (R) and whole grain, measured transcriptional level on the 0th, 5,10,15,20 and 25 day, and carry out quantitatively with respect to the abundance of cyclophilin transcripton in the pollination back.
That shown in Figure 8 is the different pollination back Northern traces of fate in grain and the relative expression of ZmIPT2 gene.0 to 5-DAP whole grain and 6 to 34-DAP is measured transcriptional level to impedicellate grain, and carry out quantitatively with respect to the abundance of cyclophilin transcripton.Ribosylzeatin level in same sample (the abundantest CK in the corn grain) has been measured in advance, represents (Brugiere et al. (2003) Plant Phsyiol132:1228-1240) with solid line.
Fig. 9 is the ppm value of ZmIPT2 in Lynx embryo library.
Figure 10 is the comparison of the aminoacid sequence of the IPT albumen (OsIPT) of inferring corresponding to Arabidopis thaliana IPT albumen (AtIPT), petunia IPT albumen (Sho) and paddy rice.Sequence in the comparison is as follows: OsIPT6 (SEQ ID NO:57); OsIPT8 (SEQ ID NO:41); OsIPT10 (SEQ ID NO:59); OsIPT11 (SEQ ID NO:43); OsIPT9 (SEQ ID NO:61); OsIPT3 (SEQ ID NO:63); OsIPT2 (SEQ IDNO:46); OsIPT1 (SEQ ID NO:49); OsIPT5 (SEQ ID NO:52); OsIPT4 (34394150) (SEQ ID NO:66); OsIPT7 (SEQ ID NO:54); AtIPT1 (AB062607) (SEQ ID NO:29); AtIPT3 (AB062610) (SEQID NO:34); AtIPT4 (AB062611) (SEQ ID NO:30); AtIPT5 (AB062608) (SEQ ID NO:35); AtIPT6 (AB062612) (SEQ IDNO:36); AtIPT7 (AB062613) (SEQ ID NO:37); AtIPT8 (AB062614) (SEQ ID NO:38); Sho (Petunia) (SEQ ID NO:31) and consensus sequence (SEQ ID NO:67).
Figure 11 be after the different pollination of performance fate at the Northern trace of grain different piece ZmIPT2 gene relative expression quantity.Measure the transcriptional level of 0 to the 25-DAP grain that splits more, and carry out quantitatively with respect to the abundance of 18S rna transcription.
Shown in Figure 12 is the active chromatogram of DMAPP::AMP prenyltransferase of edaphic bacillus and corn purification of recombinant proteins.
Chromatogram after the reaction product that shown in Figure 13 is among Figure 12 is further handled.
Shown in Figure 14 is the active chromatogram of DMAPP::ATP prenyltransferase of corn purification of recombinant proteins.
Figure 15 is the Western trace of whole corn grain at difference pollination back fate.
Figure 16 is TUSC result's a presentation graphs.
Figure 17 is the genealogical tree of plant IPT sequence.
The detailed description of invention
Hereinafter with reference to accompanying drawing the present invention is made a more detailed description, wherein showed a part of the present invention rather than whole technical scheme. In fact, these inventions can many multi-form statements, should not be construed the restriction that is subject to the listed technical scheme of this paper; These technical schemes are provided, and are in order to make the present invention satisfy the requirement of the law that is suitable for. The identical element of identical numeral in the text.
Listed of the present invention multiple modification herein and other technical scheme prompting those skilled in the art: it is relevant that the present invention enjoys the interests of instruction shown in above-mentioned explanation and the relevant drawings. Therefore, should be appreciated that the present invention is not limited by specific technical scheme, revises with other technical scheme being also included within the scope of additional claim. Although this paper has used particular term, only get its general, descriptive connotation, rather than in order to limit.
Composition
Composition of the present invention comprises prenyltransferase (IPT) polypeptide and the polynucleotides that participate in regulating development of plants, physiology and morphology process. But composition of the present invention further comprises the IPT promoter of regulatory transcription. Especially, the invention provides the polynucleotides of the nucleotide sequence that comprises the amino acid sequence shown in the coding SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 and 77 of separation. Further provide to have polynucleotides shown in this article, for example sequence number is the polypeptide of the separation of SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,47,50,53,55,58,60,62,64,45,48,51,56,65,69,70,71,72,73,74 or 77 coded amino acid sequences. Other composition comprises that sequence number is the IPT promoter sequence of SEQ ID NO:25 or 75, and this paper further provides from 5 ' and distinguished from and the promoter sequence of ZmIPT4 (SEQ ID NO:5), the ZmIPT5 (SEQ ID NO:8), ZmIPT6 (SEQ ID NO:11), ZmIPT7 (SEQ ID NO:14), ZmIPT8 (SEQ ID NO:17), ZmIPT9 (SEQ ID NO:20), OsIPT1 (SEQ ID NO:47), OsIPT2 (SEQ ID NO:44), OsIPT3 (SEQ ID NO:62), OsIPT4 (SEQ ID NO:64), OsIPT5 (SEQ ID NO:50), OsIPT6 (SEQ ID NO:55), OsIPT7 (SEQ ID NO:53), OsIPT8 (SEQ ID NO:40), OsIPT9 (SEQ ID NO:60), OsIPT10 (SEQ ID NO:58) and the OsIPT11 (SEQ ID NO:42) that identify.
Prenyltransferase polypeptide of the present invention and prenyltransferase protein family member have sequence homogeneity. In various bacteria and arabidopsis and petunia, identified the polypeptide in the IPT family. For example, referring to (Kakimoto (2001) Plant Cell Physio.42:677-658); Takei et al. (2001) The Journal of Biological Chemistry 276:26405-26410 and Zubko et al. (2002) The Plant Journal 29:797-808). The IPT family member is characterised in that to have consensus sequence GxTxxGK[ST] xxxxx[VLI] xxxxxxx[VLI] [VLI] xxDxxQx{57,60}[VLI] [VLI] xGG[ST] (SEQ ID NO:32) (wherein x represents arbitrary amino acid residue, [] expression can be any one amino acid that shows in [], x{m, n} represent to have m to n number purpose amino acid). Referring to Kakimoto et al. (2001) Plant Cell Physiol.42:677-85 and Kakimoto et al. (2003) J.Plant Res.116:233-9; In all being incorporated herein as a reference. The IPT family member also has the ATP/GTP binding site. The amino acid sequence of corn IPT albumen and arabidopsis and petunia basic element of cell division biosynthetic enzyme is compared as shown in Figure 1, and the amino acid sequence of I in Rice PT albumen and arabidopsis and petunia biosynthetic enzyme is compared shown in Figure 10. Asterisk is illustrated in the consensus sequence of finding in the various kinds of cell mitogen biosynthetic enzyme. The ATP/GTP that underscore amino acid represents to infer is in conjunction with the territory.
Prenyltransferase participates in basic element of cell division biosynthesis, and therefore IPT polypeptide of the present invention has " basic element of cell division synthesizing activity ". " basic element of cell division synthesizing activity " refers to produce the enzymatic activity of the intermediate product in the basic element of cell division and derivative or any basic element of cell division route of synthesis. Therefore basic element of cell division synthesizing activity comprises, but be not limited to, DMAPP:AMP prenyltransferase active (changing AMP (5'-AMP) and DMAPP into iPMP (IPA-5 '-monophosphate)), DMAPP:ADP prenyltransferase active (changing ADP (ADP) and DMAPP into iPDP (IPA-5 '-diphosphonic acid)), DMAPP:ATP prenyltransferase active (changing ATP (ATP) and DMAPP into iPTP (IPA-5 ' triphosphoric acid)) and DMAPP:tRNA prenyltransferase activity (tRNAs in modification kytoplasm and/or the mitochondria obtains isopentene group). Basic element of cell division synthesizing activity can further comprise the substrate that contains secondary side chain precursor except DMAPP. The example of side chain donor comprises the compound that derives from terpene. For example, substrate can be methylol cyclobutenyl diphosphonic acid (HMBPP), and it can carry out the synthetic of trans ribosylzeatin monophosphate (ZMP). For example referring to _ stot et al. (2000) Proc Natl Acad Sci 97:14778-14783 and Takei et al. (2003) J Plant Res.116 (3): 265-9.
The phytokinin composite reactive further comprises and participates in the synthetic of intermediate product that ZMP forms.For example, at Takei et al. (2001) The Journal if Biological Chemistry276:26405-26410; Zubo et al. (2002) The Plant Journal 29:797-808; Among Kakimoto et al. (2001) Plant Cell Physio.42:677-658 and Sun et al. (2003) the Plant Physiology 131:167-176, can find the method for measuring various phytokinin and intermediate product generation thereof, during each document all is incorporated herein as a reference." phytokinin composite reactive " also comprises the phenotype variation that increases to feature in any plant or the vegetable cell with cytokinin concentration.Other place of this paper that acts on that this phytokinin is specific discusses, and comprises but is not defined in mutually: strengthen branch formation, reduce apical dominance, delay senility, late blooming, the growth of increase leaf, increase phytokinin level in the plant, increase stress-tolerance, reduce top grain abortion, under stress conditions, increase or keep the seed set and reduce the growth of root.The method of measuring or detect these phenotypes is known.For example referring to, Miyawakiet al. (2004) The Plant Journal 37:128-138, Takei et al. (2001) TheJournal of Biological Chemistry 276:26405-26410, Zubo et al. (2002) The Plant Journal 29:797-808; Kakimoto et al. (2001) Plant Cell Physio.42:677-658 and Sun et al. (2003) Plant Physiology 131:167-176, each document is all in being incorporated herein as a reference.This paper has also discussed other increases the phenotype that causes owing to phytokinin composite reactive in the plant.
Composition of the present invention comprises the biosynthetic IPT sequence of participation phytokinin.Especially, the invention provides the isolating polynucleotide that comprise the nucleotide sequence of the aminoacid sequence shown in the coding SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 and 77.Provide further that to have by for example sequence number shown in this article be SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,47,50,53,55,58,60,62,64,45,48,51,56,65,69,70,71,72,73 or 74 and the isolated polypeptide of the coded aminoacid sequence of the polynucleotide of fragment and variant.In addition, further providing for example sequence number is SEQ ID NO:25 or 75 and variant and segmental promoter sequence.
The present invention includes isolating or purified polynucleotides or protein composition basically.The polynucleotide of " separation " or " purifying " or albumen or its biologically-active moiety do not contain its natural component of following basically or in fact, perhaps do not contain and its interactional polynucleotide of institute or protein ingredient in natural surroundings.Therefore, when producing by recombinant technology, the polynucleotide of isolated or purified or albumen are to be substantially free of other cellular material or substratum; When by chemosynthesis, be substantially free of precursor or other compound.Preferably, the polynucleotide of " separation " be do not contain these polynucleotide from biological gene group DNA in the sequence (preferred albumen coded sequence) of the natural flank of polynucleotide (for example, being positioned at the Nucleotide of polynucleotide 5 ' and 3 ' end).For example, in the different technologies scheme, isolating polynucleotide comprise the nucleotide sequence of the natural flank of polynucleotide in the cell genomic dna that these polynucleotide of being less than about 5kb, 4kb, 3kb, 2kb, 1kb, 0.5kb or 0.1kb originate.Be substantially devoid of the protein of cellular material, comprise and contain the protein product that is less than 30%, 20%, 10%, 5% or 1% (dry weight) contaminating protein.When albumen of the present invention or its biologically-active moiety are reorganization when producing, preferably contain the precursor or the non-target protein compound that are less than about 30%, 20%, 10%, 5% or 1% (dry weight) in the substratum.
The polynucleotide of invention and the fragment and the variant of its proteins encoded are also included among the present invention." fragment " is meant a part or the aminoacid sequence and the coded proteic part thereof of polynucleotide.Thereby the polynucleotide passage codified keeps the protein fragments that the biological activity of native protein has the phytokinin composite reactive.Optionally, as do not encode the usually fragment albumen of retains biological activity of the polynucleotide passage of hybridization probe.Therefore, the scope of nucleotide sequence fragment is at least about 20 Nucleotide, about 50 Nucleotide, about 100 Nucleotide and invents proteic total length polynucleotide until code book.
The IPT polynucleotide passage coding at least 15 of the IPT protein biological activity part of the present invention of encoding, 25,30,50,100,150,200,225,250,275,300,310,315 or 320 successive amino acid, or the proteic whole amino acid of total length IPT of the present invention (SEQ ID NO:2 for example, 6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61, in 63 and 66 322,364,337,338,352,388,353,352,450,590,328,325,251,427,417,585,455,344 and 347 amino acid).IPT polynucleotide passage as hybridization probe or PCR primer does not need the proteic biologically-active moiety of IPT of encoding usually.
Therefore, the IPT polynucleotide passage proteic biologically-active moiety of IPT of can encoding maybe can be to use the fragment of following method as hybridization probe or PCR primer.The proteic biologically-active moiety of IPT can prepare (for example passing through in-vitro recombination expression) by separating among the present invention certain the IPT polynucleotide passage that can express the IPT protein part of its coding, and measures the activity of IPT encoding histone part.Polynucleotide as the IPT nucleotide sequence fragment comprise at least 16,20,50,75,100,150,200,250,300,350,400,450,500,550,600,650,700,800,900,950 or 965 successive Nucleotide, or until the Nucleotide number of total length IPT polynucleotide as herein described (SEQ ID NO:1 for example, 3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,47,50,53,55,58,60,62,64,45,48,51,56,65,69,70,71,72,73 and 74 1495,969,2901,2654,1095,4595,1014,1955,1017,1652,1059,3419,1167,1535,3000,1209,1062,1299,1056,4682,8463,4470,4114,2599,1284,5030,8306,7608,5075,4777,984,975,753,1254,1044,1035,1284,1353,1368,1758 and 1773 Nucleotide).
" variant " is meant substantially the same sequence.For polynucleotide, variant is to comprise disappearance in the one or more sites of natural polynucleotide and/or increase one or more Nucleotide and/or substituting of one or more Nucleotide arranged in one or more sites of natural polynucleotide." natural " polynucleotide used herein and polypeptide contain natural nucleotide sequence or aminoacid sequence respectively.For polynucleotide, conservative variant comprises those because the merger of genetic code and the sequence of certain IPT amino acid sequence of polypeptide in the code book invention.This natural variant can identify by known Protocols in Molecular Biology, for example polymerase chain reaction (PCR) and following hybridization technique.The variant polynucleotide also comprise the synthetic polynucleotide of deriving, for example by the site-directed mutagenesis preparation, the proteic sequence of certain IPT in the code book invention still.In general, the specific polynucleotide measured by sequence alignment program and parameter of other place of the variant of specific polynucleotide of the present invention and this paper have 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity at least.
The variant of the specific polynucleotide of the present invention (for example with reference to polynucleotide) can be assessed by the polypeptide of the polynucleotide encoding that relatively makes a variation and with reference to the per-cent sequence similarity between the polypeptide of polynucleotide encoding.Like this, for example, the isolating polynucleotide that coding and SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 polypeptide have certain percentage sequence identity have been described also.Can utilize other local described sequence alignment program of this paper and parameter to calculate per-cent sequence identity between any two polypeptide.For the polypeptide among given arbitrarily a pair of the present invention, when relatively the per-cent sequence identity of two polypeptide of its coding is assessed, the per-cent sequence identity between two coded polypeptides is at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity.
" variation " albumen is meant in the one or more sites of native protein by disappearance or increases one or more amino acid and/or in one or more sites of native protein one or more amino acid replacements are arranged and the albumen of deriving and from native protein.The specific variant protein that the present invention comprises is a biologically active, that is to say that they have the biological activity of desired native protein, phytokinin composite reactive promptly as herein described.This variant can obtain by for example genetic polymorphism or manual operation.The aminoacid sequence of proteic biological activity variant of natural IPT and native protein has 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity at least by other local described sequence alignment program of this paper and parametric measurement among the present invention.The proteic biological activity variant of the present invention can have 1-15 with albumen, 1-10---and for example 6-10,5,4,3,2 or even 1 amino-acid residue difference.
Albumen of the present invention can change by the number of ways in comprising amino acid replacement, disappearance, cut and being inserted in.These working method generally all are known in the art.For example, proteic aminoacid sequence variant of IPT and fragment can prepare by dna mutation.The method that sudden change and polynucleotide change is known in this area.Referring to, Kunkel (1985) Proc.Natl.Acad.Sci.USA 82:488-492 for example; Kunkel et al. (1987) Methods inEnzymol.154:367-382; United States Patent (USP) 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan PublishingCompany, New York), and the document of being quoted.Can be about the guidance that does not influence the bioactive suitable amino acid replacement of target protein referring to Dayhoff et al. (1978) Atlas ofProtein Sequence and Structure (Natl.Biomed.Res.Found., Washington, D.C.) model in is incorporated in the literary composition by reference herein.Conservative substitutes, and it is optimal for example having with another that ejusdem generis amino acid exchanges.
Like this, gene of the present invention and polynucleotide had both comprised that native sequences also comprised mutant form.Equally, albumen of the present invention comprises native protein and variant and modified forms.This variant still has the IPT activity of expection.Obviously, the sudden change in the DNA of coding variant can not make sequence be in and read outside the frame, and preferably, can not form the complementation district that can produce secondary mRNA structure.
Do not expect the included proteic disappearance of this paper, insertion and substitute and to produce radical change to property of protein.But, substitute in prediction in advance, disappearance or the accurate effect inserted more at need, those skilled in the art predicts these influences by the screening method of routine.That is, estimate its activity by measuring the phytokinin composite reactive.Referring to, Takei et al. (2001) The Journal of Biological Chemistry 276:26405-26410 for example; Zubo etal. (2002) The Plant Journal 29:797-808; Kakimoto et al. (2001) PlantCell Physio.42:677-658; Sun et al. (2003) Plant Physiology 131:167-176 and Miyawaki et al. (2004) The Plant Journal 37:128-138.All documents are incorporated in the literary composition by reference.
The polynucleotide of variation and albumen also comprise to derive from such as DNA reorganizes the such sudden change and the sequence and the albumen of recombinant technology.By this class technology, can operate one or more different IPT encoding sequences and obtain new IPT polypeptide with required character.Equally, can from the correlated series polynucleotide colony that contains the corresponding to sequence area of basic sequence, generate the recombination of polynucleotide library, and in external or body, carry out homologous recombination.For example, use this method, the sequential element in coding object construction territory can be recombinated between IPT gene of the present invention and other known IPT gene, thereby obtains the proteic new gene that coding has the improvement destination properties---for example increase the K of enzyme mThis DNA reorganization strategy is known in this area.Referring to, Stemmer (1994) Proc.Natl.Acad.Sci.USA 91:10747-10751 for example; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech.15:436-438; Moore et al. (1997) J.Mol.Biol.272:336-347; Zhang et al. (1997) Proc.Natl.Acad.Sci.USA 94:4504-4509; Crameri et al. (1998) Nature 391:288-291 and United States Patent (USP) 5,605,793 and 5,837,458.
Composition of the present invention also comprises the isolating polynucleotide that contain the IPT promotor nucleotide sequence of listing in SEQ ID NO:25 or 75, and further separated, to distinguish extremely as SEQ ID NO:5 (ZmIPT4) by 5 ', SEQ ID NO:8 (ZmIPT5), SEQ IDNO:11 (ZmIPT6), SEQ ID NO:14 (ZmIPT7), SEQ ID NO:17 (ZmIPT8), SEQ ID NO:20 (ZmIPT9), SEQ ID NO:47 (OsIPT1), SEQ ID NO:44 (OsIPT2), SEQ ID NO:62 (OsIPT3), SEQ ID NO:64 (OsIPT4), SEQ ID NO:50 (OsIPT5), SEQ ID NO:55 (OsIPT6), SEQ ID NO:53 (OsIPT7), SEQ ID NO:40 (OsIPT8), SEQ ID NO:60 (OsIPT9), the encoding sequence that a part provides of SEQ ID NO:58 (OsIPT10) and SEQ ID NO:42 (OsIPT11) be the promoter sequence of feature.
" promotor " is meant the control region of DNA, starts RNA synthetic TATA box but generally include the guide RNA polymerase II at the suitable transcription initiation site of specific polynucleotide sequence.Promotor can comprise other recognition sequence in addition, usually in TATA box upstream or 5 ', be called upstream promoter element, can influence transcription initiation speed.Promoter sequence of the present invention is adjustable, and (promptly suppressing or activation) transcribes.
Known extra structural domain rises in the promoter sequence of the present invention, thus the regulating and expressing level, the development time of expression or the types of organization that expression takes place.Especially, referring to Australian Patent AU-A-77751/94 and United States Patent (USP) 5,466,785 and 5,635,618.
The present invention also comprises the fragment and the variant of the IPT promotor polynucleotide of being invented.The fragment of promotor polynucleotide can keep biological activity, thereby has transcriptional regulatory activity.Optionally, as the polynucleotide passage of hybridization probe biologically active not.Therefore, the scope of promotor nucleotide sequence fragment can be from least about 20 Nucleotide, about 50 Nucleotide, about 100 Nucleotide polynucleotide of the present invention until total length.
Therefore, the biologically-active moiety of IPT promotor polynucleotide passage codified IPT promotor, or as the hybridization probe in the following stated method or the fragment of PCR primer.The biologically-active moiety of IPT promotor polynucleotide can obtain by a part of separating certain IPT promotor polynucleotide of the present invention and the activity of measuring IPT promotor part.Polynucleotide as the IPT promoter fragment comprise at least 16,20,50,75,100,150,200,250,300,350,400,450,500,550,600,650,700,800,900,1,000,1,050 or 1,080 continuous nucleotide, or the Nucleotide number of total length IPT promotor polynucleotide of the present invention (for example being respectively 1082 and 1920 Nucleotide among the SEQ ID NOS:25 and 75).
For the promotor polynucleotide, variant is included in natural polynucleotide one or more inner site disappearance and/or increases one or more Nucleotide and/or have one or more nucleotide substitutions in one or more sites of natural polynucleotide.Usually, the variant of specific promotor polynucleotide of the present invention is at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher with the sequence identity of the specific polynucleotide of measuring by other local described sequence alignment program of this paper and parameter.
The polynucleotide of variation also comprise and derive from the sequence that obtains such as the such sudden change of DNA reorganization and recombinant technology.By this technology, can operate one or more different promoter sequences, thereby acquisition has the IPT promotor of required character.The strategy of this DNA reorganization is described in other place of this paper.
Whether existing in the art mensuration promoter sequence still keeps the method for regulatory transcription ability.This activity can be measured by the Northern engram analysis.Referring to, Sambrooket al. (1989) Molecular Cloning:A Laboratory Manual (2d ed., ColdSpring Harbor Laboratory Press, Plainview, New York) for example in being incorporated herein as a reference herein.Optionally, the biological activity of promotor can be measured from the activity of the polypeptide of this promoter expression and/or the method for level by the mensuration of specially design.These measuring methods are known in this area.And, can in the promoter sequence of inferring, identify known promoter element.For example, IPT1 promotor of the present invention (SEQ ID NO:25) has the TATA box at the bp688 place.Can find the sequence (between bp 1035 and 1042) of similar TATA box at 48bp place, transcription initiation site upstream.Between bp 929 and 932, can find possible CAAT box.
Polynucleotide of the present invention (being IPT sequence and IPT promoter sequence) can be used for from other biology, particularly separate corresponding sequence in other plant, especially other monocotyledons.In this manner, can be by identifying these sequences based on the sequence homology of itself and the listed sequence of this paper such as PCR, hybridization and other method.The present invention includes based on the complete IPT sequence of listing with this paper or IPT promoter sequence or its variant and fragments sequence identity and isolating sequence.This sequence comprises and the lineal homologous sequence of invention sequence." lineal autoploid " is meant the gene that derives from common ancestor's gene, the result who forms as species and being present in the different kinds.The gene of finding in not of the same race has at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or during higher sequence identity when its nucleotide sequence and/or its coded protein sequence, then thinks lineal autoploid.The function of lineal autoploid high conservative normally between plant.Therefore, the present invention includes coding IPT albumen or contain the IPT promoter sequence, under stringent condition, can separate polynucleotide with IPT sequence as herein described or IPT promoter sequence or its variant or fragment or complementary sequence are hybridized
In PCR method, but the design oligonucleotides primer is used for PCR reaction, and corresponding DNA sequence increases cDNA that extracts from any target plant or the genomic dna.Design PCR primer and PCR clone's method is known in this area, can be referring to Sambrook et al. (1989) Molecular Cloning:A Laboratory Manual (2d ed., Cold SpringHarbor Laboratory Press, Plainview, New York).Also can be referring to Innis et al., eds. (1990) PCR Protocols:A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCRStrategies (Academic Press, New York) and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York).Known PCR method including but not limited to, use pairing primer, nested primer, single special primer, degenerate primer, gene specific primer, carrier special primer, the part methods such as primer that do not match.
In hybridization technique, all or part of known polynucleotide can be used as with other and are present in the cloned genes group dna fragmentation of selected biology or the probe of other the corresponding polynucleotide selective cross in the cDNA fragment (being genome or cDNA library).But hybridization probe genomic DNA fragment, cDNA fragment, RNA fragment or other oligonucleotide, available such as 32But the detection moiety mark that P or other detectable are such.Therefore, for example, can prepare hybridization probe by mark synthetic oligonucleotide based on IPT polynucleotide of the present invention or IPT promoter sequence.The method for preparing hybridization probe and construction cDNA and genomic library is known in this area, can be referring to Sambrook et al. (1989) Molecular Cloning:ALaboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).
For example, complete IPT polynucleotide as herein described or IPT promoter sequence or its one or more parts can be used as the probe with corresponding IPT polynucleotide, messenger RNA(mRNA) s or promoter sequence specific hybridization.In order to obtain specific hybridization under various conditions, these probes comprise the distinguished sequence in IPT polynucleotide sequence or the IPT promoter sequence, and preferably length is at least about 10 Nucleotide, and more preferably length is at least about 20 Nucleotide.This probe can be used for corresponding IPT polynucleotide of amplification or IPT promotor from selected plant by PCR.This technology can be used for separating other encoding sequence from the plant of needs, or measures the existence of encoding sequence in the plant as diagnostic method.Hybridization technique comprises that dull and stereotyped DNA library (perhaps is plaque or clone; Screening by hybridization referring to for example Sambrook et al. (1989) MolecularCloning:A Laboratory Manual (2d ed., Cold Spring Harbor LaboratoryPress, Plainview, New York).
The hybridization of these sequences is carried out under stringent condition." stringent condition " or " stringent hybridization condition " is meant that the probe and the hybridization of its target sequence are compared and the high a lot of condition (for example high 2 times than background at least) of other sequence.Stringent condition is that sequence relies on, and is also different in its condition of varying environment.By control hybridization severity and/or rinsing condition, can identify with probe be 100% complementary target sequence (homologous probe).Optionally, stringent condition is adjustable as permission and has some mispairing in sequence, thereby can detect the similarity (allos probe) than low degree.Usually, probe length is less than about 1000 Nucleotide, and preferably length is less than about 500 Nucleotide.
Typically, stringent condition is meant pH 7.0 to 8.3, temperature is to lacking probe (for example 10 to 50 Nucleotide) at least about 30 ℃, and to long probe (for example greater than 50 Nucleotide) during at least about 60 ℃, salt concn typically is 0.01 condition to 1.0M Na Na ion concentration (or other salt) less than 1.5M Na ion.Stringent condition also can be realized such as the such destabilizing agent of methane amide by adding.The low stringent condition of recommending comprises with hybridizing at 37 ℃ in the damping fluid that contains 30 to 35% methane amides, 1M NaCl, 1%SDS (sodium laurylsulfonate), and at 1X in the 2X SSC (20X SSC=3.0M NaCl/0.3M Trisodium Citrate), in 50 to 55 ℃ are carried out rinsing.The moderate stringent condition of recommending is included among 40 to 45% methane amides, 1M NaCl, the 1%SDS in 37 ℃ hybridizes, and at 0.5X in 1X SSC, in 55 to 60 ℃ are carried out rinsing.The height stringent condition of recommending is included among 50% methane amide, 1M NaCl, the 1%SDS in 37 ℃ hybridizes, and in 0.1X SSC, in 60 to 65 ℃ are carried out rinsing.In addition, the rinsing damping fluid can comprise about 0.1% to 1%SDS.Hybridization time generally is less than 24 hours, is generally about 4 to 12 hours.The length of rinsing time wants can be enough to reach balance at least.
Specificity mainly is the effect of post-hybridization washing, and its key factor is the ionic strength and the temperature of final rinsing solution.Concerning DNA-DNA the assorted and body, T mRoughly can calculate: T by the equation of Meinkothand Wahl (1984) Anal.Biochem.138:267-284 m=81.5 ℃+16.6 (%GC)-0.61, (log M)+0.41 (%form)-500/L; Wherein M is the mole number of univalent cation, and %GC counts the per-cent of guanine and cytosine(Cyt) among the DNA, and %form is the methane amide per-cent in the hybridization solution, and L is assorted and body base pair length.T mThe temperature of the probe hybridization that is meant 50% complementary target sequence and mates fully (under ionic strength of determining and pH).1% mispairing is whenever arranged, then T mReduce by 1 ℃ approximately; Therefore can regulate T m, hybridization and/or rinsing condition come to hybridize with the sequence of required identity.For example, if seek the sequence of 〉=90% identity, then can be with T mReduce by 10 ℃.Usually, under ionic strength of determining and pH, select the hot melting point (T of bit sequencing row and its complementary sequence m) low approximately 5 ℃ stringent condition.But, also can use specific heat melting point (T m) low 1,2,3 or 4 ℃ very strict condition hybridizes and/or rinsing; The moderate stringent condition is at specific heat melting point (T m) low 6,7,8,9 or 10 ℃ condition hybridizes and/or rinsing; Low stringent condition is at specific heat melting point (T m) low 11., 12,13,14,15 or 20 ℃ condition hybridizes and/or rinsing.By equation, hybridization and rinsing composition and required T m, it will be understood by those skilled in the art that the variation of the strict degree of also having described hybridization and/or rinsing condition.If required mispairing degree makes T mBe lower than 45 ℃ (aqueous solution) or 32 ℃ (formamide soln), then preferably increase SSC concentration can use higher temperature.The detailed guidance of nucleic acid hybridization is referring to Tijssen (1993) Laboratory Techniques in Biochemistry and MolecularBiology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York) and Ausubel et al., eds. (1995) Current Protocolsin Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York).Referring to Sambrook et al. (1989) MolecularCloning:A Laboratory Manual (2d ed., Cold Spring HarborLaboratory Press, Plainview, New York).
Following term is used to describe the relation between two or more polynucleotide or the polypeptide: (a) " reference sequences " (b) " comparison window " (c) " sequence identity " and (d) " sequence identity per-cent ".
(a) " reference sequences " used herein is meant the sequence of determining as the sequence comparison basis.Reference sequences can be part or all of distinguished sequence; For example as the part of full-length cDNA or gene order or complete cDNA or gene order.
(b) " comparison window " used herein is meant the continuous and special part of polynucleotide sequence, wherein the polynucleotide sequence in the comparison window is compared with reference sequences (not comprising increases or disappearance), can comprise to increase or lack (for example room) to compare two polynucleotide are carried out optimum.Usually, comparison window length is at least 20 continuous nucleotides, is preferably 30,40,50,100 or longer.It will be understood by those skilled in the art that to avoiding owing in polynucleotide sequence, contain and have vacant position and reference sequences has high similarity, should introduce gap penalty, and from matching number, deduct.
The comparison method that is used for the sequence of comparison is known in this area.Therefore, can measure per-cent sequence identity between any two sequences by mathematical algorithm.The non-limitative example of this mathematical algorithm has the algorithm of Myers and Miller (1988) CABIOS 4:11-17; The local alignment algorithm of Smith et al. (1981) Adv.Appl.Math.2:482; The overall comparison algorithm of Needleman and Wunsch (1970) J.Mol.Biol.48:443-453; Pearson and Lipman (1988) Proc.Natl.Acad.Sci.85:2444-2448 Local Search alignment algorithm; Karlin and Altschul (1990) Proc.Natl.Acad.SciUSA 872264 algorithms are revised by Karlin and Altschul (1993) Proc.Natl.Acad.Sci.USA 90:5873-5877.
Thereby these mathematical algorithm executive programs can compare sequence and measure sequence identity.This steering routine is including but not limited to the CLUSTAL in the PC/Gene program (can be from Intelligenetics, Mountain View, California acquisition); ALIGN program (version 2 .0) and GCG Wisconsin Genetics software package, GAP in the version 10, BESTFIT, BLAST, FASTA and TFASTA (can be from Accelrys Inc., 9685Scranton Road, San Diego, California, USA obtains).Compare by these programs and can use default parameter.The CLUSTAL program is at Higgins et al. (1988) Gene73:237-244 (1988); Higgins et al. (1989) CABIOS 5:151-153; Corpetet al. (1988) Nucleic Acids Res.16:10881-90; Carried out good description among Huang et al. (1992) CABIOS 8:155-65 and Pearson et al. (1994) Meth.Mol.Biol.24:307-331.The ALIGN program is based on the algorithm of above-mentioned Myers and Miller (1988).When with ALIGN program comparing amino acid sequence, can use PAM120 weighting residue table, room length point penalty be 12 and single gap penalty be 4.The blast program of Altschul et al (1990) J.Mol.Biol.215:403 is based on the algorithm of above-mentioned Karlin and Altschul (1990).The BLAST nucleotide search can be undertaken by the BLASTN program, mark=100, and word length=12, thus obtain to invent proteic nucleotide sequence homologous nucleotide sequence with code book.The search of BLAST albumen can be undertaken by the BLASTX program, mark=50, word length=3, thereby the aminoacid sequence of acquisition and albumen of the present invention or homologous peptide.For the comparison that obtains to have vacant position to compare, can use the described Gapped BLAST of Altschul et al. (1997) Nucleic Acids Res.25:3389 (in BLAST 2.0).Optionally, can use PSI-BLAST (BLAST 2.0) to carry out repeated searching with relation far away between detection molecules.Referring to above-mentioned Altschul et al. (1997).When using BLAST, GappedBLAST, PSI-BLAST, can use the default parameter of program (for example BLASTN is used for nucleotide sequence, and BLASTX is used for protein sequence) separately.Referring to Www.ncbi.nlm.nih.govAlso can compare by hand inspection.
Unless specifically stated otherwise, sequence identity/similarity provided herein is meant and uses GAP version 10 to obtain according to following parameter: for the % identity and the % similarity of nucleotide sequence, GAP is weighted to 50, and length is weighted to 3, uses the nwsgapdna.cmp matrix of keeping the score; For the % identity and the % similarity of aminoacid sequence, GAP is weighted to 8, and length is weighted to 2, uses the BLOSUM62 matrix of keeping the score; Or its program of equal value arbitrarily." equivalence program " be meant and anyly can produce the comparison with identical Nucleotide or amino-acid residue coupling to any two sequences of being studied, and the sequence comparison program that has identical per-cent sequence identity during with the corresponding comparison comparison that produced by GAP version 10.
GAP uses the algorithm of Needleman and Wunsch (1970) J.Mol.Biol.48:443-453 to seek the matching number maximum and the comparison of two complete sequences of room number minimum.GAP considers all possible comparison and null position, and obtains to have the comparison in maximum number of matched base and minimum room.It has considered that the room produces point penalty and point penalty is extended in the room in coupling base unit.GAP must make each insert room and to produce the point penalty number be favourable in the room of the coupling that obtains.In addition, if select the room to extend point penalty greater than 0, it is favourable that the room length that GAP must make each insert the room multiply by room extension point penalty.In GCGWisconsin Genetics software package version 10, default room produces the point penalty value and room extension point penalty value is respectively 8 and 2 to protein sequence.For nucleotide sequence, it is 50 that default room produces point penalty, and default room extension point penalty is 3.The room produces and point penalty is extended to be selected from 0 to 200 integer representation, choosing in the room.Therefore, for example the room produces and room extension point penalty can be 0,1,2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,55,60,65 or bigger.
GAP is a member in the best sequence alignment family.Have many members in this family, but do not have other member to have better quality.GAP demonstrates the advantage that has aspect four on sequence alignment: quality, ratio, identity and similarity.Maximum unit when quality is aligned sequences.Ratio is that quality is divided by shorter segmental base number.Per-cent identity is the per-cent of the symbol of actual match.The per-cent similarity is the per-cent of similarity sign.Can ignore with the corresponding symbol in room.When the matrix of keeping the score of pair of symbols during, similarity is kept the score more than or equal to similarity threshold value 0.50.The used matrix of keeping the score is BLOSUM62 (referring to Henikoff and Henikoff (1989) Proc.Natl.Acad.Sci.USA 89:10915) in GCG Wisconsin Genetics software package.
(c) herein " the sequence identity " or " identity " of two polynucleotide or peptide sequence be meant specific comparison window comparison obtain maximum to seasonable two sequences in identical residue.When sequence identity per-cent is finger protein, think that then inconsistent residue position is normally alternative and different by conserved amino acid, wherein amino-acid residue substitutes with the amino-acid residue that another has same nature (for example electric charge or hydrophobicity), thereby does not change the functional property of molecule.When sequence substitutes the place not simultaneously conservative, can adjust per-cent sequence identity and proofread and correct the conservative essence of these alternate.Be called as by this conservative alternative and different sequence and have " sequence similarity " or " similarity ".The method of carrying out this adjustment is known to those skilled in the art.Typically, comprise conservative substituting as part rather than complete mispairing kept the score, thereby improved per-cent sequence identity.Therefore, for example, keeping the score when same amino acid is 1, but not conservative alternative keeping the score is 0 o'clock, and then conservative substituting kept the score between 0 and 1.Conservative alternate is kept the score can (Intelligenetics, Mountain View California) calculates by PC/GENE program for example.
(d) " sequence identity per-cent " used herein is meant the value that obtains by the sequence in two optimum comparisons of comparison window comparison, wherein the polynucleotide sequence of comparison window part can comprise when comparing with reference sequences (not containing increases or disappearance) increases or disappearance (such as room), to optimize the comparison of two sequences.Per-cent is the number that obtains matched position by the number of the position of measuring identical nucleotide base in two sequences or amino-acid residue, with the number of comparison window total number of positions order divided by matched position, and the result be multiply by 100 calculate, thereby obtain sequence identity per-cent.
The present invention further provides the plant that contains level of the present invention and/or the active IPT polypeptide that changes.In some technical scheme, plant of the present invention with IPT sequence stable integration of the present invention in its genome.In other technical scheme, the plant that provides the locus at code book invention IPT polypeptide to carry out hereditary change." natural gene seat " is meant naturally occurring gene order.For some technical scheme, locus is listed in SEQ ID NO:21,40,42,44,47,50,53,55,58,60,62 or 64.Can change locus to reduce or to remove the activity of IPT polypeptide.Term used herein " hereditary change " is meant that the genetic information of plant or plant part changes by inserting one or more exogenous polynucleotide, and the insertion of exogenous polynucleotide can cause plant phenotype to change." phenotype variation " is meant that one or more cell functions are had detectable variation.For example, the plant that has a hereditary change at the locus of coding IPT polypeptide can reduce or remove IPT polypeptide expression or activity.Produce this hereditary change locus, and owing to the levels/activity change of IPT sequence of the present invention causes the several different methods of various phenotypes variations to be described in other place of this paper.
The present invention further provides and have the plant that at least one contains the DNA construct that required heterologous nucleotide sequence is connected with IPT promotor of the present invention.In further technical scheme, DNA construct stably is incorporated in the Plant Genome.
Term plant used herein comprises whole plants, plant part or organ (for example leaf, stem, root), vegetable cell and seed and offspring thereof.Vegetable cell used herein comprises but is not defined as, the cell that from seed, obtains, suspension culture, embryo, meristem zone, callus, leaf, root, branch, gametophyte, sporophyte, pollen and sporule and plant protoplast and plant cell tissue's culture, plant callus, vegetation bed, and plant and the complete vegetable cell of plant part---for example embryo, pollen, ovule, seed, leaf, flower, branch, fruit, grain, fringe, mealie, shell, handle, root, the tip of a root, flower pesticide, cereal (grain) etc." cereal " used herein is meant by commercialization cultivation purpose but not growth or breed the sophisticated seed that the purpose of these species produces.As long as contain the nucleotide sequence of introducing, then the filial generation of aftergrowth, variant and mutant are also included within the scope of the present invention.
Method
I., sequence is provided
Sequence of the present invention can be such as bacterium, yeast, insect, Mammals or be preferably introducing/expression in the such host cell of vegetable cell.Should recognize that those skilled in the art know the multiple system that polypeptide of the present invention or nucleotide sequence can be imported host cell.Therefore knownly in prokaryotic organism or eukaryote, do not provide proteic method to be described in detail to various.
" host cell " is meant the cell that contains heterologous nucleic acid sequence of the present invention.Host cell can be such as the such prokaryotic cell prokaryocyte of intestinal bacteria, or such as the such eukaryotic cell of yeast, insect, Amphibians or mammalian cell.Host cell also can be monocotyledons or dicotyledons cell.In certain aspects, the monocotyledons host cell is the corn host cell.
Used term " polynucleotide " does not limit the invention to the polynucleotide that contain DNA.Those skilled in the art will know that polynucleotide can comprise the combination of ribonucleotide and ribonucleotide and deoxyribonucleotide.This deoxyribonucleotide and ribonucleotide comprise natural molecule and synthetic analogues.Polynucleotide of the present invention also comprise all sequences form, including but not limited to, single stranded form, double chain form, hair clip, loop-stem structure etc.
IPT polynucleotide of the present invention or IPT promotor can provide in the expression cassette that target plant is expressed being used for.Expression cassette comprises 5 ' and the 3 ' regulating and controlling sequence that can be operatively connected with IPT polynucleotide of the present invention." can be operatively connected " function that is meant two or more elements connects.For example, being operatively connected between herbicide-tolerant polynucleotide and the regulating and controlling sequence (being promotor) is that a kind of function is connected, and herbicide-tolerant polynucleotide is expressed.The element that can be operatively connected can be continuous or discontinuous.When referring to the connection of two protein-coding regions, can be operatively connected and be meant that the coding region is in identical reading frame.Expression cassette can comprise at least one other gene cotransformation in addition in biology.Optionally, other gene can provide in a plurality of expression cassettes.Expression cassette can provide a plurality of restriction sites and/or recombination site, to insert the IPT polynucleotide, makes it be in the transcriptional control of control region.Expression cassette can contain selectable marker gene in addition.
In certain aspects, expression cassette is included in transcribing 5 '-3 ' direction, transcribing with translation initiation district (being promotor), IPT polynucleotide of the present invention and transcribe with the translation termination district (being the terminator) of working in the plant.Control region (being promotor, transcription regulatory region and translation termination district) and/or IPT polynucleotide of the present invention can be for host cell or can be each other natural/similarly.Optionally, control region and/or IPT polynucleotide of the present invention are for host cell or can be allogenic each other." allos " used herein is meant that its sequence derives from alien species, and perhaps, if from same species, then the component of natural form and/or locus by the artificial interference of having a mind to basic change have taken place.For example, come from the species that are different from the polynucleotide source with the promotor that is operatively connected of heterologous polynucleotide, perhaps, if from identical/similar species, then basic change has taken place in one of them or the two its original form and/or locus, and perhaps promotor is not the natural promoter that can be operatively connected polynucleotide.Mosaic gene used herein comprises the encoding sequence that can be operationally connected to the allogenic transcription initiation region of encoding sequence.
When allogeneic promoter can be used for expressing the IPT sequence, can use natural promoter sequence or other IPT promotor (for example SEQ ID NO:25 or 75).This construct can change the expression level of IPT sequence in plant or the vegetable cell.Therefore, can change the phenotype of plant or vegetable cell.
Can to be that transcription initiation region is natural carry in the terminator, can be natural the carrying of Target IP T polynucleotide that can be operatively connected, can be that plant host is natural carries, or derives from other source (for example with reference promotor external source or allos), Target IP T polynucleotide, plant host or its any combination.The terminator can obtain from the Ti-plasmid of Agrobacterium tumefaciems easily, for example octopine synthetic enzyme and rouge alkali synthetase terminator.Also referring to Guerineau et al. (1991) Mol.Gen.Genet.262:141-144; Proudfoot (1991) Cell64:671-674; Sanfacon et al. (1991) Genes Dev.5:141-149; Mogen etal. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene91:151-158; Ballas et al. (1989) Nucleic Acids Res.17:7891-7903 and Joshi et al. (1987) Nucleic Acids Res.15:9627-9639.
Under suitable situation, can in transforming plant, optimize polynucleotide and increase its expression.That is, the codon had a liking for partially of available plant comes synthetic polyribonucleotides to improve expression amount.Referring to, for example Campbell and Gowri (1990) Plant Physiol.92:1-11 has discussed the codon service condition that the host has a liking for partially.These methods can be had a liking for the gene field partially synthetic plant and obtain.Referring to, for example United States Patent (USP) 5,380, and 831 and 5,436,391, and Murray et al. (1989) NucleicAcids Res.17:477-498, in being incorporated herein as a reference herein.
But known in cell host other sequence change reinforcing gene expression.Comprise the false poly adenosine signal of disappearance coding, exon-intron shearing site signal, similar transposon repeat and other this class may be to the disadvantageous characteristic sequence of genetic expression.For given cell host, G-C content in the sequence can be adjusted to mean level (ML) by known expressing gene calculated in the reference host cell.Under may situation, can change sequence and avoid possible hair clip secondary mRNA structure.
Expression cassette can contain 5 ' boot section sequence in addition.This boot section sequence can strengthen translation.The translation boot section is known in this area, comprises the picornavirus boot section, for example EMCV boot section (encephalomyocarditis 5 ' non-coding region) (Elroy-Stein et al. (1989) Proc.Natl.Acad.Sci.USA 86:6126-6130); The marmor upsilon boot section, for example TEV boot section (tobacco etch virus) (Gallie et al. (1995) Gene 165 (2): 233-238), MDMV boot section (maize dwarf mosaic virus) (Virology 154:9-20), and human immunoglobulin heavy chain conjugated protein (BiP) (Macejak et al. (1991) Nature 353:90-94); Alfalfa mosaic virus glutelin mRNA untranslated boot section (AMV RNA 4) (Jobling etal. (1987) Nature 325:622-625); Tobacco mosaic virus (TMV) boot section (TMV) (Gallieet al. (1989) in Molecular Biology of RNA, and ed.Cech (Liss, NewYork), pp.237-256); And the sallow mottle virus of corn boot section (MCMV) (Lommelet al. (1991) Virology 81:382-385).Also referring to Della-Cioppa et al. (1987) Plant Physiol.84:965-968.Also can use the method for other known enhancing translation.
When the preparation expression cassette, can operate multiple dna fragmentation, thereby dna sequence dna in the right direction, that the reading frame is fit to is provided.In order to realize this point, can use adaptive son or connexon to connect dna fragmentation, or use other restriction site that can facilitate, remove false DNA, remove operations such as restriction site.Based on this purpose, can use external sudden change, primer reparation, restriction, annealing, substitute again---for example conversion and transversion.
Expression cassette can comprise that also the selected marker is with the screening transformant.The selected marker is used to screen transformant or tissue.Marker gene comprises the gene of the antibiotics resistance that coding such as neomycin phosphotransferase II (NEO) and hygromix phosphotransferase (HPT) are such, and to such as careless ammonium phosphine, bromoxynil, juvabione and 2, the 4-dichlorobenzene oxygen butyl acetate (2, the 4-D) gene of such herbicidal compounds performance resistance.Other selected marker comprises such as beta-galactosidase enzymes, fluorescin---green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell 16:215-28) for example, cyan fluorescent protein (CYP) (Bolte et al. (2004) J.Cell Science117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42), and yellow fluorescence protein (derives from the PhiYFP of Evrogen TM, referring to Bolte et al. (2004) J.Cell Science 117:943-54) and such phenotypic markers.To other selected marker, usually referring to Yarranton (1992) Curr.Opin.Biotech.3:506-511; Christophersonet al. (1992) Proc.Natl.Acad.Sci.USA 89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992) Mol.Microbiol.6:2419-2422; Barkley et al. (1980) in The Operon, pp.177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figgeet al. (1988) Cell 52:713-722; Deuschle et al. (1989) Proc.Natl.Acad.Aci.USA 86:5400-5404; Fuerst et al. (1989) Proc.Natl.Acad.Sci.USA86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph D dissertation, Ruprecht-Karls-Universitat Heidelberg; Reines et al. (1993) Proc.Natl.Acad.Sci.USA 90:1917-1921; Labow et al. (1990) Mol.Cell.Biol.10:3343-3356; Zambretti et al. (1992) Proc.Natl.Acad.Sci.USA89:3952-3956; Baim et al. (1991) Proc.Natl.Acad.Sci.USA88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res.19:4647-4653; Hillenand-Wissman (1989) Topics Mol.Struc.Biol.10:143-162; Degenkolb et al. (1991) Antimicrob.Agents Chemother.35:1591-1595; Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993) Ph D dissertation, Ruprecht-Karls-Universitat Heidelberg; Gossen et al. (1992) Proc.Natl.Acad.Sci.USA89:5547-5551; Oliva et al. (1992) Antimicrob.Agents Chemother.36:913-919; Hlavka et al. (1985) Handbook of ExperimentalPharmacology, and Vo1.78 (Springer-Verlag, Berlin); Gill et al. (1988) Nature 334:721-724.During these documents are incorporated herein as a reference.Selected marker listed above is restriction not.Can use any selected marker in the present invention.
In the present invention's operation, can use multiple promotor, comprise the natural promoter of herbicide-tolerant polynucleotide sequence.Can select promotor according to required result.Nucleic acid can be had a liking for type partially with composing type, induction type, tissue or other promotor combines, be used for plant and express.
This constitutive promoter comprises, for example the core promoter of the Rsyn7 promotor in WO 99/43838 and the United States Patent (USP) 6,072,050 and other constitutive promoter; Core CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812); Rice actin (McElroy et al. (1990) Plant Cell 2:163-171); Ubiquitin (Christensenet al. (1989) Plant Mol.Biol.12:619-632 and Christensen et al. (1992) Plant Mol.Biol.18:675-689); PEMU (Last et al. (1991) Theor.Appl.Genet.81:581-588); MAS (Velten et al. (1984) EMBO J.3:2723-2730); ALS promotor (United States Patent (USP) 5,659,026) etc.Other constitutive promoter comprises that for example United States Patent (USP) 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611.
But using-system is had a liking for type promotor enhanced IP T in the specified plant tissue partially and is expressed.Organize and have a liking for the type promotor partially and comprise J.12 (2): 255-265 of Yamamoto et al. (1997) Plant; Kawamata et al. (1997) Plant Cell Physiol.38 (7): 792-803; Hansenet al. (1997) Mol.Gen Genet.254 (3): 337-343; Russell et al. (1997) Transgenic Res.6 (2): 157-168; Rinehart et al. (1996) Plant Physiol.112 (3): 1331-1341; Van Camp et al. (1996) Plant Physiol.112 (2): 525-535; Canevascini et al. (1996) Plant Physiol.112 (2): 513-524; Yamamoto et al. (1994) Plant Cell.Pnysiol.35 (5): 773-778; Lam (1994) Results Probl.Cell.Differ.20:181-196; Orozco et al. (1993) Plant Mol Biol.23 (6): 1129-1138; Matsuoka etal. (1993) Proc Natl.Acad.Sci.USA 90 (20): 9586-9590 and Guevara-Garcia et al. (1993) Plant be (3): 495-505 J.4.If desired, can modify to weaken expression this promotor.Also can be referring to United States Patent (USP) 2003/0074698, in being incorporated herein as a reference herein.
It is as known in the art that leaf is had a liking for the type promotor partially.Referring to for example, Yamamoto et al. (1997) Plant is (2): 255-265 J.12; Kwon et al. (1994) Plant Physiol.105:357-67; Yamamoto et al. (1994) Plant Cell Pnysiol.35 (5): 773-778; Gotor et al. (1993) Plant J.3:509-18; Orozco et al. (1993) Plant Mol.Biol.23 (6): 1129-1138; Baszczynski et al. (1988) Nucl.Acid Res.16:4732; Mitra et al. (1994) Plant Molecular Biology26:35-93; Kayaya et al. (1995) Molecular and General Genetics248:668-674 and Matsuoka et al. (1993) Proc.Natl.Acad.Sci.USA 90 (20): 9586-9590.Also can use decay regulation and control type promotor, for example SAM22 (Crowellet al. (1992) Plant Mol.Biol.18:459-466).Referring to United States Patent (USP) 5,589,052, in being incorporated herein as a reference herein.
It is known that root is had a liking for the type promotor partially, can be selected from a plurality of existing documents, or from the beginning separates from multiple interchangeable species.Referring to, Hire et al. (1992) Plant Mol.Biol.20 (2): 207-218 (soybean Gent isoglutamic acid synthase gene) for example; Keller andBaumgartner (1991) Plant Cell 3 (10): 1051-1061 (the different controlling elementss of Gent of French beans GRP 1.8 genes); Sanger et al. (1990) Plant Mol.Biol.14 (3): 433-443 (Agrobacterium tumefaciems mannopine synthetic enzyme (MAS) gene root-specific promoter) and Miao et al. (1991) Plant Cell 3 (1): 11-22 (coding kytoplasm glycine synthetic enzyme (GS) full length cDNA clone can be expressed at soybean root and root nodule).Also, two have wherein been described from the non-beans Parasponia of fixed nitrogen andersonii and the isolating hemoglobin gene root-specific promoter of the non-beans Trematomentosa of relevant non-fixed nitrogen referring to Bogusz et al. (1990) Plant Cell 2 (7): 633-641.The promotor of these genes is connected with β-glucuronidase reporter gene and imports among non-beans Nicotiana tabacum and the beans Lotus corniculatus, and the two can keep the root-specific promoter activity.Leach andAoyagi (1991) has described the promotor of the rolC and the rolD root induction gene of high expression level among the Agrobacterium rhizogenes (referring to Plant Science (Limerick) 79 (1): 69-76).They think enhanser and organize that to have a liking for the type terminator dna partially be dissociated in these promotors.Teeri et al. (1989) uses with the lacZ gene fusion active especially at tip of a root epidermis with the T-DNA gene that shows coding octopine synthetic enzyme in the edaphic bacillus, and TR2 ' gene is that Gent is different in complete plant, and is stimulated by the wound of leaf texture; With sterilant or larvacide gene is that a kind of combination of useful feature of special needs is (referring to EMBO J.8 (2): 343-350).TR1 ' gene and nptII (neomycin phosphotransferase II) fusion shows similar feature.Other root is had a liking for the type promotor partially and is comprised VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant Mol.Biol.29 (4): 759-772); RolB promotor (Capana et al. (1994) Plant Mol.Biol.25 (4): 681-691 and CRWAQ81 root-specific promoter (U.S.PatentPublication 2005/0097633) with first intron of ADH.Referring to United States Patent (USP) 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732 and 5,023,179.
" seed is had a liking for type partially " promotor is meant promoters active when seed development, can be included in seed initial stage or the relevant maternal tissue to express.This seed is had a liking for the type promotor partially including but not limited to Cim1 (phytokinin is induced the courier); CZ19B1 (corn 19kDa zein); Milps (inositol-1-phosphate synthase) (referring to WO 00/11177 and United States Patent (USP) 6,225,529, in being incorporated herein as a reference herein).γ-zein is the promotor of endosperm specific.Sphaeroprotein-1 (Glob-1) is typical embryo specific promoter.To dicotyledons, the promotor of seed specific including but not limited to, soybean β-Kidney bean albumen, rapeseed protein, beta-conglycinin, soybean agglutinin, Cruciferae albumen etc.For monocotyledons, seed-specific expression promoter including but not limited to, corn 15kDa zein, 22kDa zein, 27kDa zein, γ-zein, waxy gene, shrunken 1, shrunken 2, sphaeroprotein 1 etc.Referring to WO 00/12733, wherein described from the seed of end1 and end2 and had a liking for the type promotor partially; In being incorporated herein as a reference herein.At Sato et al. (1996) Proc.Natl.Acad.Sci.93:8117-8122; Among Nakase et al. (1997) Plant J 12:235-46 and Postma-Haarsma et al. (1999) the Plant Mol.Biol.39:257-71 other embryo specific promoter has been described.At Albani et al. (1984) EMBO3:1405-15; Albani et al. (1999) Theor.Appl.Gen.98:1253-62; Albaniet al. (1993) Plant J.4:343-55; Among Mena et al. (1998) The Plant Journal116:53-62 and Wu et al. (1998) the Plant Cell Physiology 39:885-889 other endosperm specific promotor has been described.
For organizing and have active promotor in such meristematic tissue, and start expression promoter in bloom period or early stage grain growth period and merit attention equally such as growing inflorescence.This can comprise for example corn Zag promotor, comprises that Zag1 and Zag2 are (referring to Schmidt etal. (1993) The Plant Cell 5:729-37; GenBank X80206; Theissen et al. (1995) Gene 156:155-166 and U.S. Patent application 10/817,483); Corn Zap promotor (is also referred to as ZmMADS; U.S. Patent application 10/387,937; WO 03/078590); Corn ckx1-2 promotor (U.S. Patent application 2002-0152500 A1; WO02/0078438); Corn eep1 promotor (U.S. Patent application 10/817,483); Corn end2 promotor (United States Patent (USP) 6,528,704 and U.S. Patent application 10/310,191); Corn lec1 promotor (U.S. Patent application 09/718,754); Corn F3.7 promotor (Baszczynskiet al., Maydica 42:189-201 (1997)); Corn tb1 promotor (Hubbarda etal., Genetics 162:1927-1935 (2002) and Wang et al. (1999) Nature398:236-239); Corn eep2 promotor (U.S. Patent application 10/817,483); Corn Trx H promotor (U.S.'s pending application application 60/514,123); Corn Zm40 promotor (United States Patent (USP) 6,403,862 and WO 01/2178); Corn mLIP15 promotor (United States Patent (USP) 6,479,734); Corn ESR promotor (U.S. Patent application 10/786,679); Corn PCNA2 promotor (U.S. Patent application 10/388,359); Maize cell mitogen oxydase promotor (U.S. Patent application 11/094,917); At Weigal et al. (1992) Cell69:843-859; Accession number AJ131822; Accession number Z71981; The promotor of accession number AF049870 and the branch of describing in McAvoy et al. (2003) Acta Hort. (ISHS) 625:379-385 are had a liking for the type promotor partially.At Ito et al. (1994) Plant Mol.Biol.24:863-878; Regad et al. (1995) Mo.Gen.Genet.248:703-711; Shaulet al. (1996) Proc.Natl.Acad.Sci.93:4868-4872; Ito et al. (1997) Plant has J.11:983-992 described other cell fission that merits attention with Trehin et al. (1997) Plant Mol.Biol.35:667-672 or meristematic tissue is had a liking for the type promotor partially, during all documents all are incorporated herein as a reference.
Inflorescence is had a liking for type promotor bag chalcone synthetase promotor (Van der Meer et al. (1990) Plant Mol.Biol.15:95-109) partially, LAT52 (Twell et al. (1989) Mol.Gen.Genet.217:240-245), pollen-specific gene (Albani et al (1990) Plant Mol Biol.15:605, Zm13 (Buerrero et al. (1993) Mol.Gen.Genet.224:161-168), Pollen Maydis specific gene (Hamilton et al. (1992) Plant Mol.Biol.18:211-218), Pollen Helianthi expressing gene (Baltz et al. (1992) The PlantJournal 2:713-721), and Pollen Brassicae campestris specific gene (Arnoldo et al. (1992) J.Cell.Biochem, summary Y101204).
The stress-inducing promotor comprises salt/water stress-inducing promotor---P5CS (Zanget al. (1997) Plant Sciences 119:81-89) for example, cold induced promoter---cor15a (Haiela et al. (1990) Plant Physiol.93:1246-1252) for example, cor15b (Wlihelmet al. (1993) Plant Mol Biol 23:1073-1077), wsc120 (Ouellet et al. (1998) FEBS Lett.423-324-328), ci7 (Kirch et al. (1997) PlantMol Biol.33:897-909), ci21A (Schneider et al. (1997) Plant Physiol.113:335-45); Drying Induction promotor---Trg-31 (Chaudhary et al (1996) Plant Mol.Biol.30:1247-57) for example; Infiltration evoked promoter---for example Rab17 (Vilardell et al. (1991) Plant Mol.Biol.17:985-93) and permeate albumen (Raghothama et al. (1993) Plant Mol Biol 23:1117-28), and heat shock promoter---heat shock protein(HSP) (Barros et al. (1992) Plant Mol.19:665-75 for example; Marrs et al. (1993) Dev.Genet.14:27-41) and smHSP (Waters et al. (1996) J.Experimental Botany 47:325-338).Other stress-inducing promotor comprises rip2 (United States Patent (USP) 5,332,808 and U.S. Patent Publication 2003/0217393) and rd29a (Yamaguchi-Shinozaki et al. (1993) Mol.Gen.Genetics 236:331-340).
Also can use in the method for the present invention and coerce insensitive promotor.Such promotor and representative example will further describe in other place of this paper.
Also can use nitrogen to reply promotor in the method for the present invention.This promotor is including but not limited to 22kDa zein promotor (Spena et al. (1982) EMBO J 1:1589-1594 and Muller et al. (1995) J.Plant Physiol 145:606-613); 19kDa zein promotor (Pedersen et al. (1982) Cell 29:1019-1025); 14kDa zein promotor (Pedersen et al. (1986) J.Biol.Chem.261:6279-6284), b-32 promotor (Lohmer et al. (1991) EMBO J10:617-624) and nitrite reductase (NiR) promotor (Rastogi et al. (1997) Plant Mol Biol.34 (3): 465-76 and Sander et al. (1995) Plant Mol Biol.27 (1): 165-77).Summary to nitrogen evoked promoter consensus sequence can be referring to for example Mulleret al. (1997) The Plant Journal 12:281-291.
The chemical regulation promotor also can be regulated and control genetic expression in the plant by using external source chemical regulation.Based on this purpose, promotor can be chemical inducible promoter, by use chemical substance inducible gene expression, or Chemical Inhibition type promotor, by using the chemical substance inhibition of gene expression.Chemical inducible promoter is known in this area, including but not limited to can be by benzamide herbicide-safener activated corn In2-2 promotor, can be used as the hydrophobic electrophilic compound activated corn GST of the institute promotor of the weedicide that uses before being unearthed, and can be by Whitfield's ointment activated tobacco PR-1a promotor.The chemical regulation promotor that other merits attention comprise steroid reply promotor (referring to for example Schena et al. (1991) Proc.Natl.Acad.Sci.USA 88:10421-10425 and McNellis et al. (1998) Plant J.14 (2): the glucocorticoid inducible promotor among the 247-257) and tsiklomitsin induce with tsiklomitsin and suppress promotor (referring to for example Gatz et al. (1991) Mol.Gen.Genet.227:229-237 and United States Patent (USP) 5,814,618 and 5,789,156), be incorporated herein as a reference herein.
Also can use in method of the present invention and the component such as ZmCkx1-2 promotor (United States Patent (USP) 6,921,815 and unsettled U.S. Patent application 11/074,144) such by phytokinin inductive promotor.This construct increases to the phytokinin in etap and/or the destination organization is synthetic.Other phytokinin evoked promoter has been described, during these all are incorporated herein as a reference in unsettled U.S. Patent application 11/094,917 and 60/627,394.
Other inducible promoter comprises the heat-shocked promotor---Gmhsp17.5-E (soybean) (Czarnecka et al. (1989) Mol Cell Biol.9 (8): 3457-3463) for example; APX1 gene promoter (Arabidopis thaliana) (Storozhenko et al. (1998) Plant Physiol.118 (3): 1005-1014); Ha hsp 17.7 G4 (Sunflower Receptacle) (Almoguera et al. (2002) Plant Physiol.129 (1): 333-341); With corn Hsp70 (Rochesteret al. (1986) EMBO J.5:451-8).
Method of the present invention comprises polypeptide or polynucleotide is imported in the plant." importing " is meant that polynucleotide or polypeptide are present in the plant, and enters the mode of vegetable cell inside.Method of the present invention does not rely on the ad hoc approach that imports sequence in plant, as long as polynucleotide or polypeptide enter at least one vegetable cell.Is known with the method in polynucleotide or the polypeptide importing plant in this area, including but not limited to, stable conversion method, instantaneous conversion method and virus-mediated method.
" stable conversion " is meant that the target constructs that imports in the plant is incorporated in the Plant Genome, and can be genetic in its filial generation." instantaneous conversion " is meant that sequence imports in the plant, only interim the expression or existence in plant.
The type that in order to realize transforming, Transformation Program and the program of polypeptide or polynucleotide sequence of importing in plant can be according to plant or vegetable cells---for example unifacial leaf or dicotyledonous---changes.The appropriate methodology that imports polypeptide and polynucleotide to vegetable cell comprises microinjection (Crosswayet al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc.Natl.Acad.Sci.USA 83:5602-5606), agrobacterium-mediated conversion (United States Patent (USP) 5,563,055 and United States Patent (USP) 5,981,840), direct gene shifts (Paszkowskiet al. (1984) EMBO J.3:2717-2722) and trajectory particle accelerated process (referring to for example, United States Patent (USP) 4,945,050; United States Patent (USP) 5,879,918; United States Patent (USP) 5,886,244 and 5,932,782; Tomes et al. (1995) in Plant Cell, Tissue, and Organ Culture:Fundamental Methods, ed.Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926); Lec1 transforms (WO 00/28058).Also referring to Weissinger et al. (1 988) Ann.Rev.Genet.22:421-477; Sanford et al. (1987) Particulate Science and Technology5:27-37 (onion); Christou et al. (1988) Plant Physiol.87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev.Biol.27P:175-182 (soybean); Singh et al. (1998) Theor.Appl.Genet.96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (paddy rice); Hoque et al. (2005) Plant Cell Tissue ﹠amp; Organ Culture 82 (1): 45-55 (paddy rice); Sreekala et al. (2005) Plant Cell Reports 24 (2): 86-94 (paddy rice); Klein et al. (1988) Proc.Natl.Acad.Sci.USA 85:4305-4309 (corn); Klein et al. (1988) Biotechnology 6:559-563 (corn); United States Patent (USP) 5,240,855; 5,322,783 and 5,324,646; Klein et al. (1 988) Plant Physiol.91:440-444 (corn); Fromm et al. (1990) Biotechnology 8:833-839 (corn); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311:763-764; United States Patent (USP) 5,736,369 (cereal); Bytebier et al. (1987) Proc.Natl.Acad.Sci.USA 84:5345-5349 (lily); De Wet et al. (1985) inThe Experimental Manipulation of Ovule Tissues, ed.Chapman et al. (Longman, New York), pp.197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor.Appl.Genet.84:560-566 (conversion of whisker mediation); D ' Halluin et al. (1992) PlantCell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (paddy rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (corn transforms by Agrobacterium tumefaciems); During all documents all are incorporated herein as a reference.
In concrete technical scheme, provide the instantaneous conversion method that in plant, imports IPT sequence of the present invention or IPT promoter sequence by various.This instantaneous conversion method perhaps changes the IPT transcript over to plant including but not limited to directly changing IPT albumen or IPT promotor or its variant and fragment over to plant.This method for example comprises, microinjection or partickle bombardment.Referring to, Crossway et al. (1986) Mol Gen.Genet.202:179-185 for example; Nomura et al. (1986) Plant Sci.44:53-58; Hepler et al. (1994) Proc.Natl.Acad.Sci.91:2176-2180 and Hush et al. (1994) The Journal of CellScience 107:775-784 are during all documents are incorporated herein as a reference.Optionally, IPT polynucleotide or IPT promotor can be by technology instantaneous conversion known in the art in plants.This technology comprises virus carrier system and has got rid of the polynucleotide precipitator method that follow-up DNA discharges.Therefore, DNA can transcribe with the particle bonded, but its release and the frequency that is incorporated in the genome greatly reduce.This method comprises the poly polyethylene (PEI of particle bag quilt; Sigma#P3143).
In other technical scheme, polynucleotide of the present invention can import in the plant by plant is contacted with virus or viral nucleic acid.Usually, this method comprises constructs of the present invention and viral DNA or the integration of RNA molecule.Should recognize that IPT polynucleotide of the present invention can be used as a viral polyprotein part at first and synthesize, then in vivo or external processing by proteolysis produce required recombinant protein.In addition, should recognize that the used promotor of the present invention also can comprise the promotor that can be transcribed by viral rna polymerase.The method that imports polynucleotide and express its proteins encoded in plant that relates to viral DNA or RNA molecule is known in this area.For example referring to, United States Patent (USP) 5,889,191,5,889,190,5,866,785,5,589,367,5,316,931 and Porta et al. (1996) Molecular Biotechnology5:209-221; In being incorporated herein as a reference herein.
Method from polynucleotide to the Plant Genome specific site that insert is known in this area.In a technical scheme, polynucleotide are finished by the site-specific recombination system in the insertion of required genomic locus.Referring to for example WO99/25821, WO99/25854, WO99/25840, WO99/25855 and WO99/25853 and the U.S. 6,187,994; 6,552,248; 6,624,297; 6,331,661; 6,262,341; 6,541,231; 6,664,108; 6,300,545; 6,528,700 and 6,911,575, during all documents are incorporated herein as a reference.Briefly, two the non-reorganization recombination sites of its both sides band of transfer box that contain polynucleotide of the present invention.In transfer box is imported to the target site that has stable integration on the genome plant of---recombination site that the non-reorganization of its both sides takes place is corresponding with the site on the transfer box---.Suitable recombinase is provided, has made transfer box be incorporated into target site.Therefore herbicide-tolerant polynucleotide can be incorporated in the Plant Genome on the specific chromosome position.
Cell transformed can be grown in plant according to traditional method.Referring to for example, McCormick et al. (1986) Plant Cell Reports 5:81-84.These plants can grow, and pollinate with same conversion plant or different plants, and identify the filial generation of having expressed the desired phenotype feature.Can grow two generations or many generations to guarantee desired phenotype feature stably express and heredity, gather in the crops seed then to determine to have realized the expression of desired phenotype feature.So, the invention provides and have polynucleotide of the present invention---expression cassette for example of the present invention, and the transformed the seed (be also referred to as " transgenic seed ") of stable integration in its genome.
Pedigree breeding is since two genotypic test crosses, for example target original seed system and another one and original seed are complementary, the close relative with one or more required features system (be stable integration polynucleotide of the present invention, have regulation activity and/or polypeptide level of the present invention etc.).If original parent does not provide all required features, in the inbreeding group, also can comprise other source.In the pedigree method,, and in the successive filial generation, screen outstanding plant self-pollination.In filial generation thereafter, the hybridization state is replaced with the homology system of pollinating certainly and selecting to produce.Typically, in the pedigree method of breeding, carry out 5 or how continuous filial generation selfing and screening: F1 → F2; F2 → F3; F3 → F4; F4 → F 5Deng.After the q.s inbreeding, filial generation thereafter can increase endogamy and grow and next seed.In concrete technical scheme, inbreeding about 95% or higher locus on the contained allelotrope that isozygotys that is.
Backcross except be used for producing backcross transform, also can unite use, with the heterozygote that changes target original seed system and use the original seed system after changing to be produced with pedigree breeding.Backcross also can be used for from a system---the one or more specific required feature transfer of donor parents is to inbrde recurrent parent---this parent possesses all outstanding agronomy features basically, but the needed feature or the characteristics that lack.But same program can be used for making filial generation to have the genotype of recurrent parent, but backcrosses by stopping in early days simultaneously, and by selfing with select to keep many components of nonrecurrent parent.For example, produced such as the such F1 of commercialization heterozygote.This commercialization heterozygote can be backcrossed with one of its parent system and produce BC1 or BC2.Selfing and screening are carried out in filial generation, so that new inbreeding filial generation of growing has the various features of recurrent parent and the several characteristic of nonrecurrent parent.This method balance the value and the intensity of used recurrent parent in new heterozygote and the breeding.
Therefore, a technical scheme of the present invention is the method for backcrossing and transforming of preparation target corn inbreeding system, comprise with target corn inbreeding system with contain mutator gene or the genetically modified donor plant that can authorize required feature (being regulating cell mitogen level (increase or reduce) or the plant phenotype (this plant phenotype is discussed hereinafter) that caused by the phytokinin level of any regulation and control) and backcross, screening contains the mutator gene or the genetically modified F1 filial generation of authorizing required feature, and the F1 progeny plant and the target corn inbreeding system of screening are backcrossed.This method can further comprise the molecule marker collection of illustrative plates that obtains target corn inbreeding system, and screen with this molecule marker collection of illustrative plates and to have required feature and the target inbreeding is the step of the progeny plant of molecule marker collection of illustrative plates.By same mode, present method is by increasing by one with the required feature hybridization of target corn inbreeding system with different milpas, contain the mutator gene that to give required feature or the final step of genetically modified F1 heterozygote corn seed thereby produce, can produce F1 heterozygote seed.
Recurrent selection is the method for improvement plant population in the plant breeding program.This method entails individual plant to form filial generation by mutual hybridization pollination.Cultivate filial generation, and, comprise individual plant, half sibs filial generation, full sibs filial generation, selfing and topcross filial generation by the filial generation of any system of selection screening advantage.The mutual hybridization pollination of filial generation of screening is to form another group filial generation.Cultivate this population, and screen the advantage plant once more to carry out mutual hybridization pollination.Recurrent selection is working cycle, therefore can repeat repeatedly if desired.The purpose of recurrent selection is the quality of improvement population.Then with the population of improvement as the source of breeding material, to obtain to can be used for heterozygote or as synthetic cultivated plant parent's inbreeding system.Synthetic cultivated plant is the formed offspring of inbreeding system hybridization by several screenings.
It is a kind of useful technology that mixing is selected to strengthen when selecting to unite use with molecule marker.In mix selecting, according to phenotype and/or genotype screening seed from individuality.Then the seed of these screenings is mixed be used for cultivating of future generation.Mixing is selected to need culturing plants population in batch, makes plant self pollination, gathers in the crops seed in batch, uses a sample of the seed of gathering in the crops in batch to cultivate the next generation then.Except self pollination, directly pollination also can be used as a breeding engineering part.
Selection by mutation is a kind of method of new proterties being introduced original seed system.The sudden change spontaneous or artificial induction can be used as the useful source of plant breeding variant.The purpose of induced mutations is to improve the mutation rate of required proterties.Can improve mutagenesis speed by multiple different methods, comprise temperature, long-term seed stores, conditions of tissue culture, radioactive rays---X-ray for example, gamma-rays (for example cobalt 60 or caesium 137), neutron (uranium 235 fission products in the reactor), β ray (for example phosphorus 32 or carbon 14 send from radio isotope), or ultraviolet ray (preferably from 2500 to 2900nm), or chemical mutation agent (base analogue (5-bromouracil) for example, related compound (8-Ethoxycaffeine), microbiotic (Streptonigrin), alkanisation reagent (sulfur mustard, nitrogen mustard, epoxide, ethane amine, vitriol, sulfonate, the sulfone lactone), trinitride, azanol, nitric acid or acridine.After by mutagenic obtained required proterties, then can be by this proterties being incorporated in the already present germplasm such as such traditional breeding technology of backcrossing.The details of selection by mutation can be referring to " Principals of Cultivar Development, " Fehr, and 1993Macmillan Publishing Company is during it is described and is incorporated herein as a reference.In addition, be the conversion of backcrossing that the sudden change of generation can be used to produce the original seed system that contains this sudden change at other.
The present invention can be used for transforming any plant species, including but not limited to unifacial leaf and dicotyledons.The example of target plant species is including but not limited to corn (Zea mays), rape (B.napus for example, B.rapa, B.juncea), particularly those are as the rape kind of seed oil raw material, alfalfa (Medicago sativa), paddy rice (paddy rice), rye (Secalecereale), jowar (Sorghum bicolor, Sorghum vulgare), millet (pearl millet (Pennisetum glaucum) for example, broomcorn millet (Panicum miliaceum), paddy (Setariaitalica), ragimillet (Eleusine coracana)), Sunflower Receptacle (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycinemax), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gossypium barbadense, Gossypiumhirsutum),, sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), Fructus Fici (Ficus casica), piscidia (Psidium guajava), mango (Mangifera indica), olive (Oleaeuropaea), papaya (Carica papaya), cashew nut (Anacardium occidentale), macadamia (Macadamia integrifolia), apricot (Prunus amygdalus), beet tails (Beta vulgaris), sugarcane (Saccharum spp.), Oak Tree, barley, vegetables, ornamental plant and softwood tree.
Vegetables comprise tomato (Lycopersicon esculentum), lettuce (e.g., Lactucasativa), string bean (Phaseolus vulgaris), green soya bean (Phaseolus limensis), pea (Lathyrus spp.) and Cucumis member---for example cucumber (C.sativus), muskmelon (C.cantalupensis) and muskmelon (C.melo).Ornamental plant comprises rhododendron (Rhododendron spp.), Flower of Largeleaf Hydrangea (Macrophylla hydrangea), the rose of Sharon (Hibiscusrosasanensis), rose (Rosa spp.), turmeric (Tulipa spp.), flower of Chinese Narcissus (Narcissusspp.), petunia (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima) and chrysanthemum.
Can be used for realizing softwood tree of the present invention, comprise for example pine tree---such as torch pine (Pinustaeda), slash pine (Pinus elliotii), yellow pine (Pinus ponderosa), black pine (Pinuscontorta) and illiteracy special case pine (Pinus radiata); Pseudotsuga menziesii (Mirbel) Franco (Pseudotsuga menziesii); Larix principis-rupprechtii (Tsuga canadensis); Dragon spruce (Picea glauca); Redwood (Sequoiasempervirens); The China fir example---such as silver-colored China fir (Abies amabilis) and fir (Abiesbalsamea); And cdear---such as North China Korean pine (Thuja plicata) and Alaska yellow pine (Chamaecyparis nootkatensis).In concrete technical scheme, plant of the present invention is farm crop (for example corn, alfalfa, Sunflower Receptacle rape, soybean, cotton, safflower, peanut, wheat, millet, tomatoes etc.).In other technical scheme, corn and soybean plants are preferred, and maize plant is preferred in other other technical scheme.
Other target plant comprises the cereal grass that the target seed is provided, seed oil plant and leguminous plants.The target seed comprises seed corn---for example corn, wheat, barley, paddy rice, jowar, rye etc.The seed oil plant comprises cotton, soybean, safflower, Sunflower Receptacle, rape, corn, alfalfa, palm, coconut etc.Leguminous plants comprises beans and pea.Steamed buns stuffed with sweetened bean paste is drawn together guar-bean, algaroba, Semen Trigonellae, soybean, green soya bean, cowpea, mung bean, green soya bean, broad bean, root of Szemao crotalaria, garbanzo etc.
Typically, can use intermediate host's cell to realize the present invention, to increase the copy number of cloning vector.Along with copy number increases, the separable carrier that contains target nucleic acid in a large number is used for importing to required vegetable cell.In a technical scheme, used the plant promoter that does not cause expression of polypeptides in the bacterium.
The most frequently used prokaryotic organism are representative with various coli strains, but also can use other microorganism strains.Normally used, the promotor that in this paper definition, comprises transcription initiation, optionally contain operation, and the protokaryon regulating and controlling sequence that carries ribosome binding sequence comprises the promotor that those are commonly used, as β-Nei Xiananmei (penicillinase) and lactose (lac) promoter systems (Chang et al. (1977) Nature 198:1056), tryptophane (trp) promoter systems (Goeddel et al. (1980) Nucleic Acids Res.8:4057) and λ deutero-PL promotor and N-gene ribosome bind site (Shimatake et al. (1981) Nature292:128).In the dna vector of transfection Escherichia coli, also used the selective marker inclusion.The example of this mark comprises the specific resistant gene at penbritin, tsiklomitsin or paraxin.
Selection can import the carrier of suitable host cell.Bacteria carrier mainly is plasmid or phage source.Infect suitable bacterial cell or carry out transfection with the phage vector particle with exposed phage vector DNA.If the use plasmid is then used plasmid vector DNA transfection bacterial cell.Express the proteic expression system of the present invention and can obtain (Palva et al. (1983) Gene 22:229-235) with genus bacillus and Salmonellas; Mosbach et al. (1983) Nature302:543-545).
The multiple eukaryotic expression system such such as yeast, insect cell line, plant and mammalian cell is well known by persons skilled in the art.As hereinafter describing in detail, polynucleotide of the present invention can be expressed in these eukaryotic systems.Hereinafter in some technical scheme of Tao Luning, the vegetable cell of conversion/transfection can be used as the proteic expression system of generation the present invention.
The synthetic of heterologous polynucleotide is known (Sherman et al. (1982) Methods in Yeast Genetics, Cold Spring Harbor Laboratory) in the yeast.The yeast of two widely used production eukaryotic proteins is yeast saccharomyces cerevisiae and pichia yeast.Carrier in yeast saccharomyces cerevisiae and pichia yeast, bacterial strain and experimental implementation are known in this area, and can obtain (for example Invitrogen) by supplier.Suitable carriers has expression regulation sequence usually, and for example promotor comprises glycerol 3-phosphate acid kinase or alcohol oxidase, and replication orgin, terminator sequence and other required element.Albumen of the present invention can and use listed standard protein isolation technique to separate from yeast by lysing cell after expression.Purge process can be monitored by Western engram technology or radioimmunoassay detection method or other standard immunoassay detection technique.
Sequence of the present invention also can be connected to and be used for for example cell culture of Mammals, insect or plant origin of transfection in the various expression vectors.The cell culture that being used to of example produced polypeptide is a mammalian cell.But this area has been developed the proteic proper host cell of various The expressed system, comprises HEK293, BHK21 and Chinese hamster ovary celI system.The expression vector of these cells comprises expression regulation sequence---for example replication orgin, promotor (for example CMV promotor, HSV tk promotor or pgk (phosphoglyceric kinase) promotor), enhanser (Queenet al. (1986) Immunol.Rev.89:49) and essential machining information site---for example ribosome bind site, RNA shearing site, poly-adenosine site (for example big T Agpoly of SV40 A site) and Transcription Termination subsequence.Also there is other to be used for the proteic zooblast of production the present invention, for example derives from the cell of American type culture collection.
Usually derive from the SF9 baculovirus at expressed in insect cells proteic suitable carrier of the present invention.Suitable insect cell line comprises mosquito larvae, silkworm, mythimna separata, moth and drosophila cell system---Schneider clone (referring to Schneider (1987) J.Embryol.Exp.Morphol.27:353-365) for example.
The same with yeast, when using more higher animal or plant host cell, typically poly-adenosine or Transcription Termination subsequence are incorporated in the carrier.The example of terminator sequence is the poly-adenosine sequence from bovine growth hormone gene.Also comprise the sequence that promotes to transcribe shearing.An example shearing sequence is the VP1 intron (Sprague et al. (1983) J.Virol.45:773-781) from SV40.In addition, the gene order of duplicating in the control host cell, those sequences of in bovine papilloma virus type carrier, finding for example, also can be incorporated into (Saveria-Campo (1985) DNA Cloning Vol.II a Practical Approach, D.M.Glover, Ed. in the carrier, IRL Press, Arlington, Virginia, pp.213-238).
Animal and eucaryon (for example yeast) host cell such as low can make it can be used for transfection by the whole bag of tricks.Existing several import DNA the method for zooblast.Comprise: calcium phosphate precipitation, recipient cell and the bacterium protoplastis that contains DNA merge, with the liposome-treated recipient cell that contains DNA, DEAE dextrin, electroporation, particle gun and direct microinjection DNA in cell.Transfectional cell by means known in the art cultivate (Kuchler (1997) BiochemicalMethods in Cell Culture and Virology, Dowden, Hutchinson and Ross, Inc.).
II. regulate and control prenyltransferase peptide concentration and/or activity
Regulation and control peptide concentration of the present invention and/or active method in plant are provided.Usually, IPT peptide concentration and/or active with respect to not containing natural control plant, plant part or the cell increase that imports sequence or reducing at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% or more.Concentration and/or active regulation and control can occur in one or more stages of growth.In concrete technical scheme, polypeptide of the present invention is to regulate and control in the monocotyledons such such as corn.
IPT polypeptide expression level can directly be measured, and for example, measures IPT polypeptide level in the plant, or indirectly, for example, measures phytokinin composite reactive in the plant.The method of measuring the phytokinin composite reactive is other local description of this paper.
In concrete technical scheme, polypeptide of the present invention or polynucleotide import in the vegetable cell.By method known to those skilled in the art, for example, but be not limited to Southern engram analysis, dna sequencing, pcr analysis or phenotype analytical, the vegetable cell that screening has the sequence of the present invention that is imported then.Change or the plant of modifying or the plant part certain hour of under the plant formation condition, growing by the aforementioned techniques scheme, with peptide concentration of the present invention and/or activity in the abundant regulation and control plant.The plant formation condition is stated as known in the art, and briefly discusses in other place of this paper.
And recognize that polypeptide level and/or activity can not instruct the polynucleotide of albumen or rna expression to regulate and control by using in transforming plant.For example, polynucleotide of the present invention can be used for designing polynucleotide constructs---and it can be used in the method for change or mutation biology genome nucleotide sequence.This polynucleotide constructs including but not limited to, RNA:DNA carrier, RNA:DNA mutational vector, RNA:DNA repair vector, mix duplex oligonucleotide, self complementary RNA: DNA oligonucleotide and reorganization oligonucleotide.This constructs and using method are known in this area.Referring to United States Patent (USP) 5,565,350; 5,731,181; 5,756,325; 5,760,012; 5,795,972 and 5,871,984; During all documents are incorporated herein as a reference.Also referring to WO 98/49350, WO 99/07865, WO 99/25821 and Beethamet al. (1999) Proc.Natl.Acad.Sci.USA 96:8774-8778; In being incorporated herein as a reference.
Therefore whether method of the present invention does not rely on complete polynucleotide and is incorporated in the genome, as long as plant or its cell are because change has taken place the polynucleotide that import in the cell.In a technical scheme of the present invention, genome can change by import polynucleotide in cell.For example, polynucleotide or its any part can be incorporated in the Plant Genome.Genomic change is including but not limited to, the increase of Nucleotide in the genome, disappearance and substitute.And the method among the present invention does not rely on increase, the disappearance of any given number Nucleotide and substitutes, and generally acknowledges this increase, disappearance or substitute to comprise 1 Nucleotide at least.
Further showing can be by only introducing the sequence in specific developmental stage generation effect, and does not need the stage closing function of its expression to regulate and control the level and/or the activity of IPT sequence at other.Have a liking for the type promotor partially and can express IPT and control by using induction type or organizing.Optionally, can make the reverse or disappearance of gene by site-specific recombinase, transposon or recombination system, this can open or close the expression of IPT sequence.
" plant of being tried or vegetable cell " is meant wherein such as transforming such gene alteration identical with the effect that target gene causes, or from the plant that has carried out change or cell and contain the plant or the vegetable cell of this change.The phenotype that " contrast " or " control plant " or " control plant cell " provides reference point to be tried plant or vegetable cell with mensuration changes.
Control plant or vegetable cell can comprise, and for example: (a) wild-type plant or cell promptly have the homologous genes type with the parent material that causes being tried the gene alteration in plant or the cell; (b) plant or the vegetable cell that has the homologous genes type with parent material, but transform with invalid construct (construct that promptly objective trait is not had known effect---for example contain the construct of marker gene); (c) isolating non-conversion plant or vegetable cell in being tried plant or vegetable cell offspring; (d) with tried identical plant or the vegetable cell of plant or vegetable cell heredity, stimulate down but be not exposed to the conditioned disjunction of inducing target gene to express, or (e) under the condition of not expressing target gene, tried plant or vegetable cell self.
In this example, for example, the change of phytokinin level, comprise the variation that phytokinin absolute magnitude, phytokinin ratio, cytokine activity or phytokinin distribute, or the variation of plant or vegetable cell phenotype---for example flowering time, seed set, branch, aging, stress-tolerance or root size can relatively be measured by being tried plant or vegetable cell and control plant or vegetable cell.
A increases prenyltransferase polypeptide active and/or concentration
The method that increases IPT polypeptide active of the present invention and/or concentration increase is provided.Can realize IPT peptide concentration of the present invention and/or active increase by the IPT polypeptide is provided in plant.As other local discussion of this paper, it is many that the method for polypeptide is provided in plant is known in this area, including but not limited to, in plant, directly import polypeptide, and in plant (instantaneous or stable) import the polynucleotide constructs that coding contains the polypeptide of phytokinin composite reactive.Also known method of the present invention can be used the polynucleotide that can not instruct albumen or rna expression in transforming plant.Therefore, IPT polypeptide level and/or active can increasing by gene or its promotor that changes coding IPT polypeptide.Referring to for example Kmiec, United States Patent (USP) 5,565,350; Zarling et al., PCT/US93/03868.Therefore, provide the mutant plant that in the ITP gene, carries sudden change, the phytokinin composite reactive that wherein suddenlys change and increase IPT genetic expression or increase coded IPT polypeptide.As described in other place of this paper, it is known measuring the method that protein concentration increases or the phytokinin composite reactive increases.
B reduces prenyltransferase polypeptide active and/or concentration
The method that reduces or remove IPT polypeptide active and/or concentration by the expression cassette with the polynucleotide with expression inhibiting IPT expression of polypeptides is provided.Polynucleotide can directly suppress the IPT expression of polypeptides by the translation that suppresses IPT polypeptide messenger RNA(mRNA), or the molecule of transcribing or translating by the IPT polypeptide gene of coding inhibition coding IPT polypeptide indirectly suppresses the IPT expression of polypeptides.The method of inhibition or removal genetic expression is known in this area in plant, and any method all can be used for the present invention to suppress the IPT polypeptide expression.
According to the present invention, if being lower than, IPT polypeptide level do not carry out hereditary change or sudden change level with identical IPT polypeptide in the plant that suppresses the IPT expression of polypeptides on statistics, then the IPT polypeptide expression is suppressed.In certain aspects of the present invention, according to the present invention, the protein level of the IPT polypeptide in the plant of change than suddenly change or hereditary change is low by 95%, low by 90%, low by 80%, low by 70%, low by 60%, low by 50%, low by 40%, low by 30%, low by 20% with the protein level of identical IPT polypeptide in the plant that suppresses the IPT expression of polypeptides, low 10% or low 5%.IPT polypeptide expression level can directly be measured, and for example measure and express IPT polypeptide level in cell or the plant, or indirect measurement, for example, measure phytokinin composite reactive in cell or the plant.The method of measuring IPT polypeptide phytokinin composite reactive will be other local description of this paper.
In other technical scheme of the present invention, by with containing the activity that the expression cassette transformed plant cells of polynucleotide that coding suppresses the polypeptide of one or more IPT polypeptide actives reduces or remove one or more IPT polypeptide.According to the present invention, do not carry out the phytokinin composite reactive of hereditary change with identical IPT polypeptide in the plant that suppresses IPT polypeptide phytokinin composite reactive if IPT phytokinin composite reactive is lower than on statistics, then the phytokinin composite reactive of IPT polypeptide is suppressed.In certain aspects of the present invention, according to the present invention, the phytokinin composite reactive of IPT polypeptide in the plant that changes than do not carry out hereditary change low by 95%, low by 90%, low by 80%, low by 70%, low by 60%, low by 50%, low by 40%, low by 30%, low by 20% with the phytokinin composite reactive of identical IPT polypeptide in the plant that suppresses the IPT expression of polypeptides, hang down 10% or be lower than 5%.According to the present invention, when detecting nothing but by other local described detection method of this paper, the phytokinin composite reactive of IPT polypeptide is " removal ".The method of measuring the phytokinin composite reactive of IPT polypeptide will be other local description of this paper.
In other technical scheme, can cut down or remove the activity of IPT polypeptide by the gene that destroys coding IPT polypeptide.The present invention comprises the mutant plant that carries sudden change in the IPT gene, and wherein sudden change can reduce the phytokinin composite reactive of the IPT polypeptide of IPT expression of gene or inhibition coding.
Therefore, can use several different methods to reduce or remove the activity of IPT polypeptide.Can use more than one method to reduce single IPT polypeptide active.In addition, can unite that making ins all sorts of ways and reduce or remove the activity of two or more different IP T polypeptide.
The non-limiting example of the method for reduction or removal IPT expression of polypeptides provides hereinafter.
1. based on the method for polynucleotide
In some technical scheme of the present invention, but usefulness contains the expression cassette transformed plant cells of the polynucleotide of expression inhibiting IPT sequence expression.Term used herein " expression " is meant the biosynthesizing of gene product, comprises transcribing and/or translating of described gene product.For example, for target of the present invention, but the expression cassette of the polynucleotide that at least 1 IPT sequence of expression inhibiting is expressed is the expression cassettes that can produce the RNA molecule that at least 1 IPT polypeptide of inhibition transcribes and/or translate.Be meant transcribing of encoding sequence and translate producing albumen or polypeptide from dna molecular " expression " or " generation " albumen or polypeptide, and be meant that from RNA molecule " expressions " or " generation " albumen or polypeptide the translation of RNA encoding sequence is with generation albumen or polypeptide.
The example that suppresses the polynucleotide of IPT sequence expression provides hereinafter.
I. there is justice to suppress/suppress altogether
In some technical scheme of the present invention, can be by having justice to suppress or suppressing the IPT polypeptide expression altogether.For inhibition altogether, direction that expression cassette is designed to " justice to be arranged " is expressed the RNA molecule corresponding to the messenger RNA(mRNA) of all or part coding IPT polypeptide.The overexpression of RNA molecule can make the expression of natural gene reduce.Thereby screening is with suppressing a plurality of departments of botany that expression cassette transforms altogether, identifies that those show that IPT expression of polypeptides at utmost suppresses.
The polynucleotide that are used for common inhibition can be corresponding to all or part sequence, all or part IPT polypeptide transcript 5 of IPT polypeptide ' and/or the encoding sequence and the non-translational region of the transcript of 3 ' non-translational region or all or part coding IPT polypeptide of encoding.In some technical scheme, wherein polynucleotide comprise all or part IPT polypeptid coding area, and expression cassette is designed to lack the initiator codon of polynucleotide, thereby do not have protein product to be transcribed.
Suppress to can be used for suppressing gene expression in plants altogether, to produce by the undetectable plant of the protein level of these coded by said gene.Referring to, Broin et al. (2002) Plant Cell14:1417-1432 for example.Inhibition also can be used for suppressing a plurality of proteic expression of same plant altogether.Referring to for example, United States Patent (USP) 5,942,657.At Flavell et al. (1994) Proc.Natl.Acad.Sci.USA 91:3490-3496; Jorgensen et al. (1996) Plant Mol.Biol.31:957-973; Johansen and Carrington (2001) Plant Physiol.126:930-938; Broin et al. (2002) Plant Cell 14:1417-1432; Stoutjesdijket al (2002) Plant Physiol 129:1723-1731; Described in Yu et al. (2003) Phytochemistry 63:753-763 and the United States Patent (USP) 5,034,323,5,283,184 and 5,942,657 with the method that suppresses plant endogenous genetic expression altogether, in all being incorporated herein as a reference.Can adopted sequence 3 ' position and poly-adenosine signal 5 ' comprising poly dT district improves the efficient of common inhibition by having at expression cassette.Referring to U.S. Patent Publication 20020048814, in being incorporated herein as a reference herein.Typically, the sequence of this nucleotide sequence and native gene transcript has sequence identity basically, be preferably greater than 65% sequence identity, and more preferably be greater than 85% sequence identity, be most preferably greater than 95% sequence identity.Referring to United States Patent (USP) 5,283,184 and 5,034,323; In being incorporated herein as a reference.
Ii. Antisense Suppression
In some technical scheme of the present invention, can carry out the inhibition of IPT expression of polypeptides by Antisense Suppression.For Antisense Suppression, expression cassette is designed to express the messenger RNA(mRNA) complementary RNA molecule with all or part coding IPT polypeptide.The overexpression of antisense rna molecule can reduce the expression of natural gene.Thereby screening is with having a plurality of departments of botany that the Antisense Suppression expression cassette transforms, and identifies that those show that maximum IPT expression of polypeptides suppresses.
The polynucleotide that are used for Antisense Suppression can be corresponding to all or part complementary sequence of the sequence of coding IPT polypeptide, all or part IPT polypeptide transcript 5 ' and/or the complementary sequence of 3 ' non-translational region, or the encoding sequence of all or part coding IPT polypeptide transcript and the complementary sequence of non-translational region.In addition, antisense polynucleotides can be and the complete complementary of target sequence (promptly same with the complementary sequence 100% of target sequence) or part complementary (promptly with the complementary sequence identity of target sequence less than 100%).Antisense Suppression can be used for suppressing the expression of same plant multiple protein.Referring to for example, United States Patent (USP) 5,942,657.In addition, the antisense nucleoside acid moieties can be used for destroying the expression of target gene.Usually use at least 50 Nucleotide, 100 Nucleotide, 200 Nucleotide, 300,400,450,500,550 or the sequence of more a plurality of Nucleotide.In for example Liu et al (2002) Plant Physiol.129:1732-1743 and United States Patent (USP) 5,759,829 and 5,942,657, described with Antisense Suppression and suppressed the method that native gene is expressed in the plant, during each document is incorporated herein as a reference.Can comprise the efficient that Antisense Suppression is improved in poly dT district by 3 ' position and 5 ' poly-adenosine signal at the expression cassette antisense sequences.Referring to U.S. Patent Publication 20020048814, in being incorporated herein as a reference.
Iii. double-stranded RNA disturbs
In some technical scheme of the present invention, can disturb the inhibition that realizes the IPT expression of polypeptides by double-stranded RNA (dsRNA).Disturb for dsRNA, in same cell, express with aforementioned similarly have in suppressing altogether adopted RNA molecule and with adopted RNA molecule complementary antisense rna molecule is wholly or in part arranged, thereby the expression that inhibitory phase should endogenous messenger RNA(mRNA).
Can realize the expression of justice and antisense molecule by the expression cassette that design contains adopted sequence and antisense sequences.Optionally, can use different expression cassettes with antisense sequences to justice.Screen the various plants system that disturbs expression cassette or a plurality of expression cassette to transform with dsRNA then, and identify the department of botany that shows maximum IPT expression of polypeptides inhibition.At Waterhouse et al. (1998) Proc.Natl.Acad.Sci.USA 95:13959-13964; Described among Liu et al. (2002) PlantPhysiol.129:1732-1743 and WO 99/49029, WO 99/53050, WO 99/61631 and the WO 00/49035 with dsRNA and disturbed the method that suppresses endogenous plant genetic expression; During each document all is incorporated herein as a reference.
Iv. hairpin RNA disturbs and contains the hairpin RNA interference of intron
In some technical scheme of the present invention, can disturb by the hairpin RNA (ihpRNA) that hairpin RNA (hpRNA) disturbed or contained intron and realize that one or more IPT polypeptide expression suppress.These methods can efficiently suppress native gene and express.Referring to Waterhouse andHelliwell (2003) Nat.Rev.Genet.4:29-38, document is incorporated into herein.
. hpRNA is disturbed, and expression cassette is designed to express the RNA molecule that forms the hairpin structure that contains single-stranded loop district and base pairing stem with self hybridization.Base pairing stem district contain corresponding to coding to suppress its expression gene the endogenous messenger RNA(mRNA) of all or part adopted sequence arranged, and with adopted sequence complementary antisense sequences is wholly or in part arranged.Therefore, the base pairing stem district of molecule determines RNA interferential specificity usually.The hpRNA molecule can efficiently suppress native gene expresses, and its inductive RNA disturbs and can be genetic among the plant offspring.Referring to for example, Chuang andMeyerowitz (2000) Proc.Natl.Acad.Sci.USA 97:4985-4990; Stoutjesdijk et al. (2002) Plant Physiol.129:1723-1731 and Waterhouseand Helliwell (2003) Nat.Rev.Genet.4:29-38.At for example Chuang andMeyerowitz (2000) Proc.Natl.Acad.Sci.USA 97:4985-4990; Stoutjesdijk et al. (2002) Plant Physiol.129:1723-1731; Waterhouseand Helliwell (2003) Nat.Rev.Genet.4:29-38; The method of using hpRNA to disturb inhibition or silencer to express has been described in Pandolfini et al.BMCBiotechnology 3:7 and the U.S. Patent Publication 20030175965; During each document all is incorporated herein as a reference.The instantaneous detection method of hpRNA construct efficient has been described, in being incorporated herein as a reference in Panstruga et al. (2003) Mol.Biol.Rep.30:135-140.
Optionally, base pairing stem district can be corresponding to the promoter sequence district that controls the genetic expression that is suppressed.Can realize transcriptional gene silencing (TGS) by the hpRNA construct, wherein the reverse repetition of hair clip is had sequence identity with startup by the silencer expression promoter.HpRNA is processed as can to trigger with the process of the interactional short rna s in homologous promoter district and degrades or methylate, thereby causes silence (Aufsatz et al. (2002) PNAS 99 (Suppl.4): 16499-16506; Mette et al. (2000) EMBO J 19 (19): 5194-5201).
For ihpRNA, disturbing molecule has the conventional structure identical with hpRNA, but the RNA molecule contains the intron that can be sheared in addition in the cell of expressing ihpRNA.Use intron can reduce to shear in the hairpin RNA molecule size of back ring, thereby increase jamming effectiveness.Referring to for example Smith et al. (2000) Nature 407:319-320.In fact, Smith et al. uses the interference of ihpRNA mediation to realize the inhibition that 100% native gene is expressed.At for example Smith et al. (2000) Nature 407:319-320; Wesley et al. (2001) PlantJ.27:581-590; Wang and Waterhouse (2001) Curr.Opin.Plant Biol.5:146-150; Waterhouse and Helliwell (2003) Nat.Rev.Genet.4:29-38; Described in Helliwell and Waterhouse (2003) Methods 30:289-295 and the U.S. Patent Publication 20030180945 with ihpRNA and disturbed the method that suppresses endogenous plant genetic expression, during each document all is incorporated herein as a reference.
HpRNA interferential expression cassette also can be designed to just sequence and antisense sequences and not correspond to endogenous RNA.In this technical scheme, justice and antisense sequences are positioned at the both sides of containing corresponding to the ring sequence of the nucleotide sequence of the endogenous messenger RNA(mRNA) of all or part of target gene.Therefore be by ring district decision RNA interferential specificity.Referring to for example WO 02/00904, in being incorporated herein as a reference herein.
V. the interference of amplicon mediation
The amplicon expression cassette contains the sequence that plant virus derives from, and this sequence contains all or part of target gene, but does not contain all genes of natural viral usually.Virus sequence in the transcription product of expression cassette can make transcription product instruct and himself duplicate.The transcript that produces by amplicon with respect to target sequence (being the messenger RNA(mRNA) of IPT polypeptide) may be justice arranged or antisense.At Angell and Baulcombe (1997) EMBO for example J.16:3675-3684; Angelland Baulcombe (1999) Plant J.20:357-362 with United States Patent (USP) 6,646, the method that suppresses endogenous plant genetic expression with amplicon has been described, during each document all is incorporated herein as a reference in 805.
Vi. ribozyme
In some technical scheme, the polynucleotide of being expressed by expression cassette of the present invention are catalysis RNA or have ribozyme activity at the messenger RNA(mRNA) of IPT polypeptide.Therefore, polynucleotide can make endogenous messenger RNA(mRNA) degraded, thereby cause the IPT polypeptide expression to reduce.For example in the United States Patent (USP) 4,987,071 this method is being described, in being incorporated herein as a reference.
Vii. siRNA or microRNA
In some technical scheme of the present invention, the RNA of gene that can be by expressing coding microRNA (miRNA) disturbs and realizes that one or more IPT expression of polypeptides suppress.MiRNAs is the regulatory factor that contains about 22 ribonucleotides.MiRNA can efficiently suppress native gene to express.Referring to for example Javier et al. (2003) Nature 425:257-263, in being incorporated herein as a reference.
Disturb for miRNA, expression cassette is designed to express the RNA molecule of miRNAs gene in the imitated simulation.The miRNA genes encoding can form the RNA that contains the hairpin structure of 22 nucleotide sequences with another native gene (target sequence) complementary.For suppressing the IPT expression of polypeptides, the 22-nucleotide sequence is selected from IPT polypeptide transcript sequence, and contains 22 Nucleotide of the described IPT peptide sequence of encode with sense orientation, and and 21 Nucleotide of the corresponding antisense sequences of adopted sequence complementary is arranged.The miRNA molecule can efficiently suppress native gene expresses, and its inductive RNA disturbs and can be genetic among the plant offspring.
2. the genetic expression based on polypeptide suppresses
In a technical scheme, polynucleotide encoding can with the gene bonded zinc finger protein of coding IPT polypeptide, thereby reduce genetic expression.In certain aspects, zinc finger protein combines with the control region of IPT polypeptide gene.In other technical scheme, zinc finger protein combines with the messenger RNA(mRNA) of coding IPT polypeptide, suppresses its translation.For example describe the method for selecting zinc finger protein target site in the United States Patent (USP) 6,453,242, for example describing the method for using zinc finger protein inhibition gene expression in plants in the U.S. Patent Publication 20030037355; During each document all is incorporated herein as a reference.
3. the protein-active based on polypeptide suppresses
In some technical scheme of the present invention, polynucleotide encoding and at least a IPT polypeptide bonded antibody, and the phytokinin composite reactive of reduction IPT polypeptide.In another technical scheme, the combination of antibody can cause the increase of antibody-IPT polypeptide complex turnover by cell Quality Control mechanism.Antibody in vegetable cell expression and be known by the molecular pathways of in vegetable cell, expressing and antibody and protein binding are suppressed in this area.Referring to for example Conrad and Sonnewald (2003) Nature Biotech.21:35-36, in being incorporated herein as a reference.
4. gene disruption
In some technical scheme of the present invention, be the activity that reduces or remove the IPT polypeptide by the gene that destroys coding IPT polypeptide.Can destroy the gene of coding IPT polypeptide by any means known in the art.For example, in a technical scheme, destroy gene by transposon tagging.In another technical scheme, thereby by at random or orthomutation mutagenesis plant and screen the active plant that reduces of IPT and destroy gene.
I. transposon tagging
In a technical scheme of the present invention, use transposon tagging to reduce or remove the phytokinin composite reactive of one or more IPT polypeptide.Transposon tagging comprises transposon is inserted into endogenous IPT gene, thereby reduces or remove the IPT expression of polypeptides." IPT gene " is meant the gene of code book invention IPT polypeptide.
In this technical scheme, thereby gene control region by transposon being inserted coding IPT polypeptide or coding region reduce or remove one or more IPT polypeptide expression.Can use the exon that is positioned at the IPT polypeptide gene, intron, 5 ' or the transposon of 3 ' non-translated sequence, promotor or any other regulating and controlling sequence reduce or remove the IPT polypeptide expression and/or the activity of coding.
The transposon tagging method of specific gene is known in this area in the plant.Referring to for example Maes et al. (1999) Trends Plant Sci.4:90-96; Dharmapuri and Sonti (1999) FEMS Microbiol.Lett.179:53-59; Meissner et al. (2000) PlantJ.22:265-274; Phogat et al. (2000) J.Biosci.25:57-63; Walbot (2000) Curr.Opin.Plant Biol.2:103-107; Gai et al. (2000) Nucleic Acids Res.28:94-96; Fitzmaurice et al. (1999) Genetics 153:1919-1928).In addition, at Bensen et al. (1995) Plant Cell 7:75-84; The TUSC process that screening Mu inserts in the gene of selecting has been described, during each document all is incorporated herein as a reference in Mena et al. (1996) Science274:1537-1540 and the United States Patent (USP) 5,962,764.
Ii. the active mutant plant that reduces
The method that native gene is expressed in other reduction or the removal plant also is known in this area, can be applied among the present invention in a similar manner.These methods comprise the mutagenesis of other form---for example methylsulfonic acid inductive sudden change of the removed department of botany of (passing through PCR) employed evaluation native gene in the reverse genetics operation, remove sudden change and fast neutron deletion mutantion.To the example of these methods referring to Ohshima et al. (1998) Virology 243:472-481; Okubara et al. (1994) Genetics 137:867-874 and Quesada et al. (2000) Genetics 154:421-436; During each document all is incorporated herein as a reference.In addition, the method TILLING of the sudden change of the rapid automatized screening chemical induction of the PCR product selectivity restriction endonuclease of use sex change HPLC or selection digestion (location induction type local damage in the genome) also can be applicable among the present invention.Referring to McCallum et al. (2000) Nat.Biotechnol.18:455-457, in being incorporated herein as a reference.
Influencing genetic expression or disturbing the sudden change of proteins encoded function (IPT activity) is known in this area.Insertion sudden change in gene extron can cause nonsense mutation usually.The phytokinin composite reactive that can suppress proteins encoded in the sudden change of conserved residues very effectively.Described and be suitable for suddenling change in the plant IPT polypeptide and remove the conserved residues of the active purpose of IPT.Referring to for example Fig. 1.This mutant strain can separate according to known procedure, and different IP T site mutation can be piled up by genetic cross.Referring to for example Gruis et al. (2002) Plant Cell 14:2863-2882.
In another technical scheme of the present invention, because gene is reverse and the reorganization in duplicate genes site, dominant mutation can be used for starting the RNA silence.Referring to for example Kusaba et al. (2003) Plant Cell 15:1455-1467.
The present invention comprises other reduction or removes the method for one or more IPT polypeptide actives.The method of genome nucleotide sequence is known in this area in other change or the mutant plant, including but not limited to, use RNA:DNA carrier, RNA:DNA mutational vector, RNA:DNA repair vector, mix double chain oligonucleotide, self complementary RNA: DNA oligonucleotide and reorganization oligonucleotide.These carriers and using method are known in this area.Referring to for example United States Patent (USP) 5,565,350; 5,731,181; 5,756,325; 5,760,012; 5,795,972 and 5,871,984; During each document all is incorporated herein as a reference.Also referring to WO 98/49350, WO 99/07865, WO 99/25821 and Beetham et al. (1999) Proc.Natl.Acad.Sci.USA96:8774-8778; During each document all is incorporated herein as a reference.
III. regulating cell mitogen level and/or activity
" phytokinin " used herein is meant that a class plays the role of a nucleus and influences the plant specificity hormone of multiple development program or the member in such in cell cycle.Phytokinin contains N 6-alternate purine derivative.Representative phytokinin comprises isopentenyl adenosine (N 6-(Δ 2-isopentene group) adenosine (following is iP), zeatin (6-(4-hydroxyl-3 methyl butyl-trans-2-alkenyl amino) purine) (following is Z) and dihydro zeatin (DZ).Free base and ribose thereof (iPR, ZR and DZR) are active compounds.Other phytokinin is known.Referring to for example United States Patent (USP) 5,211,738 and Keiber et al. (2002) Cytokinins, TheArabidopsis Book, American Society of Plant Biologists is during the two all is incorporated herein as a reference.
" regulating cell mitogen level " comprises when comparing with control plant, any phytokinin level and/or active remarkable reduction or increase in the plant.For example, compare with control plant or plant part, the regulation and control level and/or active comprise increase or reduce total cell fission cellulose content about 0.1%, 0.5%, 1%, 3% 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more.Optionally, compare with control plant or plant part, the regulation and control level of phytokinin and activity can comprise phytokinin level/or active increase or reduce about 0.2 times, 0.5 times, 2 times, 4 times, 8 times, 16 times, 32 times or more in plant or the plant part.
Recognize that also regulating cell mitogen levels/activity does not need total phytokinin level and/or active increase/reduction, but comprise the changes in distribution of phytokinin in tissue.In addition, regulating cell mitogen levels/activity does not need total phytokinin increase/reduction, but comprises that the ratio of various phytokinin derivatives changes.For example, compare various phytokinin derivatives with control plant---for example the ratio of isopentenyl adenosine type, zeatin type or dihydro zeatin type phytokinin etc. changes, thus regulation and control plant or plant part phytokinin levels/activity.
The method of measuring phytokinin level and/or activity regulation is known in this area.For example, phytokinin extraction, immune purifying, HPLC separate and the quantitative exemplary process of ELISA method has description at Faiss et al. (1997) Plant for example in J.12:401-415.Also can be referring to Werner et al. (2001) PNAS 98:10487-10492) and Dewitte et al. (1999) Plant Physiol.119:111-121.During each document all is incorporated herein as a reference.As other local discussion of this paper, phytokinin level and/or active regulation and control can further detect by monitoring specific plant phenotype.This phenotype will be described in other place of this paper.
In ad hoc approach, increase phytokinin level and/or activity in the plant by level or the activity that increases IPT polypeptide in the plant.The level and/or the active method that increase IPT polypeptide in the plant will be described in other place of this paper.Concise and to the point, these methods comprise importing IPT polypeptide of the present invention in plant, thereby increase the level and/or the activity of IPT polypeptide.In other technical scheme, thereby, provide the IPT nucleotide sequence of coding IPT polypeptide by in plant, importing the polynucleotide that contain IPT nucleotide sequence of the present invention, expression IPT sequence can increase phytokinin in plant or the plant part when comparing with control plant level and/or active mode.In some technical scheme, import to IPT constructs stable integration in the plant in Plant Genome.
In other method, by reducing one or more IPT polypeptide levels and/or active level and/or the activity that reduces phytokinin in the plant in the plant.This method will be described in other place of this paper.In this method, the IPT nucleotide sequence is imported in the plant, the expression of IPT nucleotide sequence has reduced the activity of IPT polypeptide, thus when comparing with control plant or plant part in plant or the plant part phytokinin level and/or activity reduced.In other technical scheme, the IPT construct that imports in the plant stably is incorporated in the Plant Genome.
As mentioned above, the technician knows and uses the example promotor of phytokinin levels/activity, this technical scheme in the suitable adjustable plant of promotor to describe to some extent in other place of this paper.
Therefore, the present invention further provides when comparing, had the plant of the phytokinin levels/activity of regulation and control with the phytokinin levels/activity in the control plant.In a technical scheme, plant of the present invention has the levels/activity of the IPT polypeptide of the present invention of increase, thereby has the levels/activity of the phytokinin of increase.In other technical scheme, plant of the present invention has the level of the IPT polypeptide of the present invention that reduces or remove, thereby has the levels/activity of the phytokinin of reduction.In certain aspects, this kind of plant have stable integration in its genome contain with start vegetable cell in the nucleic acid molecule of the IPT nucleotide sequence of the present invention that is connected of expression promoter.
IV. regulate and control root development
The method of regulation and control root development in plant is provided.When " regulation and control root development " is meant and compares with control plant, any variation in the roots of plants growth course.Variation in this root development including but not limited to, the primary root speed of growth, root fresh weight, lateral root and adventive root form degree, vascular system, meristematic tissue is grown or the variation of radial expansion.
The method of regulation and control root development in plant is provided.Method comprises IPT polypeptide level and/or activity in the regulation and control plant.In a method, IPT sequence of the present invention is imported in the plant.In another method, by in plant, import contain IPT nucleotide sequence of the present invention (can be the fragment of total length IPT consecutive nucleotides) thus polynucleotide, the mode of expressing described IPT sequence regulation and control root development IPT is provided nucleotide sequence.In other method, the IPT constructs that imports in the plant stably is incorporated in the Plant Genome.
In other method, regulate and control root development by IPT polypeptide level or activity in the reduction plant.This method comprises importing IPT nucleotide sequence in plant, and the activity that reduces the IPT polypeptide.In some method, the IPT constructs that imports in the plant stably is incorporated in the Plant Genome.The reduction of phytokinin composite reactive can cause the variation of at least one or a plurality of following root developments, including but not limited to, the growth of the root of comparing with control plant with bigger root meristematic tissue, increase, strengthen radial expansion, strengthen vascular system, increase root branch, more adventive root and/or root fresh weight and increase.
" root growth " used herein comprises in unifacial leaf and the dicotyledons in the root development different steps and forms growth aspect all of different piece of root system system.Should understand the enhanced root growth can be its one or more parts, comprises the enhancing growth of primary root, lateral root, adventive root etc.Measuring the method for growing variation in this root system system is known in this area.Referring to for example U.S. Patent application 2003/0074698 and Werner et al. (2001) PNAS 18:10487-10492, during the two all is incorporated herein as a reference.
As mentioned above, the technician should know the growth of using suitable promotor to regulate and control root in the plant.The example promotor of this technical scheme comprises that constitutive promoter and root have a liking for the type promotor partially.The root of example is had a liking for the type promotor partially and is described in other place of this paper.
Stimulate root growth and increase the lodging resistance that root heavily can be used for improving plant by reducing IPT polypeptide active and/or level.Term " lodging resistance " or " lodging resistance " are meant that plant is with the ability that himself is fixed in the soil.For having the plant of upright or half vertical growth habit, this term also refers to keep the ability of vertical position under the adverse environment condition.This characteristic relates to volume, the degree of depth and the form of root system system.In addition, stimulate root growth and increase the breeding that root heavily can be used for promoting external explant by reduction IPT polypeptide level and/or activity in the suitable etap.
The root architecture that increases root biomass and/or change can be used for improving the nitrogen use efficiency of plant.This improvement efficient for example can cause, and when obtainable nitrogen was existing level, phytomass and/or seed production increased, or can keep phytomass and/or seed production when obtainable nitrogen is limited.Therefore have agronomy and/or environmental advantage.
In addition, owing to IPT polypeptide level and/or the active biomass that reduces the higher root that causes have remote effect to the output by the compound that cell culture produced of root cells or transgenosis root cells or described transgenosis root cells.The example of the compound of the target that produces in the root culture is a Shikonin, can improve its output easily by described method.
Therefore, the present invention further provides the plant of the root development of comparing with the root development of control plant with regulation and control.In some technical scheme, plant of the present invention has the IPT polypeptide level of the present invention of reduction/or active and the biomass of enhanced root growth and/or root.In certain aspects, stably integrated the nucleic acid molecule that contains and start the IPT nucleotide sequence of the present invention that expression promoter can be operatively connected in the vegetable cell in the genome of this kind of plant.
V. regulate and control branch and leaf development
The method of regulation and control nutritive issue growth in plant is provided.In a technical scheme, the branch in the plant and the growth of leaf are regulated and control.When " regulation and control branch and/or leaf development " are meant and compare with control plant or plant part, any variation in plants shoots and/or leaf development.Variation in this branch and/or the leaf development is including but not limited to, the variation of the growth of root meristematic tissue, number of sheets order, leaf condition, leaf and stem vascular system, panel length and leaf aging." leaf development " used herein and " branch development " comprise in unifacial leaf and the dicotyledons, forms leaf system respectively and unify the different piece of branch system aspect all of its development in different stages growth.Measuring the method for growing variation in this branch and the leaf system system is known in this area.Referring to for example Werner et al. (2001) PNAS 98:10487-10492 and U.S. Patent application 2003/0074698, during each document all is incorporated herein as a reference.
The method of branch and/or leaf development comprises activity and/or the level of regulating and control IPT polypeptide of the present invention in the regulation and control plant.In a technical scheme, provide IPT sequence of the present invention.In other technical scheme, thereby provide IPT nucleotide sequence by the mode that in plant, imports the polynucleotide, expression IPT sequence regulation and control branch and/or the leaf development that contain IPT nucleotide sequence of the present invention.In other method, the IPT constructs that imports in the plant stably is incorporated in the Plant Genome.
In concrete technical scheme, regulate and control the growth of branch or leaf by IPT polypeptide level and/or activity in the reduction plant.The active reduction of IPT can cause the variation of one or more branches and/or leaf development, including but not limited to, compare with control plant have littler apical meristem, reduce number of sheets order, reduce leaf surface long-pending, reduce vascular tissue, the leaf aging of shorter internode and short and small growth and acceleration.
As mentioned above, the technician should know the growth of using branch and leaf in the suitable adjustable plant of promotor.The example promotor of this technical scheme comprises that constitutive promoter, branch have a liking for type promotor, branch meristematic tissue partially and have a liking for type promotor, old and feeble activated form promotor, stress induced promoter, root partially and have a liking for type promotor, nitrogen inducible promoter and leaf partially and have a liking for the type promotor partially.The example promotor is described in other place of this paper.
In plant, reduce the phytokinin composite reactive and cause shorter internode and short and small growth usually.Therefore, method of the present invention can be used for producing short and small plant.In addition, as mentioned above, the growth of adjustable of phytokinin composite reactive and branch in the adjusting plant.Therefore, the present invention further provides the method that changes root bar ratio.
Branch or leaf development further can be regulated and control by IPT polypeptide level and/or activity in the increase plant.The active increase of IPT can cause one or more variations in branch and/or the leaf development, including but not limited to, compare with control plant increase number of sheets order, increase leaf surface long-pending, increase vascular tissue, increase branch form, more between meropodium, the plant biomass and the vigor of the growth that improves, improvement and postpone the leaf aging.
In a technical scheme, improved the tolerance of plant to damage caused by waterlogging.Damage caused by waterlogging is that a kind of serious environmental that influences plant-growth and output is coerced.Damage caused by waterlogging can cause early ageing, causes the listless Huang of leaf, necrosis, falls leaves, stops growing and reduces output.Phytokinin can regulate and control aging by increasing in the plant IPT polypeptide levels/activity, and the present invention has improved the tolerance of plant to the various environment-stress that comprise damage caused by waterlogging.The aging that postpones helps enlarging the sophisticated adaptability of farm crop, improves the preservation period of potted plant, and the bottle that prolongs cut-flower is inserted the phase.
In other technical scheme, provide in callus regulation and control branch regenerated method.In the method, increase IPT polypeptide level and/or activity and will increase phytokinin level in the plant.Therefore, in substratum, reduce external source adjusting and controlling growth thing (being phytokinin) level or do not have the foreign cell mitogen and can strengthen branch regeneration in the callus.Therefore, in a technical scheme of the present invention, the level of the IPT sequence of increase and/or active can be used for overcoming those wherein bad shoot growth trend in the specific kind of the success of transgenic technology and limited speed.In addition, can carry out multiple branch to cash crop and induce, make it produce branch as much as possible.Therefore, the method for the reproduction speed that is used to increase conversion is provided.In certain aspects, the IPT sequence in inducible promoter (for example heat-shocked promotor, chemical inducible promoter) control down.Other inducible promoter is known in this area, and other local discussion of this paper.
The method of setting up callus from explant is known.For example, root, stem, branch and aseptic branch seedling are can be used for evoked callus formation several tissue-derived.Usually use the immature tissue (for example spire, root, meristematic tissue or other tissue) that growth activity is arranged, but optional.The formation of callus is controlled by the adjusting and controlling growth material in the substratum (growth hormone and phytokinin).The specific concentrations of the plant modulator that required evoked callus forms there are differences between different plant species, even depends on the source of explant.In some cases, can use in test different growth substance (for example 2,4-D or NAA) or its combination, because some kind is not replied the particular growth modulator.In addition, culture condition (being light, temperature etc.) also influences the generation of callus.In case generate the regeneration of the initial branch of available callus culture thing.Referring to for example, Gurel et al. (2001) Turk J.Bot.25:25-33; Doddset al. (1995) .Experiments in Plant Tissue Culture, CambridgeUniversity Press; Gamborg (1995) Plant Cell, Tissue and OrganCulture is during eds.G.Phillips and U.S. Patent application 20030180952, all documents all are incorporated herein as a reference.
Further recognize the speed of growth that can be by increasing seed or increase its vigor and increase seed size and/or weight.In addition, as described below, the regulation and control plant can increase plant biomass and vigor to tolerance of coercing and the growth of regulating and control root, branch and leaf.Term used herein " vigor " is meant relative situation, output and the growth velocity of plant and/or specific plant part, can be reflected in the various development characteristics, including but not limited to, chlorophyll concentration, photosynthesis speed, total biomass, root biomass, grain quality and/or grain output.In corn, vigor reflects that also the speed of growth, fringe volume and/or the heading silk of fringe extend and expansion especially.The well-developed root system successful structure of well-developed photosynthesis organ of unifying after vigor relates to the plant quick energy for growth of etap and the rudiment in early days.Vigor can be measured with reference to different phenotypes under same environmental conditions, or measures with reference to identical or different genotype under the varying environment condition.
Therefore, the present invention further provides the plant of compare with control plant branch and/or leaf development with regulation and control.In some technical scheme, plant of the present invention has the levels/activity of the IPT polypeptide of the present invention of increase.In other technical scheme, plant of the present invention has the levels/activity of the IPT polypeptide of the present invention of reduction.
VI. regulating and control germinal tissue grows
The method that provides the regulation and control germinal tissue to educate.In a technical scheme, provide the method for the flower development of regulation and control plants." regulation and control flower development " is meant the structural modification of any plant reproductive tissue of comparing with control plant or plant part." regulation and control flower development " comprises that further the plant reproductive of comparing with control plant or plant part is organized in any change of developmental stage (promptly postponing or quicken the growth of flower).Macroscopic view changes and to comprise reproductive organ volume, form, number or position, form the variation of the used development time of these structures or keep under environment-stress or the ability of the process of blooming.Microcosmic changes and to comprise the cell type of forming reproductive organ and the variation of form.
The method of flower development comprises the level and/or the activity of IPT polypeptide in regulation and control (increase or the reduce) plant in the regulation and control plant.In a method, provide IPT polypeptide of the present invention.Can by in plant, import the polynucleotide contain IPT nucleotide sequence of the present invention, thereby the mode of expressing IPT sequence regulation and control flower development provides IPT nucleotide sequence.In some technical scheme, the IPT constructs that imports in the plant stably is incorporated in the Plant Genome.
As mentioned above, the technician should know the growth of using suitable promotor to regulate and control flower in the plant.The example promotor of this technical scheme comprises that constitutive promoter, inducible promoter, branch have a liking for type promotor and inflorescence partially and have a liking for type promotor (comprise female plant grow inflorescence and have a liking for the type promotor partially) partially, comprises the promotor that those are listed in other place of this paper.
In concrete grammar, by increasing IPT sequence level of the present invention and/or active growth of regulating and control to spend.This method comprises the activity that imports the IPT nucleotide sequence and increase the IPT polypeptide in plant.In some method, the IPT constructs that imports in the plant stably is incorporated in the Plant Genome.IPT sequence level and/or active increase can cause the variation of one or more flower developments, including but not limited to, the number of blooming acceleration, spending of comparing with control plant increases and has improved the seed set.In addition, IPT sequence level or active increase can suppress the old and feeble of flower and change embryo number in the grain.Referring to Young et al. (2004) Plant J.38:910-22.Measuring the method for growing variation in this flower development is known in this area.Referring to for example Mouradov et al. (2002) The Plant Cell S111-S130, in being incorporated herein as a reference herein.
In other method, by reducing IPT sequence level of the present invention and/or active growth of regulating and control to spend.IPT sequence level and/or active reduction can cause grain abortion and sterile female plant inflorescence.Induce late blooming or inhibition to bloom to can be used for strengthening output such as the such feed farm crop of alfalfa.
Therefore, the present invention further provides the plant of the flower development of comparing with the flower development of control plant with regulation and control.Component comprises the plant of the flower development of the IPT polypeptide levels/activity of the present invention that contains reduction and change.Component also comprises the plant of the IPT polypeptide levels/activity of the present invention with increase, wherein the plant process of can keeping or bloom in the period of coercing.
VII. regulate and control the stress tolerance of plant
Provide and used IPT sequence of the present invention to change the method for plant the tolerance of abiotic stress.Increasing growth of seedling or early activity increases relevant with stress tolerance usually.For example, seedling comprises that the quick growth of the root system system after the seedling rudiment is very crucial to the survival under the unfavourable condition such such as arid.The used promotor of present method is other local description of this paper, comprises that low-level composing type, induction type or root have a liking for the type promotor partially---and the root that for example derives from ZmIPT4 and ZmIPT5 regulating and controlling sequence is had a liking for the type promotor partially.Therefore, in a method of the present invention, compare, can increase or keep the tolerance of plant coercing by the IPT activity level that reduces the rudiment seedling with control plant.In other method, thereby by in plant, introducing the polynucleotide contain IPT nucleotide sequence of the present invention, expressing the IPT sequence and increase plant and provide IPT nucleotide sequence to the mode of the tolerance of coercing.In other technical scheme, the IPT constructs that imports in the plant stably is incorporated in the Plant Genome.
The method that increases or keep the seed set in the abiotic stress stage also is provided.In the stage of coercing (for example arid, salt, heavy metal, temperature etc.), embryonic development is normally failed.In corn, the embryonic development of interruption can cause (Cheikh and Jones (1994) the Plant Physiol.106:45-51 of grain abortion in the fringe; Dietrich et al. (1 995) Plant Physiol Biochem33:327-336).Suppress this grain abortion sustainable yield.Therefore, provide the method that increases stress tolerance in plants (for example bloom and inoculate in the growth).Therefore increase the adjustable growth of coercing the flower in stage of expression of IPT sequence of the present invention, provide and kept or improve plant in the method for coercing the process of blooming down.This method comprises level and/or the activity that increases IPT sequence of the present invention.In a method, the IPT nucleotide sequence is introduced in the plant, make IPT polypeptide level and/or active increasing, thereby keep or improve the tolerance of plant under stress conditions.In other method, the IPT constructs that imports in the plant stably is incorporated in the Plant Genome.Referring to for example WO 00/63401.
In the lag period of seed development, adverse environment can cause the significant yield instability.In this stage, seed is in superstructure, biochemistry and the acute variation to the susceptibility of ambient interference, but very little variation only takes place in the dry weight accumulation.Two critical events that take place in lag period are initial sum divisions of albuminous cell and amyloplast (being the site of starch sedimentation).Shown in lag period (pollination back (DAP) is 10-12 days in corn), cytokinin concentration albuminous cell division and amyloplast form reach top speed before sharply increase, show that this hormone plays the role of a nucleus in these processes, be called " the storehouse intensity " of growing seed.Shown that phytokinin is playing an important role aspect definite seed size, reduction top abortion and the set of increase seed under the hostile environment condition.For example, elevated temperature can influence seed formation.Elevated temperature mitogen accumulation capable of inhibiting cell, reduction protoblast separate and the amyloplast number, thereby increase the grain abortion.
The storage capacity of seed forms in albuminous cell and the starch small grain number during 6 to 12DAP at first and plays a major role in the corn.Final albuminous cell that forms and amyloplast number and final grain weight height correlation (Capitanio et al., 1983; Reddy and Daynard, 1983; Jones et al., 1985,1996; Engelen-Eigles et al., 2000).Hormone, but particularly phytokinin irritation cell division, plastid formation and other process important in setting up the grain storage capacity (Davies, 1987).The ZmIPT2 promoter regulation phytokinin level of for example available startup edaphic bacillus IPT genetic expression.Equally, can use endosperm and/or stem to have a liking for the type promotor partially increases ZmIPT2 expression levels and/or time length, thereby increases the phytokinin level, and then increases storehouse intensity and grain output.Capitano，R.，Gentinetta，E.andMotto，M.(1983).Grain weight and its components in maize inbredlines.Maydica 23：365-379。Jones，R.J.，Roessler，J.and Ouattar，S.(1985).Thermal environment during endosperm cell division in maize：effects on number of endosperm cells and starch granules.Crop Science25：830-834。Jones，R.J.，Schreiber，B.M.N.and Roessler，J.(1996).Kernel sink strength capacity in maize：Genotypic and maternalregulation.Crop Science 36：301-306。Davies，G.C.(1987).The planthormones：their nature，occurrences and function.P 1-12.In P.J.Daviesand M.Nijhoff(ed.).Plant hormones and their role in plant growthand development.Dordrecht，the Netherlands。Engelen-Eigles G.，Jones，R.J.and Phillips R.L.(2000).DNA endoreduplication in maizeendosperm cells：the effect of exposure to short-term high temperature.Plant，Cell and Environment 23：657-663。
Therefore the IPT activity that increases in the inflorescence of growing and/or the method for level are provided, thereby have improved the level of phytokinin, make the seed of in adverse environment, growing at volume, reduce and having its whole hereditary potential aspect grain abortion and the set of buffering seed.These methods further can make plant keep in adverse environment and/or improve the process of blooming.
In the technical program, can use the expression that various promotors instruct can increase IPT polypeptide level and/or active sequence, including but not limited to, constitutive promoter, seed are had a liking for type promotor, growth seed or grain promotor partially, meristematic tissue is had a liking for type promotor, stress-inducing promotor and inflorescence partially and had a liking for type (for example female plant is grown the inflorescence promotor) partially.In a method, used and coerced insensitive and in the lag period of expression promoter in growing the tissue of seed.The expression level of " coercing " to be meant the sequence that can be operatively connected with promotor insensitive does not change under stress conditions or very little variation is only arranged." lag period " promotor is in seed development promoters active lag period.This growth period is other local description of this paper." grow seed have a liking for type partially " but be meant enhanced IP T expression promoter in growing seed.These are insensitive to coercing, expression promoter is known in this area in the tissue of the growth seed of development delay phase, comprise Zag2.1 (Theissen et al. (1995) Gene 156:155-166, Genbank sequence number X80206) and mzE40 (Zm40) (United States Patent (USP) 6,403,862 and WO01/2178).
Expression construct can further contain the nucleotide sequence of encoded peptide signal sequence, has changed the level and/or the activity of phytokinin in plastosome or chloroplast(id).Referring to for example Neupert (1997) Annual Rev.Biochem. 66:863-917; Glaser et al. (1998) PlantMolecular Biology 38:311-338; Duby et al. (2001) The Plant J 27 (6): 539-549.
Measuring the method that increases the seed set under the abiotic stress is known in this area.For example, can under various stress conditions, monitor the active plant that increases of IPT, and compare with control plant.For example, contain increase the phytokinin composite reactive plant bloom and the seed set stage can bear coercing of multiple degree.Under the same conditions, the plant comparison of the hereditary change of phytokinin composite reactive increase has the more growth grain of more number according to plant.
Therefore, the present invention further provides in the abiotic stress stage (arid, salt, heavy metal, extreme temperature etc.) and can increase output or keep output and/or the increase or the plant of keeping the process of blooming.In some technical scheme, under abiotic stress, increase or the plant of keeping output has the levels/activity of the IPT polypeptide of the present invention of increase.In some technical scheme, plant contains and starts the IPT nucleotide sequence of the present invention that expression promoter can be operatively connected in the vegetable cell.In some technical scheme, in the genome of this kind of plant stable integration contain and the nucleic acid molecule that starts the IPT nucleotide sequence of the present invention that expression promoter can be operatively connected in the vegetable cell.
VIII. use the method for IPT promotor polynucleotide
The polynucleotide that contain the IPT promotor among the present invention and variant and fragment, thereby, can be used for any host cell, the preferably genetic manipulation of vegetable cell when combining when promoter sequence can be operatively connected with the nucleotide sequence that contains herbicide-tolerant polynucleotide with DNA construct.In this mode, the allos herbicide-tolerant polynucleotide sequence that IPT promotor polynucleotide of the present invention is provided in expression cassette and in target host cell, has expressed.As described in following examples 2, IPT promoter sequence of the present invention is expressed in various tissues, thus the time or the space expression of available these promoter sequence goal of regulation and control polynucleotide.
Synthetic hybrid promoters district is known in this area.This zone comprises the upstream promoter element of certain polynucleotide that the promoter element with another polynucleotide can be operatively connected.In a technical scheme of the present invention, regulate and control heterologous sequence and express by contain the IPT promoter sequence of the present invention or its variant or segmental synthetic hybrid promoters that can be operatively connected with the allogeneic promoter upstream promoter element.Identify the upstream promoter element of involved in plant system of defense, can be used for producing synthetic promoter.Referring to for example Rushton et al. (1998) Curr.Opin.Plant Biol.1:311-315.Optionally, synthetic IPT promoter sequence can be included in the copy of the upstream promoter element of being found in the IPT promoter sequence.
Should be appreciated that promoter sequence of the present invention can use with natural IPT encoding sequence.The DNA construct that contains the IPT promotor that IPT gene natural with it can be operatively connected can be used for transforming any target plant, changes to obtain desired phenotype---for example regulating cell mitogen level, regulation and control root, branch, leaf, flower and embryonic development, stress tolerance and any other phenotype described herein.
The expression of any heterologous nucleotide sequence in promotor nucleotide sequence as herein described and the adjustable host plant of method, thereby the phenotype of change plant.The various changes of phenotype merit attention, and comprise that the aminoacids content of plant, the pathogenic agent defense mechanism of change plant etc. are formed, changed to lipid acid in the regulation and control plant.Express by the expressing heterologous product being provided in plant or increasing endogenous product.Optionally, can realize these results by the expression of one or more endogenous product, particularly enzymes or cofactor in the reduction plant.These variations can cause transforming the phenotypic alternation of plant.
Target gene is commercial market and the reflection that participates in the interests of farm crop exploitation thereof.The change in target farm crop and market and developing country open world market will new farm crop and technology occur.In addition, along with we understand such as the such agronomy proterties of output and hybrid vigour and the increase of feature, will change the selection of the gene that is used to transform thereupon.Usually the classification of target gene comprises, for example, refers to the gene of such participation information such as zinc, such as the gene of the such participation communication of kinases and the gene that such participation is run one's home such as heat shock protein(HSP).The transgenosis classification comprises more specifically, the gene of the agronomy important character of for example encoding, insect-resistant, disease resistance, Herbicid resistant, sterile, grain feature and commercial product.Target gene generally includes participation oil, starch, carbohydrate or Nutrition and Metabolism and those influence the gene of grain size, sucrose content etc.
In a technical scheme, target sequence improves plant-growth and/or crop yield.In the technical scheme more specifically, the expression of target nucleotide sequence has improved plant replying coercing of being brought out under the high-density growth condition.For example, target sequence comprises important function of gene on the agronomy that can improve nascent or lateral root system.These genes including but not limited to, nutrient/water delivery system and growth inducing thing.The example of these genes is including but not limited to, corn plasma membrane H +-ATPase (MHA2) (Frias et al. (1996) Plant Cell 8:1533-44); AKT1, the component of potassium absorption system in the Arabidopis thaliana (Spalding et al. (1999) J GenPhysiol 113:909-18); Activate cell fission round-robin RML gene (Cheng et al. (1995) Plant Physiol 108:881) in the roots and tops cell; Corn NADPH-linked glutamate synthase gene (Sukanya et al. (1994) Plant Mol Biol 26:1935-46) and oxyphorase (Duff et al. (1 997) J.Biol.Chem 27:16749-16752, Arredondo-Peteret al. (1997) Plant Physiol.115:1259-1266; Arredondo-Peter et al. (1997) Plant Physiol 114:493-500, and the document of being quoted).But target sequence also is used to express the antisense base sequences of the gene of negative impact root development.
In addition, can carry out hereditary change by traditional breeding way in addition such as the important character on the such agronomy of oil, starch and protein content.Change and to comprise the increase oleic acid content, saturated and unsaturation oil ratio example change, increase Methionin and sulphur level, provide indispensable amino acid and to the modification of starch.At United States Patent (USP) 5,703, the proteic modification of Hordothionin is described in 049,5,885,801,5,885,802 and 5,990,389, in being incorporated herein as a reference.Another example is at United States Patent (USP) 5,850, the Methionin of the soybean 2S albumin coding of describing in 016 and/or the seed albumen of sulphur enrichment, and the chymotrypsin inhibitor in the barley of in Williamson et al. (1987) Eur.J.Biochem.165:99-106, describing, during document is incorporated herein as a reference.
The derivative that can prepare encoding sequence by site-directed mutagenesis is to increase the amino acid whose level of preliminary election in coded polypeptide.For example, the gene source of coding barley high-lysine polypeptide (BHL) is in the barley chymotrypsin inhibitor, and U.S. Patent application 08/740,682 filed on November 1st, 1996, and WO 98/20133, during these inventions are incorporated herein as a reference.Other albumen comprises such as from sunflower seeds (Lilley et al. (1989) Proceedings ofthe World Congress on Vegetable Protein Utilization in Human Foods andAnimal Feedstuffs, ed.Applewhite (American Oil Chemists Society, Champaign, Illinois), pp.497-502; In being incorporated herein as a reference); Corn (Pedersen et al. (1986) J.Biol.Chem.261:6279; Kirihara et al. (1988) Gene 71:359; In being incorporated herein as a reference) and the vegetable-protein of the methionine(Met) enrichment of paddy rice (Musumura et al. (1989) Plant Mol.Biol.12:123 is in being incorporated herein as a reference).Important function of gene coding milk, Floury 2, somatomedin, seed store the factor and transcription factor on other agronomy.
Insect-resistant gene codified is to greatly reducing the resistance of the insect of output such as carnivorism, caterpillar, European corn borer etc.These genes comprise, for example Bacillus thuringiensis toxic protein gene (United States Patent (USP) 5,366,892; 5,747,450; 5,736,514; 5,723,756; 5,593,881 and Geiser et al. (1986) Gene 48:109) etc.
The gene of the disease-resistant characteristic of encoding comprises the detoxification gene, as anti-fumonosin (U.S.PatentNo.5,792,931); Nontoxic (avr) and disease-resistant (R) gene (Jones et al. (1994) Science266:789; Martin et al. (1993) Science 262:1432; And Mindrinos et al. (1994) Cell 78:1089) etc.
The gene of coding disease resistance proterties comprises such as anti-fumonosin (United States Patent (USP) 5,792,931); Nontoxicity (avr) and disease resistance (R) gene (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432 and Mindrinoset al. (1994) Cell 78:1089) etc. detoxification genes.
The Herbicid resistant proterties comprises that coding can suppress the herbicide resistance gene of acetolactate synthestase (ALS), particularly herbicides of sulfonylurea (acetolactate synthestase (ALS) gene that for example contains the sudden change, the particularly S4 that cause this resistance and/or Hra sudden change) effect, the herbicide resistance gene of the inhibition NADPH-linked glutamate synthase effect that coding such as glufosinates or careless fourth phosphine (being the bar gene) are such, or other this genoid known in the art.The Bar genes encoding is to the resistance of weedicide grass fourth phosphine, and the nptII genes encoding is to the resistance of microbiotic kantlex and Geneticin, and the als gene mutant code is to the resistance of sulfonylurea herbicide.
The sterile gene of also in expression cassette, encoding, the selection that provides physiology to castrate.The example of the used gene of these methods comprises that staminiferous plant is organized and has a liking for the type gene partially and such as in United States Patent (USP) 5,750,868; The such gene of describing in 5,689,051 and 6,281,348 of DAM with the sterile phenotype of staminiferous plant.Other gene comprises that kinases and coding grow the gene of virose compound to staminiferous plant or female plant gametophyte.
The grain quality is by being that the such proterties of cellulosic level reflects such as the level of oil and type, quality and quantity saturated and unsaturated, indispensable amino acid.At United States Patent (USP) 5,703, the hordothionin albumen of modifying in the corn has been described in 049,5,885,801,5,885,802 and 5,990,389.
Also available gene or increase the starch in the alcohol production for example or the gene of the protein expression commercial proterties of encoding is provided.The another kind of important commercial use that transforms plant is to produce such as at United States Patent (USP) 5,602, polymer and the biological plastics described in 321.Help the expression of polyhydroxybutyrate (PHAs) such as the such gene of β-Tong Liuxiemei, PHBase (polyhydroxybutyrate synthetic enzyme) and acetyl-CoA reductase enzyme (with regard to Schubert et al. (1988) J.Bacteriol.170:5837-5847).
The external source product comprises that the enzyme of plant and product and other derive from protokaryon and other Eukaryotic product.These products comprise enzyme, cofactor, hormone etc.The amino acid that can increase albumen, particularly has an improvement distributes to improve the level of the modified protein that plant nutrition is worth.Can realize by expressing this albumen with enhancing aminoacids content.
IX. antibody produces and purposes
Albumen of the present invention be can produce, its variant and segmental antibody comprised at natural form and recombinant forms.The known multiple method for preparing antibody of those skilled in the art.Can use various analytical procedures to produce proteic high-hydrophilic shape of the present invention.These methods can be used for the guidance technology personnel and screen peptide of the present invention, thus produce or screening under immune condition with the antibody of albumen specific reaction of the present invention.Referring to for example J.Janin, Nature, 277 (1979) 491-492; Wolfenden, et al., Biochemistry 20 (1981) 849-855; Kyte and Doolite, J.Mol Biol.157 (1982) 105-132; Rose, et al., Science 229 (1985) 834-838.Antibody can be used for screening such as expression library normal or the particular expression product that paraprotein is such, or changes its level, thereby is used to detect or diagnoses the relevant disease of various and corresponding antigen.For example, indication IPT protein level of the present invention is plant or the specified plant part that high detection method can be used for detecting the phytokinin level with rising.Antibody in the common this program be used in exist antigen/antibody in conjunction with the time group that is detected easily carry out mark.
Below technology is carried out general description; But the technician should recognize that the various changes of carrying out according to following currently known methods are known.
Various immunogens can be used for producing the antibody with albumen specific reaction of the present invention.The present invention isolating reorganization, polypeptide synthetic or natural polynucleotide encoding be the antigen that preferably produces mono-clonal or polyclonal antibody.Before the animal that can produce antibody is injected, can select polypeptide sex change of the present invention or shearing.Can produce mono-clonal or polyclonal antibody is used for following immunoassay the present invention is proteic to exist with content to measure.The method that produces polyclonal antibody is well known by persons skilled in the art.Concise and to the point, with antigen, preferably purifying protein, coupling unite suitable carrier (for example GST, key hole limpet hemocyanin etc.) albumen or be incorporated into such as recombined vaccinia virus (referring to United States Patent (USP) 4,722,848) albumen of such immune carrier mixes with adjuvant, uses the mixture immune animal then.By gathering experiment blood and detecting the reaction titre of target protein is monitored the immunne response of animal to the immunogen goods.Suitable higher during when obtaining at immunogenic antibody titers, then from animal, take a blood sample, and the preparation antiserum(antisera).The affinity costant that special mono-clonal and polyclonal antibody have usually with its homologous monovalent antigen is at least 10 6-10 7, be at least 10 usually 8, 10 9, 10 10Or be higher than 10 11The antibody combining site of liter/mole.If desired, but the antibody of sero-fast further fragmentation enrichment and albumen test is (referring to for example Coligan, Current Protocols in Immunology, Wiley/Greene, NY (1991) and Harlow and Lane, Antibodies:A Laboratory Manual, ColdSpring Harbor Press, NY (1989)).
Can produce antibody by immune animal at predicted segment of the present invention---comprise the reorganization of its binding fragment and strand part, for example segmental coupling matter that is connected with carrier proteins as mentioned above.Typically, the target immunogen is to contain at least 5 amino acid whose albumen, and more typically albumen is grown 10 amino acid, grown 15 to 20 amino acid usually, also can be longer.Peptide typically with carrier proteins coupling connection (for example as fusion rotein) or recombinant expressed in immune carrier.Antigenic determinant with antibodies on the peptide typically grows 3 to 10 amino acid.
From the hybridoma of secreting required antibody, prepare monoclonal antibody.Screening and the protein bound monoclonal antibody of originating as antigen.At for example Basic and ClinicalImmunology, 4th ed., Stites et al., Eds., Lange Medical Publications, LosAltos, in CA and the document quoted thereof, Harlow and Lane, the same; Goding, Monoclonal Antibodies:Principles and Practice, 2nd ed., AcademicPress, New York, NY (1986) and Kohler and Milstein can find the explanation or the technology that prepare monoclonal antibody among the Nature 256:495-497 (1975).Concise and to the point, realize this method with containing the proteic antigen injection of the present invention animal.Kill animals is gathered cell from its spleen then, and merges with the myeloma cell.Can be thereby obtain at hybrid cell or " hybridoma " of external breeding.Screen the hybridoma group then, separate mono-clonal, each mono-clonal secretion is at antigenic single antibody type.By this way, the single antibody type that is obtained is the product of the single B cell unlimited differentiation, the clone that replying of discernible specific site on antigenic substance produced by animal.
Other suitable technique comprises that the recombinant antibodies storehouse of screening phage or same vehicle is (referring to for example Huse et al., Science 246:1275-1281 (1989) and Ward, et al., Nature341:544-546 (1989) and Vaughan et al., Nature Biotechnology, 14:309-314 (1996)).And can produce recombination immunoglobulin.Referring to Cabilly, United States Patent (USP) 4,816,567 and Queen et al., Proc.Nat ' l Acad.Sci.86:10029-10033 (1989).
Antibody at polypeptide of the present invention also is used for affinity chromatography to separate albumen of the present invention.Use the solid support for example can connect antibody---for example such as particles such as agarose, SEPHADEX, prepare pillar, with cell lysate by pillar, rinsing, and handle with the gentle denaturing agent that concentration increases, thus discharge the albumen of purifying.
Common albumen of the present invention and antibody and material that detectable signal is provided carry out mark by ways of connecting covalently or non-covalently.Various marks and coupling technology are known, and wide coverage is all arranged in science and patent documentation.Suitable marker comprises radioactive nuleus thuja acid, enzyme, substrate, cofactor, inhibitor, fluorescence molecule, chemo-immunity group, magnetic bead etc.
Proteic immunodetection
The proteic method that detects among the present invention is not a critical aspects of the present invention.In certain embodiments, albumen is to detect and/or quantitative (referring to for example United States Patent (USP) 4,366,241 with any various known immune binding assays; 4,376,110; 4,517,288 and 4,837,168).About the summary of immunodetection referring to Methods in Cell Biology, Vol.37:Antibodies in Cell Biology, Asai, Ed., Academic Press, Inc.New York (1993); Basic and Clinical Immunology 7th Edition, Stites ﹠amp; Terr, Eds. (1991).In addition, immunodetection of the present invention can use in any form, EnzymeImmunoassay for example, Maggio, Ed., CRC Press, Boca Raton, Florida (1980); Tijan, Practice and Theory of Enzyme Immunoassays, LaboratoryTechniques in Biochemistry and Molecular Biology, Elsevier SciencePublishers B.V., Amsterdam (1985); Harlow and Lane, the same; Immunoassay:A Practical Guide, Chan, Ed., Academic Press, Orlando, FL (1987); Principles and Practice of Immunoassaysm, Price andNewman Eds., Stockton Press, NY (1991) and Non-isotopic Immunoassays, Ngo, Ed., Plenum Press, NY (1988).
Immunity binding assay (or immunodetection) typically uses specific combination and common fixedly " capture agent " of analyte (referring to the albumen among the present invention at this moment).Capture agent is the composition with the analyte specific combination.In certain aspects, capture agent is the antibody with albumen specific combination of the present invention.Antibody can produce by the known any means of the techniques described herein personnel.
Immunoassay is also utilized specific combination and mark capturing reagent and the formed marker that combines mixture of analyte usually.This marker self can be the composition that contains antibody/analyte complex.Therefore, marker can be labelled protein of the present invention or with the traget antibody of albumen specific reaction of the present invention.The antibody of optionally, marker the third composition---for example another kind of and antibody/albumen composition specific combination.
In detection, incubation and/or rinse step are all essential steps after each reagent combination.Incubation step can be generally 5 minutes to 24 hours from 5 seconds to several hours.But the incubation time is depended on detection mode, analyte, liquor capacity, concentration etc.Though the scope of temperature of reaction is very wide---for example 10 ℃ to 40 ℃, detect usually and at room temperature carry out.
The details of immunodetection of the present invention is different because of used particular detection mode, and proteic method of the present invention generally includes with biological sample with the antibody of albumen specific reaction of the present invention and contacts under the immune response condition in the detection of biological sample.Thereby make antibody under the immune response condition with protein binding, can directly or indirectly detect the existence of binding antibody.
A. non-competing detection mode
The proteic immunodetection that detects among the present invention comprises competition and non-competing mode.Non-competing immunodetection is directly to measure the detection method of the amount of the analyte (being albumen of the present invention) of catching.In one embodiment, " sandwich " detection method, capture agent (for example under the immune response condition with the antibody of albumen specific reaction of the present invention) can directly combine with its fixed solid support.But the albumen that exists in this fixed antibody Acquisition Detection sample.Like this, the fixed protein binding marker---the second antibody of tape label for example.Optionally, second antibody can not have marker, but the 3rd antibodies that be labeled conversely, special antibody type at second antibody source.Second antibody can be with modifying such as the such detectable substance of vitamin H, thus can with such as the 3rd such tagged molecule specific combination of the streptavidin of enzyme labelling.
B. compete detection mode
In the competition detection mode, the analyte that the amount of the analyte that exists in the sample is existed in the sample by (external source) analyte (albumen for example of the present invention) that measure to add carries out indirect measurement from the amount that capture agent (for example under the immune response condition with the antibody of albumen specific reaction) substitutes (or under competing).In competition detects, in sample, add the analyte of known quantity, then sample and specific combination proteic capture agent of the present invention is contacted.Be inversely proportional to the concentration of the analyte that exists in the sample with the protein content of capture reagent bind.
In a technical scheme, antibody is fixed on the solid support.With the protein content of antibodies can be by measuring the proteic amount that exists in albumen/antibody complex or optionally measuring remaining unconjugated proteic amount and measure.Proteic amount can detect by labelled protein.
It is another kind of competition detection method that haptens suppresses detection method.In this detection method, with known analyte---albumen for example of the present invention is fixed on the solid support.In sample, add known quantity and antibody albumen specific reaction under the immune response condition, then sample is contacted with fixed albumen.In this case, be inversely proportional to the proteic amount that exists in the sample with ankyrin bonded antibody amount.And the amount of fixed antibody can assign to measure by antibody remainder in detection antibody fixed part or the solution.As mentioned above, can directly detect, wherein antibody is labeled, or carries out indirect detection by the marker that adds subsequently with the antibody specific combination.
C. be used for the generation of the mixed antiserum of immunodetection
Can in immunodetection, detect albumen with antibody specific combination that produces at definite antigen or specific immune reaction.Immunodetection uses the polyclonal antiserum at polypeptide of the present invention (being antigenic peptide).Selected this antiserum(antisera) and other albumen have lower cross reactivity, and any this cross reactivity absorbs and remove (for example use the albumen (for example different enzymes) of different substrate specificities and/or have the same substrate specificity but multi-form proteic antiserum(antisera) carries out immunity absorption) by immunity before using immunodetection.
In order to produce the antiserum(antisera) that is used for immunodetection, press the described separation of preamble polypeptide of the present invention.For example, in Mammals or other eukaryotic cell lines, produce recombinant protein.The inbreeding strain of protein immunization mouse of standard adjuvant that use such as freund's adjuvant is such and standard mouse immunization experiment handbook (, the same) referring to Harlow andLane.Optionally, that derive from the invention sequence and can be used as immunogen with the synthetic polypeptide of carrier proteins coupling connection.Collect polyclonal serum, and, for example come titration immunogen polypeptide with the solid-phase immunoassay that is fixed on the solid support by immunoassay.The screening titre is 104 or higher polyclonal antiserum, and the binding immunoassay detection method---for example above method described in the Harlow and Lane 570-573 detects its cross reactivity to the polypeptide of dissimilar or substrate specificity by competing.Preferably, in this measuring method, use two or more dissimilar polypeptide.These dissimilar polypeptide can be used as the competition thing, identify the antibody with polypeptide specific combination to be measured.The competition polypeptide can the recombinant protein form produces and separates with the albumen chemical technology by standard molecular biology method as herein described.
The immunodetection of competition combination can be used for measuring cross reactivity.For example, immune peptide is fixed on the solid support.The albumen that adds combines antiserum(antisera) with the fixed antigenic competition.Above-mentioned albumen is combined sero-fast ability with immune peptide relatively with the ankyrin competition.Calculate above-mentioned proteic per-cent cross reactivity by standard method.Screening and mix those to the cross reactivity of dissimilar polypeptide less than 10% antiserum(antisera).The immunity of being undertaken by dissimilar polypeptide absorbs and remove the antibody with cross reaction from the blended antiserum(antisera) then.
In described competition binding immunoassay assay method, use immunity to absorb and the blended antiserum(antisera) then, to compare second " target " polypeptide at immune peptide.In order to compare, two peptide species are all tested in the broad concentration range, and have measured the amount that can suppress every peptide species that 50% ankyrin combines with antiserum(antisera) by standard method.If the amount of required target polypeptide is less than the twice of required immune peptide amount, then the target polypeptide is considered to the antibody specific combination that produces with immune protein.For specific final mensuration, carry out fully with immune peptide the blended antiserum(antisera) that immunity absorbs, up in immunity absorbs, not detecting and the combining of used polypeptide.Detect the antiserum(antisera) of immunity absorption fully and the reactivity of polypeptide to be measured then.If there is not reactivity, the antiserum(antisera) specific combination that polypeptide then to be measured and immune protein cause.
D. other detection mode
In certain aspects, use Western trace (immunoblot) analysis to detect and quantitatively be present in the albumen of the present invention of sample.This technology generally includes by the gel electrophoresis based on molecular weight comes sample separation albumen, isolating albumen is transferred on the suitable solid support (for example nitrocellulose filter paper, nylon filter paper or deutero-nylon filter paper), then with sample with hatching with the antibody of albumen specific combination of the present invention.Albumen specific combination on antibody and the solid support.These antibody are mark or use and the traget antibody (for example sheep anti-mouse antibody of mark) of these antibody specific combination detects directly.
E. protein quantification
Albumen of the present invention can detect with quantitative by the known the whole bag of tricks of any those skilled in the art.---for example electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin-layer chromatography (TLC), super diffusion chromatography etc. and various immunization method---for example plain reaction of liquid phase or gel precipitation that comprises the analytical biochemistry method, immunodiffusion(ID) (unidirectional or two-way), immunoelectrophoresis, radioimmunoassay detection method (RIAs), enzyme linked immunological absorption detecting method (ELISAs), immunofluorescence assay etc.
F. reduce non-specific combination
The technician should understand needs to reduce non-specific combination usually in immunodetection and analyte purifying.If detection method relates to antigen, antibody or other when being fixed on capture agent on the upholder, expectation reduces the amount with the non-specific combination of upholder.The method that reduces this non-specific combination is that those skilled in the art are known.Typically, relate to albuminoid and become subpackage to be supported thing.Especially, use always such as bovine serum albumin (BSA), skimmed milk and the such protein ingredient of gelatin.
G. the mark of immunodetection
Labelled reagent can be for example monoclonal antibody, polyclonal antibody, conjugated protein and mixture or such as affinity matrix, carbohydrate or the such polymer of fat.Be applicable to that detectable of the present invention comprises any component that can detect by beam split, radio isotope, photochemistry, biochemistry, immunochemistry, electricity, light or chemical mode.Can detect by any currently known methods---spike, nucleus magnetic resonance, the electron paramagnetic resonance of for example immune marking, Western analysis, gel blocking, fluorescence in situ hybridization analysis (FISH), radioactivity or noclilucence mark, arrhea spectrum, column chromatography, capillary electrophoresis or other method based on the labelled molecule of volume and/or change in electrical charge.Particular marker or detection moiety used in the detection are not critical aspects of the present invention.Detection moiety can be any material with detectable physics or chemical property, comprises magnetic bead, fluorescence dye, radio-labeling, enzyme and colorimetric marker or tinted shade or plastic bead, nucleic acid markers as discussed above.According to methods known in the art, marker can directly or indirectly join with component coupling to be measured.As mentioned above, can use multiple marker, the selection of marker is depended on required sensitivity, the difficulty or ease with compound coupling connection, durability requirements, available instrument and is handled regulation.The mode of certification mark thing is well known by persons skilled in the art.
The non-radioactive marker connects by indirect mode usually.In general, ligand molecular (biological example element) and molecule covalent attachment.Then part detectable with itself or with combine such as detecting the so covalently bound anti-ligand molecular of signalling system (for example streptavidin) of enzyme, fluorescent chemicals or chemiluminescence compound.Can use various parts and anti-part.
Molecule also can be directly and signal produce compound coupling connection, for example with enzyme or fluorophore coupling connection.The target enzyme of thing of serving as a mark is mainly lytic enzyme, particularly Phosphoric acid esterase, esterase and Glycosylase, or oxydo-reductase, particularly peroxidase.Fluorescent chemicals comprises fluorescein and derivative, rhodamine and derivative thereof, red sulphonyl, shape ketone etc. looses.Chemiluminescence compound comprises luciferin, 2,3-dihydrophthalazinediones, for example luminol.Summary to multiple marker of available or signal generation system can be referring to United States Patent (USP) 4,391,904, in being incorporated herein as a reference.
Some detection mode does not need the applying marking component.For example, can use the aggegation detection method to detect the existence of target antibody.In this case, the particle of envelope antigen is contained the sample aggegation of target antibody.In this mode, do not need any component of mark, the existence of target antibody can detect by simple visual observation.
Detect the compound of regulation and control enzymic activity or expression
Catalytic activity polypeptide of the present invention can contact with compound with measure described compound whether in conjunction with also/or regulate and control the enzymic activity of this peptide species.Used polypeptide has 20%, 30%, 40% at least, the specific activity of enzyme natural, total length among the present invention of 50% 60%, 70% or 80%.Usually, polypeptide is in can be enough to measure in the scope of compound effects, typically is about 1nM to 10 μ M.Equally, the concentration of testing compound is that 1nM is to 10 μ M.The technician should understand will control multiple factor---for example enzyme concn, ligand concentration (being substrate, product, inhibition, activator), pH, ionic strength and temperature, thereby obtain useful dynamics data, and whether the compound of mensuration combination or regulation and control polypeptide active exists.The method of measuring enzyme kinetics is known in this area.Referring to for example Segel, Biochemical Calculations, 2 NdEd., John Wiley and Sons, New York (1976).
Technical scheme of the present invention comprises as follows:
1. one kind contains the isolated polypeptide that is selected from following aminoacid sequence:
(a) contain SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 aminoacid sequence;
(b) contain the aminoacid sequence that has 85% sequence identity with SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 at least, wherein said polypeptide has the phytokinin composite reactive;
(c) by under stringent condition with SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73, the aminoacid sequence that the nucleotide sequence of 74 or 76 complementary sequence hybridization is coded, wherein said stringent condition is included in 37 ℃ at 50% methane amide, 1M NaCl, hybridize among the 1%SDS, in 60 ℃ to 65 ℃ rinsings in 0.1X SSC, wherein said polypeptide has the phytokinin composite reactive; And
(d) contain the aminoacid sequence of at least 50 continuous amino acids among the SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77, wherein said polypeptide has the phytokinin composite reactive.
2. one kind contains the isolating polynucleotide that are selected from following nucleotide sequence:
(a) contain SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 nucleotide sequence;
(b) coding contains the nucleotide sequence of SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 aminoacid sequence;
(c) contain the nucleotide sequence that has 85% sequence identity with SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 at least, wherein said polynucleotide encoding has the polypeptide of phytokinin composite reactive;
(d) contain SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 or its complementary sequence in the nucleotide sequence of at least 50 continuous nucleotides; And
(e) under stringent condition with a) in the nucleotide sequence of complementary sequence hybridization of nucleotide sequence, wherein said stringent condition is included in 37 ℃ hybridizes in 50% methane amide, 1M NaCl, 1%SDS, in 60 ℃ to 65 ℃ rinsings in 0.1X SSC.
3. expression cassette that contains the polynucleotide in the technical scheme 2.
4. the expression cassette in the technical scheme 3, wherein said polynucleotide with in plant, start expression promoter and be connected.
5. one kind contains and the plant that starts the polynucleotide that expression promoter is connected in plant, and wherein said polynucleotide contain and are selected from following nucleotide sequence:
(a) contain SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 nucleotide sequence;
(b) coding contains the nucleotide sequence of SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 aminoacid sequence;
(c) contain the nucleotide sequence that has 85% sequence identity with SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 at least, wherein said polynucleotide encoding has the polypeptide of phytokinin composite reactive;
(d) under stringent condition with a) in the nucleotide sequence of complementary sequence hybridization of nucleotide sequence, wherein said stringent condition is included in 37 ℃ and hybridizes in 50% methane amide, 1M NaCl, 1%SDS, in 60 ℃ to 65 ℃ rinsings in 0.1X SSC, wherein said polynucleotide encoding has the polypeptide of phytokinin composite reactive; And
(e) contain SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 or its complementary sequence in the nucleotide sequence of at least 50 continuous nucleotides.
6. the plant in the technical scheme 5, wherein said plant has the phytokinin level of regulation and control.
7. the plant in the technical scheme 6, wherein said phytokinin level is regulated and control in nutritive issue, germinal tissue or nutritive issue and germinal tissue.
8. the plant in the technical scheme 6, wherein said phytokinin level increases.
9. the plant in the technical scheme 6, wherein said phytokinin level reduces.
10. the plant in the technical scheme 5,6,7,8 or 9, wherein said promotor is to organize to have a liking for type promotor, constitutive promoter or inducible promoter partially.
11. the plant in the technical scheme 10, wherein said promotor are roots has a liking for type promotor, leaf partially and have a liking for the type promotor partially, branch has a liking for the type promotor partially or inflorescence is had a liking for the type promotor partially.
12. the plant in the technical scheme 5, wherein said plant has the growth of the flower of regulation and control.
13. the plant in the technical scheme 5, wherein said plant has the growth of the root of regulation and control.
14. the plant in the technical scheme 13, wherein Tiao Kong root development comprises the increase of at least a root growth or the increase of lateral root or adventive root formation.
15. the plant in the technical scheme 5, wherein said plant has the shoot-root ratio of change.
16. the plant in the technical scheme 5, wherein said plant have the seed size of increase or the seed weight of increase.
17. the plant in the technical scheme 16, wherein the increase of seed size or seed weight comprise that idiosome is long-pending, at least one increase in embryo weight, cotyledon volume or the cotyledon weight.
18. the plant in the technical scheme 5, vigor of wherein said plant or biomass yield increase.
19. the plant in the technical scheme 5, the stress tolerance of wherein said plant is kept or is improved.
20. the plant in the technical scheme 19, wherein the plant size increases or keeps.
21. the plant in the technical scheme 19, wherein the abortion of grain top reduces.
22. the plant in the technical scheme 19, the seed set of wherein said plant increases or keeps.
23. the plant in technical scheme 19,20,21 or 22, wherein said promotor be coerce insensitive, and expression in seed tissue of growing in seed development lag period at least and the relevant female parent tissue.
24. the plant in the technical scheme 5, the growth of the branch of wherein said plant reduces.
25. the plant in the technical scheme 5, wherein said The Plant Senescence postpones or the increase of nourishing and growing.
26. the plant of technical scheme 5 to 9,12 to 22,24 and 25 in any one, wherein said polynucleotide stably are incorporated in the Plant Genome.
27. the transformed the seed of the plant in the claim 26.
28. carry out the plant of genetic modification at natural gene group seat, described genome seat coding is selected from following polypeptide:
(a) contain SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 aminoacid sequence;
(b) contain the aminoacid sequence that has 85% sequence identity with SEQ ID NO:SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 at least, wherein said polypeptide has the phytokinin composite reactive;
Wherein said plant is genetically modified to increase, to reduce or remove the activity of described polypeptide.
29. technical scheme 5 to 9,12 to 22,24 to 28 plant in any one, wherein said plant is a monocotyledons.
30. the plant in the technical scheme 29, wherein said monocotyledons are corn, wheat, paddy rice, barley, jowar or rye.
31. technical scheme 5 to 9,12 to 22,24 to 28 plant in any one, wherein said plant is a dicotyledons.
32. a method that reduces or remove polypeptide active in the plant comprises to described plant importing the polynucleotide that contain SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 segmental or described segmental complementary sequence.
33. the method in the technical scheme 32, wherein said polynucleotide can reduce phytokinin level in the described plant.
34. the method in the technical scheme 32, the activity of wherein said polypeptide are reduction in nutritive issue, germinal tissue or nutritive issue and germinal tissue or remove.
35. the method in the technical scheme 32, the polynucleotide of wherein said importing are had a liking for type promotor, constitutive promoter or inducible promoter partially and are connected with organizing.
36. being roots, the method in the technical scheme 35, wherein said promotor have a liking for the type promotor partially.
37. the method in the technical scheme 32, the growth that wherein reduces or remove the adjustable roots of plants of described polypeptide active.
38. the method in the technical scheme 37, wherein Tiao Kong root development comprises the increase that at least a root growth increase or lateral root or adventive root form.
39. a method that increases polypeptide level in the plant comprises importing in described plant containing the polynucleotide that are selected from following Nucleotide:
(a) contain SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 nucleotide sequence;
(b) coding contains the nucleotide sequence of SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 aminoacid sequence;
(c) contain the nucleotide sequence that has 85% sequence identity with SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 at least, wherein said polynucleotide encoding has the polypeptide of phytokinin composite reactive;
(d) contain SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 or its complementary sequence in the nucleotide sequence of at least 40 continuous nucleotides; And
(e) under stringent condition with a) in the nucleotide sequence of complementary sequence hybridization of nucleotide sequence, wherein said stringent condition is included in 37 ℃ and hybridizes in 50% methane amide, 1M NaCl, 1%SDS, in 60 ℃ to 65 ℃ rinsings in 0.1X SSC, wherein said polynucleotide encoding has the polypeptide of phytokinin composite reactive.
40. the method in the technical scheme 39, wherein expressing described polynucleotide can increase phytokinin level in the plant.
41. the method in technical scheme 39 or 40, wherein the polypeptide level increases in nutritive issue, germinal tissue or nutritive issue and germinal tissue.
42. the method in technical scheme 39 or 40, wherein said promotor are to organize to have a liking for type promotor, constitutive promoter or inducible promoter partially.
43. the method in the technical scheme 42, wherein said promotor are roots to be had a liking for type promotor, leaf partially and has a liking for type promotor, branch partially and have a liking for type promotor, seed partially and have a liking for partially that type promotor, grain are had a liking for the type promotor partially or inflorescence is had a liking for the type promotor partially.
44. the method in technical scheme 39 or 40, the stress tolerance of wherein said plant is kept or is improved.
45. the method in the technical scheme 44, wherein the plant size increases or keeps.
46. the method in the technical scheme 44, wherein seeds abortion reduces.
47. the method in the technical scheme 44, the seed set of wherein said plant increases or keeps.
48. the method in the technical scheme 44, wherein said promotor are to coerce insensitively, and express in the seed tissue of growing in the development delay phase.
49. the method in technical scheme 39 or 40 wherein increases the shoot growth that the polypeptide level can increase plant.
50. the method in technical scheme 39 or 40 wherein increases seed size or seed weight that polypeptide active can increase plant.
51. the method in the technical scheme 50, wherein seed size of Zeng Jiaing or seed weight comprise that idiosome is long-pending, at least one increase in embryo weight, cotyledon volume or the cotyledon weight.
52. the method in technical scheme 39 or 40 wherein increases plant biomass or plant vigor that polypeptide active can increase described plant.
53. the method in technical scheme 39 or 40 wherein increases the growth of the adjustable flower of polypeptide active.
54. the method in technical scheme 39 or 40, but wherein increase polypeptide level delay senility or increase the growth of leaf.
55. the method for technical scheme 32-40 in any one, wherein said plant is a dicotyledons.
56. the method for technical scheme 32-40 in any one, wherein said plant is a monocotyledons.
57. the method in the technical scheme 56, wherein said monocotyledons are corn, wheat, paddy rice, barley, jowar or rye.
58. isolating polynucleotide that contain the nucleotide sequence of SEQ ID NO:25 or 75.
59. a DNA construct that contains the promotor that is connected with target Nucleotide, wherein said promotor contains the polynucleotide in the technical scheme 58.
60. expression vector that contains the DNA construct in the technical scheme 59.
61. a plant that contains the DNA construct of being made up of the allos target nucleotide sequence that is connected with promotor at least, wherein said promotor comprises SEQ ID NO:25 or 75.
62. the plant in the claim 61, wherein said DNA construct stably is incorporated in the Plant Genome.
63. the plant in technical scheme 61 or 62, wherein said plant is a dicotyledons.
64. the plant in technical scheme 61 or 62, wherein said plant is a monocotyledons.
65. the plant in the technical scheme 63, wherein said monocotyledons are corn, wheat, paddy rice, barley, jowar or rye.
66. the plant in technical scheme 61 or 62, wherein said target dna sequence coded polypeptide.
67. comprising, the method that the goal of regulation and control nucleotide sequence is expressed, described method in plant, introduce the DNA construct that contains the target heterologous nucleotide sequence that is connected with the promotor of forming by nucleotide sequence in the technical scheme 58.
68. the method in the claim 67, wherein said DNA construct stably is incorporated in the Plant Genome.
69. the method in technical scheme 67 or 68, wherein said plant is a dicotyledons.
70. the method in technical scheme 67 or 68, wherein said plant is a monocotyledons.
71. the method in the technical scheme 70, wherein said monocotyledons are corn, wheat, paddy rice, barley, jowar or rye.
72. the method in technical scheme 67 or 68, wherein said target dna sequence coded polypeptide.
Following embodiment is exemplary, but not determinate.
Embodiment
The clone of embodiment 1.ZmIPT1 and gene expression characteristics
We describe evaluation and feature from the IPT polypeptide of the called after ZmIPT1 of corn hereinafter.
Material and method: use ZmIPT1 cDNA3 ' terminal fragment screening Mo17BAC library, by identifying with the sequence identity of edaphic bacillus ipt from B73.Wherein 1 positive colony digests with HindII, and subclone is in pBluescript.Is probe screening recombinant plasmid by colony screening with 3 ' terminal fragment.To 1 positive colony order-checking.Results are used for the sample of RT-PCR from 3 independent plant.Carry out RT-PCR with the ThermoScript RT-PCR system of the total RNA of 5 μ g by Invitrogen.The reverse transcription mixture carries out PCR with the intron-exon-intron connection that strides across of design with the primer of avoiding amplifying genom DNA.
The result:
The protein sequence of A. inferring:
Identified two corn ipt ESTs that infer, aminoacid sequence that it is inferred and edaphic bacillus (data not shown), Arabidopis thaliana and petunia IPT albumen (Fig. 1) have similarity.They are identical for the full insertion sequencing result codings of these two ESTs, corresponding cDNA called after ZmIPT1 (SEQ ID NO:22).
Fig. 1 provides the amino acid comparison of ZmIPT1, Arabidopis thaliana and petunia cytokinin-biosynthesizing enzyme.Asterisk is illustrated in amino acid conservative in a plurality of cytokinin-biosynthesizing enzymes.The amino acid of underscore is represented the ATP/GTP binding site (at amino acid 84-90) of inferring.The ZmIPT1 protein sequence of inferring as shown in Figure 1, contains the used isolating definite conserved sequence from arabidopsis gene of Takei et al. (2001) J.Biol.Chem.276:26405-26410
GxTxxGK[ST] xxxxx[VLI] xxxxxxx[VLI] [VLI] xxDxxQx{57,60}[VLI] [VLI] xGG[ST] (SEQ ID NO:32) (wherein x represents any amino-acid residue, [] expression is presented at any amino acid in [], x{m, n}m is to n amino acid).Notice that ZmIPT1 also has the ATP/GTP binding site of inferring at amino acid 51-58.In addition, the length of ZmIPT1 and AtIPT4 and Sho gene are closely similar.In addition, the special zinc of finding in all eucaryon tRNAIPTs refers to that (CxxCx{12,18}HxxxxxH) (SEQID NO:33) (this is essential in conjunction with the tRNA molecule) is not present among the ZmIPT1 similar elements.
ZmIPT1 sequence and total length Sho (the phytokinin synthetic proteins in the petunia) have 21.9% amino acid sequence identity (34.1% similarity); Has 10.8% identity (21.2% similarity) with total length ipt (edaphic bacillus); Has 24.7% identity (34.8% similarity) with total length AtIPT1 (Arabidopis thaliana); Has 35.6% identity (45.3% similarity) with total length AtIPT2 (Arabidopis thaliana); Has 22.4% identity (34.6% similarity) with total length AtIPT3 (Arabidopis thaliana); Has 20.7% identity (31.6% similarity) with total length AtIPT4 (Arabidopis thaliana); Has 22.7% identity (35.7% similarity) with total length AtIPT5 (Arabidopis thaliana); Has 21.8% identity (36.4% similarity) with total length AtIPT6 (Arabidopis thaliana); Has 23.4% identity (33.1% similarity) with total length AtIPT7 (Arabidopis thaliana); Have 26.3% identity (35.9% similarity) and have 18.9% identity (31.2% similarity) with total length AtIPT8 (Arabidopis thaliana) with total length AtIPT9 (Arabidopis thaliana).
ZmIPT1 is provided sequence variants.SEQ ID NOS:22,23 and 24 ZmIPT1 Nucleotide and aminoacid sequences corresponding to the shearing sequence of Mo17 genomic clone source.SEQ IDNOS:26,27 and 28 is the variants from the ZmIPT1 sequence of the total length EST order-checking of B73.The comparison of ZmIPT1 and variant thereof is presented among Fig. 3.These sequences have 98% amino acid sequence identity.
B. gene structure
Probe screening Mo17 BAC library by corresponding to two ESTs screens 4 identical clones.With 1 clone's wherein 11kb HindIII fragment subclone in pBluescript and check order.The comparison that EST clones full insertion sequence shows 6 introns of existence.What is interesting is from the AtIPT4 gene of Arabidopis thaliana with from the Sho gene of petunia and all do not contain intron.Classify the gene order of ZmIPT1 as SEQ ID NO:21.
The genetic expression of embodiment 2.ZmIPT1
Wherein the ZmIPT1 ESTs of 1 evaluation is from B73 embryo library, other the library from the root of growing.In order to obtain the expression level of ZmIPT1, carried out the Lynx database search.3 ' end at gene is found an ideal label from poly-A tail 231bp.In table 1, list types of organization, library matching number and average ppm.In most organs, express all lower, but higher in seedling and embryo library.In the embryo library, the etap height (Fig. 4) after the expression ratio of 10DAP.
Table 1 contains the Lynx library number and the average ppm value of ZmIPT1 label.
Types of organization The #Lynx library Average ppm
Seedling
1 29
Fringe 5 4
Endosperm 2 8
Embryo 4 10.75
Stem 1 9
Leaf 2 3
Root 2 2.5
Detected the expression map of various corn organs by RT-PCR at grain growth period ZmIPT.After 20 circulations, do not detect amplified production, illustrate that expression of gene is very low.But after 30 circulations, the band of the suitable size that can increase (Fig. 5).Fig. 5 A has shown that the ZmIPT1 transcript is present in leaf, mesocotyl and the root of the ovary of ripe plant and seedling.This distribution illustrates the inclined to one side preferendum that this gene is expressed in similar and that grow fast tissue with meristematic tissue.In the B73 grain of growing (Fig. 5 B), the ZmIPT1 transcript exists to 10DAP strongly 0, reduces at 15DAP then.The known collection of illustrative plates of phytokinin is relevant in the expression map of ZmIPT1 and the known growth grain, reaches peak value in lag period.The accumulation of phytokinin can start the early stage cell fission in endosperm and the embryonic development.
Equally, the ZmIPT1 label only is detected in the blade that the cell fission district and the BA of leaf handle.The distribution of this transcript shows the inclined to one side preferendum that ZmIPT1 expresses in meristematic tissue tissue similar and that grow fast, illustrate that the root of corn and the grain of growth are the main sites of phytokinin synthetic.
Embodiment 3.ZmIPT2, ZmIPT4, ZmIPT5, ZmIPT6, ZmIPT7, ZmIPT8 and ZmIPT9 separate and evaluation
AtIPT1 and AtIPT3 are carried out blasted to the AtIPT8 protein sequence at 6 possible reading frames that corn gene group sequence produces, search similarity to a certain degree.Because paddy rice and corn gene group have colinearity significantly, so use same procedure to optimize this search at the rice genome database.Be at least 200 paddy rice sequence with the E value then and search for GSS corn database once more.Because the GSS database is not arranged to contig, so the E value that obtains is at least 150 sequence merging and compares by Sequencher.
Can identify that by this method 8 codings infer the contig of CK synthetic enzyme (ZmIPT2 is to ZmIPT9), wherein 6 open reading frame does not have intron.The translation albumen of corresponding these genes of inferring contains 320 to 380 amino acid, and this conforms to plant IPT albumen expection size.The deck watch of corresponding protein is shown in Fig. 1.The protein sequence that new ZmIPT gene (except the ZmIPT8) is inferred contains the definite sequence of finding in the IPT albumen not of the same race.This sequence GxTxxGK[ST] xxxxx[VLI] xxxxxxx[VLI] [VLI] xxDxxQx{57,60}[VLI] [VLI] xGG[ST] (wherein x represents any amino-acid residue, [] is illustrated in any amino acid in [], x{m, n}m is to n amino acid) (SEQ ID NO:32) also find in ZmIPT1, is used to separate the IPT gene of Arabidopis thaliana in the past by Kakimoto and Takei.With the proteic homology of other plant IPT be 40%.
List in the following table 2 with the full length amino acid sequence identity of ZmIPT2, ZmIPT4, ZmIPT5, ZmIPT6, ZmIPT7, ZmIPT8 and ZmIPT9 and the highest BLAST coupling of similarity.
Table 2
Gene 34394150 (paddy rice) AtIPT5 (Arabidopis thaliana)
Similarity Identity Similarity Identity
ZmIPT2 55.15 46.51 53.02 45.30
ZmIPT4 74.05 69.68 58.70 53.73
ZmIPT5 71.99 65.96 60.70 55.59
ZmIPT6 71.86 64.67 59.62 53.53
ZmIPT7 58.63 50.16 59.36 51.94
ZmIPT8 54.71 47.72 46.73 38.89
Corn IPT sequence to ZmIPT2 at amino acid/11 7-24, to ZmIPT4 at amino acid 72-79, to ZmIPT5 at amino acid 57-64, to ZmIPT6 at amino acid 55-62, ZmIPT7 at amino acid 23-30, also had the ATP/GTP binding site of inferring to ZmIPT8 at amino acid 83-90.
Polypeptide and known protein by the ZmIPT polynucleotide encoding have sequence similarity.For example, the amino acid 48 to 327 by the tRNA prenyltransferase of Nucleotide 821 to 3 encoded polypeptides of ZmIPT9 and Arabidopis thaliana has 55% amino acid sequence identity (GenBank accession number BAB59048.1).The amino acid 48 to 327 of the IPP transferring enzyme of being inferred by Nucleotide 821 to 3 encoded polypeptides and the Arabidopis thaliana of ZmIPT9 has 55% amino acid sequence identity (GenBank accession number AAK64114.1).Has 55% amino acid sequence identity (GenBank accession number AAM63091.1) by amino acid 48 to 327 like Nucleotide 821 to 3 encoded polypeptides of ZmIPT9 and the Arabidopis thaliana IPP transferase.The amino acid 28 to 278 of the tRNA σ-2-isopentenylpyrophosphate transferring enzyme of being inferred by Nucleotide 839 to 3 encoded polypeptides and the Arabidopis thaliana of ZmIPT9 has 36% amino acid sequence identity (GenBank accession number YP_008242.1).Amino acid/11 7 to 248 by the tRNA isopentenylpyrophosphate transferring enzyme of Nucleotide 824 to 3 encoded polypeptides of ZmIPT9 and streptococcus pneumoniae R6 has 35% amino acid sequence identity (GenBank accession number NP_358182.1).Has 34% amino acid sequence identity (GenBank accession number Q8CWS7) by Nucleotide 818 to 3 encoded polypeptides of ZmIPT9 and the amino acid 2 to 231 of tRNA σ (2)-isopentenylpyrophosphate transferring enzyme.Amino acid 2 to 231 by the tRNA isopentenylpyrophosphate transferring enzyme of Nucleotide 818 to 3 encoded polypeptides of ZmIPT9 and streptococcus pneumoniae R6 has 34% amino acid sequence identity (GenBank accession number NP_345176.1).Has 34% amino acid sequence identity (GenBank accession number AAP05599.1) by Nucleotide 818 to 3 encoded polypeptides of ZmIPT9 and the amino acid 31 to 275 of the chlamydial tRNA σ of cavy preferendum (2)-isopentenylpyrophosphate transferring enzyme.Amino acid 6 to 133 by tRNA σ (2)-isopentenylpyrophosphate transferring enzyme of Nucleotide 818 to 435 encoded polypeptides of ZmIPT9 and xyllela fastidiosa 9a5c has 48% amino acid sequence identity (GenBank accession number NP_297383.1).Amino acid 6 to 133 by tRNA σ (2)-isopentenylpyrophosphate transferring enzyme of Nucleotide 818 to 435 encoded polypeptides of ZmIPT9 and xyllela fastidiosa Dixon has 48% amino acid sequence identity (GenBank accession number xyllela fastidiosa Dixon).
The Molecular Identification that embodiment 4. separates ZmIPT2 and ZmIPT2 gene from Mo17 and B73 corn system
Material and method:
Vegetable material: in this research, use corn (Zea mays) variant B73 and Mo17.Gather in the crops the sample of wild plant in development in different stages, and be kept at-80 ℃.From 0 to 25DAP every 5 days results grain sample, and by the whole grain of cutting and separating (0DAP), bennet, megarchidium and pericarp (5DAP), bennet, megarchidium, endosperm/blastular and pericarp (10DAP) or bennet, embryo, endosperm and pericarp (15,20 and 25DAP).Collection is corresponding to the tissue of 2 to 4 different fringes.Use every DAP from 0 to 5 (whole grain), from 6 to 15 and 20,27 and 34DAP (seed of no pericarp) or 20,25,30 and the sample series of 35DAP (bennet) results study expression map (the Brugiere et al. of cytokinin oxidase 1 gene (Ckx1) the corn, 2003, the same).
Carry out Study on Transformation with Colombia's wild-type Arabidopis thaliana.
PCR: pcr amplification ZmIPT2 encoding sequence from B73 and Mo17 genomic dna.Based on GSS contig sequences Design primer ZmIPT2-5 ' (5 '-ATCATCAAGACA ATGGAGCACGGTG-3 ') (SEQ ID NO:78) and ZmIPT2-3 ' (5 '-CGTCCGCTAGCTACTTA TGCATCAG-3 ') (SEQ IDNO:79) (underscore is an encoding sequence).As the part of gateway cloning program, usefulness primer ZmIPT2-5-Gatewdy (5 '-GGGGACAAGTTTGTACAAAAAAGCAGGCTCAATGG-AGCACGGTGCCGTCGCCG-3 ') and (SEQ ID NO:80) and ZmIPT2-3-Gateway (5 '-GGGGACCACTTTGTACAA-GAAAGCTGGGTCTTATGCATCAGCCACGGCGGTG-3 ') (SEQ IDNO:81) amplification att-side ZmIPT2 fragment.
In each case, by following cycling condition PCR (GeneAmp PCRSystem 9700): the 94 ℃ of 2min (1 circulation) that fall progressively, 94 ℃ of 30s, 65 ℃ of 45s and 72 ℃ of 1min 30s (5 circulations, each cycle annealing temperature reduces by 1 ℃), 94 ℃ of 30s, 60 ℃ of 45s and 72 ℃ of 1min 30s (30 circulations), 72 ℃ of 7min, 4 ℃ of terminations.Use the Pfu Ultra HotstartDNA polysaccharase (Stratagene) of harmonic(-)mean error rate (every 500-bp amplified fragments is less than 0.5%).
With sample on the PCR product to contain the pyridine of bromination second (1: 10000, in sepharose v/v).Reclaim the band that corresponds to ZmIPT2 gene att-side ZmIPT2 gene with QIAquick PCR purification kit (QIAgen) glue.
DNA and RNA extract: extract genomic dna in the V3-4 stage according to Dellaporta et al. (1983) Plant Mol Biol1:19-21 from B73 and Mo17 plant sample, and be stored in-20 ℃.Prepare total RNA according to Verwoerd et al. (1989) Nucleic Acid Res 17:2362 with hot phenol extraction program, and be stored in-80 ℃.With RNeasy Mini Protocolfor RNA Cleanup (QIAgen) purifying grain developmental sequence sample, and with 50 μ l DEPC water elutions.With 260 and the purity of the optical density(OD) (DO) of 280nm estimation RNA prepared product, and measure RNA and DNA concentration.
Southern trace s, Northern trace s and hybridization: for Southern trace s, with digestion genome or the BAC cloned DNA at 0.8% sepharose at the 110V electrophoresis, the migration back was dyeed following then the transfer at 1: 10000 in (v/v) bromination second pyridine solution-TAE damping fluid.For Northern trace s, the pyridine of bromination second is added in the RNA sample of sex change, and in 1.5% sex change sepharose, carries out electrophoresis (Brugiere et al. (2003) Plant Physiol.132:1228-1240) at 80V.According to specification sheets Turbo-blotter (Schleicher ﹠amp; Schuell) carry out trace.After the transfer, with nylon membrane (Nytran plus, Schleicher ﹠amp; Schuell) crosslinked with Stratalinker (Stratagene), and at 80 ℃ of baking 30min.Use by extending at random [α- 32P]-dCTP labeled primer (Rediprime IIRandomPrime Labelling System, Amersham Biosciences), and with QuickSpin Columns (Roche) purifying.Hybridize 16h with ExpressHyb hybridization solution (BD Biosciences) at 65 ℃, and (0.1xSSC 0.1%SDS) washes film (Brugiere et al. (2003) Plant Physiol.132:1228-1240) under foregoing stringent condition.The abundance of relative transcript is carried out quantitatively by imaging software (ImageQuant, Molecular Dynamics) with phosphor imager (MD860, Molecular Dynamic).
The BAC subclone: digestion BAC clone and subclone are in pBluescript SK+.This plasmid comprises a multiple clone site between lacZ gene and promotor thereof.The lacZ gene is because the coding tilactase therefore usually as reporter gene, can produce the Hei Lanse precipitation by the X-gal enzymic hydrolysis.Being contained in the segmental plasmid of multiple clone site insertion BAC makes bacterium be revealed as white owing to not synthesizing this kind of enzyme.Thereby can screen the clone who contains the BAC subclone, further screen by PCR or Southern trace.
The result:
Separate the ZmIPT2 gene from corn gene group DNA: extract from two different variant B73 of corn and the genomic dna of Mo17, and by the pcr amplification ZmIPT2 encoding sequence that falls progressively.The ZmIPT2 gene amplification product is as the probe of Southern and Northern Blot experiment.Be cloned into ZmIPT2 CDS among the pDONR221 (Invitrogen) and check order.Mo17 sequence and GSS contig sequence 100% homology.Homology at nucleotide level B73 and Mo17 gene is 98.8%.Two genes cause at protein level 3 amino acid whose changes (96.1% identity) being arranged in the difference of nucleotide level.The Nucleotide of ZmIPT2 and aminoacid sequence are SEQ ID NO:3 and 2, and the Nucleotide of ZmIPT2 variant and aminoacid sequence are SEQ ID NO:76 and 77.The comparison of ZmIPT2 and ZmIPT2 variant shows that the difference of polypeptide occurs in amino acid/11 25 (A → L), amino acid/11 38 (Q → R) and amino acid/11 93R → H.
The mapping of gene in the corn gene group: in order to measure ZmIPT2 is single copy or multi-copy gene in corn, with HindIII, EcoRI and EcoRV digestion B73 and Mo17 genomic dna, and in gel electrophoresis, as described in material and method part, carry out trace.Is that probe is hybridized with film with the ZmIPT2 genomic fragment that extracts in the past.The radioautograph picture of film as shown in Figure 6.
Single carrying means ZmIPT2 of each of this digestion more may be single copy gene.For the HindIII fragment determine with BAC clone.In order to obtain out of Memory, used oat-maize chromosome to add system (Ananiev et al. (1997) Proc.Natl.Acad.Sci.94:3524-3529) about the physical location of ZmIPT2 gene in the corn gene group.Use ZmIPT2-5 ' and ZmIPT2-3 ' primer as described in material and method part, to carry out PCR (data not shown).The expection size of amplified fragments is 995bp.With the positive contrast of B73 genome DNA sample, and oat gene group DNA and water belongs with yin contrast.
Data show the amplification of only adding visible ZmIPT2 gene in the system at karyomit(e) 2 oats-corn.This result is proved by bioinformatics method, and determines the position on karyomit(e) 2.The ZmIPT2 sequence is at first as screening B73 and the public and individual bacterial artificial chromosome of Mo17 (BAC) library.Identify positive colony and identify the BAC contig by FPC Contig Viewer.By this strategy, can identify to comprise the marker of several physical maps at the MZA of maize chromosome 2 mark, bin 4 (data not shown), this can be an experimental patterns of determining the ZmIPT2 gene by OMA.
The genetic expression of embodiment 5.ZmIPT2, ZmIPT4, ZmIPT5, ZmIPT6 and ZmIPT8
In order to obtain the expression level of various ZmIPT sequences, the Lynx database is searched for.Types of organization, library matching number and average ppm list in table 3-7.
As shown in table 3, the expression of ZmIPT2 is limited in the grain tissue, and with grain in phytokinin synthetic initial relevant, as Brugiere et al. (2003) Plant Physiol.132 (3): as described in the 1228-1240.Fig. 9 provides the diagram of the ppm value of ZmIPT2 in Lynx embryo library.Other ZmIPT expression of gene is lower, and the possible function of root, meristematic tissue and albuminous cell mitogen synthetic enzyme is consistent with for example organize at other.Referring to following table 4-7.
Table 3. contains the Lynx library and the ppm value of ZmIPT2 label.
Types of organization The #Lynx library Average ppm
Endosperm＜10DAP 2 393
Corn embryosperm＞10DAP 1 5
Embryo 2 17
Whole grain＜10DAP 2 10
Whole grain＞10DAP 4 11
Fringe 2 20
Pericarp 1 5
Pith 1 5
Table 4. contains Lynx library and the ppm value of ZmIPT4.
Types of organization The #Lynx library Average ppm
Embryo 15DAP
1 5
Root 3 33
Table 5. contains the Lynx library and the ppm value of ZmIPT5 label.
Types of organization The #Lynx library Average ppm
Root V6 or still less 9 4.8
Root V12-R1 1 91
Seedling 4 3.5
Leaf 5 5.2
Embryo 11DAP 1 3
Stem 4 33.25
Sheath and shell 2 1
Tassel and fringe 1 2
Fringe 0DAP 1 7
Shell 2 2.5
Pulvinus 1 7
Table 6. contains the Lynx library and the ppm value of ZmIPT6 label.
Types of organization The #Lynx library PPM
Root V6 or still less 7 6
Root V12-R1 1 0
The seedling mesocotyl 1 5
Palpus or fringe bud 5 6
The R1 apical meristem 1 23
The V3 phyllopodium 1 1
Stem 4 19
Root 2 13
Table 7. contains the Lynx library and the ppm value of ZmIPT8 label.
Types of organization The #Lynx library Mean P PM
Prematurity fringe base 1 3
The fringe meristematic tissue 1 9
Endosperm 1 7
Inbrde anti-rotten stem 1 12
Inbrde responsive stem 1 5
The expression of embodiment 6.ZmIPT2 gene in corn tissue
Studied the expression map of ZmIPT2 in the different steps Different Organs with provide about its phytokinin synthetic aspect the information of effect.As if based on Lynx data (as described in embodiment 5), the expression of ZmIPT2 is limited in the grain of growth (Fig. 9).In order to obtain the Global Information that ZmIPT2 expresses in corn, and checking Lynx data, organize from different B73 with 25DAP in 0,5,10,15,20---leaf, stem, root and whole grain extraction RNA.The total RNA of 40 μ g of each sample is dyeed with the pyridine of bromination second, and go up sample in sepharose.The band that obtains with [α- 32P]-the ZmIPT2 probe hybridization of dCTP mark.In second hybridization, use the cyclophilin probe to contrast as last sample.After quantitative, with the relatively back expression ratio of calculating ZmIPT2 of cyclophilin with phosphor-imager.Cyclophilin is considered to (Marivet et al. (1995) the Mol Genet Gen247:222-228 of constitutive expression in Different Organs.The result is presented at Fig. 7.The level of ZmIPT2 transcript in leaf, stem and root that detects is very low, but the higher level in grain is lower in the 0DAP expression, and expressing from 5 to 10DAP increases, and reduces from 15 to 25DAP expression.This expression map is not only verified the Lynx data, and relevant with the appearing and subsiding of CK in the grain (referring to embodiment 5).
In order to obtain ZmIPT2 accurate expression map in grain, measured 0-and be with the grain of pericarp, 6-not to have the level that reaches ZmIPT2 transcript in 6 to the 42DAP independent bennets in the pericarp grain to 34-DAP to 5-DAP.Referring to Fig. 8.As previously mentioned, go up the sample gel with the total RNA of 40 μ g, with bromination second pyridine dyeing, and on nylon membrane trace.With the ZmIPT2 probe hybridization of film with the 32P-dCTP mark.With the Northern experimental result of " seed of no pericarp " sample show the ZmIPT2 expression level 0 and 4DAP very low.Expression is since 5 to 8DAP increases, and peak value reduces up to 14DAP then at 8DAP.As if in its latter stage (15 to 34DAP), transcriptional level begins again to increase.But unclear whether this is the result that cyclophilin is expressed reduction.This phenomenon is also found in Ckx1 expresses (Brugiere et al. (2003) Plant Physiol132:1228-1240).In the Northern experiment with the bennet sample, transcriptional level sharply increases from 6 to 10DAP, and peak value slowly reduces up to 15DAP then at 10DAP.Find once more that in this experiment as if transcriptional level raise again at its latter stage, but do not know that this is whether because cyclophilin expresses to reduce causes.In this experiment, corresponding to " not having the bennet seed " sample in contrast at 9DAP, to compare with other trace.The relative expression of 9DAP is 4 times of contrast, show ZmIPT2 to be expressed in the bennet rest part than seed higher.This species diversity and the CK level fact higher 2 times than seed rest part in bennet is consistent (Brugiere et al. (2003) Plant Physiol 132:1228-1240).
The transcript level is compared with the ZR concentration of measuring in same sample (solid line among Fig. 8) relatively.What is interesting is, in bennet the accumulation of the expression of ZmIPT2 and ZR overlapping well, and comprise its latter stage in the seed other parts, it shifts to an earlier date a little than ZR peak value.
Integrate, these results show that ZmIPT2 all is transient expressions in the grain growth period at bennet and seed rest part, and its with grain in the expression map of ZR horizontal parallel and ZmIPT2 be consistent as the effect of CK synthase gene.
Also studied the expression of ZmIPT2 in different grain tissues in the different grain tissues.In this research, use be cut apart from 0 to 25DAP grain sample.Collect sample from the Johnston's of U.S. Iowa field.Grain is divided into different piece (bennet, megarchidium, endosperm/blastular, endosperm, embryo and pericarp) according to the stage.Total RNA with 30 μ g purifying goes up the sample gel, with bromination second pyridine dyeing, and carries out the trace reaction on nylon membrane.
Result as shown in figure 11 shows that ZmIPT2 transcript level is abundanter than seed rest part in bennet.Particularly, at this moment in the embryo sample, also find some expression 15,20 and 25DAP.But at 10DAP, the ZmIPT2 transcript has identical amount in the endosperm/blastular of growing and bennet.Comprehensive true 1) phytokinin in bennet than seed rest part abundanter and 2) cytokinin oxidase transcript and activity are also than seed rest part abundanter (Brugiere et al. (2003) Plant Physiol.132:1228-1240) in this organ, these results show that bennet more may be the main position of CK synthetic.The expression that the nearest data of expressing about Arabidopis thaliana IPT make us infer ZmIPT2 may occur in is responsible for CK synthetic phloem cell, and these cellular localizations are in the vascular bundle to the transportation of growth grain.When the cell fission at these tissues enlivens most, in endosperm of growing and embryo, all find the existence of ZmIPT2 transcript.This supports the effect of ZmIPT2 as the CK synthetic proteins once more, can form by catalysis CK in the embryo of the endosperm of organizing 10DAP for example of quick division/growths and growth, and the storehouse intensity support grain that can drive in the bennet is grown.
Embodiment 7. derives from colibacillary ZmIPT2 polypeptide expression and purifying
Material and method:
Recombinant protein purification, gel electrophoresis and Western trace: e. coli bl21-AI (Invitrogen) incubated overnight that will contain pDEST17-ZmIPT2 (Mo17) plasmid.Inoculate fresh LB substratum with the diluent of 1/200 culture, bacterium is cultivated 2h at 37 ℃, induces with the 0.2%L-pectinose then, and cultivates 2 to 4h.As preparation bacterioprotein extract as described in the supplier, and under the sex change condition in 12.5% polyacrylamide gel electrophoresis.With the albumen of Ni-NTA agarose solution according to recommendation (Qiagen) purifying His-mark from the crude protein extract of provider.Behind the electrophoresis, albumen or undertaken gel-coloredly by GelCode (Pierce), perhaps electricity consumption carryover preface is carried out trace on polyvinylidene difluoride (PVDF) (PVDF) film.Anti-mouse IgG antibody with the coupling connection alkaline phosphatase of the anti-Histidine monoclonal antibody (Sigma-Aldrich) of mouse and sheep carries out Western trace (Brugiere et al. (1999) Plant Cell11:1995-2012) as previously mentioned.
The result:
With the carrier of Gateway system compatible in clone ZmIPT2 encoding sequence: used two kinds of methods in order to study the proteic function of ZmIPT2 in vitro and in vivo.First kind is the ZmIPT2 albumen at expression in escherichia coli and purifying tape label, and second kind is that the 35S promoter that is used in the Cauliflower embedded virus is controlled the callus that starts the construct arabidopsis thaliana transformation of ZmIPT2 gene overexpression down.This purpose has been used the Gateway system of molecular cloning.
The Gateway technology is used to make up protein expression vector (E.coli Expression Systemwith Gateway Technology kit, Invitrogen) and the Arabidopis thaliana conversion carrier (MultisiteGateway Three-Fragment Vector Construction Kit, Invitrogen).The first step is that the ZmIPT2 fragment to former extraction adds special att sequence.Available a pair of specially the design at the primer of gene flanking region with suitable att site realized by this fragment of pcr amplification.
After these specific sites join side, the fragment of new gel extraction is inserted in the donor carrier (pDONR221) by reorganization.Recombinate in external catalysis by BP clone enzyme.The carrier that produces is by checking with a plurality of Restriction Enzyme digestion and the migration in agarose gel electrophoresis.The clip size of digestion conforms to the length of the digestion product of each enzyme expection.With Mo17 and B73 ZmIPT2 gene clone in donor carrier separately, and the sequence of inserting with M13 forward and reverse primer order-checking.The Mo17 clone is 100% with the homology of GSS contig sequence, therefore can be used for construction expression and transformation construct.
In vitro study: the expression of ZmIPT2 albumen in intestinal bacteria: with the ZmIPT2 albumen of tape label at expression in escherichia coli.Make the ZmIPT2 gene in intestinal bacteria the transcriptional activation except inducing by the T7 promotor, this method also adds 6 histidine-tagged at the proteic N-terminal of reorganization ZmIPT2, thereby can be used for its purifying.Reorganization by the ZmIPt2 encoding sequence between pDONR221-ZmIPT2 and pDEST17 (Invitrogen) produces expression vector.
The fusion of transcribing to 6xHis-tag and ZmIPT2 is checked order, with expression vector transformed into escherichia coli BL21-AI bacterial strain.These cells contain the expression system by the L-arabinose regulation and control, can induce the expression of t7 rna polymerase.Also denaturing polyacrylamide gel electrophoresis (SDS-PAGE) detects the protein extract of inducing back different time (2h and 4h) to collect at t7 rna polymerase.Collect not derivative sample, with the expression of inducing and not having a gus protein when inducing as negative control.Gel shows that with the blue dyeing of coomassie albumen exists.
Behind the electrophoresis, will induce and inductive sample trace on pvdf membrane not.Carry out the Western trace to determine that inductive albumen contains the His-label.Based on this purpose, we have used the murine antibody at poly Histidine peptide.These antibody are the albumen of identification tape label only, then by the anti-mouse IgG antibody recognition of band alkaline phosphatase.Thereby can be the existence that recombinant protein is identified in the reaction that is deposited in the purple product on the film by transforming colourless substrate.
Can be observed two bands, one is expection size (about 37kDa), and another is big (about 40kDa) slightly, and the two all can be induced by L-arabinose.These two bands may increase proteic positive charge owing to increase extra alkaline residue, thereby cause mobility to change.Also may be owing to be to have covalently bound cofactor at escherichia coli expression albumen.For explain these two kinds may, by mass spectroscopy the trysinization thing of each purifying band.In order to identify that further these two bands need be further purified albumen.
The proteic purifying of ZmIPT2 of band His label: the existence of 6xHis label can come this albumen of affinity purification by the Ni-NTA resin column.With sample on the crude extract to post and collect effluent liquid.After the coupled columns washing several times, with the eluant solution albumen that contains imidazoles, imidazoles and post have high-affinity, therefore can discharge albumen from post.All collect sample and carry out gel electrophoresis in per step of purifying, dye by preceding method.
Experiment shows that albumen expresses with solubilized form because the albumen existence is all arranged in last cleer and peaceful effluent liquid, but in precipitation seldom.Albumen is in the second and the 3rd elution fraction.In the component the proteic amount of ZmIPT2 with respect to the second time solution volume be estimated as 70 to 80% of total protein.
Carry out the Western trace with same sample.The result shows that albumen has seldom amount existence in precipitation, and is most of in solution (effluent liquid).The amount of strong signal indicating ZmIPT2 albumen in crude extract of effluent liquid surpasses the capacity of post.
In addition, expressed ZmIPT2 albumen, made ZmIPT2 on SDS-PAGE, carry out purifying with single band with the terminal label of C-.Segmental purity is near 100%.And find that component has DMAPP:ADP and DMAPP:ATP prenyltransferase activity.
The in vitro study of embodiment 8.ZmIPT2 gene overexpression in Arabidopis thaliana
Material and method:
Vitro culture: use different substratum to carry out Arabidopis thaliana rudiment, callus culture and regeneration (Kakimoto (1998) J.Plant Res.111:261-265).Used substratum is as described below:
■ 5000X CIM (callus of induce substratum) hormone mixt: 2.5mg/ ml 2,4 dichlorphenoxyacetic acids (2,4-D), 0.25mg/ml kinetin and 5mg/ml vitamin H be dissolved in the dimethyl sulfoxide (DMSO) (DMSO).
■ 500X element-vitamine compound: 50mg/ml inositol.10mg/ml thiamines-HCl, 0.5mg/ml vitamin B6-HCl and 0.5mg/ml nicotinic acid.
■ GM (rudiment substratum): 1L contains 4.3g Murashige and Skoog ' s medium salts composition (Sigma), 10g sucrose, 2ml 500X vitamine mixture, 10ml 5%2-(N-morpholine)-hydroxyethylsulfonic acid (MES, be adjusted into pH 5.7 with KOH) and the mixture of 3g Phytagel (Sigma), autoclaving.
■ CIM (callus of induce substratum): 1L contains the mixture of 3.08g Gamborg ' s B5 medium salt component (Sigma), 20g glucose, 2ml 500X vitamine mixture, 10ml 5%MES (being adjusted into pH 5.7 with KOH) and 3g Phytagel, autoclaving adds 200 μ l 5000X CIM hormone mixts.
■ AIM (edaphic bacillus infection substratum): from CIM, omit Phytage and prepare.
■ WASHM (washing substratum): from GM, omit Phytagel, add the 100mg/l cefotaxime sodium.
Transform the selection substratum of callus:
■ GM+IBA (GIBA): GM adds 100mg/l cefotaxime, 50mg/l Pyocianil, 3mg/l bialaphos and 0.3mg/l indolebutyric acid (IBA).
■ GM+IBA+Z (GIBAZ): GM adds 100mg/l cefotaxime, 50mg/l Pyocianil, 3mg/l bialaphos, 0.3mg/l indolebutyric acid (IBA) and the trans zeatin of 1mg/l (tZ).
Experiment purpose is that detection growth hormone and phytokinin influence root and branch regenerated, preparation GM, and add the different hormones of measuring.Prepare 25 kinds of concentration that contain different concns tZ and IBA, every kind of hormone is set to 0,100,300,1000 and the substratum of 3000ng/ml.
In the GM substratum, make the Arabidopis thaliana seed germination of sterilization, and under continuous light 23 ℃ of growths.To above-mentioned experiment,, and in 25 kinds of substratum, under continuous light, cultivated for 3 weeks in 23 ℃ with 15 days seedling plumular axis of scalper cutting.For the experiment of need use callus, plumular axis was grown in CIM 10 to 12 days under the same conditions.
The Arabidopis thaliana callus transforms: with edaphic bacillus suspension (0.2 OD of inductive callus at AIM 600) the middle immersion 5 minutes.On filter paper, remove most of liquid, then callus is placed in the CIM substratum, under continuous light, cultivated 2 days in 23 ℃.Abundant rinsing callus in the WASHM substratum then, and be placed on GIBA or the GIBAZ substratum and cultivate about 3 weeks.
Clone:, make up the construct that is contained in the gene under the control of Cauliflower embedded virus 35S promoter for the Gateway continuous expression ZmIPT2 in Arabidopis thaliana of system.The gateway cloning pDONR-P4-P1R plasmid construction that contains 35S promoter.After obtaining these 3 kinds of elements, carry out the reorganization of multidigit point with 3 donor carriers and the 4th carrier that is called the purpose carrier.
LR clone enzyme can carry the plasmid of promotor, goal gene and terminator and contain frontier district, the Ti-plasmids left and right sides and the binary vector of BAR drug resistant gene between orderly " 3 site " reorganization takes place.The construct that obtains is by verifying with Restriction Enzyme digestion, gel electrophoresis and comparison digestion fragment and expection digestion product size.
Final construct contains and comprises the 35S-ZmIPT2-PINII sequence, and comprises the BAR gene.This gene is authorized the transformed plant cells Herbicid resistant as selective marker.
The conversion of edaphic bacillus: next step is that the plasmid that will contain the 35S-ZmIPT2-PINII construct transforms Agrobacterium tumefaciems (LBA4044).This plasmid contains infection and T-DNA is transported to gene required in the Agrobacterium tumefaciems (vir gene).Behind bacterium electroporation (Suzuki (1999) Plant Cell Physiol 39:1258-1268), these two plasmids can be in its COS site reorganization separately.The reorganization result is one and is called the 48kb plasmid of " intasome (co-integrate) altogether ".
Check the edaphic bacillus that contains this common intasome by the Quality Control process.This program comprises extracts intasome plasmid altogether, and is transformed in the intestinal bacteria, and verifies by restriction digestion.This step is essential to " the mistake reorganization " of screening two plasmids and producing non-functional construct in the COS site.
Though with number of ways the 35S-ZmIPT2-PINII construct is transformed into edaphic bacillus, does not identify and contain the correct clone of intasome plasmid altogether.Because 35S promoter is seepage in edaphic bacillus, the expression of therefore inferring ZmIPT2 is lethal to edaphic bacillus.The lethality of construct may be because the essential compound of the edaphic bacillus of initiatively degrading causes.This metabolite may comprise that the CK synthetic may substrate, for example 4-hydroxy-3-methyl-2-(E)-butenyl bisphosphate (HMBPP) from for example isoprenoid route of synthesis.
Two isoprenoid route of synthesis have been set up in the analysis of microbial genome and biochemical test, methylpent acid esters (MVA) and non-methylpent acid esters (1-deoxy-D-xylulose sugar-5-phosphoric acid, DXP or 2-C-methyl D-erythritol-4-phosphoric acid, MEP) approach.The DXP approach is present in some bacterium and the plant chloroplast.The gene of non-methylpent acid esters (MEP) approach of encoding mainly is present in the gram-positive microorganism.HMBPP is the precursor of the non-methylpent acid esters of isoprenoid synthetic (MEP) approach, is the possible substrate (Takei et al. (2003) JPlant Res 116:265-9) of AtIPT7.The gene order of analyzing Agrobacterium tumefaciems C58 shows the enzyme of its coding MEP approach, but does not have enzyme (Wood et al. (2001) Science294:2317-2323 of MVA approach; Goodner et al. (2001) Science 294:232-2328).We think as a result based on these, and HMBPP is the proteic substrate of ZmIPT2, utilizes this compound can suppress the formation of isoprenoid by enzyme, thereby causes bacterium not grow.
In order to avoid this problem, made up same construct, but the current 35S promoter that is connected with the ADH1 intron that uses suppresses ZmIPT2 expression of gene in the edaphic bacillus.Use this construct can obtain to carry the correct edaphic bacillus of intasome altogether.
The result:
Arabidopis thaliana callus regenerated root or branch in substratum depend on the level of growth hormone and phytokinin in the substratum.Therefore, the Arabidopis thaliana plumular axis is cultivated in the substratum that contains the increase of growth hormone and phytokinin level.The combination for preparing 25 different tZ and IBA concentration is 0,100,300,1000 and 3000ng/ml to every kind of concentration of hormone, as mentioned above plumular axis is transferred in the substratum then.In culturing room, cultivated for 3 weeks, every kind of hormone combinations is gathered the picture of 2 representative callus.The result shows higher growth hormone: the phytokinin ratio is beneficial to root and forms, and higher phytokinin: the growth hormone ratio is beneficial to branch and forms.
This experiment shows that root or branch formation are subjected to growth hormone/phytokinin scale effect.Growth have the effect of inducing root, and phytokinin induces branch to form.Based on these results, Arabidopis thaliana callus overexpression cytokinin-biosynthesizing enzyme then can not grow root in the substratum that only contains growth hormone.Detected the function of the phytokinin synthetic gene that this detection method infers by Arabidopis thaliana IPT (tmr) gene identification.Particularly, with the construct of two overexpressions of gateway cloning system constructing as the IPT of cytokinin-biosynthesizing enzyme or GUS in contrast.The arabidopsis thaliana transformation callus can have root to produce at the callus that transforms with the 35S-GUS-PINII construct, and not have root to produce with the callus that the 35S-IPT-PINII construct transforms after 3 weeks.In order to verify that callus is effectively transformed, carried out original position GUS dyeing.These contain gus protein with the tissue that 35S-GUS-PINII transforms, and produce blue look in the solution that contains the GUS substrate behind the incubation.These result verification use the high throughput testing method can detect the corn C K synthetic gene of inferring.
Transfer to the Arabidopis thaliana callus of cultivating in the GM substratum that contains growth hormone or growth hormone and phytokinin 10 days with the 35S-ADHI-ZmIPT2-PinII construct.Add the callus that herbicide screening transforms.Transforming 3 weeks back generation obvious phenotypes.Contrast and 35S-ADHI-ZmIPT2-PINII callus growth phase on the substratum that contains growth hormone and phytokinin is same.The same with expection, with the contrast callus of 35S-GUS-PINII construct conversion can be on the substratum that only contains growth hormone regenerated root.On the contrary, the callus that transforms with the 35S-ADHI-ZmIPT2-PINII construct with can not in this substratum, produce root with the callus of 35S-IPT-PINII construct conversion is the same, some callus even renewablely go out branch.Show that according to aforementioned preliminary experiment these callus synthesize CK owing to expressing the ZmIPT2 gene.Thereby reduction growth hormone: the phytokinin ratio, suppress the formation of root.These results support that ZmIPT2 is the conclusion of phytokinin synthetic gene.
The separation and the order-checking of embodiment 9.ZmIPT2 promotor
In order to separate the promotor of ZmIPT2 gene, used high-throughput bacterial artificial chromosome (BAC) screening process.Pass through PCR screening and separating to 5 positive colony according to the ZmIPT2 sequence.In order to verify that target gene is present on the bacterial chromosome, the BAC clone is cultivated and prepares.The BACs that obtains digests with HindIII, and carries out gel electrophoresis, carries out the Southern trace then.Trace with [α- 32P]-the ZmIPT2 probe hybridization of dCTP mark.Southern trace method is as described in the embodiment 4.
The Southern trace shows in the separative BAC clone of institute and contains the ZmIPT2 sequence.After the checking, with the BACs subclone to among BamHI and the postdigestive pBluescript of HindIII.After the connection, transform the competence intestinal bacteria of chemical preparation, and on penbritin LB substratum, cultivate.Then by clone hybridization method screening positive clone.With the clone transfer on the nylon membrane with [α- 32P]-dCTP ZmIPT2 probe hybridization to be to detect the clone contain the ZmIPT2 district in its plasmid.At last, prepare the clone of screening, and the primer of plasmid with 5 ' OH direction checked order.Thereby can obtain the sequence of ZmIPT2 upstream 1354bp.Use the BAC step to move the sequence that strategy can obtain this gene promoter 3280bp.The ZmIPT2 promoter sequence is SEQ IDNO:75.The use same policy has been identified the ZmIPT1 promotor among the SEQ ID NO:25.
Can separate ZmIPT4 to ZmIPT9 by same way as, and OsIPT1 is to the promoter sequence of OsIPT11.Sequence ZmIPT4 provided herein (SEQ ID NO:5), ZmIPT5 (SEQ ID NO:8), ZmIPT6 (SEQ ID NO:11), ZmIPT7 (SEQ IDNO:14), ZmIPT8 (SEQ ID NO:17), and ZmIPT9 (SEQ ID NO:20), OsIPT1 (SEQ ID NO:47), OsIPT2 (SEQ ID NO:44), OsIPT3 (SEQ ID NO:62), OsIPT4 (SEQ ID NO:64), OsIPT5 (SEQID NO:50), OsIPT6 (SEQ ID NO:55), OsIPT7 (SEQ ID NO:53), OsIPT8 (SEQ ID NO:40), OsIPT9 (SEQ ID NO:60), OsIPT10 (SEQ ID NO:58) and OsIPT11 (SEQ ID NO:42) comprise the suitable upstream that is used to identify the function on subsequence.
Embodiment 10.IPT is active to be detected
A. in bacteria culture medium, pass through corn or I in Rice PT sequence synthetic cell mitogen
In the bacteria culture medium of known secretory cell mitogen, measure the ability of IPT sequence synthetic cell mitogen of the present invention.In intestinal bacteria, measure enzymic activity.
To contain the T7 promotor: the e. coli bl21-AI of IPT sequence (Invitrogen) (being cloned in the IPT among the pDEST17 (Invitrogen)) cultivated 4h at 37 ℃, in 20 ℃ of accumulation that have an inducible protein under 0.2% pectinoses 12 hours.By centrifugal collection microorganism, add then buffer A (25mM Tris-HCI, 50mM KCI, 5mM beta-mercaptoethanol, 1mM PMSF and 20 μ g/ml bright press down mould peptide) to OD600 be 100, then by the broken intestinal bacteria of freeze-thaw method.Then with the intestinal bacteria of fragmentation 300,000g reclaimed supernatant in centrifugal 10 minutes.With 10 μ l supernatants with contain 60 μ M DMAPP, 5 μ M[3H] AMP (722GBq/mmol) and 10MM MgCl 2Buffer A mix, 25 ℃ of incubations 30 minutes.Add 50mM Tris-HCI (pH 9) then in reaction solution, adding calf intestinal alkaline phosphatase to concentration again is 2 units/30 μ l, carries out the dephosphorization reaction in 30 minutes at 37 ℃ of incubations.By the reverse thin-layer chromatography of C18 (moving phase: 50% methyl alcohol) reaction solution is developed the color, and, determined in the reaction solution that contains intestinal bacteria extract, to have the formation of isopentenyl adenosine with T7::IPT sequence by radioautograph detection reaction product.
Know that further 3H-HMBPP (4-hydroxy-3-methyl-2-(E) butenyl bisphosphate) can be used as the substrate of above-mentioned detection method.Referring to for example Krall et al. (2002) FEBS Letters527:318-8, in being incorporated herein as a reference.
B.DMAPP:ATP or ADP or the active detection of AMP prenyltransferase
Measure DMAPP:ATP (or ADP or AMP) prenyltransferase activity by the method that Blackwell and Horgan (1991) FEBS Lett.16:10-12 describe, carry out some changes.The sample that detects is crude extract and band T7 promotor:: the intestinal bacteria purifying protein of IPT sequence.With dilution buffer liquid (25mM TrisHC1, pH 7.5; The 5mM 2 mercapto ethanol; 0.2mg ml -1Bovine serum albumin) purifying protein is diluted to suitable concn.Sample and equal-volume are contained 25mM TrisHC1 (pH 7.5), 10mM MgCl 2, 5mM 2 mercapto ethanol, 60 μ M DMAPP and 2 μ M[2,8- 3H] ATP (120GBq mmol -1), [2,8- 3H] ADP (118GBq mmol -1), [2- 3H] AMP (72GBq mmol -1) or [2,8- 3H] adenosine (143GBq mmol -1) 2x detect mixture and mix and carry out isoprenylation (Isopentenylation) reaction.Incubation adds 1/2 volume calf intestinal alkaline phosphatase (CIAP) mixture [0.5TrisHC1 (pH 9.0), 10mM MgCl after the suitable time 2With 1,000units ml -1CIAP (Takara Shuzo Co.Ltd., Otsu, Shiga, Japan)], with mixture at 37 ℃ of incubation 30min.Add 700 μ l ethyl acetate then, and oscillation mixture.17, the centrifugal 2min of 000xg reclaims organic phase, and with water rinse 2 times.(Amersham Pharmacia Biotech, Tokyo Japan) mix, and use the liquid flashing counting determining radioactive level with organic phase and 10 times of volume scintillation solution ACSII.Measure [2,8- 3H] isopentenyl adenosine (iPA) rate of recovery, be used to calculate the amount of the product of formation.The IPT sequence of using purifying by the isopentene groupization of ATP synthesize [2,8- 3H] iPA, carry out CIAP then as mentioned above and handle.All are measured and repeat twice, calculate with mean value.
In order to measure the K of ATP m, with purifying protein (2ng ml -1Be dissolved in the dilution buffer liquid) contain 25mM TrisHC1 (pH 7.5), 10mM MgCl with equal-volume 2, the 5mM 2 mercapto ethanol, and 0.4mM DMAPP and ATP (2-502 μ M [2,8- 3H] ATP, 1.22MBqml -1) 2x detect mixture and mix.In order to measure the K of DMAPP m, with purifying protein (2ng ml -1) contain 25mM TrisHC1 (pH 7.5), 10mM MgCl with equal-volume 2, the 5mM 2 mercapto ethanol, and 0.25-200 μ M DMAPP and 200 μ M [2,8- 3] ATP (7.07GBq mmol -1) 2x detect mixture and mix.Mixture at 24 ℃ of incubation 0min or 4min, is used the CIAP reaction mixture, extract as mentioned above with ethyl acetate then.To deduct the value that 0min obtains in the value that 4min obtains, the difference that obtains is enzymic activity.
In order to determine IPT sequence catalysis isopentene group radical transfer, with HPLC and mass spectroscopy reaction product to ATP, ADP or AMP.Briefly, crude extract and the Ni-NTA agarose microbeads incubation for preparing from the IPTG inductive intestinal bacteria that contain the pDEST17-IPT plasmid.After the abundant rinsing of pearl, be resuspended in the solution that contains 25mM Tris.HC1 (pH 7.5), 100mM KC1 and 5mM 2 mercapto ethanol.The 2x that microballoon precipitation and equal-volume are contained unlabelled ATP of 1mM and 1mM DMAPP detects mixture to be mixed, at 25 ℃ of incubations 1 hour of vibrating.After centrifugal, reclaim supernatant and be divided into two portions, a part is handled with CIAP as previously mentioned.Will with or the supernatant do not handled with CIAP mix with 3 times of volume acetone.At-80 ℃ of incubation 30min, then 17, the centrifugal 30min of 000xg removes Deproteinization with mixture.With supernatant vacuum-drying, and resistates is dissolved in the methyl alcohol.(Japan) by duplicate samples such as HPLC separation, the program of use is as follows: 20mM KH for Chemco, Osaka with Chemcobond ODS-W post 2PO 4In carry out 15min, use 0% acetonitrile and 20mM KH then 2PO 4To 80% acetonitrile and 4mM KH 2PO 4Linear gradient carry out 30min.Collect cut, and vacuum-drying, resistates is resuspended in the ethanol.Centrifugally remove possible salt post precipitation, with solution carry out the fast atom bombardment(FAB) MALDI-MS (JMS-SX102 or JEOL MStation, JEOL DATUM LTD., Tokyo, Japan).
C. the mensuration of branch and root regeneration
The following conversion of carrying out the Arabidopis thaliana callus.With 3mg/L bialaphos (bialaphos) screening transformant.According to Koncz et al. (1992) Methods in Arabidopsis Research, Sinapore, River Edge, N.J., the described sterilization Arabidopis thaliana of World Scientific seed.Seed is placed on the GM substratum, under continuous light, in 23 ℃ of growths 11 days.Cutting plumular axis section, and be placed on the last cultivation of CIM 8 days.With callus at AIM edaphic bacillus suspension (0.2OD 600) the middle immersion 5 minutes.On filter paper, remove most of liquid, then Arabidopis thaliana is placed on the CIM substratum, under continuous light, cultivated 2 days in 23 ℃.Abundant rinsing callus in the WASHM substratum, and be placed on about 3 weeks of cultivation on GM+IBA or the GM+Z+IBA substratum.With 3mg/L bialaphos screening transformant.
The substratum prescription of above-mentioned transformation experiment is as follows.The 5000xCIM hormone mixt contains 2.5mg/ml 2,4-D (Sigma Cat.No.D 6679); 0.25mg/ml phytokinin (kinetin) (Sigma Cat no.K 0753) and 5mg/ml are dissolved in vitamin H (the Sigma Cat.No.B 3399 among the DMSO.The 500x vitamine mixture contains 50g/l inositol (SigmaCat.No.I 3011); 10g/l thiamines-HCl (Sigma Cat.No.T 3902); 0.5g/l vitamin B6-HCl (Sigma Cat.No.P 8666) and 0.5g/l nicotinic acid (Sigma Cat.No.N0765).GM (rudiment substratum) (1 liter) contains 4.3g MS medium salts composition (SigmaCat.No.M 5524); 10g sucrose (Sigma Cat.No.S 8501); 2ml 500x vitamine mixture; 10ml 5%MES (adjusting to pH 5.7) (Sigma Cat.No.M 2933) and 3g Phytagel (Sigma Cat.No.P 8169) with KOH.The mixture autoclaving also is poured on the Petri plate.CIM (callus inducing medium) contains 3.08g Gamborg ' sB5 medium salts composition (Sigma Cat.No.G 5768); 20g glucose (Sigma Cat.No.G7528); 2ml 500x vitamine mixture; 10ml 5%MES (adjusting to pH 5.7) and 3g Phytagel with KOH.The mixture autoclaving after the cooling, adds 200 μ l CIM hormone mixts.Then mixture is toppled over the Petri plate.AIM (edaphic bacillus infection substratum) contains the CIM of no Phytagel.WASHM (cleaning substratum) adds the 100mg/l cefotaxime sodium for removing the GM of Phytagel.(screening of transformed calli contains autoclaved GM substratum to GM+, adds following component by filter paper then: 1ml 100mg/ml cefotaxime (Sigma Cat.No.C 7039); 1ml 50mg/ml Pyocianil (SigmaCat.No.C 3416) and 3ml 1mg/ml bialaphos.GM+IBA adds 300 μ l 1mg/ml indolebutyric acids (IBA) (Sigma Cat.No.I 7512) in above-mentioned GM substratum.GM+IBA+Z adds 300 μ l 1mg/ml IBA and the trans zeatin of 1ml1mg/ml (Z) (Sigma Cat.No.Z 2753) in above-mentioned GM substratum.
In order to detect the function of IPT, at first select the IPT sequence of corn, it is imported in the callus of falling the Arabidopis thaliana under 35S promoter control.The callus that transforms with control vector shows as normal hormone response.Root only forms and takes place when growth hormone exists, and branch takes place when being formed on phytokinin and growth hormone.On the contrary, the callus that transforms with 35S::IPT even do not using the foreign cell mitogen or existing under the phytokinin that the external source that reduces concentration uses and the regeneration branch.In addition, the regulation and control of phytokinin synthetic can be measured the change of its all directions.Exemplary process comprises that phytokinin extraction, immune purifying, HPLC separate and the ELISA quantivative approach, for example referring to Faiss et al. (1997) Plant J.12:401-415.Also see also Werner et al. (2001) PNAS 98:10487-10492) and Dewitte et al. (1999) Plant Physiol.119:111-121.
The active mensuration of D.DMAPP:tRNA prenyltransferase
(Tokyo is Japan) according to the preparation of the method among Kline et al. (1969) Biochemistry 8:4361-4371 modification insufficient (undermodified) tRNA for type X, Sigma-Aldrich Japan to handle yeast tRNA by permanganic acid.Protein sample (20ng (albumen ml with 20 microlitre purifying in the dilution buffer liquid -1) detect mixture (25mM Tris-HCl, pH 7.5 with equal-volume 2X tRNA prenyltransferase; 10mM MgCl 2The 5mM 2 mercapto ethanol; 0.67 μ M[1- 3H] DMAPP, 555GBq mmol -1567A 260Unit/ml -1Modify insufficient tRNA) at 25 ℃ of incubation 30min.Add 160 μ l 0.4M sodium-acetates and 500 μ l ethanol, left standstill 10 minutes, reclaim the tRNA precipitation, use the 80%ETOH rinsing, and be dissolved in the 30 μ l sterilized waters by centrifugal (17,000xg 20 minutes) on ice.Mix with the ACSI of 10 times of volumes, measure radioactive level.
Embodiment 11. keeps in coercing or increases the seed set
Can improve the level of phytokinin to the female inflorescence fixed point overexpression IPT sequence of the present invention of growing, and can make the corn seed of growth realize its whole genetic potentials on the volume, to reduce top grain abortion and buffering seed set in adverse environment.The abiotic stress that takes place in the grain growth period can make the phytokinin level reduce.Under stress conditions, the phytokinin composite reactive may reduce, and the phytokinin degraded increases (Brugiere et al. (2003) Plant Physiol.132 (3): 1228-40).Therefore, in lag-phase grain, keep in the non-limiting method of phytokinin level, the IPT gene be connected 1) coerce insensitive; 2) the direct expression of structure gene is main to the grain of growing; And 3) can preferentially start on the controlled member of expression of structural gene in the grain growth lag-phase.Can use in relevant maternal tissue or nearly flowering period localization and expression promotor.Optionally, can use constitutive promoter.
For example, the plasmid that is selected from ZmIPT1-9 or OsIPTl-11 with containing, is connected (Schmidt et al. (1993) Plant Cell5:729-737) with the Zag2.1 promotor and comprises the sequence of the selectable marker gene BAR (Wohlleben et al. (1988) Gene 70:25-37) that can authorize the weedicide bialaphos of the immature maize from greenhouse donor plant bombards.Optionally, selectable marker gene can be on the another one plasmid.The following conversion.The substratum prescription is as follows.
With fringe shelling, and add 0.5% little stain remover at 30% Clorox bleach and carried out surface sterilization 20 minutes, twice of rinsing in sterilized water then.The cutting immature embryo, and plumular axis is placed on (on the cotyledon dish side) below the side, each flat board is put 25 embryos, cultivates 4 hours on the 560Y substratum, aligns with the 2.5cm positioning area then, prepares bombardment.
Preparation contains the plasmid of the IPT sequence that is connected with the Zag2.1 promotor.This plasmid DNA and the plasmid DNA that contains the BAR selective marker are deposited on 1.1 μ m (mean diameter) the tungsten precipitation---use following CaCl 2The precipitation program: 100 μ l contain the water of the tungsten particle of preparation; 10 μ l (1 μ g) DNA (the total DNA of 1 μ g) in Tris edta buffer liquid; 100 μ l 2.5MCaCl 2With 10 μ l 0.1M spermidines.
In tungsten particle suspension, adding every kind of reagent on the multitube vibrator successively.Final mixture is ultrasonic, and incubation is 10 minutes under constant vibration.At post precipitation, will manage centrifugally, remove liquid, with 500ml 100% washing with alcohol, centrifugal 30 seconds.Remove liquid once more, in final tungsten particle precipitation, add 105 μ l, 100% ethanol.To particle gun bombardment, tungsten/DNA particle is ultrasonic, 10 μ l points in each carrier center, are made its drying 2 minutes before bombardment.
Sample plate is in horizontal #4 or the #HE34-1 or the #HE34-2 bombardment of particle gun.With 10 parts of particle/DNA that are equipped with from every control altogether all samples is carried out single bombardment at 650PSI.
After the bombardment, embryo was cultivated 2 days on the 560Y substratum, transferred to the 560R that contains the 3mg/L bialaphos then and select per 2 weeks to carry out a subculture on the substratum.After selecting in about 10 weeks, the resistant calli transfer of granules of screening is started the regeneration of plant to the 288J substratum.In the ripe back of somatic embryo (somatic embryo) (2-4 week), well-developed somatic embryo is transferred in the rudiment substratum, and transferred in the illumination cultivation room.After about 7-10 days, the seedling that grows is transferred to 272V do not have in the hormone culture-medium pipe and cultivated 7-10 days, well form up to seedling.Then plant is transferred to and contained flowerpot, and grew for 1 week,, transfer to then in classical 600 jars (1.6 gallons) and grow to maturation then in greenhouse regrowth 1-2 week in culturing room with in the dull and stereotyped socket of soil (be equivalent to 2.5 " jar).The monitoring plant is also kept the score to keeping or increasing the seed set in the abiotic stress phase.In addition, the phytokinin level (as described in embodiment 5c) of the transformant of monitoring under coercing and keep the growth of grain.
Bombardment substratum (560Y) contains 4.0g/l N6 basis salt (SIGMA C-1416), 1.0ml/l Eriksson ' s vitamine mixture (1000X SIGMA-1511), 0.5mg/l thiamines HCl, 120.0g/l sucrose, 1.0mg/l 2,4-D and 2.88g/l L-proline(Pro) (are adjusted to 5.8 back D-I H with KOH with pH 2The O constant volume); 2.0g/l Gelrite (uses D-I H 2Add behind the O constant volume) and 8.5mg/l Silver Nitrate (medium sterilization and be cooled to room temperature then add).Select substratum (560R) to contain 4.0g/l N6 basis salt (SIGMA C-1416), 1.0ml/lEriksson ' s vitamine mixture (1000X SIGMA-1511), 0.5mg/l thiamines HCl, 30.0g/l sucrose and 2.0mg/l 2,4-D (adjusts to 5.8 back D-I H with KOH with pH 2The O constant volume); 3.0g/l Gelrite (uses D-I H 2Add behind the O constant volume) and 0.85mg/l Silver Nitrate and 3.0mg/l bialaphos (all adding at medium sterilization and after being cooled to room temperature).
Plant regeneration substratum (288J) contains 4.3g/l MS salt (GIBCO 11117-074), and (0.10g/l vitamin B6 HCL and 0.40g/l Padil are with pure D-I H for 0.100g nicotinic acid, 0.02g/l thiamines HCL for 5.0ml/l MS VITAMIN liquid storage 2The O constant volume) (Murashigeand Skoog (1962) Physiol.Plant.15:473), the 100mg/l inositol, the 0.5mg/l zeatin, (it is back with pure D-I H to be adjusted to pH 5.6 for 60g/l sucrose and 1.0ml/l 0.1mM dormin 2The O constant volume); 3.0g/l Gelrite (adding behind the constant volume) and 1.0mg/l indolylacetic acid and 3.0mg/l bialaphos (medium sterilization and be cooled to 60 ℃ then add).No hormone culture-medium (272V) contains 4.3g/l MS salt (GIBCO 11117-074), and (0.10g/l vitamin B6 HCL and 0.40g/l Padil are with pure D-I H for 0.100g nicotinic acid, 0.02g/l thiamines HCL for 5.0ml/l MS VITAMIN liquid storage 2The O constant volume), (it is back with pure D-I H to be adjusted to pH 5.6 for 0.1g/l inositol and 40.0g/l sucrose 2The O constant volume) and the 6g/l bacteria Agr (with pure D-I H 2Add behind the O constant volume), sterilize and be cooled to 60 ℃.
Embodiment 12: the regulation and control root development
Agrobacterium-mediated usefulness is designed to be undertaken by suitable promotor the corn of the plasmid conversion of PTGS (PTGS), can use the method (United States Patent (USP) 5 of Zhao, 981,840 and PCT patent disclosure WO98/32326, during its content is incorporated herein as a reference).Briefly, from corn, separate immature embryo, but embryo is contacted with the edaphic bacillus suspension of transfering DNA construct.Described construct comprises the CRWAQ81 root that is connected with the hairpin structure in ZmIPT1-9 of the present invention or any one encoding sequence of OsIPT1-11 polynucleotide source and has a liking for the type promotor partially:: ADH intron promotor.Other useful construct comprises the hair clip construct that acts on ZmIPT1-9 of the present invention or any one promotor of OsIPT1-11 polynucleotide.(Aufsatz et al.(2002)PNAS 99(Suppl.4)：16499-16506；Mette et al.(2000)EMBO J 19(19)：5194-5201)。Construct is transferred to (step 1: infect step) at least one cell of at least one immature embryo.In this step, immature embryo is immersed in the edaphic bacillus suspension inoculates.Embryo and edaphic bacillus are cultivated for some time (step 2: be total to culturing step) altogether; Can on solid medium, carry out.Carry out optionally " dormancy " step after cultivating altogether.In sleep step, embryo is not added at the microbiotic that has the growth of at least a inhibition edaphic bacillus under the situation of the sub-screening reagent of Plant Transformation and cultivate (step 3: sleep step).Then the embryo of inoculation is cultivated containing on the substratum of selective reagents; Callus (the step 4: the screening step) that transforms is reclaimed in growth.Be plant (step 5: regeneration step) then with callus regeneration.
The monitoring plant is also kept the score to the regulation and control of root development.The regulation and control of root development comprise that the one or more root portion of monitoring comprise the growth of the enhanced root of primary root, axillary root, adventive root etc.The method of measuring this root system system growth variation is known in this area.Referring to for example, U.S. Patent application 2003/0074698 and Werner et al. (2001) PNAS 18:10487-10492 are in being incorporated herein as a reference.
Embodiment 13. regulation and control The Plant Senescence
To contain with constitutive promoter, root and have a liking for the type promotor partially or promote old and feeble promotor---SAG12 (Gan et al. (1995) Science 270:5244 for example, Genbank Acc.No.U37336) DNA construct of the ZmIPT1-9 of Lian Jieing or any one polynucleotide of OsIPT1-11 is incorporated into milpa, as described in Zhao et al. (1998) Maize GeneticsCorporation Newsletter 72:34-37, in being incorporated herein as a reference.
For example, obtain to contain the milpa of the IPT sequence that is connected with the SAG12 promotor.In contrast, will also import in the milpa with the construct that phytokinin has nothing to do by above-mentioned method for transformation.Phenotype to the transgenic corn plant of IPT polypeptide level with rising is studied.For example, can monitor the vigor of plant raising, the anti-infective tolerance that the shelf bottle is inserted phase and improvement.Can monitor under various environment-stress, comprise for example causing the listless jaundice of leaf, necrosis usually, come off, stop growing and reducing the damage caused by waterlogging of output, the ability of plant delay senility.
Embodiment 14. soybean embryos transform
With the plasmid bombardment soybean embryo that contains the IPT sequence that is connected with following ubiquitin promoter.For the inductor somatic embryo, the immature seed of soybean culture kind A2872 was cultivated for 6 to 10 weeks in suitable agarose substratum under illumination or in the dark in 26 ℃ at the cotyledon of the long 3-5mm of sterilized face excision.Excising parity then gives birth to the somatic embryo of embryo and is placed in the suitable liquid nutrient medium.After repeating to screen the somatic embryo bunch of breeding, keep suspension is following for early stage globular stage embryo.
In the rotary flask that contains the 35ml liquid nutrient medium, 150rpm, 26 ℃, by keeping soybean embryonic stage suspension culture under the condition of carrying out the fluorescence irradiation 16: 8 hours sky/nights.By inoculation in the liquid nutrient medium about 35mg organize and every carrying out a subculture two weeks.
Then soybean embryonic stage suspension culture is transformed (Klein etal. (1987) Nature (London) 327:70-73, U.S.Patent No.4,945,050) by the particle gun blast technique.In conversion, use Du Pont Biolistic PDS1000/HE instrument (helium modified version (heliumretrofit)).
The selectable marker gene that is beneficial to the soybean conversion can be the transgenosis (Odell et al. (1985) Nature 313:810-812) that contains Cauliflower embedded virus 35S promoter, hygromycin phosphotransferase gene (the from E.coli of plasmid pJR225; Gritz et al. (1983) Gene25:179-188) and from 3 ' district of the rouge alkali synthetase gene of the T-DNA of Agrobacterium tumefaciems Ti-plasmids.The expression cassette that contains the IPT sequence that is connected with ubiquitin can be used as restriction fragment and separates.Then this fragment is inserted into the specific limited site of the carrier that contains marker gene.
In the 1 μ m gold grain suspension of 50 μ l 60mg/ml, add (adding successively): 5 μ lDNA (1 μ g/ μ l), 20 μ l spermidines (0.1M) and 50 μ l CaCl 2(2.5M).Then with granules preparation thing vibration 3 minutes, removed supernatant in centrifugal 10 seconds.To wrap then by the particle of DNA and in 400 μ l, 70% ethanol, wash 1 time, be resuspended in the 40 μ l dehydrated alcohols.With ultrasonic 3 times of DNA/ particle suspension liquid, each 1 second.Then with 5 microlitre bags by sample on the gold grain of DNA in huge carrier plate separately.
The suspension culture in about two weeks of 300-400mg is placed in the empty petri plate of 60 * 15mm, and residual liquid is removed from tissue with suction pipe.To each transformation experiment, bombard the tissue of 5-10 flat board usually.Film rupture pressure is set to 1100psi, and cell is evacuated to 28 Inches Of Mercuries.Tissue is placed on from the place of 3.5 inches of protection screens bombardment 3 times.After the bombardment, tissue is divided into two parts, puts back in the liquid and cultivate as mentioned above.
After bombardment 5 to 7 days, liquid nutrient medium is changed to fresh culture, replace with the fresh culture that contains the 50mg/ml Totomycin after 7 to 12 days in bombardment.This selection substratum upgrades weekly.After 7 to 8 weeks of bombardment, can be observed from the tissue growth of the embryo bunch viridescent conversion of unconverted necrosis.Remove isolating chlorenchyma, and be inoculated in the flask to produce the embryo suspension culture of conversion new, clonal propagation.Each new system can be used as independently transformation event and handles.Then with these suspension subculture, keep immature embryo bunch or maturation and rudiment by single somatic embryo are regenerated as whole plant.
Embodiment 15. Sunflower Receptacle meristematic tissue transform
With the following conversion of the expression cassette Sunflower Receptacle meristematic tissue that contains the IPT sequence that is connected with ubiquitin promoter (also referring to European patent EP 0 486233, in being incorporated herein as a reference, and Malone-Schoneberg et al. (1994) Plant Science 103:199-207).(Helianthus annuus L.) shells with single wheat head threshing machine with sophisticated sunflower seeds.Seed was added in the 20%Clorox liquid lime chloride of 2 Tween 20 surface sterilization 30 minutes at every 50ml solution.With sterile purified water with seed rinsing 2 times.
Prepare the plumular axis explant that splits by the described program of the Schrammeijer et al. (Schrammeijer et al. (1990) PlantCell Rep.9:55-60) that revises.Behind the surface sterilization seed is absorbed 60 minutes in distilled water.Remove the cotyledon of seed then, obtain the clean section in plumular axis transverse section.Behind the excision tip of a root, explant is vertically sectioned between prophyll.Two portions tangent plane upwards is placed on contains Murashige and mineral element (Murashige et al. (1962) Physiol.Plant., 15:473-497), Shepard ' s vitamin addn (Shepard (1980) in Emergent Techniques for the Genetic Improvement of Crops (University of Minnesota Press, St.Paul, Minnesota), the 40mg/l adenine sulfate, 30g/l sucrose, 0.5mg/l 6-phenmethyl-aminopurine (BAP), 0.25mg/l indole-3-acetic acid (IAA), 0.1mg/l gibberic acid (GA3), cultivate on the GBA substratum of pH 5.6 and 8g/l Phytagar.
Explant before handling, edaphic bacillus is carried out micropellet bombardment (Bidney et al. (1992) Plant Mol.Biol.18:301-313).30 to 40 explant ring-types are placed on the dull and stereotyped center of 60 * 20mm carry out this processing.The little bullet of about 4.7mg 1.8mm tungsten is suspended in the 25ml sterilization TE damping fluid (pH 8.0 for 10mM Tris HCl, 1mM EDTA), and 1.5ml liquid is used in each bombardment.Each flat board is at PDS 1000 _In the particle accelerator by placing the 150mm nytex screen bombardment 2 times on the sample 2cm.
In all transformation experiments, use nontoxic Agrobacterium tumefaciems bacterial strain EHA105.To contain comprise the IPT expression of gene box that is connected with ubiquitin promoter dual-purpose plasmid vector by importing among the edaphic bacillus bacterial strain EHA105 as the described freeze-thaw method of Holsters et al. (1978) Mol.Gen.Genet.163:181-187.This plasmid further comprises kantlex selectable marker gene (being nptII).The bacterium that is used for the Plant Transformation experiment is containing bacterium and is keeping required suitable antibiotic liquid YEP substratum (the 10gm/l yeast extract of dual-purpose plasmid, the 10gm/l bacto peptone, 5gm/l NaCl, pH 7.0) middle incubated overnight (28 ℃, 100RPM continuous oscillation).Suspension OD 600Be to use in 0.4 to 0.8 o'clock.With the edaphic bacillus cell precipitation and be resuspended in and contain 12.5mM MES pH 5.7,1gm/l NH 4Cl and 0.3gm/l MgSO 4Inoculation medium in to OD 600Be 0.5.
The explant of fresh bombardment is placed in the edaphic bacillus suspension, mixes, left standstill then 30 minutes.Under 26 ℃, the condition of every day 18-hour (illumination) explant transferred in the GBA substratum then and cultivate altogether, tangent plane is downward.After cultivating 3 days altogether, explant is transferred among the 374B (lack the adjusting and controlling growth thing, sucrose level is reduced to 1% GBA substratum) that adds 250mg/l cefotaxime and 50mg/l phosphoric acid kantlex.Explant is selected to cultivate for 2 to 5 weeks, transfer to then to cultivate in the fresh 374B substratum that does not contain kantlex and grew continuously in 1 to 2 week.To have the antibiotics resistant of differentiation, and not produce the vitellarium that is suitable for the branch excision and transfer to the plant hormone that carries out 3 days for the second time in the GBA substratum that contains the 250mg/l cefotaxime and handle.To detecting the existence of NPTII by ELISA, and detect transgene expression by the phytokinin composite reactive from the leaf sample of the branch of the anti-kantlex of green.This detection is as described below.
NPTII-male branch is transplanted to Pioneer _Mix and body 6440 vitro culture Sunflower Receptacle seedling rhizome.With the rudiment in 48-0 substratum (0.3%gelrite, pH 5.6 for half strength Murashigeand Skoog salt, 0.5% sucrose) of the seed of surface sterilization, and under described explant culture condition, cultivate.Remove seedling top, on plumular axis, produce a 1cm terrace cut slice, then the branch that transforms is inserted in the section.Whole portion is wrapped up with the protection branch with parafilm.The plant of transplanting is transferred to the external cultivation of carrying out for 1 week in the soil.Transplant in soil remains under the high humidity, slowly makes it adapt to greenhouse then.Sophisticated T in the greenhouse 0The transform portion of plant (parent generation) identifies by NPTII ELISA and/or the phytokinin composite reactive of analyzing leaf extract, and from the positive T of NPTII- 0The transgenic seed of plant results is identified by the phytokinin composite reactive of analyzing small portion dry seeds cotyledon.
Embodiment 16.IPT variant
A. do not change the ZmIPT1-9 of amino acid sequence coded and the variant nucleotide sequence of OsIPT1-11 (SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76)
At SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73, ZmIPT1-9 in 74 or 76 or the nucleotide sequence of OsIPT1-11 are used to produce when corresponding ORF plays nucleotide sequence that the beginning and end become and compares, and the nucleotide sequence of open reading frame has 70%, 75%, 80%, 85%, the variant nucleotide sequence of 90% and 95% nucleotide sequence homology.These have the password sublist generation of the variant of function by standard.When the nucleotide sequence of variant changed, its open reading frame amino acid sequence coded did not change.
The variant aminoacid sequence of B.ZmIPT1-9 and OsIPT1-11
ZmIPT1-9 and OsIPT1-11 variant aminoacid sequence have been produced.In the present embodiment, one or more amino acid have been changed.Particularly, SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 open reading frame have been investigated, determining suitable amino acid change.The amino acid of selecting changes and is by with reference to carrying out with other gene family member's of homologous protein and a plurality of kinds protein comparison.Referring to Fig. 1 and/or Figure 10.Selected think be not in amino acid under the high selective pressure (non-height is conservative), the amino acid replacement that can quite easily be had similar chemical feature (being the identical functions side chain).Functional as detecting it as described in the embodiment 10.Can produce with SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 and 76 nucleotide sequence homology by present method is 70%, 75%, 80%, 85%, 90% or 95% variant.
Other variant aminoacid sequence of B.ZmIPT1-9 and OsIPT1-11
In the present embodiment, the identity of structure and reference protein sequence is 80%, 85%, 90% and 95% artificial sequence protein.This need identify the conservative and variable region in the comparison of Fig. 1 and/or Figure 10, uses the amino acid replacement table to make up then.This part will be described in more detail below.
The mensuration that aminoacid sequence changes is based on mainly that the conserved regions of IPT albumen or other IPT polypeptide carries out.Referring to Fig. 1 and 10,, can change the variable region of IPT polypeptide based on sequence alignment.Conservative alternative it is generally acknowledged in conserved regions do not change function.In addition, the technician's functional variant that should understand IPT sequence of the present invention can carry out the substituting of non-conserved amino acid of minority in conserved regions.
Structure is different from original series then, and identity is the artificial sequence protein of 80-85%, 85-90%, 90-95% and 95-100%.For example, these interval mid points are positioned degree of freedom plus-minus 1%.Amino acid replacement can be realized by the customization perl script.Substitution tables is as shown in table 6 below.
Table 8. substitution tables
Amino acid Height phase Sihe preferably substitutes What change puts in order Note
I L，V 1 Substitute at 50: 50
L I，V 2 Substitute at 50: 50
V I，L 3 Substitute at 50: 50
A G 4
G A 5
D E 6
E D 7
W Y 8
Y W 9
S T 10
T S 11
K R 12
R K 13
N Q 14
Q N 15
F Y 16
M L 17 First methionine(Met) can not change
H Na Not good substitutes
C Na Not good substitutes
P Na Not good substitutes
At first identify any conserved amino acid in the albumen that should not change, and remove from substitution tables.Initial methionine joins in this tabulation automatically.Change then.
H, C and P are unalterable.This change will at first be carried out with Isoleucine, stride across N-terminal to C-terminal.Be leucine etc. then, up to reaching suitable target spot.Can carry out the mediant purpose substitutes not cause reverse change.Tab sequential is 1-17, and it is essential carrying out a plurality of Isoleucines changes before leucine and methionine(Met).And many amino acid do not need to change in this mode.L, I and V participate in two and optionally preferably substituted in alternative 50: 50.
Output variant aminoacid sequence.Calculate per-cent identity with perl script.Use this program, produce amino acid identity with SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 the initial unaltered nucleotide sequence of ORF and be 82%, 87%, 92% and 97% ZmIPT1-9 and OsIPT1-11 variant.
Embodiment 17. I in Rice PT sequence signatures
Identified 11 contain with Arabidopis thaliana and petunia IPT albumen have similarity putative amino acid sequence infer paddy rice ipt sequence.Figure 10 is the aminoacid sequence comparison that Arabidopis thaliana IPT albumen (AtIPT), petunia IPT albumen (Sho) and paddy rice are inferred IPT albumen (OsIPT).Asterisk is illustrated in the conservative amino acid position of most IPT albumen, its consensus sequence is GxTxxGK[ST] xxxxx[VLI] xxxxxxx[VLI] [VLI] xxDxxQx{57,60}[VLI] [VLI] xGG[ST] (SEQ ID NO:32) (wherein x represents any amino-acid residue, [] is illustrated in any amino acid in [], x{m, n}m is to n amino-acid residue number) (Takei et al. (2001) J.Biol.Chem.276:26405-26410).
The ATP/GTP-binding site of inferring (P-ring) element (prosite PS00017: consensus sequence [AG]-x (4)-G-K-[ST]), (SEQ ID NO:69) represents with underscore.Amino acid/11 28-135 at SEQ ID NO:54; Amino acid 59-66 at SEQ ID NO:66; Amino acid 59-66 at SEQ ID NO:63; Amino acid 40-47 at SEQ ID NO:61; Amino acid 320-327 at SEQ ID NO:43; Amino acid 22-29 at SEQ ID NO:49; Amino acid 315-322 at SEQ ID NO:59; Amino acid 32-39 at SEQ ID NO:57; Amino acid 41-48 at SEQ ID NO:41; Amino acid 25-32 at SEQ ID NO:46; And there is this structural domain at the amino acid 37-44 of SEQ ID NO:52.The tRNA prenyltransferase structural domain (PF01715) of inferring is positioned at the amino acid 59-348 of SEQ ID NO:57 and the amino acid 69-352 of SEQ ID NO:41.
The whole amino acid sequence identity that the various I in Rice PT sequences of Align X program determination of use default setting are compared with known Arabidopis thaliana IPT sequence.Table 9 has been summed up these results.Table 10 is listed the polypeptide that has homology with I in Rice PT sequence.This sequence is identified with BLASTP2.2.6.
Table 9
Rice protein SEQ ID NO： Best IPT coupling Similarity (%) Identity (%)
OsIPT7 54 AtIPT1 43.4 32.1
OsIPT6 57 AtIPT9 61 51.9
OsIPT10 59 AtIPT1 28 19.2
OsIPT3 63 AtIPT5 48.3 41.4
OsIPT8 41 AtIPT2 57.9 46.2
OsIPT11 43 AtIPT1 28.6 20.4
OsIPT4 66 AtIPT5 55.6 45.9
OsIPT5 52 AtIPT1 38.4 28.4
OsIPT1 49 AtIPT5 40.4 28.2
OsIPT9 61 AtIPT1 37.1 26.5
OsIPT2 46 AtIPT7 51.6 37.7
Table 10
I in Rice PT sequence Has the sequence of homology with I in Rice PT sequence Approximate region with I in Rice PT sequence of homology The % identity of homologous region
SEQ ID NO：54 The similar cell fission fibroin of NP_917001.1 16-427 73％
TRNA δ (2)-isopentenylpyrophosphate transferring enzyme that XP_475862.1 infers 121-398 61％
AAT85187.1| agnoprotein [paddy rice (japonica cultivar-group)] | BACK| 121-398 61％
BAB59040.1| gland acid prenyltransferase [Arabidopis thaliana] 123-365 39％
BAB59029.1| cytokinin-biosynthesizing enzyme [Arabidopis thaliana] 123-365 39％
SEQ ID NO：41 The similar tRNA prenyltransferase of NP_914320.1| [paddy rice (japonica cultivar-group)] 1-450 80％
BAB59042.1|tRNA prenyltransferase [Arabidopis thaliana] 35-441 35％
F84676 hypothetical protein At2g27760[input]-Arabidopis thaliana 35-441 37％
The tRNA Prenyl-pyrophosphatase that AAS79605.1| infers [Ipomoea trifida] 35-442 46％
The tRNA isopentenylpyrophosphate transferring enzyme [Arabidopis thaliana] that AAL87321.1| infers 156-441 43％
SEQ ID NO：43 XP_476953.1| hypothetical protein [paddy rice (japonica cultivar-group)] 1-252 93％
TRNA σ (2)-isopentenylpyrophosphate transferring enzyme that XP_475862.1| infers [paddy rice (japonica cultivar-group)] 314-590 57％
AAT85187.1| agnoprotein [paddy rice (japonica cultivar-group)] 314-590 57％
I in Rice PT sequence Has the sequence of homology with I in Rice PT sequence Approximate region with I in Rice PT sequence of homology The % identity of homologous region
NP_917001.1| cytokinin-biosynthesizing enzyme albuminoid [paddy rice (japonica cultivar-group)] 315-590 56％
BAB59029.1| cytokinin-biosynthesizing enzyme [Arabidopis thaliana] 313-590 38％
SEQ ID NO：46 The gland acid prenyltransferase [paddy rice (japonica cultivar-group)] that AAT77921.1| infers 17-288 42％
The cytokinin-biosynthesizing enzyme that XP_477138.1| infers [paddy rice (japonica cultivar-group)] 7-288 39％
AAN46854.1|At3g63110/T20O10_210[Arabidopis thaliana] 17-288 37％
Emb|CAB87756.1|tRNA isopentenyl transferase-like protein [Arabidopis thaliana] 17-288 37％
BAB02782.1|tRNA prenyltransferase albuminoid [Arabidopis thaliana] 10-287 37％
SEQ ID NO：49 The gland acid prenyltransferase [paddy rice (japonica cultivar-group)] that AAT77921.1| infers 10-287 43％
The cytokinin-biosynthesizing enzyme that XP_477138.1| infers [paddy rice (japonica cultivar-group)] 14-312 39％
AAN46854.1|At3g63110/T20O10_210[Arabidopis thaliana] 13-287 40％
CAB87756.1|tRNA prenyltransferase albuminoid [Arabidopis thaliana] 13-287 40％
BAB59032.1| cytokinin-biosynthesizing enzyme [Arabidopis thaliana] 14-287 40％
SEQ ID NO：52 NP_917001.1| cytokinin-biosynthesizing enzyme albuminoid [paddy rice (japonica cultivar-group)] 21-251 75％
TRNA σ (2)-isopentenylpyrophosphate transferring enzyme that XP_475862.1| infers [paddy rice (japonica cultivar-group)] 30-251 63％
I in Rice PT sequence Has the sequence of homology with I in Rice PT sequence Approximate region with I in Rice PT sequence of homology The % identity of homologous region
AAT85187.1| agnoprotein [paddy rice (japonica cultivar-group)] 30-251 63％
BAB59040.1| gland acid prenyltransferase [Arabidopis thaliana] 32-251 38％
BAB59029.1| cytokinin-biosynthesizing enzyme [Arabidopis thaliana] 32-251 38％
BAB02956.1|tRNA prenyltransferase albuminoid [Arabidopis thaliana] 32-251 36％
SEQ ID NO：57 The tRNA prenyltransferase that BAD62118.1| infers [paddy rice (japonica cultivar-group)] 1-417 96％
AAK64114.1|putative IPP transferring enzyme [Arabidopis thaliana] 24-411 58％
AAM63091.1|IPP transferring enzyme albuminoid [Arabidopis thaliana] 24-411 58％
BAB59048.1|tRNA prenyltransferase [Arabidopis thaliana] 24-411 58％
The tRNA σ that YP_008242.1| infers-2-isopentenylpyrophosphate transferring enzyme 17-346 33％
SEQ ID NO：59 XP_476953.1| hypothetical protein [paddy rice (japonica cultivar-group)] 1-199 91％
The tRNA σ (2) that XP_475862.1| infers-isopentenylpyrophosphate transferring enzyme [paddy rice 309-585 55％
AAT85187.1| agnoprotein [paddy rice (japonica cultivar-group)] 309-585 55％
NP_917001.1| cytokinin-biosynthesizing enzyme albuminoid [paddy rice (japonica cultivar-group)] 310-585 54％
BAB59029.1| cytokinin-biosynthesizing enzyme [Arabidopis thaliana] 308-585 37％
I in Rice PT sequence Has the sequence of homology with I in Rice PT sequence Approximate region with I in Rice PT sequence of homology The % identity of homologous region
SEQ ID NO：61 TRNA σ (2)-isopentenylpyrophosphate transferring enzyme that XP_475862.1| infers [paddy rice (japonica cultivar-group)] 1-360 83％
AAT85187.1| agnoprotein [paddy rice (japonica cultivar-group)] 1-360 83％
NP_917001.1| cytokinin-biosynthesizing enzyme albuminoid [paddy rice (japonica cultivar-group)] 33-312 74％
BAB59040.1|adenylate prenyltransferase [Arabidopis thaliana] 34-312 43％
BAB59029.1| cytokinin-biosynthesizing enzyme [Arabidopis thaliana] 34-312 43％
SEQ ID NO：63 The gland acid prenyltransferase [paddy rice (japonica cultivar-group)] that AAT77921.1| infers 1-344 71％
The cytokinin-biosynthesizing enzyme that XP_477138.1| infers [paddy rice (japonica cultivar-group)] 35-326 53％
AAN46854.1|At3g63110/T20O10_210[Arabidopis thaliana] 49-320 43％
CAB87756.1|tRNA prenyltransferase albuminoid [Arabidopis thaliana] 49-320 43％
BAB59041.1| gland acid prenyltransferase [Arabidopis thaliana] 51-325 44％
SEQ ID NO：66 The cytokinin-biosynthesizing enzyme that XP_477138.1| infers [paddy rice (japonica cultivar-group)] 1-316 78％
The gland acid prenyltransferase [paddy rice (japonica cultivar-group)] that AAT77921.1| infers 51-314 67％
AAN46854.1|At3g63110/T20O10_210[Arabidopis thaliana] 51-314 51％
I in Rice PT sequence Has the sequence of homology with I in Rice PT sequence Approximate region with I in Rice PT sequence of homology The % identity of homologous region
CAB87756.1|tRNA prenyltransferase albuminoid [Arabidopis thaliana] 51-314 51％
BAB59041.1| gland acid prenyltransferase [Arabidopis thaliana] 51-314 52％
Table 11. is summed up Zm and Os IPT sequence
SEQ ID NO Describe Type
1 The ZmIPT2 total length DNA
2 The ZmIPT2 polypeptide AA
3 The ZmIPT2 encoding sequence DNA
76 The encoding sequence of ZmIPT2 variation DNA
77 The ZmIPT2 polypeptide that makes a variation AA
4 ZmIPT1 diploid sequence DNA
5 The ZmIPT4 total length DNA
6 The ZmIPT4 polypeptide AA
7 The ZmIPT4 encoding sequence DNA
8 The ZmIPT5 total length DNA
9 The ZmIPT5 polypeptide AA
10 The ZmIPT5 encoding sequence DNA
11 The ZmIPT6 total length DNA
12 The ZmIPT6 polypeptide AA
13 The ZmIPT6 encoding sequence DNA
SEQ ID NO Describe Type
14 The ZmIPT7 total length DNA
15 The ZmIPT7 polypeptide AA
16 The ZmIPT7 encoding sequence DNA
17 The ZmIPT8 total length DNA
18 The ZmIPT8 polypeptide AA
19 The ZmIPT8 encoding sequence DNA
20 The ZmIPT9 total length DNA
21 The ZmIPT1 genome DNA
22 The ZmIPT1 total length DNA
23 The ZmIPT1 polypeptide AA
24 The ZmIPT1 encoding sequence DNA
26 Variant ZmIPT1 total length DNA
27 Variant ZmIPT1 polypeptide AA
28 Variant ZmIPT1 encoding sequence DNA
25 The ZmIPT1 promotor DNA
40 The OsIPT8 genome DNA
41 The OsIPT8 polypeptide AA
71 The OsIPT8 encoding sequence DNA
42 The OsIPT11 genome DNA
43 The OsIPT11 polypeptide AA
74 The OsIPT11 encoding sequence DNA
44 The OsIPT2 genome DNA
45 The OsIPT2 encoding sequence DNA
SEQ ID NO Describe Type
46 The OsIPT2 polypeptide AA
47 The OsIPT1 genome DNA
48 The OsIPT1 encoding sequence DNA
49 The OsIPT polypeptide AA
50 The OsIPT5 genome DNA
51 The OsIPT5 encoding sequence DNA
52 The OsIPT5 polypeptide AA
53 The OsIPT7 genome DNA
54 The OsIPT7 polypeptide AA
70 The OsIPT7 encoding sequence DNA
55 The OsIPT6 genome DNA
56 The OsIPT6 encoding sequence DNA
57 The OsIPT6 polypeptide AA
58 The OsIPT10 genome DNA
59 The OsIPT10 polypeptide AA
73 The OsIPT10 encoding sequence DNA
60 The OsIPT9 genome DNA
61 The OsIPT9 polypeptide AA
72 The OsIPT9 encoding sequence DNA
62 The OsIPT3 genome DNA
63 The OsIPT3 polypeptide AA
69 The OsIPT3 encoding sequence DNA
SEQ ID NO Describe Type
64 The OsIPT4 genome DNA
65 The OsIPT4 encoding sequence DNA
66 The OsIPT4 polypeptide AA
75 The ZmIPT2 promotor DNA
Embodiment 18.IPT is active to be detected
In bacteria culture medium, detect the ability of the albumen synthetic cell mitogen of sequence encoding of the present invention.The result shows that sequence encoding of the present invention has the active albumen of prenyltransferase.By the catalytic reaction of edaphic bacillus ipt as Akiyoshi et al. (1984) PNAS 81 (19): shown in the 5994-5998.
The IPT trace routine is by carrying out below with reference to document: Kakimoto, T. (2001) Identification of plant biosynthetic enzymes as dimethylallyldiphosphate:ATP/ADP isopentenyltransferases, Plant Cen Physiol 42:677-685.Sakakibara，H.，and Takei，K.(2002)Identification ofCytokinin Biosynthesis Genes in Arabidopsis：A Breakthrough forUnderstanding the Metabolic Pathway and the Regulation in HigherPlants，J.Plant Growth Regul.21：17-23。Sakano，Y.，Okada，Y.，Matsunaga，A.，Suwama，T.，Kaneko，T.，Ito，K.，Noguchi，H.，and Abe，I.(2004)Molecular cloning，expression，and characterization ofadenylate isopentenyltransferase from hop(Humulus lupulus L.)，Phytochemistry 65：2439-2446。
With gene specific primer amplification ZmIPT2 gene, and be cloned into pET28a (N-end mark) or the pET30b (the terminal label of C-) that digests with NdeI and NotI with suitable NdeI and NotI restriction site extension.Translate the sequence of verifying resultant plasmid by order-checking and the His label that ZmIPT2 merges, and transform BL21-Star with pET28a-ZmIPT2 and pET30b-ZmIPT2 TMCompetent escherichia coli cell (Invitrogen TM).Equally, the tzs IPT gene clone that derives from Agrobacterium tumefaciems is obtained plasmid Rosetta2 (DE3) pLysS that is used to transform in the pET28a.
Use TALON TMThe albumen of the specification sheets purification of Recombinant his mark that post (BD Biosciences) provides according to manufacturers.With purifying protein by following program determination dimethyl-allyl bisphosphate (DMAPP):: AMP and DMAPP::ATP prenyltransferase activity:
The protein extract of purifying is being contained 12.5mM Tris-HCl (pH 7.5), 37.5mMKCl, 5mM MgCl 2, 1mM DMAPP and 1mM AMP or ATP reaction mixture in 30 ℃ of reactions 2 hours.The termination reaction by boiling sample 5 minutes.
Half reaction mixture is handled with calf intestinal alkaline phosphatase (CAIP), added 2x CAIP reaction buffer (0.45M Tris-HCl pH 9, the 10mM MgCl of 1 times of volume 2, 1000 CAIP/ml of unit) in 37 ℃ of incubations 1 hour.
By C18-ODS2 post (Phenomenex) reaction product isolated, use 0.1M acetate with reverse hplc (Agilent 1100 systems have diode-array detector), pH 3.3 (buffer A) separates by following program with acetonitrile (Buffer B):
ο 100% buffer A wash-out 15 minutes.
The linear gradient elution that ο uses from 100% buffer A and 0% buffer B to 20% buffer A and 80% buffer B forms 35 minutes.
UV absorbs in the 280nm monitoring.Product retention time and the standard substance that obtain from Sigma or OlChemIm are compared.
At first with the Tzs and the ZmIPT2 protein determination DMAPP::AMP prenyltransferase activity of recombinating.Shown in Figure 12 A and Figure 12 B is substrate 5 '-AMP (Sigma) of reaction and product isopentenyl adenosine 5 '-single phosphoric acid (iPMP) HPLC chromatogram (OlChemIm) of expection.The chromatogram that obtains with IPT (tzs) albumen shows that nearly all 5 '-AMP substrate changes iPMP (Figure 12 C) into.Equally, the chromatogram that obtains with the ZmIPT2 purifying protein shows that this enzyme can change 5 '-AMP into iPMP, but lower than the efficient of edaphic bacillus IPT, because 5 ' not all-AMP is changed (Figure 12 D).
The identity that reaction product of handling with calf intestinal alkaline phosphatase (CAIP) and HPLC color atlas show reaction product iPMP.Shown in Figure 13 A and the 13B is with adenosine (Ado) (Sigma) and the chromatogram that (Sigma) obtains of isopentenyl adenosine (iPAR).Shown in expection, behind the product dephosphorylation of each reaction, iPMP changes isopentenyl adenosine (iPAR) (Figure 13 C and 13D) into, and wherein remaining 5 '-AMP changes Ado (Figure 13 D) into.This shows that ZmIPT2 can be iPMP with 5 '-AMP and DMAPP metabolism.
Measure the DMAPP::ATP activity by the same reaction damping fluid, but in reaction mixture, replace 5 '-AMP with 5 '-ATP.Shown in Figure 14 A is the chromatogram that obtains with 5 '-ATP.If ZmIPT2 can transfer on the 5 ' ATP by catalysis DMAPP, the product that then obtains can produce iPTP.The chromatogram of Figure 14 B shows that 5 ' all-ATP is iPTP by the ZmIPT2 metabolism, shows that ZmIPT2 uses efficiency ratio 5 '-AMP height of 5 '-ATP.Reaction product is handled to determine its identity with CAIP.This processing should produce iPAR.After the HPLC separation, chromatogram and iPAR standard colour chart are compared (Figure 14 C).After the processing, reaction product is converted into iPAR (Figure 14 D), thereby shows that ZmIPT2 can be iPTP with 5 '-ATP and DMAPP metabolism.These results have proved that together ZmIPT2 is a cytokinin-biosynthesizing enzyme, preferentially uses 5 '-ATP as substrate.
Same experiment shows that 5 '-ADP also is the suitable substrates of the enzyme of coding.In a word, these results prove that ZmIPT2 is a kind of cytokinin-biosynthesizing enzyme, preferentially uses 5 '-ATP as substrate.Experiment from now on will be by purifying the dynamics of each substrate of ZmIPT2 protein determination.
Embodiment 19. detects ZmIPT2 albumen in growing grain
In order further to study the proteic express spectra of ZmIPT2, use polyclonal antibody to carry out the Western Blot experiment.From rabbit, obtain the proteic polyclonal antibody of reorganization ZmIPT2 at the N-terminal His mark of purifying.The 15 microgram albumen that will be after different pollinations extract the whole grain of fate (DAP) results carry out SDS-PAGE, and are transferred on the pvdf membrane.Method by Laemmli (Nature 227:680-685,1970) is one anti-with anti-ZmIPT2 polyclonal antibody, and the goat anti-rabbit igg antibody of coupling connection alkaline phosphatase is the two anti-ZmIPT2 of detection albumen.
Shown in Figure 15 is the ZmIPT2 protein level that increases from 0 to 10DAP, and peak value begins to descend from 10DAP to 15DAP at 10DAP then, after this is stabilized in constant level.Genetic expression shown in this and the Northern trace reaches peak value at 10DAP, and it is consistent expressing the intensive result at bennet with endosperm.Though after this total genetic expression descends, expression level still keeps higher level in the later stage in bennet.Compare with other organ, the ZmIPT2 protein level is very high in the grain.The result shows that the proteic cytokine activity of ZmIPT2 more may be at transcriptional level control in the grain.The Western engram analysis of protein level shows that antibody is very special to ZmIPT2 in the grain.Antibody and in situ hybridization are very useful in the accurate site of measuring the genetic expression of grain reaction period.
The unusual overexpression of embodiment 20.ZmIPT2 in transgenic arabidopsis
Embodiment has in the past described the overexpression of ZmIPT2 in the Arabidopis thaliana callus.For the influence of the overexpression of studying ZmIPT2 in whole plant level, comprise construct 35S-AdhI-ZmIPT2-PinII with containing, with bar weedicide drug resistant gene the Agrobacterium tumefaciems bacterial strain arabidopsis thaliana transformation plant of the plasmid of mark.(Thompson et al. (1987) EMBO J 6 (9): 2519-2523; White et al. (1990) Nucleic Acids Res.18 (4): 1062) use the Arabidopis thaliana Transformation Program of simplifying (Clough and Bent (1998) Plant J.16:735-743).The seed kind is being contained on the level land of soil, optimizing rudiment in 2 days at 4 ℃ of incubations.In hot-house culture after 10 days, by Finale with 1/1000 dilution TMWeedicide sprays seedling every day, sprays and screens transformant over 5 days.
After the screening, identify the plant that herbicide-resistant is handled.Some plant are compared less with other, blackish green.The green of leaf is relevant with phytokinin, shows that the phytokinin level of blackish green transformed plant raises.Some transfer-gen plant is compared more influenced with other, may with known depend on genome in the relevant position effect of insertion and the genetically modified expression level that changes is relevant.
Growing commitment, some transfer-gen plant is compared with the non-transgenic plant and show the phenomenon of accumulation anthocyanidin in leaf.Some transfer-gen plant is compared with the wild-type Arabidopis thaliana and is had the height serrated leaf.This phenotype is report (van der Graaff et al. (2001) Plant Growth Regul.34 (3): 305-315) in the Arabidopis thaliana plant of overexpression edaphic bacillus ipt gene.The high level phytokinin is deleterious (van derGraaff et al., 2001) to plant-growth usually, some transfer-gen plant compare with adjoining tree in growth course grow difficult.Some transfer-gen plant compared with the control has the apical dominance of reduction at the inflorescence stem, and this reports (van derGraaff et al., 2001 in the Arabidopis thaliana of contained high levels phytokinin and tobacco plant; Crozier et al. (2000) Biosynthesis of hormones andellicitor molecules.In Biochemistry and molecular biology of plants, B.Buchanan, W.Gruissem, and R.L.Jones, eds (Rockville, Maryland:American Society of Plant Biologists), pp.850-929).
Some transfer-gen plant has " bushy " phenotype, may a large amount of leaves causes because apical dominance reduction produces.Some plant has relatively poor seed set owing to lacking the silique or the littler silique that contain seed seldom.They also reach the accumulation that shows anthocyanidin along the inflorescence stem in leaf.Plant is usually expressed as the spination stem leaf.The most extreme phenotype is lotus throne (leaf) clump with the about 5mm of diameter and the transfer-gen plant with curling leaf of very little expression anthocyanidin accumulation signal.This plant can bloom, but does not produce seed.And show unusual a large amount of big trichodes.In the tobacco of tool high level phytokinin, (Crozier et al., 2000) were described before the leaf phenotype of curling.
Therefore, proteic overexpression further shows in the Arabidopis thaliana, by making up various phenotypes, proteic function with in the past in Arabidopis thaliana and tobacco the overexpression of IPT gene be consistent (Van der Graaff at al., 2001; Crozier et al., 2000).Several strains independently in the transfer-gen plant observed phenotype be consistent with the phytokinin accumulating level, show that ZmIPT2 is a cytokinin-biosynthesizing enzyme.
Embodiment 21. measures gene function by the Mu label
Can further verify the function of gene by the mutant of transcribing and/or translating of research destruction target sequence.In concrete technical scheme, undertaken by the U.S.'s 5,962,764 described methods.The Trait Utility Sytstem for Corn (TUSC) is the private resource of inserting by the special transposon of Mutator transposable element system screening-gene from saturated maize mutant body.For example, can study ZmIPT sequence of the present invention to for example effect of plant storehouse intensity of proterties.Identify the TUSC mutant of ZmIPT2 in order to following method.
Provide the gene order of 1495bp to carry out the TUSC screening in corn IPT2 gene (ZmIPT2), to identify seedling Mutator insertion.The gene that work is disclosed contains one not by intron destructive 966bp open reading frame (ORF; Nt83-1048).
(PHN79087 and PHN79088) carries out preliminary screening to the TUSC dna library with two ZmIPT2-special primers, terminal (TIR) combination of primers that oppositely repeats of each primer and Mutator, and as the U.S. 5,962,764 is described.Below list primer sequence, sequence number is respectively SEQ ID Nos:82-84.
PHN79087 zmIPT2-F 5′＞TGTTGTGTGCACAGAATCGAGCGG＜3′
PHN79088 zmIPT2-R 5′＞CGTCCGCTAGCTACTTATGCATCAG＜3′
PHN9242 MuTIR 5′＞AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC＜3′
Primer is before use by with B73 genomic dna and PHN79087+79088 combination of primers, ZmIPT2 carried out gene specific increase and verify.Excision contrast amplified production screens as TUSC from sepharose 32The hybridization probe of P-mark.
Primer is right Expection (re. reference sequences) (bp) Observed B73gDNA (bp)
79087+79088 1033 ～1050
By PCR and ZmIPT2 hybridization TUSC dna profiling storehouse and single sample are carried out continuously several take turns screening after, the heredity of detection of desired zmIPT2::Mu allelotrope between germplasm.Carrying out multiple ZmIPT2::Mu PCR by the dna profiling of 5 grain to single TUSC plant selfing (F2) seed of screening detects.One of them TUSC family, PV03_13H-07 (from No. 26 storehouses) all shows the strong positive result to 79087+9242 and 79088+9242 combination of primers in the F2 template detection.These PCR product cloning are inserted allelic dna sequence dna with the zmIPT2Mu that PV03 13H-07 family is contained in Topo-TA carrier (Invitrogen) verify.Estimate each PCR fragment all with ZmIPT2 seat homology, and have～the Mutator TIR homology of 71bp.Expection be inserted into corn gene group DNA and to repeat also be the allelic expected results of PV03 13H-07 ZmIPT2::Mu the 9bp host site that produces by the Mu element.
As shown in figure 16, the dna sequence dna of each TUSC CPR product shows the feature of these expections.79087+9242 PCR product contains the fragment that PV03 13H-07 Mu inserts the direct homologous 600bp of left side, site and ZmIPT2.79088+9242 PCR product contains the fragment with the same 442bp of the dna sequence dna of ZmIPT2, expression be the right side that Mu inserts the site, and contain the PHN79088 primer sites.Mutator TIR sequence is handled and compared with the zmIPT2 reference sequences, these PCR fragments have 9bp (Nucleotide 624-632 in the ZmIPT2 reference sequences of 1495bp) overlapping, and expression is inserted the 9bp host site repetition that ZmIPT2 has produced expection with Mutator.
Therefore, the PV03 13H-07 of TUSC family contains heritable Mutator insertion in the encoding sequence (ORF) of ZmIPT2 gene.This equipotential gene expection produces null mutation or " knocking out " ZmIPT2 seat.From the TUSC seed bank separate and breeding from the suddenly change F2 progeny seed of hereditary isolated PV03 13H-07 of ZmIPT2::Mu, i.e. zmIPT2-H07 is to carry out phenotype and molecular biological analysis.
Figure 16 illustrates and has summed up TUSC result, and corresponding sequence is SEQ ID NO:85.
As additional features, the MuTIR of each zmIPT2::Mu PCR product is partly carried out blast search is positioned at the Mu element at ZmIPT2 seat with summary identity.Contain 39bp TIR flanking sequence with the TUSC PCR product of Mutator PHN9242 primer amplification at the inherent element of amplification.BLAST result is consistent with the zmIPT2::Mu element of Mu4 or Mu3 element.
＞IPT2_TIR_L(SEQ ID NO：86)
GAGATAATTGCCATTATAGAAGAAGAGAGAAGGGGATTCGACGAAATAGAGGCGATGGCGTTGGCTTCTCT
＞IPT2_TIR_R(SEQ ID NO：87)
AAGCCAACGCCAACGCCTCTATTTCGTCGAATCCCCTTCTCTCTTCTTCTATAATGGCAATTATCTC
In certain aspects, nucleic acid construct of the present invention can have the plant of desired phenotype with other target nucleotide sequence combination (" accumulation ") with generation.Polynucleotide of the present invention can be piled up with any gene or the assortment of genes, and the combination of generation can comprise any one or a plurality of herbicide-tolerant polynucleotide of multiple copied.Required combination can influence one or more proterties; That is, can produce the genetic expression that the incompatible regulation and control of particular group influence cytokine activity.For example, the phytokinin synthetic raises to unite with the downward modulation of phytokinin degraded and carries out.Other combination can be designed to produce the plant with various required proterties, for example those foregoing plant.
All documents and the patent application that the present invention relates to have indicative effect to those skilled in the art.All documents and patent application are introduced the present invention with same degree as reference, i.e. during each document or patent application is incorporated herein particularly, individually as a reference.
Though aforementioned invention is described in detail to reach the clear purpose of understanding by the mode of example and embodiment, obviously can carry out specific change and modification in appended claim scope.
Sequence table
Sequence table
<110>Pioneer Hi-Bred International，Inc.
＜120〉Isopentenyl transferase sequences and using method thereof
<130>1507-AR
<150>60/610,656
<151>2004-09-17
<150>60/637,230
<151>2004-12-17
<150>60/696,405
<151>2005-07-01
<160>87
<170>FastSEQ for Windows Version 4.0
<210>1
<211>1495
<212>DNA
＜213〉corn (Zea mays)
<220>
<221>CDS
<222>(83)...(1051)
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT2 full length sequence
<400>1
aaaaggcacg gactgcttct ttttctattt tttgttgtgt gcacagaatc gagcggctac 60
aataatcaag atcatcaaga ca atg gag cac ggt gcc gtc gcc ggg aag ccc 112
Met Glu His Gly Ala Val Ala Gly Lys Pro
1 5 10
aag gtg gtg ttc gtg ctc ggc gcc aca gcg aca ggg aag tcg aag ctc 160
Lys Val Val Phe Val Leu Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu
15 20 25
gcc atc gcc ctc gcc gag cgc ttc aac ggt gag gtt atc aac gct gac 208
Ala Ile Ala Leu Ala Glu Arg Phe Asn Gly Glu Val Ile Asn Ala Asp
30 35 40
aaa atc cag gtc cac gat ggc gtg ccc atc atc acg aac aag gtc aca 256
Lys Ile Gln Val His Asp Gly Val Pro Ile Ile Thr Asn Lys Val Thr
45 50 55
gag gaa gag cag ggc ggg gtg ccc cac cac ctg ctc agc gtc cgc cac 304
Glu Glu Glu Gln Gly Gly Val Pro His His Leu Leu Ser Val Arg His
60 65 70
ccg gac gcc gac ttc act gcg gag gag ttc cga cgt gag gcg gcc agc 352
Pro Asp Ala Asp Phe Thr Ala Glu Glu Phe Arg Arg Glu Ala Ala Ser
75 80 85 90
gcc gtg gcc cgc gtg ctc tcg gcg ggc cgc ctc ccc gtc gtg gca ggc 400
Ala Val Ala Arg Val Leu Ser Ala Gly Arg Leu Pro Val Val Ala Gly
95 100 105
ggg tcc aac acc tac atc gag gca ctg gtg gaa ggc gac ggc gcc gcc 448
Gly Ser Asn Thr Tyr Ile Glu Ala Leu Val Glu Gly Asp Gly Ala Ala
110 115 120
ttc cgc gcg gcg cac gac ctc ctc ttc gtc tgg gtg gac gcg gag cag 496
Phe Arg Ala Ala His Asp Leu Leu Phe Val Trp Val Asp Ala Glu Gln
125 130 135
gag ctg ctg gag tgg tac gcc gcg ctg cgc gtg gac gag atg gtg gcc 544
Glu Leu Leu Glu Trp Tyr Ala Ala Leu Arg Val Asp Glu Met Val Ala
140 145 150
cgc ggg ctg gtg agc gag gct cgc gcg gcg ttc ggc ggc gcc ggg gtt 592
Arg Gly Leu Val Ser Glu Ala Arg Ala Ala Phe Gly Gly Ala Gly Val
155 160 165 170
gac tac aac cat ggc gtg cgc cgc gcc atc ggc ctg ccg gag atg cac 640
Asp Tyr Asn His Gly Val Arg Arg Ala Ile Gly Leu Pro Glu Met His
175 180 185
gcc tac ctg gtg gcg gag cgc gag ggc gtc gct ggg gag gcc gag ctc 688
Ala Tyr Leu Val Ala Glu Arg Glu Gly Val Ala Gly Glu Ala Glu Leu
190 195 200
gcg gcc atg ctg gaa cgc gcg gtg cgc gag atc aag gac aac acc ttc 736
Ala Ala Met Leu Glu Arg Ala Val Arg Glu Ile Lys Asp Asn Thr Phe
205 210 215
cgc ctc gcg cgc acg cag gcg gag aag atc cgg cgc ctc agc acg ctc 784
Arg Leu Ala Arg Thr Gln Ala Glu Lys Ile Arg Arg Leu Ser Thr Leu
220 225 230
gac ggc tgg gac gtc cgc cgc atc gac gtg acc ccc gtg ttc gcg cgc 832
Asp Gly Trp Asp Val Arg Arg Ile Asp Val Thr Pro Val Phe Ala Arg
235 240 245 250
aag gcc gat ggc act gag tgc cac gag ctg act tgg aag aag cag gtg 880
Lys Ala Asp Gly Thr Glu Cys His Glu Leu Thr Trp Lys Lys Gln Val
255 260 265
tgg gag ccg tgc gag gag atg gtg agg gct ttc ctc gag ccg tcc ctg 928
Trp Glu Pro Cys Glu Glu Met Val Arg Ala Phe Leu Glu Pro Ser Leu
270 275 280
act gcc gtt cca ggt gtt gca gta act gaa gaa ggg aac gcc ggc gtc 976
Thr Ala Val Pro Gly Val Ala Val Thr Glu Glu Gly Asn Ala Gly Val
285 290 295
gtc gct act gct gca ccc gct ggt gat gtc gtc gtc cca act ggc gat 1024
Val Ala Thr Ala Ala Pro Ala Gly Asp Val Val Val Pro Thr Gly Asp
300 305 310
gtc gtc acc gcc gtg gct gat gca taa gtagctagcg gacgtagcgc 1071
Val Val Thr Ala Val Ala Asp Ala *
315 320
atgcatgcaa tgcatgcagg ctggctggct ggcttaatta gtgcctccga cttgctttaa 1131
actcatgtag ctgcgtccat gggagagggt gagatacaag tttatgcgac ttatatttct 1191
ttctaaattt aaatggatct cggatccgta gtatctggtt taatataatt ataatatttc 1251
cttcgaatta ttatatatat atgctcacac tcagttaggg atatatactc cctccattca 1311
ctctatgtat ttggattcat atgcaaaagt attttaaaat tatactacct ccattctcga 1371
atatttgtta cccgcttgtt tattttctaa aacatgataa ataaaaaaac ggagagaata 1431
gtattttatt atttgttgat gatatatttt gtaagatatg aacggtgaaa gttttaccat 1491
aaag 1495
<210>2
<211>322
<212>PRT
＜213〉corn
<400>2
Met Glu His Gly Ala Val Ala Gly Lys Pro Lys Val Val Phe Val Leu
1 5 10 15
Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu Ala Ile Ala Leu Ala Glu
20 25 30
Arg Phe Asn Gly Glu Val Ile Asn Ala Asp Lys Ile Gln Val His Asp
35 40 45
Gly Val Pro Ile Ile Thr Asn Lys Val Thr Glu Glu Glu Gln Gly Gly
50 55 60
Val Pro His His Leu Leu Ser Val Arg His Pro Asp Ala Asp Phe Thr
65 70 75 80
Ala Glu Glu Phe Arg Arg Glu Ala Ala Ser Ala Val Ala Arg Val Leu
85 90 95
Ser Ala Gly Arg Leu Pro Val Val Ala Gly Gly Ser Asn Thr Tyr Ile
100 105 110
Glu Ala Leu Val Glu Gly Asp Gly Ala Ala Phe Arg Ala Ala His Asp
115 120 125
Leu Leu Phe Val Trp Val Asp Ala Glu Gln Glu Leu Leu Glu Trp Tyr
130 135 140
Ala Ala Leu Arg Val Asp Glu Met Val Ala Arg Gly Leu Val Ser Glu
145 150 155 160
Ala Arg Ala Ala Phe Gly Gly Ala Gly Val Asp Tyr Asn His Gly Val
165 170 175
Arg Arg Ala Ile Gly Leu Pro Glu Met His Ala Tyr Leu Val Ala Glu
180 185 190
Arg Glu Gly Val Ala Gly Glu Ala Glu Leu Ala Ala Met Leu Glu Arg
195 200 205
Ala Val Arg Glu Ile Lys Asp Asn Thr Phe Arg Leu Ala Arg Thr Gln
210 215 220
Ala Glu Lys Ile Arg Arg Leu Ser Thr Leu Asp Gly Trp Asp Val Arg
225 230 235 240
Arg Ile Asp Val Thr Pro Val Phe Ala Arg Lys Ala Asp Gly Thr Glu
245 250 255
Cys His Glu Leu Thr Trp Lys Lys Gln Val Trp Glu Pro Cys Glu Glu
260 265 270
Met Val Arg Ala Phe Leu Glu Pro Ser Leu Thr Ala Val Pro Gly Val
275 280 285
Ala Val Thr Glu Glu Gly Asn Ala Gly Val Val Ala Thr Ala Ala Pro
290 295 300
Ala Gly Asp Val Val Val Pro Thr Gly Asp Val Val Thr Ala Val Ala
305 310 315 320
Asp Ala
<210>3
<211>969
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT2 encoding sequence
<400>3
atggagcacg gtgccgtcgc cgggaagccc aaggtggtgt tcgtgctcgg cgccacagcg 60
acagggaagt cgaagctcgc catcgccctc gccgagcgct tcaacggtga ggttatcaac 120
gctgacaaaa tccaggtcca cgatggcgtg cccatcatca cgaacaaggt cacagaggaa 180
gagcagggcg gggtgcccca ccacctgctc agcgtccgcc acccggacgc cgacttcact 240
gcggaggagt tccgacgtga ggcggccagc gccgtggccc gcgtgctctc ggcgggccgc 300
ctccccgtcg tggcaggcgg gtccaacacc tacatcgagg cactggtgga aggcgacggc 360
gccgccttcc gcgcggcgca cgacctcctc ttcgtctggg tggacgcgga gcaggagctg 420
ctggagtggt acgccgcgct gcgcgtggac gagatggtgg cccgcgggct ggtgagcgag 480
gctcgcgcgg cgttcggcgg cgccggggtt gactacaacc atggcgtgcg ccgcgccatc 540
ggcctgccgg agatgcacgc ctacctggtg gcggagcgcg agggcgtcgc tggggaggcc 600
gagctcgcgg ccatgctgga acgcgcggtg cgcgagatca aggacaacac cttccgcctc 660
gcgcgcacgc aggcggagaa gatccggcgc ctcagcacgc tcgacggctg ggacgtccgc 720
cgcatcgacg tgacccccgt gttcgcgcgc aaggccgatg gcactgagtg ccacgagctg 780
acttggaaga agcaggtgtg ggagccgtgc gaggagatgg tgagggcttt cctcgagccg 840
tccctgactg ccgttccagg tgttgcagta actgaagaag ggaacgccgg cgtcgtcgct 900
actgctgcac ccgctggtga tgtcgtcgtc ccaactggcg atgtcgtcac cgccgtggct 960
gatgcataa 969
<210>4
<211>2901
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT1 partial sequence
<400>4
gccgactatt tgttagtcag ctaactatta gctctagtaa attcaaatgg agtctaagct 60
cttagttgtg ctatggttgt attttatcaa taattataac taaatttggc aagtgtttat 120
taattgagcg tctagattcc atgtgattca tgtgataaag catgccaatt aggccccgtt 180
tgactcctct tacaaaagtt tagcactaca tttttttggt aaagtttagc tactaaagaa 240
acaacagaat tcctataagt ggtgtaccaa aatttagcat tcattagcat taccaaagat 300
gctaaactat attaaaaata gtcccctaga accatttctc actccccctc cccaccaaat 360
tcttctctct ctctctcctc ccacaactga ccgctagctt ctgctgtcac gcaggtgacg 420
ctagcttcca cattaattag ggataatatg ttaaacactt gcatcaaaca tgtctcaagt 480
tctaaagttt aaccaaagtt taagcccatt ttagaaacca cagtttttaa aatactataa 540
tatactttag tcattacaat accacagttt gaaataatac agtttttact ttagtaatta 600
caataccaca gtttgaaata atacagtttt acaaactgtg gtcaatacag ttttgcaaac 660
taaggtccag acctaagttt agaatagctt aaaataacta cagtatttgc aatacttcgg 720
ttttgaaaat agagatttta gcaatcttaa acacctcctt agcatatgct aaactttagc 780
agtatagaaa gatggaccat tgttcaagta tctatccact tccacactac gtttctgtgg 840
cttctagacc cgtcgtacgt gtggtacaat acttttgata agcagttctt tggtgcctgc 900
ttcttccgct gctaaaaggc atggaggtag tccccccgtc gacgtgccag gaattcggga 960
ttgggaaagc atgtcgctgt caggctggca cgcttttttg ggtgggacga gacgaccatg 1020
tccacgtcaa cgtccccgtc ccacttctcg ccggttctgc tgtgaaaaag ttaccatcag 1080
ctgcggtctt ggggcagcag cgatggccat ggcctcaggc tcttctgctt caggcgctgc 1140
actcgcttcc ggtggcctcg cccttgcctg tgctgctccc actcgtgcgc acctcgcagc 1200
acccggttgc cgcaggcctg tacatccgca tgcatgcttt tcttatgtct gcttttcctt 1260
cctatgcaga cagtacagct ctcagaaaga aggaaaaaaa actagactca cctcgcacac 1320
atattgcgtc cacagctctc ttgaagaggg gtcacttgcg cttgtgcttg gcaaaacagt 1380
ggaattgtcc gacaaaaacc ttcttacgac atccacacat ggtttgacaa ctttcttttg 1440
ccatgagtcg tcagtggcac ctatcaaaat atgagaggga gattatgagt tgctacagag 1500
aaggcatacg catctgacag ggtaccaatg gacttacaga agaatgcttc ggttgcgtca 1560
acacgatgca agttccaccc aaaatcttta ctcagccgat gcaatctccg tctcttttat 1620
ttaatggaga aaaaaaaaga aacgctaaga agtctacatt gagccaagta tccgtgtgtt 1680
cagtcgcaca gtattctaaa acaacacaac aacataaaaa aatacacagg atactaagtg 1740
cttacttgac gtcgaactag tctacgagtg tttgccttca gctgggaaac agcttcgtcc 1800
aacaagctct taagctgatc gtcatgcata cctaacaggc ttgcacagga accctcacca 1860
gattcttttc tgggtaaata tgctctgaaa aactcgtcaa actcacgaac cccaatagcc 1920
tgccgcagcc cctgggtata gacagcatcc gcatcatata tgctgcatac ttcgtccagc 1980
aggccaccat ccatcatgca atcgaccctt ttgttgacat aactgtccag gacttgaaga 2040
tcagcatcta cccacaggaa acagcagtcg agtctggagt tactaggccg accccatttc 2100
tgttctgaca tgatgagcag gaattcccag caagtttata ctcaattagg gaaacaaaac 2160
caaaaaaaga agagccttgt gaggcaattg tcggctcatg ttcatgacaa agggaggata 2220
ttatacaagc agagcagaca agtgcagcga aaaattcctc accttagcgg cctctccttg 2280
gaacagatcg ctgggtaggg cacccgtggt tgcatacaac tcgaggtagc gtttgatctt 2340
tgtgatacac caacccatgc agaacgaaaa atacacaagc aatcaacggc agtaggaaaa 2400
tgagcacctg tacaagaagg aattctaaca tggtagagct caagagctgc ataaagtcag 2460
gaaaaacttg ggcaacaccc ttacttttct atggtcgttt ggatggatcc tctgcgcagc 2520
cacaggatcg atctccttca agcgttcaaa cccattgcct tcatcttcat cagtaagacc 2580
tgacgattgg catacatgtc aaccgctgat tgttcatact aagaacaagg aacatttagc 2640
atgactcatt attcgcctat accatcatct atgtgatctc tcagagtaca gccctgcatt 2700
tcttctgcca tatcatccaa gaggaatggg ctaacgagag cctggagtat tttgtgggca 2760
aaaacacacg gtggttcaga cactgcggtc acccagaaaa ccatacagaa atcaggacac 2820
ttcaaatttg aacctggatg tagaagtttg tgccgccgac aaccacaggg aggccaccgc 2880
ggtccactat ttcctgtata a 2901
<210>5
<211>2654
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT4 total length
<221>CDS
<222>(904)...(1998)
<400>5
ttttggggga tcccaaagaa actagtatgt ggattgctcg tcgccgcgct gcacacatgc 60
ttcgtgcgct gcaaaatctg tccacgcgcg cgggcgcaca cacattattt tttcgttcat 120
ttgtatctgt gaaagatacg tacaaaatct gcgtgtatct tccatgattt gacaagaatt 180
tcagacacca aggcaaattt tgttggtaca tacagctcag cagcagtcct ttctgttgac 240
ctgctgcccc cttttgcttc cgttctcgat ccaaatctat ggttgaatct ttcttctgat 300
caccaggatt gttgttgttt agactttaga tcatcctgat cctgcgtgtc cggatcaaat 360
ctgcaaatcc aacgcaaaaa aaatggttca cgtgctaggt acagtttctc aaacatcaca 420
tatttggtcg tttatggtct aatgccaatt tcaaaatggg agatttcgtt ttcctcaaat 480
cgtacaagaa tgaagctgcc atatagtacg aaattcctct gaaattccag agcttcgaat 540
tacacaatcc aattaattgg ctacatgaag gtagcgccgt agcggccgac gtaccattcc 600
gacgacccca tcaatataat gggcatgggg gggcatctga atctttatct aaaatacatt 660
tgttttcgtt tcaatctaat ctaaccccaa attaaaggaa cgcatttgca catttttgta 720
ttgcaacgag gaggatccat ttgcccactt gttttcgcca gcacaagata aatagcagcc 780
acacccagca catcgacctg cagccaactc acgaactaac taccagaaga tctcaaaggc 840
ttcgattctt gaccccaagc aagtggttaa gcataagcaa cttaaacgac agcgacagaa 900
acc atg tca ctc tac ttg gcg ccc acg gcc gcc gct gcc acc acc acc 948
Met Ser Leu Tyr Leu Ala Pro Thr Ala Ala Ala Ala Thr Thr Thr
1 5 10 15
acc acc acc ctc cca agg cag ctg cta cca gcg ccg tcc atc gac cta 996
Thr Thr Thr Leu Pro Arg Gln Leu Leu Pro Ala Pro Ser Ile Asp Leu
20 25 30
agg cgg ctg gaa cga cgt ggc atg gcg ctg ccc ctg cca ccg gcg ccg 1044
Arg Arg Leu Glu Arg Arg Gly Met Ala Leu Pro Leu Pro Pro Ala Pro
35 40 45
gcg ccg ccg cca ccg ctg gtc agt gcc aac aac agg cat gcc gga gcg 1092
Ala Pro Pro Pro Pro Leu Val Ser Ala Asn Asn Arg His Ala Gly Ala
50 55 60
aag cac aag gcc gtg gtg gtg atg ggc gcc acg ggg acc ggc aag tcg 1140
Lys His Lys Ala Val Val Val Met Gly Ala Thr Gly Thr Gly Lys Ser
65 70 75
cgg ctg gcg gtg gac ctg gcg ctc cgg ttc ggc ggc gag gtc atc aac 1188
Arg Leu Ala Val Asp Leu Ala Leu Arg Phe Gly Gly Glu Val Ile Asn
80 85 90 95
tcg gac aag atc cag ctg cac gcc ggc ctg gac gtg acc acg aac aag 1236
Ser Asp Lys Ile Gln Leu His Ala Gly Leu Asp Val Thr Thr Asn Lys
100 105 110
gtg acc gag cag gag cgc gcc ggc gtg ccg cac cac ctg ctc ggg gtg 1284
Val Thr Glu Gln Glu Arg Ala Gly Val Pro His His Leu Leu Gly Val
115 120 125
gcg cgg ccc gac gag gag ttc acg gcc gcg gac ttc cgg cgc gag gcg 1332
Ala Arg Pro Asp Glu Glu Phe Thr Ala Ala Asp Phe Arg Arg Glu Ala
130 135 140
acc cgc gcc gcg cgc gcc atc acc gcg cgc ggc cgc ctg ccc atc gtc 1380
Thr Arg Ala Ala Arg Ala Ile Thr Ala Arg Gly Arg Leu Pro Ile Val
145 150 155
gcg gga ggg tcc aac tcg tac gtg gag gag ctg gtg gac ggc gac cgc 1428
Ala Gly Gly Ser Asn Ser Tyr Val Glu Glu Leu Val Asp Gly Asp Arg
160 165 170 175
gcc gcg ttc cgc gac cgc tac gac tgc tgc ttc ctc tgg gtg gac gtg 1476
Ala Ala Phe Arg Asp Arg Tyr Asp Cys Cys Phe Leu Trp Val Asp Val
180 185 190
cag cgc gcc gtg ctg cac ggc tgc gtg gcg cgg cgc gtc gac gag atg 1524
Gln Arg Ala Val Leu His Gly Cys Val Ala Arg Arg Val Asp Glu Met
195 200 205
cgc gcc cgc ggc ctg gtg gac gag gtc gcg gcg gcc ttc gac ccg cgc 1572
Arg Ala Arg Gly Lau Val Asp Glu Val Ala Ala Ala Phe Asp Pro Arg
210 215 220
cgc aac gac tac tcg cgc ggc ctc tgg cgc gcc att ggc gcg ccc gag 1620
Arg Asn Asp Tyr Ser Arg Gly Leu Trp Arg Ala Ile Gly Ala Pro Glu
225 230 235
ctc gac gcg tac ctg cgg tgg ccg gga ccg ggt gta gac ggc gac gcg 1668
Leu Asp Ala Tyr Leu Arg Trp Pro Gly Pro Gly Val Asp Gly Asp Ala
240 245 250 255
gaa agc gag ggc gag cgc gac cgg ctg ctg gcc gcc gcc atc gag gac 1716
Glu Ser Glu Gly Glu Arg Asp Arg Leu Leu Ala Ala Ala Ile Glu Asp
260 265 270
atc aag tcc aac acc cgc cgc ctg tcg tgc cgg cag cgc gcc aag atc 1764
Ile Lys Ser Asn Thr Arg Arg Leu Ser Cys Arg Gln Arg Ala Lys Ile
275 280 285
cag cgc ctg gcc aag atg tgg ggc gtc cgg cgc gtc gac gcc acc gag 1812
Gln Arg Leu Ala Lys Met Trp Gly Val Arg Arg Val Asp Ala Thr Glu
290 295 300
gtc ttc cgg agg cgc ggc gac gag gcc gac gag gcc tgg cag cgg ctc 1860
Val Phe Arg Arg Arg Gly Asp Glu Ala Asp Glu Ala Trp Gln Arg Leu
305 310 315
gtc gcc gcg ccg tgc atc gac gcc gtg cgc tcc ttc cta cga acc gac 1908
Val Ala Ala Pro Cys Ile Asp Ala Val Arg Ser Phe Leu Arg Thr Asp
320 325 330 335
gac gcc gcg gcg acc gtc gcc agt gac ctg gcg gtg gac gga gtc gtg 1956
Asp Ala Ala Ala Thr Val Ala Ser Asp Leu Ala Val Asp Gly Val Val
340 345 350
ccc gtg ttc gct ccc gcg ccg gct gcg gcc gta gca gga taa 1998
Pro Val Phe Ala Pro Ala Pro Ala Ala Ala Val Ala Gly *
355 360
cggacgacga agctcctcca tgagcgcgtt gacagctgca ctgcattcac gaatagccat 2058
tatgtataag gacaccatta cttggtgcga tggctgcgat cgtcgtcaag aaggaaaaag 2118
ggagtggtcg agaagcgagg ggaatgacga gcatgattat agtagtatct acgtcggaac 2178
ttgcatggga ctcagtcgca caaagagatt ggcgtgattg cttcgagaat cgtgcgtttg 2238
aaatcctagc taggagagga ggagagaagc aaacggagaa agtggattta ctatcatata 2298
tatggccgca tatatagcac ttgcatacag ataaatgcgt tacatgtatg ttcgagcgag 2358
gagcatgcat tatttgcacg agttggcacc tgctgtgttt gacttatcac ctgtcctttt 2418
cacccggttt ctgttttatt tgttatatga aagtgatgct agcttattcc tgttttcctt 2478
ttcatttggt tgctacaacg tgcatacatg gttgtgttgt gcgcgcaatc gagtttgtac 2538
aatcgaggtt gtgcatattt acaaggaaat attagttgca aactagcaat attaatgaca 2598
catttttaat atatttatca tatacttcct ccttaaaata taaggcaatc ctttaa 2654
<210>6
<211>364
<212>PRT
＜213〉corn
<400>6
Met Ser Leu Tyr Leu Ala Pro Thr Ala Ala Ala Ala Thr Thr Thr Thr
1 5 10 15
Thr Thr Leu Pro Arg Gln Leu Leu Pro Ala Pro Ser Ile Asp Leu Arg
20 25 30
Arg Leu Glu Arg Arg Gly Met Ala Leu Pro Leu Pro Pro Ala Pro Ala
35 40 45
Pro Pro Pro Pro Leu Val Ser Ala Asn Asn Arg His Ala Gly Ala Lys
50 55 60
His Lys Ala Val Val Val Met Gly Ala Thr Gly Thr Gly Lys Ser Arg
65 70 75 80
Leu Ala Val Asp Leu Ala Leu Arg Phe Gly Gly Glu Val Ile Asn Ser
85 90 95
Asp Lys Ile Gln Leu His Ala Gly Leu Asp Val Thr Thr Asn Lys Val
100 105 110
Thr Glu Gln Glu Arg Ala Gly Val Pro His His Leu Leu Gly Val Ala
115 120 125
Arg Pro Asp Glu Glu Phe Thr Ala Ala Asp Phe Arg Arg Glu Ala Thr
130 135 140
Arg Ala Ala Arg Ala Ile Thr Ala Arg Gly Arg Leu Pro Ile Val Ala
145 150 155 160
Gly Gly Ser Asn Ser Tyr Val Glu Glu Leu Val Asp Gly Asp Arg Ala
165 170 175
Ala Phe Arg Asp Arg Tyr Asp Cys Cys Phe Leu Trp Val Asp Val Gln
180 185 190
Arg Ala Val Leu His Gly Cys Val Ala Arg Arg Val Asp Glu Met Arg
195 200 205
Ala Arg Gly Leu Val Asp Glu Val Ala Ala Ala Phe Asp Pro Arg Arg
210 215 220
Asn Asp Tyr Ser Arg Gly Leu Trp Arg Ala Ile Gly Ala Pro Glu Leu
225 230 235 240
Asp Ala Tyr Leu Arg Trp Pro Gly Pro Gly Val Asp Gly Asp Ala Glu
245 250 255
Ser Glu Gly Glu Arg Asp Arg Leu Leu Ala Ala Ala Ile Glu Asp Ile
260 265 270
Lys Ser Asn Thr Arg Arg Leu Ser Cys Arg Gln Arg Ala Lys Ile Gln
275 280 285
Arg Leu Ala Lys Met Trp Gly Val Arg Arg Val Asp Ala Thr Glu Val
290 295 300
Phe Arg Arg Arg Gly Asp Glu Ala Asp Glu Ala Trp Gln Arg Leu Val
305 310 315 320
Ala Ala Pro Cys Ile Asp Ala Val Arg Ser Phe Leu Arg Thr Asp Asp
325 330 335
Ala Ala Ala Thr Val Ala Ser Asp Leu Ala Val Asp Gly Val Val Pro
340 345 350
Val Phe Ala Pro Ala Pro Ala Ala Ala Val Ala Gly
355 360
<210>7
<211>1095
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT4 encoding sequence
<400>7
atgtcactct acttggcgcc cacggccgcc gctgccacca ccaccaccac caccctccca 60
aggcagctgc taccagcgcc gtccatcgac ctaaggcggc tggaacgacg tggcatggcg 120
ctgcccctgc caccggcgcc ggcgccgccg ccaccgctgg tcagtgccaa caacaggcat 180
gccggagcga agcacaaggc cgtggtggtg atgggcgcca cggggaccgg caagtcgcgg 240
ctggcggtgg acctggcgct ccggttcggc ggcgaggtca tcaactcgga caagatccag 300
ctgcacgccg gcctggacgt gaccacgaac aaggtgaccg agcaggagcg cgccggcgtg 360
ccgcaccacc tgctcggggt ggcgcggccc gacgaggagt tcacggccgc ggacttccgg 420
cgcgaggcga cccgcgccgc gcgcgccatc accgcgcgcg gccgcctgcc catcgtcgcg 480
ggagggtcca actcgtacgt ggaggagctg gtggacggcg accgcgccgc gttccgcgac 540
cgctacgact gctgcttcct ctgggtggac gtgcagcgcg ccgtgctgca cggctgcgtg 600
gcgcggcgcg tcgacgagat gcgcgcccgc ggcctggtgg acgaggtcgc ggcggccttc 660
gacccgcgcc gcaacgacta ctcgcgcggc ctctggcgcg ccattggcgc gcccgagctc 720
gacgcgtacc tgcggtggcc gggaccgggt gtagacggcg acgcggaaag cgagggcgag 780
cgcgaccggc tgctggccgc cgccatcgag gacatcaagt ccaacacccg ccgcctgtcg 840
tgccggcagc gcgccaagat ccagcgcctg gccaagatgt ggggcgtccg gcgcgtcgac 900
gccaccgagg tcttccggag gcgcggcgac gaggccgacg aggcctggca gcggctcgtc 960
gccgcgccgt gcatcgacgc cgtgcgctcc ttcctacgaa ccgacgacgc cgcggcgacc 1020
gtcgccagtg acctggcggt ggacggagtc gtgcccgtgt tcgctcccgc gccggctgcg 1080
gccgtagcag gataa 1095
<210>8
<211>4595
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT5 full length sequence
<221>CDS
<222>(1952)...(2965)
<400>8
ggaggccggc gccgtggagg cgcgagggtg gtggcccgcc gggttctcgc cggcttacat 60
ggtgtccaag gcggcgctga acgcctactc gcgcgtcctg gcgcggaggc accccgcgct 120
gcgcgtcaac tgcgtgcacc cgggcttcgt caggaccgac atgaccgtca acttcggcat 180
gctcacgccc gaggaaggcg gcagcagggt ggtggccgtc gctctgctcc ccgacggcgg 240
gcccaccggc gcctacttcc aggagcgcca gcaggcgccg ttcgtgtgac gcgctctgcc 300
tctgctctgc ttccttcacc acccgatgct tgatagctat gtatctcttg aagttttcgc 360
ttgataatag ttgatacaca ttcaatcccc gcgcgtaatc tctccgttgc aaaaataatg 420
gaatcctaag ttttggacaa gtaaaaattt ctcaactttt gatcaaccta tcgacgagat 480
gaatcatggg ataaatacat atgttttgcg aagatggaga cacaaaattt ctccatggga 540
atccatcctc gacggagaat tcgacgggtg gatgctgccg agccgtgcat tttcgcactc 600
gtagatgacg cgtctacgca gtacgcaggt gcttcgaact gctgcacgcg ctttgcacag 660
gaacttgcat ttgctgaacc catttcccgt gctcctgttt gtccgctgtt tccatcgtcc 720
gactccgacc ggcggcactc ctctggtctg cctctcgtag caggctagcg gcggctagta 780
ggccccgtgg taccgggccg gaccgattgg attggacgga ggcgggcgcg cacgcaccac 840
acgcccccgg tgtccgggcg tccgtacgcc gtactccctc cccgctgccc gcgtcacgcg 900
tccctccaac caggcgacga aacgactcca ccctccactc actcggccgc cgcacgcagc 960
cctaggccgt agcccaatat gagtgcgcgc cgcggcggct aggcctcccg agtcccgccg 1020
cctccccaac cccgcccagg cgcaggcggg gcggcggcca ccaccagcac ggcacgcacc 1080
acaccaccag tctctgtccg cgatccgatc agtagcgtag cgctagcggc agtcgctctc 1140
gagcgcgggg cgctgttgct gccctgtggt ctgtggacgt ccggcggtcc ggaggccgtg 1200
cagtgcacga tcgtcctgta cgttggaatt ggatcgcctt tgctgctgct gctgcgcgag 1260
tgggtggctc aattcttcga tgcgtttccg acggcccttt tgccctttat tttccctcct 1320
ccttggcagc ttgcggcgga cgacatggtg gtgtcctgtc ctctcgtcgt cctcaccaca 1380
gagaaggcca ccgcagctaa gctagtgcaa accatgcggg gctaagctag taacattatt 1440
ctccgtgcat gcactgtgtc actgcatgat gatcgtcgtt ttcgaaagaa gctagatgac 1500
gaccaagacc agcaggtagt ccgcgcggaa gaaagcgacg agacactcta gtcaactctc 1560
tcttgggcct tggcttgccg tggatataca tggatcggag gtcaactctc ccatggtggc 1620
ttgccgcttg cctgctctgc ctcaatctgt tgccttgttc gtcgtcgtcg tcgtgtcgtg 1680
cgacggcaaa agagaaagcc actcgctgcc ggtacttgca tcgccagtcg ccactcgcca 1740
ccttatctaa accgaatcat gcagtgcggt caaccgcggt cgctgtagcg cgcggccctg 1800
catttggaga cgcccccgcc ctataaatac ccatgctttg ctctgcttct gctcccacac 1860
cacgcagacg cagccaagca agcagccaag gaaggaagct agctagctag ctgatcacaa 1920
agcagggccg attcccgatc cggcagcatc c atg gcg gcc ccc gcg atg gca 1972
Met Ala Ala Pro Ala Met Ala
1 5
gcg ccg ccg cca ccg ccg gcc tgc ttc ccc atg ccc acc agg ctg acg 2020
Ala Pro Pro Pro Pro Pro Ala Cys Phe Pro Met Pro Thr Arg Lau Thr
10 15 20
atg ccg ccg acg tcg atc acg ctc ccg gac ccg ccg ccg ctg tct gtc 2068
Met Pro Pro Thr Ser Ile Thr Leu Pro Asp Pro Pro Pro Leu Ser Val
25 30 35
ggc ggc gcc tgc agg cgc gtg gcg gcc aag cac aag gcc gtg gtg gtg 2116
Gly Gly Ala Cys Arg Arg Val Ala Ala Lys His Lys Ala Val Val Val
40 45 50 55
ctg ggc gcc acg ggc acc ggc aag tcc cgc ctg gcg atc gac ctc gcg 2164
Leu Gly Ala Thr Gly Thr Gly Lys Ser Arg Leu Ala Ile Asp Leu Ala
60 65 70
ctg cgc ttc ggc ggc gag gtc atc aac tcg gac aag atc cag gcg cac 2212
Leu Arg Phe Gly Gly Glu Val Ile Asn Ser Asp Lys Ile Gln Ala His
75 80 85
gcc ggc ctg gac gtg gcc acc aac aag gtg ggc ctc gcc gag cgc ggg 2260
Ala Gly Leu Asp Val Ala Thr Asn Lys Val Gly Leu Ala Glu Arg Gly
90 95 100
cgg gtg ccg cac cac ctg ctg ggc gtg gtg cac ccg gac gcc gag ttc 2308
Arg Val Pro His His Leu Leu Gly Val Val His Pro Asp Ala Glu Phe
105 110 115
acg gcg gcc gac ttc cgc cgc gag gcc tcg cgc gcc gcg gac cgc gcc 2356
Thr Ala Ala Asp Phe Arg Arg Glu Ala Ser Arg Ala Ala Asp Arg Ala
120 125 130 135
gcg gcg cgg ggc cgg gtg ccc gtc atc gcc ggc ggc tcc aac tcg tac 2404
Ala Ala Arg Gly Arg Val Pro Val Ile Ala Gly Gly Ser Asn Ser Tyr
140 145 150
gtg gag gag ctc gtc gag ggg gac cgg cgc gcg ttc cgg gac cgg tac 2452
Val Glu Glu Leu Val Glu Gly Asp Arg Arg Ala Phe Arg Asp Arg Tyr
155 160 165
gag tgc tgc ttc ctc tgg gtg gac gcg cag ctc ccc gtg ctg cac ggc 2500
Glu Cys Cys Phe Leu Trp Val Asp Ala Gln Leu Pro Val Leu His Gly
170 175 180
ttc gtc gcc cgc cgc gtc gac gac atg tgc cgg cgc ggc ctc gtc gac 2548
Phe Val Ala Arg Arg Val Asp Asp Met Cys Arg Arg Gly Leu Val Asp
185 190 195
gag gtg gcg gcc gcg ttc gac ccc cgc cgc acc gac tac tcc agg ggc 2596
Glu Val Ala Ala Ala Phe Asp Pro Arg Arg Thr Asp Tyr Ser Arg Gly
200 205 210 215
atc tgg cgc gcc atc ggc gtg ccg gag ctc gac gcc tac ctc cgg gcg 2644
Ile Trp Arg Ala Ile Gly Val Pro Glu Leu Asp Ala Tyr Leu Arg Ala
220 225 230
cgc ggc cgc ggc cac ggc cac cac cac gac cag atg ctc gcc gcg gcc 2692
Arg Gly Arg Gly His Gly His His His Asp Gln Met Leu Ala Ala Ala
235 240 245
ctc cac gag atc aag gcc aac acg tcc cgc ctc gcc gtg cgc cag cgc 2740
Leu His Glu Ile Lys Ala Asn Thr Ser Arg Leu Ala Val Arg Gln Arg
250 255 260
ggc aag atc cag cgg ctc gag cgc atg tgg cgc gtc cgc cgc gtc gac 2788
Gly Lys Ile Gln Arg Leu Glu Arg Met Trp Arg Val Arg Arg Val Asp
265 270 275
gcc acg gag gtg ttc ctg aag cgc ggc ctc gcc gcc gac gag gcc tgg 2836
Ala Thr Glu Val Phe Leu Lys Arg Gly Leu Ala Ala Asp Glu Ala Trp
280 285 290 295
cag cgg ctg gtc gcc gcg ccc tgc att gac gcc gtc agg tcc ttc ctg 2884
Gln Arg Leu Val Ala Ala Pro Cys Ile Asp Ala Val Arg Ser Phe Leu
300 305 310
ctg gag gac caa caa gag tac agc agc atg ggc acc gcc ggc gcc atg 2932
Leu Glu Asp Gln Gln Glu Tyr Ser Ser Met Gly Thr Ala Gly Ala Met
315 320 325
ttg cct gcc gcc gtc gca gcc gcg gct gtc taa cacaacacaa gtacacaata 2985
Leu Pro Ala Ala Val Ala Ala Ala Ala Val *
330 335
acacaacaca cacggaaccg gaacgctgcc cagagtcctc cacacgtggc cacgcgcgcc 3045
agcctccatt ggcgatcggc gcaatgctct gctgcggtca accgcgcggt gacccggcag 3105
agtagcgcag atcatatagt tgatcctggt caggggaaac tgggaaaagt aatgattttg 3165
tccccatttt ctctgtaata tttttttttg gcacgagata tgatgcgatc gagcgcggga 3225
gcgagttttg agtatggaat aaggccctgt tccaagaatg cgaagtagac gccggcactg 3285
ttggttttgg ggggtggtga tgtatttctt attatgagat tagatgtgaa tagtgtctag 3345
tcagtatcgt aatctgaacg tttcatgctc accattgaga tgtgttatca agaatctagc 3405
tggttgcgca cttgcaatag tctagaactc tctctacact cgtttcgatc gcttctgttc 3465
tttttcaata tgtcctttgc attgtgtgat atgaaattgc agcagatatt ggccaaacac 3525
aacaaattgc catgtctctc gtaaatgagc catatttatc cggccggatc atctgcagtt 3585
tcgtccgtgg atgttgctgt agataggccg ctgttgtgtg ggatggtcgt ggtctgctct 3645
atatatcagc ggttagacgt aactggactg ggagttggct gttggcatat gacctgcttc 3705
tgttgtccct ttccatgccc tcgttttcca gctctagcac ttgatgcgag aaacattctc 3765
atgcataatt gagatcagtt agcagatgac ttggaatgcc aattaaggtc aaaccatcgc 3825
accgtcagtg cctgtttgtt gtatttgtat ccgtcctgga gatcaaggtc aactcccagc 3885
gtgctaataa tcggccaaag cctaagcatg gtttcaattc ccagcgtgtg ttatcttctt 3945
gaaactaaca ccgtcaaact ctagaacgta ctagatagtg tgtggccctc aaggtcaacc 4005
aagccacacc ttactagaat cttgtgacgg cagcgagaac gaaccaattg tgcaagtgcc 4065
tttttttctt cttcttcgat ctgtttcgtt tctttgaata gattcttcag gcaacaccac 4125
cagccatgac caaccgcttc gatgccactg atgaatgata atagtcacag atacatagta 4185
cttcacttgc acaacatgat gtgttctaga ggttaaggat ggtgctaaga aagtcaaagc 4245
ttttctatga ggaagaaaaa aaagaagtca aactgcagca tgctctgctc gtttttttaa 4305
atttttttaa tccttttaaa taattttaag atttattttc atcaaaaatt tatttctaaa 4365
catatggtct tttacacttt gcctactagg tgtagtatga ttatttcccc tttctcttac 4425
gtcgtgaaga tgattccgct gcgtcttttg taccatcact ttcgaacttg agggttgttt 4485
cattgtcgta gcacatacac aaggtaccaa gacgtactcg aggaaggatt gatagggaag 4545
taaggaatga gtcataacac cgtacaatat taaggtcatg acatcaagaa 4595
<210>9
<211>337
<212>PRT
＜213〉corn
<400>9
Met Ala Ala Pro Ala Met Ala Ala Pro Pro Pro Pro Pro Ala Cys Phe
1 5 10 15
Pro Met Pro Thr Arg Leu Thr Met Pro Pro Thr Ser Ile Thr Leu Pro
20 25 30
Asp Pro Pro Pro Leu Ser Val Gly Gly Ala Cys Arg Arg Val Ala Ala
35 40 45
Lys His Lys Ala Val Val Val Leu Gly Ala Thr Gly Thr Gly Lys Ser
50 55 60
Arg Leu Ala Ile Asp Leu Ala Leu Arg Phe Gly Gly Glu Val Ile Asn
65 70 75 80
Ser Asp Lys Ile Gln Ala His Ala Gly Leu Asp Val Ala Thr Asn Lys
85 90 95
Val Gly Leu Ala Glu Arg Gly Arg Val Pro His His Leu Leu Gly Val
100 105 110
Val His Pro Asp Ala Glu Phe Thr Ala Ala Asp Phe Arg Arg Glu Ala
115 120 125
Ser Arg Ala Ala Asp Arg Ala Ala Ala Arg Gly Arg Val Pro Val Ile
130 135 140
Ala Gly Gly Ser Asn Ser Tyr Val Glu Glu Leu Val Glu Gly Asp Arg
145 150 155 160
Arg Ala Phe Arg Asp Arg Tyr Glu Cys Cys Phe Leu Trp Val Asp Ala
165 170 175
Gln Leu Pro Val Leu His Gly Phe Val Ala Arg Arg Val Asp Asp Met
180 185 190
Cys Arg Arg Gly Leu Val Asp Glu Val Ala Ala Ala Phe Asp Pro Arg
195 200 205
Arg Thr Asp Tyr Ser Arg Gly Ile Trp Arg Ala Ile Gly Val Pro Glu
210 215 220
Leu Asp Ala Tyr Leu Arg Ala Arg Gly Arg Gly His Gly His His His
225 230 235 240
Asp Gln Met Leu Ala Ala Ala Leu His Glu Ile Lys Ala Asn Thr Ser
245 250 255
Arg Leu Ala Val Arg Gln Arg Gly Lys Ile Gln Arg Leu Glu Arg Met
260 265 270
Trp Arg Val Arg Arg Val Asp Ala Thr Glu Val Phe Leu Lys Arg Gly
275 280 285
Leu Ala Ala Asp Glu Ala Trp Gln Arg Leu Val Ala Ala Pro Cys Ile
290 295 300
Asp Ala Val Arg Ser Phe Leu Leu Glu Asp Gln Gln Glu Tyr Ser Ser
305 310 315 320
Met Gly Thr Ala Gly Ala Met Leu Pro Ala Ala Val Ala Ala Ala Ala
325 330 335
Val
<210>10
<211>1014
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT5 encoding sequence
<400>10
atggcggccc ccgcgatggc agcgccgccg ccaccgccgg cctgcttccc catgcccacc 60
aggctgacga tgccgccgac gtcgatcacg ctcccggacc cgccgccgct gtctgtcggc 120
ggcgcctgca ggcgcgtggc ggccaagcac aaggccgtgg tggtgctggg cgccacgggc 180
accggcaagt cccgcctggc gatcgacctc gcgctgcgct tcggeggcga ggtcatcaac 240
tcggacaaga tccaggcgca cgccggcctg gacgtggcca ccaacaaggt gggcctcgcc 300
gagcgcgggc gggtgccgca ccacctgctg ggcgtggtgc acccggacgc cgagttcacg 360
gcggccgact tccgccgcga ggcctcgcgc gccgcggacc gcgccgcggc gcggggccgg 420
gtgcccgtca tcgccggcgg ctccaactcg tacgtggagg agctcgtcga gggggaccgg 480
cgcgcgttcc gggaccggta cgagtgctgc ttcctctggg tggacgcgca gctccccgtg 540
ctgcacggct tcgtcgcccg ccgcgtcgac gacatgtgcc ggcgcggcct cgtcgacgag 600
gtggcggccg cgttcgaccc ccgccgcacc gactactcca ggggcatctg gcgcgccatc 660
ggcgtgccgg agctcgacgc ctacctccgg gcgcgcggcc gcggccacgg ccaccaccac 720
gaccagatgc tcgccgcggc cctccacgag atcaaggcca acacgtcccg cctcgccgtg 780
cgccagcgcg gcaagatcca gcggctcgag cgcatgtggc gcgtccgccg cgtcgacgcc 840
acggaggtgt tcctgaagcg cggcctcgcc gccgacgagg cctggcagcg gctggtcgcc 900
gcgccctgca ttgacgccgt caggtccttc ctgctggagg accaacaaga gtacagcagc 960
atgggcaccg ccggcgccat gttgcctgcc gccgtcgcag ccgcggctgt ctaa 1014
<210>11
<211>1955
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT6 full length sequence
<221>CDS
<222>(659)...(1675)
<400>11
aataacattt tagtaatttg tttttctttt atttatatgg accagcagct agtgtatgtg 60
aggggctgta aaaatggttc tttacatcct acatgtaaag aattttttcc cctcccatat 120
gcatacaagc tctttgaatg aaagaactgc agtggtgtgg gtctcaggca aacaatccac 180
gtcggaggag gagtgttacg gcgttgcatt tcaccacggt ttactggtga gtgatttttt 240
ttttctttaa ggcctccttt agaacacatg gattttatag aaatgatata tgaattttac 300
agaaaatagt tcaaaaccat agaaaaaatg caggattcac gaaataatcg tttgttccaa 360
aggatgcgtt agacttcggc aaatcccatt cgccgcatcc aatccatcca ctacggagtg 420
ttcagccaaa gctttaaact agtcgtcatt cgtcaagaac acaaccacca gcggacaacc 480
cgaccagtga aaccctctgt cccgccctat aaatacccat gctttcttct gctcctacac 540
cacgcaccca agcaagccaa gcgacgacca gcagcaagca gccaaggaag ctagctagct 600
agctgaccga ccagctgtga tcgcaagcag ggccgacccc gaccggcagc gtatatac 658
atg aca ctg tcc atg acg gcc ccc gcg atg gca gca gcg cca ccg gcc 706
Met Thr Leu Ser Met Thr Ala Pro Ala Met Ala Ala Ala Pro Pro Ala
1 5 10 15
tgc tcc ccc atg gcg gcc agg ctg acg atg ccg ccg ctg ccg gac gcc 754
Cys Ser Pro Met Ala Ala Arg Leu Thr Met Pro Pro Leu Pro Asp Ala
20 25 30
gcg gcg ccg ctg tcg gtc gtg ggc tgc agg cgc atg gcg gcc aag cac 802
Ala Ala Pro Leu Ser Val Val Gly Cys Arg Arg Met Ala Ala Lys His
35 40 45
aag gcc gtc gtg gtg ctg ggc gcc acg ggc acc ggc aag tcc cgc ctg 850
Lys Ala Val Val Val Leu Gly Ala Thr Gly Thr Gly Lys Ser Arg Leu
50 55 60
gcg atc gac ctc gct ctg cgc ttc ggc ggc gag gtc atc aac tcc gac 898
Ala Ile Asp Leu Ala Leu Arg Phe Gly Gly Glu Val Ile Asn Ser Asp
65 70 75 80
aag atc cag gcg tac gcc ggc ctg gac gtg gcc acc aac aag gtg ggg 946
Lys Ile Gln Ala Tyr Ala Gly Leu Asp Val Ala Thr Asn Lys Val Gly
85 90 95
ccc gcc gag cgc gcg gcg gtg ccg cac cac ctg ctg ggc gtc gtg cac 994
Pro Ala Glu Arg Ala Ala Val Pro His His Leu Leu Gly Val Val His
100 105 110
ccg gac gcc gag ttc acg gcg gcg gac ttc cgg cgc gag gcc gcg ggc 1042
Pro Asp Ala Glu Phe Thr Ala Ala Asp Phe Arg Arg Glu Ala Ala Gly
115 120 125
gcc gcg gcc cgc gtc gcg tcg cgg ggc cgc gtg ccc atc atc gcg ggc 1090
Ala Ala Ala Arg Val Ala Ser Arg Gly Arg Val Pro Ile Ile Ala Gly
130 135 140
ggc tcc aac tcg tac gtg gag gag ctc gtc gag ggg gac cgc cgc gcg 1138
Gly Ser Asn Ser Tyr Val Glu Glu Leu Val Glu Gly Asp Arg Arg Ala
145 150 155 160
ttc cgg gag agg tac gac tgc tgc ttc ctg tgg gtg gac gcg cgg ctc 1186
Phe Arg Glu Arg Tyr Asp Cys Cys Phe Leu Trp Val Asp Ala Arg Leu
165 170 175
ccc gtg ctg cac ggc ttc gtg gcc cgc cgc gtg gac gag atg tgc cgg 1234
Pro Val Leu His Gly Phe Val Ala Arg Arg Val Asp Glu Met Cys Arg
180 185 190
cgc ggg ctc gtg gac gag gtg gcg gcc gcg ttc gac ccg cgc cgc acc 1282
Arg Gly Leu Val Asp Glu Val Ala Ala Ala Phe Asp Pro Arg Arg Thr
195 200 205
gac tac tcg agg ggc atc tgg cgc gcc atc ggc gtg ccg gag atg gac 1330
Asp Tyr Ser Arg Gly Ile Trp Arg Ala Ile Gly Val Pro Glu Met Asp
210 215 220
gcc tac ctc cgc gcg ggc ggc cac ggc gac ggc gac ggc gac gag cag 1378
Ala Tyr Leu Arg Ala Gly Gly His Gly Asp Gly Asp Gly Asp Glu Gln
225 230 235 240
gag cag cgc gcg cgc atg ctc gcc gcg gcg ctc gac gag atc aag gtc 1426
Glu Gln Arg Ala Arg Met Leu Ala Ala Ala Leu Asp Glu Ile Lys Val
245 250 255
aac acg tcc cgg ctc gcc ctg cgt cag cgc ggc aag atc cag cgg ctg 1474
Asn Thr Ser Arg Leu Ala Leu Arg Gln Arg Gly Lys Ile Gln Arg Leu
260 265 270
gca cgc atg tgg cgc gtc cgc cgc gtc gac gcc acg gag gtg ttc ctg 1522
Ala Arg Met Trp Arg Val Arg Arg Val Asp Ala Thr Glu Val Phe Leu
275 280 285
aag cgc ggc cac gcc gcc gac gag gcc tgg cag cgg ctg gtc gcc gcg 1570
Lys Arg Gly His Ala Ala Asp Glu Ala Trp Gln Arg Leu Val Ala Ala
290 295 300
ccg tgc att gac gcc gtc agg tcc ttc ctg ctg gag gag caa gag tac 1618
Pro Cys Ile Asp Ala Val Arg Ser Phe Leu Leu Glu Glu Gln Glu Tyr
305 310 315 320
agc agc agc atg gtc acc gcc tcc atg ttt gcc tcc acg gcg gcc gcg 1666
Ser Ser Ser Met Val Thr Ala Ser Met Phe Ala Ser Thr Ala Ala Ala
325 330 335
gct gtc tag cctcccccca gtggctcacc agctcagcga atggaagaat 1715
Ala Val *
gaatggccag cttggctgtg ctgcatgctc tgctgcggtc aaccgcgcgc tgaccggcag 1775
agtggcgctg atgatatagt tgaccctgtc acaagagcag ggaaagtaat tattttgtcc 1835
ccattttctc tgtatttttg tacgagatga tgcgatcgag cgcgagagcg agttttgagt 1895
accctgtccc aagagcactg ttgatttggg gtgagactgt gttcagcggt tacccctaaa 1955
<210>12
<211>338
<212>PRT
＜213〉corn
<400>12
Met Thr Leu Ser Met Thr Ala Pro Ala Met Ala Ala Ala Pro Pro Ala
1 5 10 15
Cys Ser Pro Met Ala Ala Arg Leu Thr Met Pro Pro Leu Pro Asp Ala
20 25 30
Ala Ala Pro Leu Ser Val Val Gly Cys Arg Arg Met Ala Ala Lys His
35 40 45
Lys Ala Val Val Val Leu Gly Ala Thr Gly Thr Gly Lys Ser Arg Leu
50 55 60
Ala Ile Asp Leu Ala Leu Arg Phe Gly Gly Glu Val Ile Asn Ser Asp
65 70 75 80
Lys Ile Gln Ala Tyr Ala Gly Leu Asp Val Ala Thr Asn Lys Val Gly
85 90 95
Pro Ala Glu Arg Ala Ala Val Pro His His Leu Leu Gly Val Val His
100 105 110
Pro Asp Ala Glu Phe Thr Ala Ala Asp Phe Arg Arg Glu Ala Ala Gly
115 120 125
Ala Ala Ala Arg Val Ala Ser Arg Gly Arg Val Pro Ile Ile Ala Gly
130 135 140
Gly Ser Asn Ser Tyr Val Glu Glu Leu Val Glu Gly Asp Arg Arg Ala
145 150 155 160
Phe Arg Glu Arg Tyr Asp Cys Cys Phe Leu Trp Val Asp Ala Arg Leu
165 170 175
Pro Val Leu His Gly Phe Val Ala Arg Arg Val Asp Glu Met Cys Arg
180 185 190
Arg Gly Leu Val Asp Glu Val Ala Ala Ala Phe Asp Pro Arg Arg Thr
195 200 205
Asp Tyr Ser Arg Gly Ile Trp Arg Ala Ile Gly Val Pro Glu Met Asp
210 215 220
Ala Tyr Leu Arg Ala Gly Gly His Gly Asp Gly Asp Gly Asp Glu Gln
225 230 235 240
Glu Gln Arg Ala Arg Met Leu Ala Ala Ala Leu Asp Glu Ile Lys Val
245 250 255
Asn Thr Ser Arg Leu Ala Leu Arg Gln Arg Gly Lys Ile Gln Arg Leu
260 265 270
Ala Arg Met Trp Arg Val Arg Arg Val Asp Ala Thr Glu Val Phe Leu
275 280 285
Lys Arg Gly His Ala Ala Asp Glu Ala Trp Gln Arg Leu Val Ala Ala
290 295 300
Pro Cys Ile Asp Ala Val Arg Ser Phe Leu Leu Glu Glu Gln Glu Tyr
305 310 315 320
Ser Ser Ser Met Val Thr Ala Ser Met Phe Ala Ser Thr Ala Ala Ala
325 330 335
Ala Val
<210>13
<211>1017
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT6 encoding sequence
<400>13
atgacactgt ccatgacggc ccccgcgatg gcagcagcgc caccggcctg ctcccccatg 60
gcggccaggc tgacgatgcc gccgctgccg gacgccgcgg cgccgctgtc ggtcgtgggc 120
tgcaggcgca tggcggccaa gcacaaggcc gtcgtggtgc tgggcgccac gggcaccggc 180
aagtcccgcc tggcgatcga cctcgctctg cgcttcggcg gcgaggtcat caactccgac 240
aagatccagg cgtacgccgg cctggacgtg gccaccaaca aggtggggcc cgccgagcgc 300
gcggcggtgc cgcaccacct gctgggcgtc gtgcacccgg acgccgagtt cacggcggcg 360
gacttccggc gcgaggccgc gggcgccgcg gcccgcgtcg cgtcgcgggg ccgcgtgccc 420
atcatcgcgg gcggctccaa ctcgtacgtg gaggagctcg tcgaggggga ccgccgcgcg 480
ttccgggaga ggtacgactg ctgcttcctg tgggtggacg cgcggctccc cgtgctgcac 540
ggcttcgtgg cccgccgcgt ggacgagatg tgccggcgcg ggctcgtgga cgaggtggcg 600
gccgcgttcg acccgcgccg caccgactac tcgaggggca tctggcgcgc catcggcgtg 660
ccggagatgg acgcctacct ccgcgcgggc ggccacggcg acggcgacgg cgacgagcag 720
gagcagcgcg cgcgcatgct cgccgcggcg ctcgacgaga tcaaggtcaa cacgtcccgg 780
ctcgccctgc gtcagcgcgg caagatccag cggctggcac gcatgtggcg cgtccgccgc 840
gtcgacgcca cggaggtgtt cctgaagcgc ggccacgccg ccgacgaggc ctggcagcgg 900
ctggtcgccg cgccgtgcat tgacgccgtc aggtccttcc tgctggagga gcaagagtac 960
agcagcagca tggtcaccgc ctccatgttt gcctccacgg cggccgcggc tgtctag 1017
<210>14
<211>1652
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT7 full length sequence
<221>CDS
<222>(298)...(1356)
<400>14
tcaaagactg aaaagtaatt taattgaccc ccggtcaggt caggtcaggt caggtcatgt 60
caggcacaag gcgtgtgtta gggtttcctt gtcgcgtact aacgaagaca tacatacgaa 120
ctgacgggaa aacaccagtc aagtctgtgg ctgacttcgt gccgtgcgct cttgaacccg 180
agcactataa aaacggagac ctatgcacgc ttttcattca cccatataca cagccgctac 240
actactacaa gctagcttgt acgtggtaac actgtgaaag acagtcgtac actcacg atg 300
Met
1
gcg gga gtt aac ggt gcc acg gcg agc gga ggc gac aac aag gcc aag 348
Ala Gly Val Asn Gly Ala Thr Ala Ser Gly Gly Asp Asn Lys Ala Lys
5 10 15
gtg gtg ctg gtg atg ggc gcc acg gcc acc ggc aag tcc aag ctg gcc 396
Val Val Leu Val Met Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu Ala
20 25 30
atc gac ctc gcg ctg cgc ttc ggc gga gag gtc gtc aac tcc gac aag 444
Ile Asp Leu Ala Leu Arg Phe Gly Gly Glu Val Val Asn Ser Asp Lys
35 40 45
atc cag gtg cac gac ggc ctc gac gtg gtc acc aac aag gtc acc gcc 492
Ile Gln Val His Asp Gly Leu Asp Val Val Thr Asn Lys Val Thr Ala
50 55 60 65
gcg gag cgc cag ggc gtg cca cac cac ctt atc gac ggg gtg gcg ccc 540
Ala Glu Arg Gln Gly Val Pro His His Leu Ile Asp Gly Val Ala Pro
70 75 80
gac gcc gac tac acc acc gcc gac ttc tgc agg gac gcc gtg cgc gct 588
Asp Ala Asp Tyr Thr Thr Ala Asp Phe Cys Arg Asp Ala Val Arg Ala
85 90 95
gtg gag tcc att ctc gag agg ggc cgc gtc ccg atc atc gcc ggg ggc 636
Val Glu Ser Ile Leu Glu Arg Gly Arg Val Pro Ile Ile Ala Gly Gly
100 105 110
tcc aac aga tac ctg gag gcg ctg ctg gac ggg gaa cct cct gca ggc 684
Ser Asn Arg Tyr Leu Glu Ala Leu Leu Asp Gly Glu Pro Pro Ala Gly
115 120 125
ttc cgc ggc cgc tac gaa tgc tgc ttc ctc tgg gtc gac agc gac ctg 732
Phe Arg Gly Arg Tyr Glu Cys Cys Phe Leu Trp Val Asp Ser Asp Leu
130 135 140 145
gcg gtg ytg gac cgc tac ata ggg agc cgc gtg gac tgc atg ctg gag 780
Ala Val Xaa Asp Arg Tyr Ile Gly Ser Arg Val Asp Cys Met Leu Glu
150 155 160
cag ggg ctc gtc cgc gag gtg cgg gcc ttc ttt cgg cac gac gac gcc 828
Gln Gly Leu Val Arg Glu Val Arg Ala Phe Phe Arg His Asp Asp Ala
165 170 175
gac tac tcc agg ggt atc cgg agg gcc atc ggc gtg ccg gag atg gac 876
Asp Tyr Ser Arg Gly Ile Arg Arg Ala Ile Gly Val Pro Glu Met Asp
180 185 190
atg tac ttc cgg atg gag gcc gca ggg gct ctc gac ggc gac gat gat 924
Met Tyr Phe Arg Met Glu Ala Ala Gly Ala Leu Asp Gly Asp Asp Asp
195 200 205
gat cag ctg cga gtg cgg ctc ctc gcc gcg gcc gtt aac gag atc aag 972
Asp Gln Leu Arg Val Arg Leu Leu Ala Ala Ala Val Asn Glu Ile Lys
210 215 220 225
gcc aac acg tgc ggc ctg gcg cgc cgc cag ctg cag aag atc cac cgg 1020
Ala Asn Thr Cys Gly Leu Ala Arg Arg Gln Leu Gln Lys Ile His Arg
230 235 240
ctc cac ggt ctc caa ggc tgg agc gac atc cac cgc ctc gac gtc acg 1068
Leu His Gly Leu Gln Gly Trp Ser Asp Ile His Arg Leu Asp Val Thr
245 250 255
gag gtg ctt cag ctc aag gtc ggg aac gcc ggg aac cca aag gca cag 1116
Glu Val Leu Gln Leu Lys Val Gly Asn Ala Gly Asn Pro Lys Ala Gln
260 265 270
cgc gac gcg tgg gag acg gac gtc gtc agc cct gcg gcg agg atc gtg 1164
Arg Asp Ala Trp Glu Thr Asp Val Val Ser Pro Ala Ala Arg Ile Val
275 280 285
gga atg ttt ctg gct gtt gag gga gct agg gac aag gac aag gac cgt 1212
Gly Met Phe Leu Ala Val Glu Gly Ala Arg Asp Lys Asp Lys Asp Arg
290 295 300 305
ttc ttg ttg acg acg ccc aaa gaa gtg gcc gtg cca ggc att tgc acg 1260
Phe Leu Leu Thr Thr Pro Lys Glu Val Ala Val Pro Gly Ile Cys Thr
310 315 320
gcc acg gca gat tgg ttc ggc cag cag ctg gac atg acg gtc atg tct 1308
Ala Thr Ala Asp Trp Phe Gly Gln Gln Leu Asp Met Thr Val Met Ser
325 330 335
cca agc aaa ggg ttt gct gga ttg ggc tcg gcg gcc gcc gcg gtt taa 1356
Pro Ser Lys Gly Phe Ala Gly Leu Gly Ser Ala Ala Ala Ala Val *
340 345 350
gctgtgatga cgatgaactc atctgctgat gatcaatcac tgaacggact ccaaatgcat 1416
gtacattcat ttatttcatg tagggaataa gttgttgtaa tgtattgctc ccccactaat 1476
aattaattta aggccaggta taggagaaat tgtaggggag gctgaacgac atagctcata 1536
ctttggaacg ttgtaatcta gccgatcaat ttcacgaaac catatttttt gaaacataat 1596
ctctattcag cattatgcca cgccatttac acaagacctt gtatatatat aaaaag 1652
<210>15
<211>352
<212>PRT
＜213〉corn
<220>
＜221〉variant
<222>148
＜223〉Xaa=arbitrary amino acid
<400>15
Met Ala Gly Val Asn Gly Ala Thr Ala Ser Gly Gly Asp Asn Lys Ala
1 5 10 15
Lys Val Val Leu Val Met Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu
20 25 30
Ala Ile Asp Leu Ala Leu Arg Phe Gly Gly Glu Val Val Asn Ser Asp
35 40 45
Lys Ile Gln Val His Asp Gly Leu Asp Val Val Thr Asn Lys Val Thr
50 55 60
Ala Ala Glu Arg Gln Gly Val Pro His His Leu Ile Asp Gly Val Ala
65 70 75 80
Pro Asp Ala Asp Tyr Thr Thr Ala Asp Phe Cys Arg Asp Ala Val Arg
85 90 95
Ala Val Glu Ser Ile Leu Glu Arg Gly Arg Val Pro Ile Ile Ala Gly
100 105 110
Gly Ser Asn Arg Tyr Leu Glu Ala Leu Leu Asp Gly Glu Pro Pro Ala
115 120 125
Gly Phe Arg Gly Arg Tyr Glu Cys Cys Phe Leu Trp Val Asp Ser Asp
130 135 140
Leu Ala Val Xaa Asp Arg Tyr Ile Gly Ser Arg Val Asp Cys Met Leu
145 150 155 160
Glu Gln Gly Leu Val Arg Glu Val Arg Ala Phe Phe Arg His Asp Asp
165 170 175
Ala Asp Tyr Ser Arg Gly Ile Arg Arg Ala Ile Gly Val Pro Glu Met
180 185 190
Asp Met Tyr Phe Arg Met Glu Ala Ala Gly Ala Leu Asp Gly Asp Asp
195 200 205
Asp Asp Gln Leu Arg Val Arg Leu Leu Ala Ala Ala Val Asn Glu Ile
210 215 220
Lys Ala Asn Thr Cys Gly Leu Ala Arg Arg Gln Leu Gln Lys Ile His
225 230 235 240
Arg Leu His Gly Leu Gln Gly Trp Ser Asp Ile His Arg Leu Asp Val
245 250 255
Thr Glu Val Leu Gln Leu Lys Val Gly Asn Ala Gly Asn Pro Lys Ala
260 265 270
Gln Arg Asp Ala Trp Glu Thr Asp Val Val Ser Pro Ala Ala Arg Ile
275 280 285
Val Gly Met Phe Leu Ala Val Glu Gly Ala Arg Asp Lys Asp Lys Asp
290 295 300
Arg Phe Leu Leu Thr Thr Pro Lys Glu Val Ala Val Pro Gly Ile Cys
305 310 315 320
Thr Ala Thr Ala Asp Trp Phe Gly Gln Gln Leu Asp Met Thr Val Met
325 330 335
Ser Pro Ser Lys Gly Phe Ala Gly Leu Gly Ser Ala Ala Ala Ala Val
340 345 350
<210>16
<211>1059
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT7 encoding sequence
<400>16
atggcgggag ttaacggtgc cacggcgagc ggaggcgaca acaaggccaa ggtggtgctg 60
gtgatgggcg ccacggccac cggcaagtcc aagctggcca tcgacctcgc gctgcgcttc 120
ggcggagagg tcgtcaactc cgacaagatc caggtgcacg acggcctcga cgtggtcacc 180
aacaaggtca ccgccgcgga gcgccagggc gtgccacacc accttatcga cggggtggcg 240
cccgacgccg actacaccac cgccgacttc tgcagggacg ccgtgcgcgc tgtggagtcc 300
attctcgaga ggggccgcgt cccgatcatc gccgggggct ccaacagata cctggaggcg 360
ctgctggacg gggaacctcc tgcaggcttc cgcggccgct acgaatgctg cttcctctgg 420
gtcgacagcg acctggcggt gytggaccgc tacataggga gccgcgtgga ctgcatgctg 480
gagcaggggc tcgtccgcga ggtgcgggcc ttctttcggc acgacgacgc cgactactcc 540
aggggtatcc ggagggccat cggcgtgccg gagatggaca tgtacttccg gatggaggcc 600
gcaggggctc tcgacggcga cgatgatgat cagctgcgag tgcggctcct cgccgcggcc 660
gttaacgaga tcaaggccaa cacgtgcggc ctggcgcgcc gccagctgca gaagatccac 720
cggctccacg gtctccaagg ctggagcgac atccaccgcc tcgacgtcac ggaggtgctt 780
cagctcaagg tcgggaacgc cgggaaccca aaggcacagc gcgacgcgtg ggagacggac 840
gtcgtcagcc ctgcggcgag gatcgtggga atgtttctgg ctgttgaggg agctagggac 900
aaggacaagg accgtttctt gttgacgacg cccaaagaag tggccgtgcc aggcatttgc 960
acggccacgg cagattggtt cggccagcag ctggacatga cggtcatgtc tccaagcaaa 1020
gggtttgctg gattgggctc ggcggccgcc gcggtttaa 1059
<210>17
<211>3419
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT8 full length sequence
<221>CDS
<222>(1897)...(3063)
<400>17
gtcttagtgc atcgattcta agagtgaagc aggtagaata ctcacctatt ctctgtaaga 60
tatatgagtg agtttaaata cctctctaca gaccaaattc tagagttttt tttttccaaa 120
ccgatactga tcggtctcca gtggttggat aaataccgac cttattattc ggtcagcagg 180
cgaagcgacc gcagtgttag cgatcgacga taaaaccatg gtggtcagca ctgatcgcag 240
gcgaggccac gtcgtcgttc cgtaacgctc gtgctgaaac cagcccgagt aaactgtgag 300
ccgcttcttt ttcgagtacg atccgggacc agacgttaca gaaaaaaaaa aggatgagca 360
tgaagctgct gccgaggctg agcatcaagg ctgcctttcc gttcattggc tgggtgcggt 420
tatgggtgca gtactgcagt gctgcgcagt cgagtcgtgc tcgtctccat cctactcacc 480
atgtgcagcc gactttcata tagaaccgga ggctgacaga cagacagaca gacagagccg 540
ctacgctact ggatcaccgc cggccagggg aacgagaggc atggccgcat catcaccagc 600
catgggttag tagtcaccca aattcttcct cgcatcgcac gcgccgcgcg gtcaagccac 660
gacacgagac ggaggattac gaaaaggaac ggaacggaac cgcccgtcgc gtcgcacgcc 720
gggaccggga tgggcgcgga cgcgagcccg gaggcaggcc gaaaggtcgc cggccggctg 780
gccggacgga cggaagggga ggcggggaga aacgaagcct gtcgtgtcgt gtcgtgtcgt 840
gcgaggcagc cagcgccgca ggtcgcagtc tctggagtct ggacccggcc gaaaaggcgt 900
gccgggacca ggaccagaac ccggacccgg atccaacaga agatgtacta ttggcaggag 960
cagtcggaag cggacgcgcg cgcacccgac acgatggggg cgccagtgcc accaactcag 1020
cagccagtgg ccggccgggc ccaaagcggc tggagcttgc cgtgccggct gcctgccgaa 1080
tccaagcgaa gcgcaccggc gcggctaccc gcacccgctc gcggctgccc tgccctccca 1140
ctagtcccgg ctctgctgct cgcctcggaa tgttctcgcc gcctgcgggg acgacacgcg 1200
acgcttatta taaccacgcc tctgtccggc ggtcgccctg ccaccgcccg gcacccggca 1260
cccgccacct ggttttgttg gcgtccctcg cgctgccact gcgagctggg tggggatcgg 1320
ggccccggtc catccggaca ggaagccccg catggccgcg accgccatca tgggccgacg 1380
tacagcgtcc gcttttgttt aaggtccccc gcgcatcgca tcgatcgtgt cgtgtcgtgg 1440
caattgcttt cggagtgtcg agcgccactc ctgcaaagcc tgtgctgtgc tgctgccttg 1500
tattgtatat atacacacgc acacacaacg agtcgagccg agcaatactg gcacggcgcg 1560
ttgccccctg ccagacagca cggccaacgc caccccacca gtccaacagc aggcggtggc 1620
cgaggaggag ggaatagccg aatagggatt tttgaggttt tcggcggcag aaatacgagc 1680
gaaaactcaa aacaggcgcg cgactgaaga gagagcgcta gctggaagag acgggcgagc 1740
cgatctggcg tggcagccgt tccctgcccc gtccccgcat aaatcccaac aaggacgctg 1800
gcgctgcgtg tatctccctc gcaagagaca aaaaaaaata tcacacacac ggcgcggcgg 1860
tcatagtgcg gctgattcgg atcgggcact agctac atg acc acc ctc ctc gcc 1914
Met Thr Thr Leu Leu Ala
1 5
aat agg atc act acg ctc gtg cgc gcc cct cct cct ccc atg gcc gcc 1962
Asn Arg Ile Thr Thr Leu Val Arg Ala Pro Pro Pro Pro Met Ala Ala
10 15 20
gcc gcc gtc gcg gga gcg cgg agg cca ttg cac cgg acc ttg gcg cac 2010
Ala Ala Val Ala Gly Ala Arg Arg Pro Leu His Arg Thr Leu Ala His
25 30 35
ccg cca ccg ccc gag gag gac gag cat cag cag cag cgc gcg tgc cgc 2058
Pro Pro Pro Pro Glu Glu Asp Glu His Gln Gln Gln Arg Ala Cys Arg
40 45 50
agc agg gga tcc tcg tcc tcc tgc tcg gct tcc tcg tca tcg acg ccc 2106
Ser Arg Gly Ser Ser Ser Ser Cys Ser Ala Ser Ser Ser Ser Thr Pro
55 60 65 70
gcc cgg ccc cgg ggc acg ggg atg gtg gtg atc gtc ggc gcc acg ggc 2154
Ala Arg Pro Arg Gly Thr Gly Met Val Val Ile Val Gly Ala Thr Gly
75 80 85
acc ggg aag acc aag ctg tcc atc gac gcc gcg gag gcg gtc ggc ggg 2202
Thr Gly Lys Thr Lys Leu Ser Ile Asp Ala Ala Glu Ala Val Gly Gly
90 95 100
gag gtg gtg aac gcg gat aag atc cag ctc tac gcc ggg ctg gac gtg 2250
Glu Val Val Asn Ala Asp Lys Ile Gln Leu Tyr Ala Gly Leu Asp Val
105 110 115
acc acg aac aag gtg gcc ccc gcg gac cgc cgc ggc gtg ccg cac cac 2298
Thr Thr Asn Lys Val Ala Pro Ala Asp Arg Arg Gly Val Pro His His
120 125 130
ctc ctc ggc gcc atc cgc ccc gag gcc ggc gag ctc ccg ccc tcc acg 2346
Leu Leu Gly Ala Ile Arg Pro Glu Ala Gly Glu Leu Pro Pro Ser Thr
135 140 145 150
ttc cgc tcc ctc gcc gcc gcc acg gcc gcc tcg atc gcc gcg cgc ggc 2394
Phe Arg Ser Leu Ala Ala Ala Thr Ala Ala Ser Ile Ala Ala Arg Gly
155 160 165
cgc ctg ccg gtc gtc gcg ggc ggc tcc aac tcc ctc atc cac gcg ctc 2442
Arg Leu Pro Val Val Ala Gly Gly Ser Asn Ser Leu Ile His Ala Leu
170 175 180
ctc gcc gac cgc ctc gac gcc ggc gcc gcc gac ccc ttc tcc gct cca 2490
Leu Ala Asp Arg Leu Asp Ala Gly Ala Ala Asp Pro Phe Ser Ala Pro
185 190 195
ccg cag ccg gcg ccg ccg cgg tgg ggc cgc cgg ccc gcg ctc cga tcc 2538
Pro Gln Pro Ala Pro Pro Arg Trp Gly Arg Arg Pro Ala Leu Arg Ser
200 205 210
ccg tgc tgt ctc ctc tgg gtc cac gtc gac gcc gcg ctc ctc gcg gag 2586
Pro Cys Cys Leu Leu Trp Val His Val Asp Ala Ala Leu Leu Ala Glu
215 220 225 230
tac ctg gac cgg cgc gtg gac gac atg gtg cgc ggc ggc atg gtg gag 2634
Tyr Leu Asp Arg Arg Val Asp Asp Met Val Arg Gly Gly Met Val Glu
235 240 245
gag ctg cgg gag tac ttc gcc gcg acc acc gcc gcc gag cgc gcc gcg 2682
Glu Leu Arg Glu Tyr Phe Ala Ala Thr Thr Ala Ala Glu Arg Ala Ala
250 255 260
cac gcc gcg ggg ctg ggc agg gcc atc ggc gtg ccc gag ctg ggc gcc 2730
His Ala Ala Gly Leu Gly Arg Ala Ile Gly Val Pro Glu Leu Gly Ala
265 270 275
tgc ttc gcg ggg cgc gcc agc ttc cgc gcc gcg atc gac gac atc aag 2778
Cys Phe Ala Gly Arg Ala Ser Phe Arg Ala Ala Ile Asp Asp Ile Lys
280 285 290
gcc aac acg cgg gac ctg gcg gcc gcg cag gtg cgc aag atc cga cgc 2826
Ala Asn Thr Arg Asp Leu Ala Ala Ala Gln Val Arg Lys Ile Arg Arg
295 300 305 310
atg gcc gat gcc tgg ggc tgg ccc atc cag cgg ctc gac gcg tcg gcc 2874
Met Ala Asp Ala Trp Gly Trp Pro Ile Gln Arg Leu Asp Ala Ser Ala
315 320 325
aca gtc cgc gcg cgc ctc cgc ggc gcg ggg ccc gac gcg gag tcg gcg 2922
Thr Val Arg Ala Arg Leu Arg Gly Ala Gly Pro Asp Ala Glu Ser Ala
330 335 340
tgc tgg gag cgc gac gtg cgc gcg ccc ggg ctc gcc gcc atc cgg agc 2970
Cys Trp Glu Arg Asp Val Arg Ala Pro Gly Leu Ala Ala Ile Arg Ser
345 350 355
ttc ctt cta gag ctg gac ggc ggc agc gtc gtc gac ggc gct gtg gtg 3018
Phe Leu Leu Glu Leu Asp Gly Gly Ser Val Val Asp Gly Ala Val Val
360 365 370
gag gag gtg gag ccg cgg gtg cga tgc tgc gac gtg gtg ggg tga 3063
Glu Glu Val Glu Pro Arg Val Arg Cys Cys Asp Val Val Gly *
375 380 385
gcgagctcgg tcctcagctg ctgtcacttt ccgggcggag ttattcgcga tatacgccgc 3123
gaaaaggctg cggggggctt ttggactcga gggtttaggc cgccgatttt gcagggtccc 3183
ggcggccgct gaccggtggg gtccggcgaa gggcacagcg agtgagtgag tgacacaggg 3243
acatgagaat gagagaagga gacagaggga gaaaagaaaa tgcttcatgt ttagtgttta 3303
ctacaaatca ttactattag ttaccattag tgtaggcaga gataagcatt gatgaaggga 3363
gagggaggag actgtgaatt cgaggggtat cttttcttct ttttgctttt ggttcg 3419
<210>18
<211>388
<212>PRT
＜213〉corn
<400>18
Met Thr Thr Leu Leu Ala Asn Arg Ile Thr Thr Leu Val Arg Ala Pro
1 5 10 15
Pro Pro Pro Met Ala Ala Ala Ala Val Ala Gly Ala Arg Arg Pro Leu
20 25 30
His Arg Thr Leu Ala His Pro Pro Pro Pro Glu Glu Asp Glu His Gln
35 40 45
Gln Gln Arg Ala Cys Arg Ser Arg Gly Ser Ser Ser Ser Cys Ser Ala
50 55 60
Ser Ser Ser Ser Thr Pro Ala Arg Pro Arg Gly Thr Gly Met Val Val
65 70 75 80
Ile Val Gly Ala Thr Gly Thr Gly Lys Thr Lys Leu Ser Ile Asp Ala
85 90 95
Ala Glu Ala Val Gly Gly Glu Val Val Asn Ala Asp Lys Ile Gln Leu
100 105 110
Tyr Ala Gly Leu Asp Val Thr Thr Asn Lys Val Ala Pro Ala Asp Arg
115 120 125
Arg Gly Val Pro His His Leu Leu Gly Ala Ile Arg Pro Glu Ala Gly
130 135 140
Glu Leu Pro Pro Ser Thr Phe Arg Ser Leu Ala Ala Ala Thr Ala Ala
145 150 155 160
Ser Ile Ala Ala Arg Gly Arg Leu Pro Val Val Ala Gly Gly Ser Asn
165 170 175
Ser Leu Ile His Ala Leu Leu Ala Asp Arg Leu Asp Ala Gly Ala Ala
180 185 190
Asp Pro Phe Ser Ala Pro Pro Gln Pro Ala Pro Pro Arg Trp Gly Arg
195 200 205
Arg Pro Ala Leu Arg Ser Pro Cys Cys Leu Leu Trp Val His Val Asp
210 215 220
Ala Ala Leu Leu Ala Glu Tyr Leu Asp Arg Arg Val Asp Asp Met Val
225 230 235 240
Arg Gly Gly Met Val Glu Glu Leu Arg Glu Tyr Phe Ala Ala Thr Thr
245 250 255
Ala Ala Glu Arg Ala Ala His Ala Ala Gly Leu Gly Arg Ala Ile Gly
260 265 270
Val Pro Glu Leu Gly Ala Cys Phe Ala Gly Arg Ala Ser Phe Arg Ala
275 280 285
Ala Ile Asp Asp Ile Lys Ala Asn Thr Arg Asp Leu Ala Ala Ala Gln
290 295 300
Val Arg Lys Ile Arg Arg Met Ala Asp Ala Trp Gly Trp Pro Ile Gln
305 310 315 320
Arg Leu Asp Ala Ser Ala Thr Val Arg Ala Arg Leu Arg Gly Ala Gly
325 330 335
Pro Asp Ala Glu Ser Ala Cys Trp Glu Arg Asp Val Arg Ala Pro Gly
340 345 350
Leu Ala Ala Ile Arg Ser Phe Leu Leu Glu Leu Asp Gly Gly Ser Val
355 360 365
Val Asp Gly Ala Val Val Glu Glu Val Glu Pro Arg Val Arg Cys Cys
370 375 380
Asp Val Val Gly
385
<210>19
<211>1167
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT8 encoding sequence
<400>19
atgaccaccc tcctcgccaa taggatcact acgctcgtgc gcgcccctcc tcctcccatg 60
gccgccgccg ccgtcgcggg agcgcggagg ccattgcacc ggaccttggc gcacccgcca 120
ccgcccgagg aggacgagca tcagcagcag cgcgcgtgcc gcagcagggg atcctcgtcc 180
tcctgctcgg cttcctcgtc atcgacgccc gcccggcccc ggggcacggg gatggtggtg 240
atcgtcggcg ccacgggcac cgggaagacc aagctgtcca tcgacgccgc ggaggcggtc 300
ggcggggagg tggtgaacgc ggataagatc cagctctacg ccgggctgga cgtgaccacg 360
aacaaggtgg cccccgcgga ccgccgcggc gtgccgcacc acctcctcgg cgccatccgc 420
cccgaggccg gcgagctccc gccctccacg ttccgctccc tcgccgccgc cacggccgcc 480
tcgatcgccg cgcgcggccg cctgccggtc gtcgcgggcg gctccaactc cctcatccac 540
gcgctcctcg ccgaccgcct cgacgccggc gccgccgacc ccttctccgc tccaccgcag 600
ccggcgccgc cgcggtgggg ccgccggccc gcgctccgat ccccgtgctg tctcctctgg 660
gtccacgtcg acgccgcgct cctcgcggag tacctggacc ggcgcgtgga cgacatggtg 720
cgcggcggca tggtggagga gctgcgggag tacttcgccg cgaccaccgc cgccgagcgc 780
gccgcgcacg ccgcggggct gggcagggcc atcggcgtgc ccgagctggg cgcctgcttc 840
gcggggcgcg ccagcttccg cgccgcgatc gacgacatca aggccaacac gcgggacctg 900
gcggccgcgc aggtgcgcaa gatccgacgc atggccgatg cctggggctg gcccatccag 960
cggctcgacg cgtcggccac agtccgcgcg cgcctccgcg gcgcggggcc cgacgcggag 1020
tcggcgtgct gggagcgcga cgtgcgcgcg cccgggctcg ccgccatccg gagcttcctt 1080
ctagagctgg acggcggcag cgtcgtcgac ggcgctgtgg tggaggaggt ggagccgcgg 1140
gtgcgatgct gcgacgtggt ggggtga 1167
<210>20
<211>1535
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT9 full length sequence
<400>20
gcttgcttgt aaccgatggc actacttgca gagttcatac gtggctgcaa cccgatatca 60
agcagccatg aggcttccga aagtaagccg cctgtgtcaa ccagcatttc ttcacacctc 120
agatcaattg accggtacag ttcaatgcgt ggacttgcga ggaaaatgca gaagaagtca 180
tactccatct ccctggcctc gtagtttcca gcggatgagg gagcctcagt taggtcagtg 240
tcatgctgtt cacagaatgc atcgtacggt aaggcgaagg cagaaggagg ggagcctgat 300
gacctgataa tctcgaggct gcggctcaat ctgttccagt tattgacaga caagtcccgg 360
gctctggggt caccagcctg caccaccagc tctaccgctt cctcccactg gccgttctcc 420
cgaaaatcag cgagctcaga ccacacggcc aaagtggact ccatggatga ctgtggaacg 480
ttcggcttgc catagatgta ccatctcagg tacagcccag tccctcctgc gataacgggc 540
acgcagcctc tgtcaagaac atcctgcgtc gccctccggg catcgcggaa aaaggctcca 600
gccgagtaat cgtcggacgt gtccagtatg tcgatcaagt gatgcggcac taggctcatc 660
tccgccgcgg acggtttggc agaaccaacg tcaaggccac ggtagacttg cacggagtcc 720
gcactgatga tctcccctcc gagcctcctg gccacctcca gcgccagcct gctctttcca 780
gcaccagtag gaccagagat gacgatgacc gtgtccttct tcttatgatg agttggtggt 840
ggcagagacg aggcggccat cgtggcggcc ttggttgagg cacagaaaga tggtagaagc 900
ctgtgctgtg actgcaagca caggataggc cagctcctcc agatggcacg ccgcatcgcc 960
cccagctgct gtggcctcat ctcgccggac atgataaagg aagagtatct gccaaagacg 1020
cagacagaaa ttcagggtag gctacgtgat ttgctgagat gaaaatgctg cttgacagcg 1080
tttgaagtcc tgcaggcatt tcatcataca cctaggtagg actcagtcga gagccattgc 1140
tcctggcttg gctcggagtc atagagtggt agccttattt agccatcgtt agcaacaagg 1200
aagtggtgag tgtgaatgtg caggaagaag tacccatgga gaactgtatg tgaattcaaa 1260
cggaggatgc gtacttgtgg ctgtggctgc ggcggcgagc tccgacaagg ttgctctcgc 1320
aagctacaag gaggggagga gtgggggaac ggaagccatt ccgcttacct tgagccagca 1380
acttccggcc tctcctccgt cccaccgccg gcgtggcgtg gtgcgcctca gcgcctggcc 1440
gccgcgcttc cgaggacggc cagggagcag ccgtcggcgc ctcgggcgtt aggctatccg 1500
cactcatata actctaaatt tctactctaa aagaa 1535
<210>21
<211>3000
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT1 genome sequence
<400>21
tttctgcaaa agtatctaag ttgattcttg ttaaagcctc tccttgattc ccaaatccag 60
catacccttg agagtctttt ctttagtcgg gtaagtcttg ctgagtaatt ccatactcag 120
ggttttattc cctgttgttt ttcaggtcat agttttgtgc tgttgatgat ggtgttaagt 180
gccggtgggc tcggccttct tataagtcta agtaaccctt ctaaacttct taatgaggat 240
ggtcccttga gctagcatat atttcaaact tatacttttg caatcactcc gataaaataa 300
tataaaattt ttgtaacttg taaaatttgg taacaaggtt ttcgctgcaa aaatattggt 360
gtgtgtgatt tgtgttactt aatcccgagg ttctggttgt aagtggttta tccggtgtcc 420
ttggggcaat cggacggatc ctgttaagtt atctggtgca catgcatagc agtctgaggt 480
ctttgagaca aggacaggtg catgtgggcc caataacttg ggaggttctg ccacaattat 540
tagcaagata tcggagatat ttatgtgcta tatttttact atagaggagt gagacgaaga 600
gtgttatgta agttacagag tagaaacaaa ttctactact gtataaaatc atttcacatc 660
ccccatccca tgaatttgag ataggcttat atctaaactt tggaaagtgg tggaatgtca 720
aattccaaac taaataagtt actttagtga gtgaattcca attcctttaa aatgaaggga 780
tccaaacgcc ccgtaaggaa aatagaaatc ccttaggctt tgtttgggta aagagagatt 840
gaagtggatt aaggtgtatt gaaggagatt aaaataaaaa ttagttcata ttacacttca 900
atacacctca taccacctca atccactcca atctgagatt acccaaacaa gtccttagta 960
aaattgtgtt cccaaactat gctctaattt tactagcatt ttttatccac taactattag 1020
ctccaaacac cccctaattt tagtagcaag agcaaggaaa accccccagc catcttcatc 1080
tgcctgctgg tgccggactg acggttagag atggcccacc cctcctccgc cgccgccgta 1140
tcctccacgg cgcccgctgc aaaccctagt tatggcgccc gcgaggaagg aggcgcccgc 1200
tctccgccgt ctccgtctcc gtctccgtct cagagggggc gggccaaggt ggtgatcgtt 1260
atgggcgcca cgggcgccgg caagtcgcgg ctggccgtcg acctcgcggc ccacttcgcc 1320
ggcgtcgagg tggtcagcgc cgactccatg cagctctacc gcggcctcga cgtcctcacc 1380
aacaaggctc ccctccacga gcagaacggt ctgtttctga ctcctcaccg cctcccccct 1440
aatttcagtt tcctgtcaga ttaaatgctc gagcctgttc catgcgtgtt tgcaggtgtt 1500
cctcatcatc tacttagcgt gattgatccc tctgtcgagt tcacttgccg tgatttccgc 1560
gaccgtgccc tgccggtaag ccagtgctgc tgccagccac tgcctctaca agttccagca 1620
cttgctttag ttggtcacat gatagctaag gccttcccct ctgctcacag attatacagg 1680
aaatagtgga ccgcggtggc ctccctgtgg ttgtcggcgg cacaaacttc tacatccagg 1740
ttcaaatttg aagtgtccta atttctgtat ggttttctgg gtgaccgcag tgtctgaacc 1800
accgtcgtgt ttttgcccac aaaatactcc aggctctcgt tagcccattc ctcttggatg 1860
atatggcaga agaaatgcag ggctgtactc tgagagatca catagatgat ggtataggcg 1920
agtaatgagt catgctaaat gttccttgtt cttagtatga acaatcagcg gttgacatgt 1980
atgccaatcg tcaggcctta ccgatgaaga tgaaggcaat gggtttgaac gcttgaagga 2040
gatcgatcct gtggctgcgc agaggatcca tccaaacgac catagaaaag taagggtgtt 2100
gcccaagttt ttcctgactt tatgcagctc ttgagctcta ccatgttaga attacttctt 2160
gtacaggtgc tcattttcct actgccgttg attgcttgtg tatttttcgt tctgcatggg 2220
ttggtgtatc acaaagatca aacgctacct cgagttgtat gcaaccacgg gtgccctacc 2280
cagcgatctg ttccaaggag aggccgctaa ggtgaggaat ttttcgctgc acttgtctgc 2340
tctgcttgta taatatcctc cctttgtcat gaacatgagc cgacaattgc ctcacaaggc 2400
tcttcttttt ttggttttgt ttccctaatt gagtataaac ttgctgggaa ttcctgctca 2460
tcatgtcaga acagaaatgg ggtcggccta gtaactccag actcgactgc tgtttcctgt 2520
gggtagatgc tgatcttcaa gtcctggaca gttatgtcaa caaaagggtc gattgcatga 2580
tggatggtgg cctgctggac gaagtatgca gcatatatga tgcggatgct gtctataccc 2640
aggggctgcg gcaggctatt ggggttcgtg agtttgacga gtttttcaga gcatatttac 2700
ccagaaaaga atctggtgag ggttcctgtg caagcctgtt aggtatgcat gacgatcagc 2760
ttaagagctt gttggacgaa gctgtttccc agctgaaggc aaacactcgt agactagttc 2820
gacgtcaagt aagcacttag tatcctgtgt atttttttat gttgttgtgt tgttttagaa 2880
tactgtgcga ctgaacacac ggatacttgg ctcaatgtag acttcttagc gtttcttttt 2940
ttttctccat taaataaaag agacggagat tgcatcggct gagtaaagat tttgggtgga 3000
<210>22
<211>1209
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT1 total length (from the ZmIPT1 genomic clone)
<221>CDS
<222>(1)...(1062)
<400>22
atg gcc cac ccc tcc tcc gcc gcc gcc gta tcc tcc acg gcg ccc gct 48
Met Ala His Pro Ser Ser Ala Ala Ala Val Ser Ser Thr Ala Pro Ala
1 5 10 15
gca aac cct agt tat ggc gcc cgc gag gaa gga ggc gcc cgc tct ccg 96
Ala Asn Pro Ser Tyr Gly Ala Arg Glu Glu Gly Gly Ala Arg Ser Pro
20 25 30
ccg tct ccg tct ccg tct ccg tct cag agg ggg cgg gcc aag gtg gtg 144
Pro Ser Pro Ser Pro Ser Pro Ser Gln Arg Gly Arg Ala Lys Val Val
35 40 45
atc gtt atg ggc gcc acg ggc gcc ggc aag tcg cgg ctg gcc gtc gac 192
Ile Val Met Gly Ala Thr Gly Ala Gly Lys Ser Arg Leu Ala Val Asp
50 55 60
ctc gcg gcc cac ttc gcc ggc gtc gag gtg gtc agc gcc gac tcc atg 240
Leu Ala Ala His Phe Ala Gly Val Glu Val Val Ser Ala Asp Ser Met
65 70 75 80
cag ctc tac cgc ggc ctc gac gtc ctc acc aac aag gct ccc ctc cac 288
Gln Leu Tyr Arg Gly Leu Asp Val Leu Thr Asn Lys Ala Pro Leu His
85 90 95
gag cag aac ggt gtt cct cat cat cta ctt agc gtg att gat ccc tct 336
Glu Gln Asn Gly Val Pro His His Leu Leu Ser Val Ile Asp Pro Ser
100 105 110
gtc gag ttc act tgc cgt gat ttc cgc gac cgt gcc ctg ccg att ata 384
Val Glu Phe Thr Cys Arg Asp Phe Arg Asp Arg Ala Leu Pro Ile Ile
115 120 125
cag gaa ata gtg gac cgc ggt ggc ctc cct gtg gtt gtc ggc ggc aca 432
Gln Glu Ile Val Asp Arg Gly Gly Leu Pro Val Val Val Gly Gly Thr
130 135 140
aac ttc tac atc cag gct ctc gtt agc cca ttc ctc ttg gat gat atg 480
Asn Phe Tyr Ile Gln Ala Leu Val Ser Pro Phe Leu Leu Asp Asp Met
145 150 155 160
gca gaa gaa atg cag ggc tgt act ctg aga gat cac ata gat gat ggc 528
Ala Glu Glu Met Gln Gly Cys Thr Leu Arg Asp His Ile Asp Asp Gly
165 170 175
ctt cc gat gaa gat gaa ggc aat ggg ttt gaa cgc ttg aag gag atc 576
Leu Thr Asp Glu Asp Glu Gly Asn Gly Phe Glu Arg Leu Lys Glu Ile
180 185 190
gat cct gtg gct gcg cag agg atc cat cca aac gac cat aga aaa atc 624
Asp Pro Val Ala Ala Gln Arg Ile His Pro Asn Asp His Arg Lys Ile
195 200 205
aaa cgc tac ctc gag ttg tat gca acc acg ggt gcc cta ccc agc gat 672
Lys Arg Tyr Leu Glu Leu Tyr Ala Thr Thr Gly Ala Leu Pro Ser Asp
210 215 220
ctg ttc caa gga gag gcc gct aag aaa tgg ggt cgg cct agt aac tcc 720
Leu Phe Gln Gly Glu Ala Ala Lys Lys Trp Gly Arg Pro Ser Asn Ser
225 230 235 240
aga ctc gac tgc tgt ttc ctg tgg gta gat gct gat ctt caa gtc ctg 768
Arg Leu Asp Cys Cys Phe Leu Trp Val Asp Ala Asp Leu Gln Val Leu
245 250 255
gac agt tat gtc aac aaa agg gtc gat tgc atg atg gat ggt ggc ctg 816
Asp Ser Tyr Val Asn Lys Arg Val Asp Cys Met Met Asp Gly Gly Leu
260 265 270
ctg gac gaa gta tgc agc ata tat gat gcg gat gct gtc tat acc cag 864
Leu Asp Glu Val Cys Ser Ile Tyr Asp Ala Asp Ala Val Tyr Thr Gln
275 280 285
ggg ctg cgg cag gct att ggg gtt cgt gag ttt gac gag ttt ttc aga 912
Gly Leu Arg Gln Ala Ile Gly Val Arg Glu Phe Asp Glu Phe Phe Arg
290 295 300
gca tat tta ccc aga aaa gaa tct ggt gag ggt tcc tgt gca agc ctg 960
Ala Tyr Leu Pro Arg Lys Glu Ser Gly Glu Gly Ser Cys Ala Ser Leu
305 310 315 320
tta ggt atg cat gac gat cag ctt aag agc ttg ttg gac gaa gct gtt 1008
Leu Gly Met His Asp Asp Gln Leu Lys Ser Leu Leu Asp Glu Ala Val
325 330 335
tcc cag ctg aag gca aac act cgt aga cta gtt cga cgt caa gta agc 1056
Ser Gln Leu Lys Ala Asn Thr Arg Arg Leu Val Arg Arg Gln Val Ser
340 345 350
act tag tatcctgtgt atttttttat gttgttgtgt tgttttagaa tactgtgcga 1112
Thr *
ctgaacacac ggatacttgg ctcaatgtag acttcttagc gtttcttttt ttttctccat 1172
taaataaaag agacggagat tgcatcggct gagtaaa 1209
<210>23
<211>353
<212>PRT
＜213〉corn
<400>23
Met Ala His Pro Ser Ser Ala Ala Ala Val Ser Ser Thr Ala Pro Ala
1 5 10 15
Ala Asn Pro Ser Tyr Gly Ala Arg Glu Glu Gly Gly Ala Arg Ser Pro
20 25 30
Pro Ser Pro Ser Pro Ser Pro Ser Gln Arg Gly Arg Ala Lys Val Val
35 40 45
Ile Val Met Gly Ala Thr Gly Ala Gly Lys Ser Arg Leu Ala Val Asp
50 55 60
Leu Ala Ala His Phe Ala Gly Val Glu Val Val Ser Ala Asp Ser Met
65 70 75 80
Gln Leu Tyr Arg Gly Leu Asp Val Leu Thr Asn Lys Ala Pro Leu His
85 90 95
Glu Gln Asn Gly Val Pro His His Leu Leu Ser Val Ile Asp Pro Ser
100 105 110
Val Glu Phe Thr Cys Arg Asp Phe Arg Asp Arg Ala Leu Pro Ile Ile
115 120 125
Gln Glu Ile Val Asp Arg Gly Gly Leu Pro Val Val Val Gly Gly Thr
130 135 140
Asn Phe Tyr Ile Gln Ala Leu Val Ser Pro Phe Leu Leu Asp Asp Met
145 150 155 160
Ala Glu Glu Met Gln Gly Cys Thr Leu Arg Asp His Ile Asp Asp Gly
165 170 175
Leu Thr Asp Glu Asp Glu Gly Asn Gly Phe Glu Arg Leu Lys Glu Ile
180 185 190
Asp Pro Val Ala Ala Gln Arg Ile His Pro Asn Asp His Arg Lys Ile
195 200 205
Lys Arg Tyr Leu Glu Leu Tyr Ala Thr Thr Gly Ala Leu Pro Ser Asp
210 215 220
Leu Phe Gln Gly Glu Ala Ala Lys Lys Trp Gly Arg Pro Ser Asn Ser
225 230 235 240
Arg Leu Asp Cys Cys Phe Leu Trp Val Asp Ala Asp Leu Gln Val Leu
245 250 255
Asp Ser Tyr Val Asn Lys Arg Val Asp Cys Met Met Asp Gly Gly Leu
260 265 270
Leu Asp Glu Val Cys Ser Ile Tyr Asp Ala Asp Ala Val Tyr Thr Gln
275 280 285
Gly Leu Arg Gln Ala Ile Gly Val Arg Glu Phe Asp Glu Phe Phe Arg
290 295 300
Ala Tyr Leu Pro Arg Lys Glu Ser Gly Glu Gly Ser Cys Ala Ser Leu
305 310 315 320
Leu Gly Met His Asp Asp Gln Leu Lys Ser Lau Lau Asp Glu Ala Val
325 330 335
Ser Gln Leu Lys Ala Asu Thr Arg Arg Leu Val Arg Arg Gln Val Ser
340 345 350
Thr
<210>24
<211>1062
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT1 encoding sequence
<400>24
atggcccacc cctcctccgc cgccgccgta tcctccacgg cgcccgctgc aaaccctagt 60
tatggcgccc gcgaggaagg aggcgcccgc tctccgccgt ctccgtctcc gtctccgtct 120
cagagggggc gggccaaggt ggtgatcgtt atgggcgcca cgggcgccgg caagtcgcgg 180
ctggccgtcg acctcgcggc ccacttcgcc ggcgtcgagg tggtcagcgc cgactccatg 240
cagctctacc gcggcctcga cgtcctcacc aacaaggctc ccctccacga gcagaacggt 300
gttcctcatc atctacttag cgtgattgat ccctctgtcg agttcacttg ccgtgatttc 360
cgcgaccgtg ccctgccgat tatacaggaa atagtggacc gcggtggcct ccctgtggtt 420
gtcggcggca caaacttcta catccaggct ctcgttagcc cattcctctt ggatgatatg 480
gcagaagaaa tgcagggctg tactctgaga gatcacatag atgatggcct taccgatgaa 540
gatgaaggca atgggtttga acgcttgaag gagatcgatc ctgtggctgc gcagaggatc 600
catccaaacg accatagaaa aatcaaacgc tacctcgagt tgtatgcaac cacgggtgcc 660
ctacccagcg atctgttcca aggagaggcc gctaagaaat ggggtcggcc tagtaactcc 720
agactcgact gctgtttcct gtgggtagat gctgatcttc aagtcctgga cagttatgtc 780
aacaaaaggg tcgattgcat gatggatggt ggcctgctgg acgaagtatg cagcatatat 840
gatgcggatg ctgtctatac ccaggggctg cggcaggcta ttggggttcg tgagtttgac 900
gagtttttca gagcatattt acccagaaaa gaatctggtg agggttcctg tgcaagcctg 960
ttaggtatgc atgacgatca gcttaagagc ttgttggacg aagctgtttc ccagctgaag 1020
gcaaacactc gtagactagt tcgacgtcaa gtaagcactt ag 1062
<210>25
<211>1082
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉ZmIPT1 promotor
<400>25
tttctgcaaa agtatctaag ttgattcttg ttaaagcctc tccttgattc ccaaatccag 60
catacccttg agagtctttt ctttagtcgg gtaagtcttg ctgagtaatt ccatactcag 120
ggttttattc cctgttgttt ttcaggtcat agttttgtgc tgttgatgat ggtgttaagt 180
gccggtgggc tcggccttct tataagtcta agtaaccctt ctaaacttct taatgaggat 240
ggtcccttga gctagcatat atttcaaact tatacttttg caatcactcc gataaaataa 300
tataaaattt ttgtaacttg taaaatttgg taacaaggtt ttcgctgcaa aaatattggt 360
gtgtgtgatt tgtgttactt aatcccgagg ttctggttgt aagtggttta tccggtgtcc 420
ttggggcaat cggacggatc ctgttaagtt atctggtgca catgcatagc agtctgaggt 480
ctttgagaca aggacaggtg catgtgggcc caataacttg ggaggttctg ccacaattat 540
tagcaagata tcggagatat ttatgtgcta tatttttact atagaggagt gagacgaaga 600
gtgttatgta agttacagag tagaaacaaa ttctactact gtataaaatc atttcacatc 660
ccccatccca tgaatttgag ataggcttat atctaaactt tggaaagtgg tggaatgtca 720
aattccaaac taaataagtt actttagtga gtgaattcca attcctttaa aatgaaggga 780
tccaaacgcc ccgtaaggaa aatagaaatc ccttaggctt tgtttgggta aagagagatt 840
gaagtggatt aaggtgtatt gaaggagatt aaaataaaaa ttagttcata ttacacttca 900
atacacctca taccacctca atccactcca atctgagatt acccaaacaa gtccttagta 960
aaattgtgtt cccaaactat gctctaattt tactagcatt ttttatccac taactattag 1020
ctccaaacac cccctaattt tagtagcaag agcaaggaaa accccccagc catcttcatc 1080
tg 1082
<210>26
<211>1299
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉variant of ZmIPT1, total length is from B73
EST
<221>CDS
<222>(31)...(1086)
<400>26
ccacgcgtcc ggccggactg acggttagag atg gcc cac ccc tcc gcc gcc gcc 54
Met Ala His Pro Ser Ala Ala Ala
1 5
gcc gcc gta tcc tcc acg gcg ccc gct gca aac cct agt tct ggc gcc 102
Ala Ala Val Ser Ser Thr Ala Pro Ala Ala Asn Pro Ser Ser Gly Ala
10 15 20
cgc gag gaa gga ggc gcc cgc tct ccg ccg tcg ccg tct ccg tct cag 150
Arg Glu Glu Gly Gly Ala Arg Ser Pro Pro Ser Pro Ser Pro Ser Gln
25 30 35 40
agg ggg cgg gcc aag gtg gtg atc gtt atg ggc gcc acg ggc gcc ggc 198
Arg Gly Arg Ala Lys Val Val Ile Val Met Gly Ala Thr Gly Ala Gly
45 50 55
aag tcg cgg ctg gcc gtc gac ctc gcg gcc cac ttc gcc ggc gtc gaa 246
Lys Ser Arg Leu Ala Val Asp Leu Ala Ala His Phe Ala Gly Val Glu
60 65 70
gtg gtc agc gcc gac tcc atg cag ctc tac cgc ggc ctc gac gtc ctc 294
Val Val Ser Ala Asp Ser Met Gln Leu Tyr Arg Gly Leu Asp Val Leu
75 80 85
acc aac aag gct ccc ctc cac gag cag aac ggt gtt cct cat cat cta 342
Thr Asn Lys Ala Pro Leu His Glu Gln Asn Gly Val Pro His His Leu
90 95 100
ctt agc gtg att gat ccc tct gtc gag ttc act tgc cgt gat ttc cgc 390
Leu Ser Val Ile Asp Pro Ser Val Glu Phe Thr Cys Arg Asp Phe Arg
105 110 115 120
gac cgt gcc gtg ccg att ata cag gaa ata gtg gac cgc ggt ggc ctc 438
Asp Arg Ala Val Pro Ile Ile Gln Glu Ile Val Asp Arg Gly Gly Leu
125 130 135
cct gtg gtt gtc ggc ggc aca aac ttc tac atc cag gct ctc gtt agc 486
Pro Val Val Val Gly Gly Thr Asn Phe Tyr Ile Gln Ala Leu Val Ser
140 145 150
cca ttc ctc ttg gat gat atg gca gaa gaa atg cag ggc tgt act ctg 534
Pro Phe Leu Leu Asp Asp Met Ala Glu Glu Met Gln Gly Cys Thr Leu
155 160 165
aga gat cac ata gat gat ggt ctt act gat gaa gat gaa ggc aat ggg 582
Arg Asp His Ile Asp Asp Gly Leu Thr Asp Glu Asp Glu Gly Asn Gly
170 175 180
ttt gaa cgc ttg aag gag atc gat cct gtg gct gcg cag agg atc cat 630
Phe Glu Arg Leu Lys Glu Ile Asp Pro Val Ala Ala Gln Arg Ile His
185 190 195 200
cca aac gac cat aga aaa atc aaa cgc tac ctc gag ttg tat gca acc 678
Pro Asn Asp His Arg Lys Ile Lys Arg Tyr Leu Glu Leu Tyr Ala Thr
205 210 215
acg ggt gcc cta ccc agc gat ctg ttc caa gga gag gcc gct aag aaa 726
Thr Gly Ala Leu Pro Ser Asp Leu Phe Gln Gly Glu Ala Ala Lys Lys
220 225 230
tgg ggt cgg cct agt aac tcc aga ctc gac tgc tgt ttc ctg tgg gta 774
Trp Gly Arg Pro Ser Asn Ser Arg Leu Asp Cys Cys Phe Leu Trp Val
235 240 245
gat gct gat ctt caa gtc ctg gac agt tat gtc aac aaa agg gtc gat 822
Asp Ala Asp Leu Gln Val Leu Asp Ser Tyr Val Asn Lys Arg Val Asp
250 255 260
tgc atg atg gat ggt ggc ctg ctg gac gaa gta tgc agc ata tat gat 870
Cys Met Met Asp Gly Gly Leu Leu Asp Glu Val Cys Ser Ile Tyr Asp
265 270 275 280
gcg gat gct gtc tat acc cag ggg ctg cgg cag gct att ggg gtt cgt 918
Ala Asp Ala Val Tyr Thr Gln Gly Leu Arg Gln Ala Ile Gly Val Arg
285 290 295
gag ttt gac gag ttt ttc aga gca tat tta ccc aga aaa gaa tct ggt 966
Glu Phe Asp Glu Phe Phe Arg Ala Tyr Leu Pro Arg Lys Glu Ser Gly
300 305 310
gag ggt tcc tgt gca agc ctg tta ggt atg cat gac gat cag ctt aag 1014
Glu Gly Ser Cys Ala Ser Leu Lau Gly Met His Asp Asp Gln Leu Lys
315 320 325
agc ttg ttg gac gaa gct gtt tcc cag ctg aag gca aac act cgt aga 1062
Ser Leu Leu Asp Glu Ala Val Ser Gln Leu Lys Ala Asn Thr Arg Arg
330 335 340
cta gtt cga cgt caa gta agc act tagtatcctg tgtatttttt tatgttgttg 1116
Leu Val Arg Arg Gln Val Ser Thr
345 350
tgttgtttta gaatactgtg cgactgaaca cacggatact tggctcaatg tagacttctt 1176
agcgtttctt tttttttctc cattaaataa aagagacgga gattgcatcg gctgagtaaa 1236
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1296
aaa 1299
<210>27
<211>352
<212>PRT
＜213〉corn
<400>27
Met Ala His Pro Ser Ala Ala Ala Ala Ala Val Ser Ser Thr Ala Pro
1 5 10 15
Ala Ala Asn Pro Ser Ser Gly Ala Arg Glu Glu Gly Gly Ala Arg Ser
20 25 30
Pro Pro Ser Pro Ser Pro Ser Gln Arg Gly Arg Ala Lys Val Val Ile
35 40 45
Val Met Gly Ala Thr Gly Ala Gly Lys Ser Arg Leu Ala Val Asp Leu
50 55 60
Ala Ala His Phe Ala Gly Val Glu Val Val Ser Ala Asp Ser Met Gln
65 70 75 80
Leu Tyr Arg Gly Leu Asp Val Leu Thr Asn Lys Ala Pro Leu His Glu
85 90 95
Gln Asn Gly Val Pro His His Leu Leu Ser Val Ile Asp Pro Ser Val
100 105 110
Glu Phe Thr Cys Arg Asp Phe Arg Asp Arg Ala Val Pro Ile Ile Gln
115 120 125
Glu Ile Val Asp Arg Gly Gly Leu Pro Val Val Val Gly Gly Thr Asn
130 135 140
Phe Tyr Ile Gln Ala Leu Val Ser Pro Phe Leu Leu Asp Asp Met Ala
145 150 155 160
Glu Glu Met Gln Gly Cys Thr Leu Arg Asp His Ile Asp Asp Gly Leu
165 170 175
Thr Asp Glu Asp Glu Gly Asn Gly Phe Glu Arg Leu Lys Glu Ile Asp
180 185 190
Pro Val Ala Ala Gln Arg Ile His Pro Asn Asp His Arg Lys Ile Lys
195 200 205
Arg Tyr Leu Glu Leu Tyr Ala Thr Thr Gly Ala Leu Pro Ser Asp Leu
210 215 220
Phe Gln Gly Glu Ala Ala Lys Lys Trp Gly Arg Pro Ser Asn Ser Arg
225 230 235 240
Leu Asp Cys Cys Phe Leu Trp Val Asp Ala Asp Leu Gln Val Leu Asp
245 250 255
Ser Tyr Val Asn Lys Arg Val Asp Cys Met Met Asp Gly Gly Leu Leu
260 265 270
Asp Glu Val Cys Ser Ile Tyr Asp Ala Asp Ala Val Tyr Thr Gln Gly
275 280 285
Leu Arg Gln Ala Ile Gly Val Arg Glu Phe Asp Glu Phe Phe Arg Ala
290 295 300
Tyr Leu Pro Arg Lys Glu Ser Gly Glu Gly Ser Cys Ala Ser Leu Leu
305 310 315 320
Gly Met His Asp Asp Gln Leu Lys Ser Leu Leu Asp Glu Ala Val Ser
325 330 335
Gln Leu Lys Ala Asn Thr Arg Arg Leu Val Arg Arg Gln Val Ser Thr
340 345 350
<210>28
<211>1056
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉variant ZmIPT1, cds is from B73 EsT
<400>28
atggcccacc cctccgccgc cgccgccgcc gtatcctcca cggcgcccgc tgcaaaccct 60
agttctggcg cccgcgagga aggaggcgcc cgctctccgc cgtcgccgtc tccgtctcag 120
agggggcggg ccaaggtggt gatcgttatg ggcgccacgg gcgccggcaa gtcgcggctg 180
gccgtcgacc tcgcggccca cttcgccggc gtcgaagtgg tcagcgccga ctccatgcag 240
ctctaccgcg gcctcgacgt cctcaccaac aaggctcccc tccacgagca gaacggtgtt 300
cctcatcatc tacttagcgt gattgatccc tctgtcgagt tcacttgccg tgatttccgc 360
gaccgtgccg tgccgattat acaggaaata gtggaccgcg gtggcctccc tgtggttgtc 420
ggcggcacaa acttctacat ccaggctctc gttagcccat tcctcttgga tgatatggca 480
gaagaaatgc agggctgtac tctgagagat cacatagatg atggtcttac tgatgaagat 540
gaaggcaatg ggtttgaacg cttgaaggag atcgatcctg tggctgcgca gaggatccat 600
ccaaacgacc atagaaaaat caaacgctac ctcgagttgt atgcaaccac gggtgcccta 660
cccagcgatc tgttccaagg agaggccgct aagaaatggg gtcggcctag taactccaga 720
ctcgactgct gtttcctgtg ggtagatgct gatcttcaag tcctggacag ttatgtcaac 780
aaaagggtcg attgcatgat ggatggtggc ctgctggacg aagtatgcag catatatgat 840
gcggatgctg tctataccca ggggctgcgg caggctattg gggttcgtga gtttgacgag 900
tttttcagag catatttacc cagaaaagaa tctggtgagg gttcctgtgc aagcctgtta 960
ggtatgcatg acgatcagct taagagcttg ttggacgaag ctgtttccca gctgaaggca 1020
aacactcgta gactagttcg acgtcaagta agcact 1056
<210>29
<211>357
<212>PRT
＜213〉Arabidopis thaliana (Arabidopsis thaliana)
<400>29
Met Thr Glu Leu Asn Phe His Leu Leu Pro Ile Ile Ser Asp Arg Phe
1 5 10 15
Thr Thr Thr Thr Thr Thr Ser Pro Ser Phe Ser Ser His Ser Ser Ser
20 25 30
Ser Ser Ser Leu Leu Ser Phe Thr Lys Arg Arg Arg Lys His Gln Pro
35 40 45
Leu Val Ser Ser Ile Arg Met Glu Gln Ser Arg Ser Arg Asn Arg Lys
50 55 60
Asp Lys Val Val ValIle Leu Gly Ala Thr Gly Ala Gly Lys Ser Arg
65 70 75 80
Leu Ser Val Asp Leu Ala Thr Arg Phe Pro Ser Glu Ile Ile Asn Ser
85 90 95
Asp Lys Ile Gln Val Tyr Glu Gly Leu Glu Ile Thr Thr Asn Gln Ile
100 105 110
Thr Leu Gln Asp Arg Arg Gly Val Pro His His Leu Leu Gly Val Ile
115 120 125
Asn Pro Glu His Gly Glu Leu Thr Ala Gly Glu Phe Arg Ser Ala Ala
130 135 140
Ser Asn Val Val Lys Glu Ile Thr Ser Arg Gln Lys Val Pro Ile Ile
145 150 155 160
Ala Gly Gly Ser Asn Ser Phe Val His Ala Leu Leu Ala Gln Arg Phe
165 170 175
Asp Pro Lys Phe Asp Pro Phe Ser Ser Gly Ser Cys Leu Ile Ser Ser
180 185 190
Asp Leu Arg Tyr Glu Cys Cys Phe Ile Trp Val Asp Val Ser Glu Thr
195 200 205
Val Leu Tyr Glu Tyr Leu Leu Arg Arg Val Asp Glu Met Met Asp Ser
210 215 220
Gly Met Phe Glu Glu Leu Ser Arg Phe Tyr Asp Pro Val Lys Ser Gly
225 230 235 240
Leu Glu Thr Arg Phe Gly Ile Arg Lys Ala Ile Gly Val Pro Glu Phe
245 250 255
Asp Gly Tyr Phe Lys Glu Tyr Pro Pro Glu Lys Lys Met Ile Lys Trp
260 265 270
Asp Ala Leu Arg Lys Ala Ala Tyr Asp Lys Ala Val Asp Asp Ile Lys
275 280 285
Arg Asn Thr Trp Thr Leu Ala Lys Arg Gln Val Lys Lys Ile Glu Met
290 295 300
Leu Lys Asp Ala Gly Trp Glu Ile Glu Arg Val Asp Ala Thr Ala Ser
305 310 315 320
Phe Lys Ala Val Met Met Lys Ser Ser Ser Glu Lys Lys Trp Arg Glu
325 330 335
Asn Trp Glu Glu Gln Val Leu Glu Pro Ser Val Lys Ile Val Lys Arg
340 345 350
His Leu Val Gln Asn
355
<210>30
<211>318
<212>PRT
＜213〉Arabidopis thaliana
<400>30
Met Lys Cys Asn Asp Lys Met Val Val Ile Met Gly Ala Thr Gly Ser
1 5 10 15
Gly Lys Ser Ser Leu Ser Val Asp Leu Ala Leu His Phe Lys Ala Glu
20 25 30
Ile Ile Asn Ser Asp Lys Met Gln Phe Tyr Asp Gly Leu Lys Ile Thr
35 40 45
Thr Asn Gln Ser Thr Ile Glu Asp Arg Arg Gly Val Pro His His Leu
50 55 60
Leu Gly Glu Leu Asn Pro Glu Ala Gly Glu Val Thr Ala Ala Glu Phe
65 70 75 80
Arg Val Met Ala Ala Glu Ala Ile Ser Glu Ile Thr Gln Arg Lys Lys
85 90 95
Leu Pro Ile Leu Ala Gly Gly Ser Asn Ser Tyr Ile His Ala Leu Leu
100 105 110
Ala Lys Ser Tyr Asp Pro Glu Asn Tyr Pro Phe Ser Asp His Lys Gly
115 120 125
Ser Ile Cys Ser Glu Leu Lys Tyr Asp Cys Cys Phe Ile Trp Ile Asp
130 135 140
Val Asp Gln Ser Val Leu Phe Glu Tyr Leu Ser Leu Arg Leu Asp Leu
145 150 155 160
Met Met Lys Ser Gly Met Phe Glu Glu Ile Ala Glu Phe His Arg Ser
165 170 175
Lys Lys Ala Pro Lys Glu Pro Leu Gly Ile Trp Lys Ala Ile Gly Val
180 185 190
Gln Glu Phe Asp Asp Tyr Leu Lys Met Tyr Lys Trp Asp Asn Asp Met
195 200 205
Asp Lys Trp Asp Pro Met Arg Lys Glu Ala Tyr Glu Lys Ala Val Arg
210 215 220
Ala Ile Lys Glu Asn Thr Phe Gln Leu Thr Lys Asp Gln Ile Thr Lys
225 230 235 240
Ile Asn Lys Leu Arg Asn Ala Gly Trp Asp Ile Lys Lys Val Asp Ala
245 250 255
Thr Ala Ser Phe Arg Glu Ala Ile Arg Ala Ala Lys Glu Gly Glu Gly
260 265 270
Val Ala Glu Met Gln Arg Lys Ile Trp Asn Lys Glu Val Leu Glu Pro
275 280 285
Cys Val Lys Ile Val Arg Ser His Leu Asp Gln Pro Ile Asn Tyr Tyr
290 295 300
Tyr Tyr Tyr Phe Tyr Leu Leu Lys Arg Phe Leu Ser Leu Asn
305 310 315
<210>31
<211>350
<212>PRT
＜213〉petunia x hybrida
<400>31
Met Leu Ile Val Val His Ile Ile Ser Ile Thr Arg Ile Ile Phe Ile
1 5 10 15
Thr Leu Thr His Asn His Leu His Phe Leu Met Phe Arg Ser Leu Ser
20 25 30
Tyr Asn His Lys His Leu Lys Phe Leu Thr Asn Pro Thr Thr Arg Val
35 40 45
Leu Arg Arg Asn Met Ser Ser Ser Thr Val Val Thr Ile Pro Gly Pro
50 55 60
Thr Gln Lys Asn Lys Asn Lys Ile Ile Val Ile Met Gly Ala Thr Gly
65 70 75 80
Ser Gly Lys Ser Lys Leu Ser Ile Asp Leu Val Thr Arg His Tyr Pro
85 90 95
Phe Ser Glu Ile Ile Asn Ser Asp Lys Ile Gln Ile Thr Lys Gly Leu
100 105 110
Asn Ile Thr Thr Asn Lys Ile Thr Val Pro Asp Arg Arg Gly Val Val
115 120 125
His His Leu Leu Gly Glu Ile Asp Pro Asp Phe Asn Phe Ser Pro Ser
130 135 140
His Phe Arg Ser Ile Ala Gly Gln Arg Ile Asn Ser Ile Ile Asn Arg
145 150 155 160
His Lys Leu Pro Phe Leu Val Gly Gly Ser Asn Ser Tyr Ile Tyr Ala
165 170 175
Leu Leu Thr Asn Arg Phe Asp Pro Asp Phe Asn Pro Asp Ser Asn Pro
180 185 190
Val His Phe Ile Ser Asn Glu Leu Arg Tyr Asn Cys Cys Phe Ile Trp
195 200 205
Val Asp Val Leu Asn Pro Val Leu Asn Glu Tyr Leu Asp Lys Arg Val
210 215 220
Asp Glu Met Met Asn Ser Gly Met Tyr Glu Glu Leu Glu Gln Phe Phe
225 230 235 240
Lys Glu Asn Arg Phe Ser Asp Pro Gly Leu Glu Pro Gly Arg Ala Thr
245 250 255
Gly Leu Arg Lys Ala Ile Gly Val Pro Glu Met Glu Arg Tyr Phe Lys
260 265 270
Lys Ser Cys Thr Tyr Glu Glu Ala Val Arg Glu Ile Lys Glu Asn Thr
275 280 285
Trp Arg Leu Ala Lys Lys Gln Met Trp Lys Ile Gln Arg Leu Arg Glu
290 295 300
Ala Gly Trp Asp Leu Gln Arg Val Asp Ala Thr Glu Ala Phe Val Glu
305 310 315 320
Ala Met Ser Asn Lys Lys Glu Lys Gly Ile Ile Trp Glu Lys Gln Val
325 330 335
Val Glu Pro Ser Val Lys Ile Val Asn Arg Phe Leu Leu Asp
340 345 350
<210>32
<211>92
<212>PRT
＜213〉artificial sequence
<220>
＜223〉cytokinin-biosynthesizing enzyme consensus sequence
＜221〉variant
<222>(8)...(8)
＜223〉the 8th amino acid can be T.
＜221〉variant
<222>(14)...(14)
＜223〉the 14th amino acid can be L or I.
＜221〉variant
<222>(22)...(23)
＜223〉the 22nd and 23 amino acid can be L or I.
＜221〉variant
<222>(87)...(88)
＜223〉the 87th and 88 amino acid can be L or I.
＜221〉variant
<222>(92)...(92)
＜223〉the 92nd amino acid can be T.
＜221〉variant
<222>(2)...(89)
＜223〉Xaa=arbitrary amino acid
<400>32
Gly Xaa Thr Xaa Xaa Gly Lys Ser Xaa Xaa Xaa Xaa Xaa Val Xaa Xaa
1 5 10 15
Xaa Xaa Xaa Xaa Xaa Val Val Xaa Xaa Asp Xaa Xaa Gln Xaa Xaa Xaa
20 25 30
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
35 40 45
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
50 55 60
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
65 70 75 80
Xaa Xaa Xaa Xaa Xaa Xaa Val Val Xaa Gly Gly Ser
85 90
<210>33
<211>23
<212>PRT
＜213〉artificial sequence
<220>
＜223〉the total zinc of finding in tRNA IPTs refers to primitive
＜221〉variant
<222>2，3，5，6，7，8，9，10，11，12，13，14，15，16，18，19，20，2l，22
＜223〉Xaa=arbitrary amino acid
<400>33
Cys Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1 5 10 15
His Xaa Xaa Xaa Xaa Xaa His
20
<210>34
<211>336
<212>PRT
＜213〉Arabidopis thaliana
<400>34
Met Ile Met Lys Ile Ser Met Ala Met Cys Lys Gln Pro Leu Pro Pro
1 5 10 15
Ser Pro Thr Leu Asp Phe Pro Pro Ala Arg Phe Gly Pro Asn Met Leu
20 25 30
Thr Leu Asn Pro Tyr Gly Pro Lys Asp Lys Val Val Val Ile Met Gly
35 40 45
Ala Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp Ile Ala Thr Arg
50 55 60
Phe Arg Ala Glu Ile Ile Asn Ser Asp Lys Ile Gln Val His Gln Gly
65 70 75 80
Leu Asp Ile Val Thr Asn Lys Ile Thr Ser Glu Glu Ser Cys Gly Val
85 90 95
Pro His His Leu Leu Gly Val Leu Pro Pro Glu Ala Asp Leu Thr Ala
100 105 110
Ala Asn Tyr Cys His Met Ala Asn Leu Ser Ile Glu Ser Val Leu Asn
115 120 125
Arg Gly Lys Leu Pro Ile Ile Val Gly Gly Ser Asn Ser Tyr Val Glu
130 135 140
Ala Leu Val Asp Asp Lys Glu Asn Lys Phe Arg Ser Arg Tyr Asp Cys
145 150 155 160
Cys Phe Leu Trp Val Asp Val Ala Leu Pro Val Leu His Gly Phe Val
165 170 175
Ser Glu Arg Val Asp Lys Met Val Glu Ser Gly Met Val Glu Glu Val
180 185 190
Arg Glu Phe Phe Asp Phe Ser Asn Ser Asp Tyr Ser Arg Gly Ile Lys
195 200 205
Lys Ala Ile Gly Phe Pro Glu Phe Asp Arg Phe Phe Arg Asn Glu Gln
210 215 220
Phe Leu Asn Val Glu Asp Arg Glu Glu Leu Leu Ser Lys Val Leu Glu
225 230 235 240
Glu Ile Lys Arg Asn Thr Phe Glu Leu Ala Cys Arg Gln Arg Glu Lys
245 250 255
Ile Glu Arg Leu Arg Lys Val Lys Lys Trp Ser Ile Gln Arg Val Asp
260 265 270
Ala Thr Pro Val Phe Thr Lys Arg Arg Ser Lys Met Asp Ala Asn Val
275 280 285
Ala Trp Glu Arg Leu Val Ala Gly Pro Ser Thr Asp Thr Val Ser Arg
290 295 300
Phe Leu Leu Asp Ile Ala Ser Arg Arg Pro Leu Val Glu Ala Ser Thr
305 310 315 320
Ala Val Ala Ala Ala Met Glu Arg Glu Leu Ser Arg Cys Leu Val Ala
325 330 335
<210>35
<211>330
<212>PRT
＜213〉Arabidopis thaliana
<400>35
Met Lys Pro Cys Met Thr Ala Leu Arg Gln Val Ile Gln Pro Leu Ser
1 5 10 15
Leu Asn Phe Gln Gly Asn Met Val Asp Val Pro Phe Phe Arg Arg Lys
20 25 30
Asp Lys Val Val Phe Val Met Gly Ala Thr Gly Thr Gly Lys Ser Arg
35 40 45
Leu Ala Ile Asp Leu Ala Thr Arg Phe Pro Ala Glu Ile Val Asn Ser
50 55 60
Asp Lys Ile Gln Val Tyr Lys Gly Leu Asp Ile Val Thr Asn Lys Val
65 70 75 80
Thr Pro Glu Glu Ser Leu Gly Val Pro His His Leu Leu Gly Thr Val
85 90 95
His Asp Thr Tyr Glu Asp Phe Thr Ala Glu Asp Phe Gln Arg Glu Ala
100 105 110
Ile Arg Ala Val Glu Ser Ile Val Gln Arg Asp Arg Val Pro Ile Ile
115 120 125
Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn Asp Cys Val
130 135 140
Asp Phe Arg Leu Arg Tyr Asn Cys Cys Phe Leu Trp Val Asp Val Ser
145 150 155 160
Arg Pro Val Leu His Ser Phe Val Ser Glu Arg Val Asp Lys Met Val
165 170 175
Asp Met Gly Leu Val Asp Glu Val Arg Arg Ile Phe Asp Pro Ser Ser
180 185 190
Ser Asp Tyr Ser Ala Gly Ile Arg Arg Ala Ile Gly Val Pro Glu Leu
195 200 205
Asp Glu Phe Leu Arg Ser Glu Met Arg Asn Tyr Pro Ala Glu Thr Thr
210 215 220
Glu Arg Leu Leu Glu Thr Ala Ile Glu Lys Ile Lys Glu Asn Thr Cys
225 230 235 240
Leu Leu Ala Cys Arg Gln Leu Gln Lys Ile Gln Arg Leu Tyr Lys Gln
245 250 255
Trp Lys Trp Asn Met His Arg Val Asp Ala Thr Glu Val Phe Leu Arg
260 265 270
Arg Gly Glu Glu Ala Asp Glu Ala Trp Asp Asn Ser Val Ala His Pro
275 280 285
Ser Ala Leu Ala Val Glu Lys Phe Leu Ser Tyr Ser Asp Asp His His
290 295 300
Leu Glu Gly Ala Asn Ile Leu Leu Pro Glu Ile Ser Ala Val Pro Pro
305 310 315 320
Leu Pro Ala Ala Val Ala Ala Ile Ser Arg
325 330
<210>36
<211>342
<212>PRT
＜213〉Arabidopis thaliana
<400>36
Met Gln Gln Leu Met Thr Leu Leu Ser Pro Pro Leu Ser His Ser Ser
1 5 10 15
Leu Leu Pro Thr Val Thr Thr Lys Phe Gly Ser Pro Arg Leu Val Thr
20 25 30
Thr Cys Met Gly His Ala Gly Arg Lys Asn Ile Lys Asp Lys Val Val
35 40 45
Leu Ile Thr Gly Thr Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp
50 55 60
Leu Ala Thr Arg Phe Phe Pro Ala Glu Ile Ile Asn Ser Asp Lys Met
65 70 75 80
Gln Ile Tyr Lys Gly Phe Glu Ile Val Thr Asn Leu Ile Pro Leu His
85 90 95
Glu Gln Gly Gly Val Pro His His Leu Leu Gly Gln Phe His Pro Gln
100 105 110
Asp Gly Glu Leu Thr Pro Ala Glu Phe Arg Ser Leu Ala Thr Leu Ser
115 120 125
Ile Ser Lys Leu Ile Ser Ser Lys Lys Leu Pro Ile Val Val Gly Gly
130 135 140
Ser Asn Ser Phe Asn His Ala Leu Leu Ala Glu Arg Phe Asp Pro Asp
145 150 155 160
Ile Asp Pro Phe Ser Pro Gly Ser Ser Leu Ser Thr Ile Cys Ser Asp
165 170 175
Leu Arg Tyr Lys Cys Cys Ile Leu Trp Val Asp Val Leu Glu Pro Val
180 185 190
Leu Phe Gln His Leu Cys Asn Arg Val Asp Gln Met Ile Glu Ser Gly
195 200 205
Leu Val Glu Gln Leu Ala Glu Leu Tyr Asp Pro Val Val Asp Ser Gly
210 215 220
Arg Arg Leu Gly Val Arg Lys Thr Ile Gly Val Glu Glu Phe Asp Arg
225 230 235 240
Tyr Phe Arg Val Tyr Pro Lys Glu Met Asp Lys Gly Ile Trp Asp Leu
245 250 255
Ala Arg Lys Ala Ala Tyr Glu Glu Thr Val Lys Gly Met Lys Glu Arg
260 265 270
Thr Cys Arg Leu Val Lys Lys Gln Lys Glu Lys Ile Met Lys Leu Ile
275 280 285
Arg Gly Gly Trp Glu Ile Lys Arg Leu Asp Ala Thr Ala Ala Ile Met
290 295 300
Ala Glu Leu Asn Gln Ser Thr Ala Lys Gly Glu Gly Lys Asn Gly Arg
305 310 315 320
Glu Ile Trp Glu Lys His Ile Val Asp Glu Ser Val Glu Ile Val Lys
325 330 335
Lys Phe Leu Leu Glu Val
340
<210>37
<211>329
<212>PRT
＜213〉Arabidopis thaliana
<400>37
Met Lys Phe Ser Ile Ser Ser Leu Lys Gln Val Gln Pro Ile Leu Cys
1 5 10 15
Phe Lys Asn Lys Leu Ser Lys Val Asn Val Asn Ser Phe Leu His Pro
20 25 30
Lys Glu Lys Val Ile Phe Val Met Gly Ala Thr Gly Ser Gly Lys Ser
35 40 45
Arg Leu Ala Ile Asp Leu Ala Thr Arg Phe Gln Gly Glu Ile Ile Asn
50 55 60
Ser Asp Lys Ile Gln Leu Tyr Lys Gly Leu Asp Val Leu Thr Asn Lys
65 70 75 80
Val Thr Pro Lys Glu Cys Arg Gly Val Pro His His Leu Leu Gly Val
85 90 95
Phe Asp Ser Glu Ala Gly Asn Leu Thr Ala Thr Gln Tyr Ser Arg Leu
100 105 110
Ala Ser Gln Ala Ile Ser Lys Leu Ser Ala Asn Asn Lys Leu Pro Ile
115 120 125
Val Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn His Ser
130 135 140
Ser Gly Phe Leu Leu Asn Asn Tyr Asp Cys Cys Phe Ile Trp Val Asp
145 150 155 160
Val Ser Leu Pro Val Leu Asn Ser Phe Val Ser Lys Arg Val Asp Arg
165 170 175
Met Met Glu Ala Gly Leu Leu Glu Glu Val Arg Glu Val Phe Asn Pro
180 185 190
Lys Ala Asn Tyr Ser Val Gly Ile Arg Arg Ala Ile Gly Val Pro Glu
195 200 205
Leu His Glu Tyr Leu Arg Asn Glu Ser Leu Val Asp Arg Ala Thr Lys
210 215 220
Ser Lys Met Leu Asp Val Ala Val Lys Asn Ile Lys Lys Asn Thr Glu
225 230 235 240
Ile Leu Ala Cys Arg Gln Leu Lys Lys Ile Gln Arg Leu His Lys Lys
245 250 255
Trp Lys Met Ser Met His Arg Val Asp Ala Thr Glu Val Phe Leu Lys
260 265 270
Arg Asn Val Glu Glu Gln Asp Glu Ala Trp Glu Asn Leu Val Ala Arg
275 280 285
Pro Ser Glu Arg Ile Val Asp Lys Phe Tyr Asn Asn Asn Asn Gln Leu
290 295 300
Lys Asn Asp Asp Val Glu His Cys Leu Ala Ala Ser Tyr Gly Gly Gly
305 310 315 320
Ser Gly Ser Arg Ala His Asn Met Ile
325
<210>38
<211>330
<212>PRT
＜213〉Arabidopis thaliana
<400>38
Met Gln Asn Leu Thr Ser Thr Phe Val Ser Pro Ser Met Ile Pro Ile
1 5 10 15
Thr Ser Pro Arg Leu Arg Leu Pro Pro Pro Arg Ser Val Val Pro Met
20 25 30
Thr Thr Val Cys Met Glu Gln Ser Tyr Lys Gln Lys Val Val Val Ile
35 40 45
Met Gly Ala Thr Gly Ser Gly Lys Ser Cys Leu Ser Ile Asp Leu Ala
50 55 60
Thr Arg Phe Ser Gly Glu Ile Val Asn Ser Asp Lys Ile Gln Phe Tyr
65 70 75 80
Asp Gly Leu Lys Val Thr Thr Asn Gln Met Ser Ile Leu Glu Arg Cys
85 90 95
Gly Val Pro His His Leu Leu Gly Glu Leu Pro Pro Asp Asp Ser Glu
100 105 110
Leu Thr Thr Ser Glu Phe Arg Ser Leu Ala Ser Arg Ser Ile Ser Glu
115 120 125
Ile Thr Ala Arg Gly Asn Leu Pro Ile Ile Ala Gly Gly Ser Asn Ser
130 135 140
Phe Ile His Ala Leu Leu Val Asp Arg Phe Asp Pro Lys Thr Tyr Pro
145 150 155 160
Phe Ser Ser Glu Thr Ser Ile Ser Ser Gly Leu Arg Tyr Glu Cys Cys
165 170 175
Phe Leu Trp Val Asp Val Ser Val Ser Val Leu Phe Glu Tyr Leu Ser
180 185 190
Lys Arg Val Asp Gln Met Met Glu Ser Gly Met Phe Glu Glu Leu Ala
195 200 205
Gly Phe Tyr Asp Pro Arg Tyr Ser Gly Ser Ala Ile Arg Ala His Gly
210 215 220
Ile His Lys Thr Ile Gly Ile Pro Glu Phe Asp Arg Tyr Phe Ser Leu
225 230 235 240
Tyr Pro Pro Glu Arg Lys Gln Lys Met Ser Glu Trp Asp Gln Ala Arg
245 250 255
Lys Gly Ala Tyr Asp Glu Ala Val Gln Glu Ile Lys Glu Asn Thr Trp
260 265 270
Arg Leu Ala Lys Lys Gln Ile Glu Arg Ile Met Lys Leu Lys Ser Ser
275 280 285
Gly Trp Asp Ile Gln Arg Leu Asp Ala Thr Pro Ser Phe Gly Arg Ser
290 295 300
Ser Arg Glu Ile Trp Asp Asn Thr Val Leu Asp Glu Ser Ile Lys Val
305 310 315 320
Val Lys Arg Phe Leu Val Lys Asp Lys Val
325 330
<210>39
<211>350
<212>PRT
＜213〉artificial sequence
<220>
＜223〉consensus sequence of ZmIPT1
<400>39
Met Ala His Pro Ala Ala Ala Ala Ala Val Ser Ser Thr Ala Pro Ala
1 5 10 15
Ala Asn Pro Ser Gly Ala Arg Glu Glu Gly Gly Ala Arg Ser Pro Pro
20 25 30
Ser Pro Ser Pro Ser Gln Arg Gly Arg Ala Lys Val Val Ile Val Met
35 40 45
Gly Ala Thr Gly Ala Gly Lys Ser Arg Leu Ala Val Asp Leu Ala Ala
50 55 60
His Phe Ala Gly Val Glu Val Val Ser Ala Asp Ser Met Gln Leu Tyr
65 70 75 80
Arg Gly Leu Asp Val Leu Thr Asn Lys Ala Pro Leu His Glu Gln Asn
85 90 95
Gly Val Pro His His Leu Leu Ser Val Ile Asp Pro Ser Val Glu Phe
100 105 110
Thr Cys Arg Asp Phe Arg Asp Arg Ala Leu Pro Ile Ile Gln Glu Ile
115 120 125
Val Asp Arg Gly Gly Leu Pro Val Val Val Gly Gly Thr Asn Phe Tyr
130 135 140
Ile Gln Ala Leu Val Ser Pro Phe Leu Leu Asp Asp Met Ala Glu Glu
145 150 155 160
Met Gln Gly Cys Thr Leu Arg Asp His Ile Asp Asp Gly Leu Thr Asp
165 170 175
Glu Asp Glu Gly Asn Gly Phe Glu Arg Leu Lys Glu Ile Asp Pro Val
180 185 190
Ala Ala Gln Arg Ile His Pro Asn Asp His Arg Lys Ile Lys Arg Tyr
195 200 205
Leu Glu Leu Tyr Ala Thr Thr Gly Ala Leu Pro Ser Asp Leu Phe Gln
210 215 220
Gly Glu Ala Ala Lys Lys Trp Gly Arg Pro Ser Asn Ser Arg Leu Asp
225 230 235 240
Cys Cys Phe Leu Trp Val Asp Ala Asp Leu Gln Val Leu Asp Ser Tyr
245 250 255
Val Asn Lys Arg Val Asp Cys Met Met Asp Gly Gly Leu Leu Asp Glu
260 265 270
Val Cys Ser Ile Tyr Asp Ala Asp Ala Val Tyr Thr Gln Gly Leu Arg
275 280 285
Gln Ala Ile Gly Val Arg Glu Phe Asp Glu Phe Phe Arg Ala Tyr Leu
290 295 300
Pro Arg Lys Glu Ser Gly Glu Gly Ser Cys Ala Ser Leu Leu Gly Met
305 310 315 320
His Asp Asp Gln Leu Lys Ser Leu Leu Asp Glu Ala Val Ser Gln Leu
325 330 335
Lys Ala Asn Thr Arg Arg Leu Val Arg Arg Gln Val Ser Thr
340 345 350
<210>40
<211>4680
<212>DNA
＜213〉paddy rice (Oryza sativa)
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT8 genome sequence (011718_1)
<221>exon
<222>(225)...(489)
<221>exon
<222>(576)...(655)
<221>exon
<222>(801)...(869)
<221>exon
<222>(966)...(1047)
<221>exon
<222>(1158)...(1252)
<221>exon
<222>(1385)...(1459)
<221>exon
<222>(1641)...(1692)
<221>exon
<222>(1698)...(1886)
<221>exon
<222>(1923)...(2008)
<221>exon
<222>(2083)...(2158)
<221>exon
<222>(2257)...(2420)
<221>exon
<222>(2563)...(2682)
<400>40
accatagtga aagaaaaaat acgttggagt acgccgattt tcttgtaaat ttgatatttc 60
actcccctag tcccctatta ccaatttttt tttttaaaaa aagaaaaaac gcaaccttac 120
cagcccaaag gcccaaagcc cacaacagag aggagagtgg gcgacggggg gctagggcgg 180
cggcggcgcg gcgaccagcg acgggcggcg cgcacctgac cggaatggcc cacctcgcgg 240
cctctgccgc cccgcttcca agcgctgacc ccgacgccgg cgaggagtcc tcccactctc 300
cgccgccgcc ggagaagggg ctgaggaagg tggtggtggt gatgggcgcg actggcgccg 360
gcaagtcgcg gctggccgtc gacctcgcga gccacttcgc cggcgtcgag gtggtcagcg 420
ccgactccat gcaagtctac ggtgggctcg atgtcctcac caacaaggtc cccctccacg 480
agcagaaagg tctcctcccg ggattcccca gttcttcttt tgaccaaacc tgcttcagat 540
cgagcttaac agcgctatct ttgccgtgtt accaggcgtt cctcaccatc tcctgagcgt 600
gattgatccc tctgtggagt tcacttgccg cgatttccgc gaccatgctg tgccggtgag 660
cctatgatgt tgctgctacg acttttagtg ctcctagtgt gccatgttta ctgattagtt 720
gatgtttctt agtgctctgc tcaccaatta tataaggtat attggtttac tgattaattg 780
ctgtttctga gtggtcacag attatagaag gtatattgga tcgtggcggc ctccctgtta 840
ttgttggtgg tacaaacttc tacatccagg ttgatactta agcgcatgag gattcctgta 900
tattaggcta tttttcttct gaattagact atatctgatt tttgtccttt taacacttat 960
tgtaggctct tgttagccca ttcctctttg atgatatggc acaggatatt gagggtctta 1020
ctttaaatga ccacctagat gagataggtg aatgatgaaa gcttagcaca tgtttcttgt 1080
tgttagcatg ttttgatcaa tggttgtgtc caattagtgt ttgacttgtt aaacactgct 1140
taacacatgc caagcagggc ttgataatga tgatgaagcc ggtctgtatg aacatttgaa 1200
gaagattgat cctgttgctg cacaaaggat acacccgaac aaccatcgaa aagtaagggt 1260
gttgcacagt tgtgccctta acctgttagg tttctttggt agcaattgga ttttccttgt 1320
ggtgttgccc catttgcctt atccggttat cctgttctgc atgctttttt gttgtgttga 1380
ccagataaaa cgctaccttg agttgtatga atccacaggt gccctaccta gtgatctttt 1440
ccaagggcaa gccacagagg tgagaaaaaa atgatttccc ttttaattaa tttctttatt 1500
ctgacttgtt gctgactcta tagtccatgt gaaatgtgca aggactttat gcatattatc 1560
atgcgcacaa cacatttttt gccgtacgag ttggacctca tgcgaactct aaatgtccta 1620
atgaggtcat ttgttgtcag gacagaagtg gggtcgacct agtaactcca gatttgactg 1680
ttgtttcttg tggttagatg ctgatcttca tgttctggat cgttatgtca atgaaagggt 1740
cgactgcatg attgatgatg gcctgctaga tgaagtgtgt aacatatatg atcgagaggc 1800
cacttatacc caagggctgc ggcaggccat tggtgttcgt gaatttgatg agtttttcag 1860
attttatttt gcaaggaagg aaaccggtga gataaagatg gattcctgta caactatggc 1920
aggtctccat gatgataacc tgaagggctt attggatgaa gcagtctcac aactaaaagc 1980
aaacactcgc agacttgttc gacgtcaagt aatctcgaca cttttttaag taaataattg 2040
aaaattgcat tttgtgtgtt ttatattctt gcctttcttc agagacgaag gctgcatcgg 2100
ttgaataaat attttgagtg gaacttgcgt catattgatg caacagaagc tttctatggt 2160
aatgatatgt gcatttcatg ttttagttca aagccaaaag atttcatgtc ttacgaaatc 2220
taatgtgttt gcttaacatg tcatgcatat ttctaggtgc cactgctgac tcatggaaca 2280
tgaaagttgt gaaaccttgc gtggatattg ttagagattt cttgtctgat gatacaattt 2340
tggcaagcag agatggttct agtgtaactg gaagccctag gatgtcttca agagagttgt 2400
ggactcaata tgtttgtgag gtaattggga ggcttttctt attcttacca aaaagaatgt 2460
tgataactgt atcgtcattt gtgcgttttg ccacattttt tgttagtggg acagcaatca 2520
atctgatgaa actttcttgc ctttcctgct cctattttac aggcctgtga taaccgggta 2580
cttcggggaa cgcatgagtg ggagcaacac aagcaaggcc gatgccaccg taaaagagta 2640
caacgtttga aacagaaggc tagtacagtg atatcattat aggcaattag cactgtttgc 2700
actctcggtg ttcatgaacc tttcttcatt ctctgcaact gtccccatgc atcctgtttg 2760
tcaaattggc tgaagactac accattcaga aggtagcaag cagcagatat atttgttaat 2820
agtaccttgc tagattcttg tgccagttcc aaacatccaa tgcagagaat acaaactcta 2880
cagattggtc agcacaagca cgtccgattg agcagcatct acactgatga ccagttggag 2940
tttctccaat ctgctgatca tttctagact agttttccca ttaaggacac cataaattgg 3000
gtaggcggtc cagcttgtta gcaaagtggt gatagtgatt agcaattaag catgacattg 3060
acccatcgaa tatttgcata tcttggtctt ccagattgca tgatttttcc ttcatatgtg 3120
actggaaaca gtggggccat gctaggttac ataaattcct gggcgtgata cactgcgaat 3180
agtagctatc atgtttacta ctgtcgtgtt gagactactg tacagtagct cgtatgtatt 3240
tctcgtatgt ttgtgcataa gtgaggggtc gatgagagtg acttactaga cttttctcat 3300
cctaaattcc taataactag aaaagatgac cgaaattggg aaggcgactt gtgcctcttt 3360
tggaatgatc gaaatataga ggaactttca tgttgacctg attcttacga aaatcatgta 3420
aaactcgtgt tcgttgtcaa aaggcccaac ttcatctcag atgagcataa gtataccata 3480
ttaatgcttc aaaatggtta atgctagctc gtttttactg cacaactaat gctcgatgtc 3540
caaatatact tgggttatta ttattttttt gaaggatttt tcatgtgagt ctcgccgagg 3600
tccactaacc ggtacacagg cgccgacctc tggcacatta ttttacacga gaaatttaag 3660
gtaggcatga aatcatcagt cgcacggatg caaacgtgac gacatcatca gaaacaatat 3720
actgctgcgc cgatttaaac tacacttaaa ttaaataatt ctattagtgg tacgagagta 3780
gtactactcc tgtatgtaga atagatgtgc acgggcgcac gtgtttcatc cctctaattc 3840
tgaatcccca cgtgacgatc gagcttaaag ccgaacgggc ggggcggggg gataaagcgg 3900
gtcccccagc cgctgtctcc agttcacacc cacaacccga agtcgatcgc tcgtgttcgt 3960
gtccgcctcg acggcgaact cgacgggtcc cgacccgcaa acccaacacc cacacctact 4020
tatacccacc tccactaatc cctcctctca tcgcaccacc acgccactga gctcaagcta 4080
agctaagtgc taacctaggt gttcgaccat ggacaccgag gacacgtcgt cggcttcgtc 4140
ctcgtcggtg tcgccgccgt cgtcgccggg cggcgggcac caccaccggc tgccgccgaa 4200
gcggcgggcg gggcggaaga aattccggga gacgcggcac ccggtgtacc gcggcgtgcg 4260
cgcgcgggcg ggggggagca ggtgggtgtg cgaggtgcgc gagccgcagg cgcaggcgcg 4320
catctggctc ggcacctacc cgacgccgga gatggcggcg cgcgcgcacg acgtcgcggc 4380
catcgccctc cgcggcgagc gcggcgccga gctcaacttc ccggactccc cctccacgct 4440
cccgcgcgcg cgcacggcgt cgcccgagga catccgcctc gccgccgcgc aggccgccga 4500
gctgtaccgc cgcccgccgc cgccgctggc attgccggag gatccgcagg aaggcacgag 4560
cggcggcggc gccaccgcca cctcggggcg tccggctgcc gtgttcgtgg acgaggacgc 4620
catcttcgac atgccggggc tgatcgacga catggcgagg gggatgatgc tgacgccgcc 4680
<210>41
<211>450
<212>PRT
＜213〉paddy rice
<220>
<221>CHAIN
<222>(0)...(0)
＜223〉OsIPT8 aminoacid sequence (017718_1)
<400>41
Met Ala His Leu Ala Ala Ser Ala Ala Pro Leu Pro Ser Ala Asp Pro
1 5 10 15
Asp Ala Gly Glu Glu Ser Ser His Ser Pro Pro Pro Pro Glu Lys Gly
20 25 30
Leu Arg Lys Val Val Val Val Met Gly Ala Thr Gly Ala Gly Lys Ser
35 40 45
Arg Leu Ala Val Asp Leu Ala Ser His Phe Ala Gly Val Glu Val Val
50 55 60
Ser Ala Asp Ser Met Gln Val Tyr Gly Gly Leu Asp Val Leu Thr Asn
65 70 75 80
Lys Val Pro Leu His Glu Gln Lys Gly Val Pro His His Leu Leu Ser
85 90 95
Val Ile Asp Pro Ser Val Glu Phe Thr Cys Arg Asp Phe Arg Asp His
100 105 110
Ala Val Pro Ile Ile Glu Gly Ile Leu Asp Arg Gly Gly Leu Pro Val
115 120 125
Ile Val Gly Gly Thr Asn Phe Tyr Ile Gln Ala Leu Val Ser Pro Phe
130 135 140
Leu Phe Asp Asp Met Ala Gln Asp Ile Glu Gly Leu Thr Leu Asn Asp
145 150 155 160
His Leu Asp Glu Ile Gly Leu Asp Asn Asp Asp Glu Ala Gly Leu Tyr
165 170 175
Glu His Leu Lys Lys Ile Asp Pro Val Ala Ala Gln Arg Ile His Pro
180 185 190
Asn Asn His Arg Lys Ile Lys Arg Tyr Leu Glu Leu Tyr Glu Ser Thr
195 200 205
Gly Ala Leu Pro Ser Asp Leu Phe Gln Gly Gln Ala Thr Glu Asp Arg
210 215 220
Ser Gly Val Asp Leu Val Thr Pro Asp Leu Thr Val Val Ser Cys Asp
225 230 235 240
Ala Asp Leu His Val Leu Asp Arg Tyr Val Asn Glu Arg Val Asp Cys
245 250 255
Met Ile Asp Asp Gly Leu Leu Asp Glu Val Cys Asn Ile Tyr Asp Arg
260 265 270
Glu Ala Thr Tyr Thr Gln Gly Leu Arg Gln Ala Ile Gly Val Arg Glu
275 280 285
Phe Asp Glu Phe Phe Arg Phe Tyr Phe Ala Arg Lys Glu Thr Gly Leu
290 295 300
His Asp Asp Asn Leu Lys Gly Leu Leu Asp Glu Ala Val Ser Gln Leu
305 310 315 320
Lys Ala Asn Thr Arg Arg Leu Val Arg Arg Gln Arg Arg Arg Leu His
325 330 335
Arg Leu Asn Lys Tyr Phe Glu Trp Asn Leu Arg His Ile Asp Ala Thr
340 345 350
Glu Ala Phe Tyr Gly Ala Thr Ala Asp Ser Trp Asn Met Lys Val Val
355 360 365
Lys Pro Cys Val Asp Ile Val Arg Asp Phe Leu Ser Asp Asp Thr Ile
370 375 380
Leu Ala Ser Arg Asp Gly Ser Ser Val Thr Gly Ser Pro Arg Met Ser
385 390 395 400
Ser Arg Glu Leu Trp Thr Gln Tyr Val Cys Glu Ala Cys Asp Asn Arg
405 410 415
Val Leu Arg Gly Thr His Glu Trp Glu Gln His Lys Gln Gly Arg Cys
420 425 430
His Arg Lys Arg Val Gln Arg Leu Lys Gln Lys Ala Ser Thr Val Ile
435 440 445
Ser Leu
450
<210>42
<211>8463
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT11 genome sequence (006475_2)
＜221〉exon
<222>(2001)...(2834)
＜221〉exon
<222>(3574)...(3597)
＜221〉exon
<222>(5549)...(6463)
<400>42
tttgttgtga acttgagagg aataagttca tttgtgttcc ctcaacttga cgtcgggttc 60
gaattacgtc cccaaaccac aatacaatat aacacatcct caacttgcaa tacaggctca 120
tattaggtcc caaaacagta ctatacctag ttttggctga tgtagcgcac acgtaactca 180
tttgactagg tcctcatctc acgtggcatt gacatggtgc ttacgtagca attcgacaga 240
taaaataatt aaaactatgg ggctcgcata tcaatagtgg ggccatgcgg ggtccacatg 300
tcaataatag aaatggaaaa acaaaatggg cccacttgtc atccccgtcc atttctcgcc 360
atccccttcc ctatcttcgg caacaatgag ggaggcggct ggaggaggag ctcaagcggc 420
cgctagcaag tgcggcagct gcggcgggcg cgacaacagt tgatgacgat agggtcatcc 480
gctctcctct cctcccctcc catccctggc caccgccgtc ctcccttacc cccggcgctg 540
actaggtcta ctctgcggcc atggccttct ccccgaccat ccacctccac cacccacatt 600
gcctcctcct ctctccaacc ccttgtctat ctccccctac cacccatggc tctccgcctg 660
atcgagcccc cgccgccatg acccccttcg tcgtccctcc tctactctcg acatcctcct 720
gagcccttcc cctcctttga cttcggatga ggatgcacgg gcttggagcg ggaggtggag 780
agggcaagga gctcgcttgc tccactctgg ctgcttcacc caccgctcgc tccactctgc 840
ccttctcctc gcaggggaga gaaaggggga acatagcgat gctcacaaaa atgcgtttaa 900
acgcatttaa ttctggttta ggtacttgat gagtgaggat gacatgtggg acccacatgg 960
tcccaccgct ttttaattat tttgtggtgt aactgacaag tgatcccacg gttttattta 1020
ttttctcgga tcaaattgcc acgtaagcac cagagacaat attaccacgg acatcttttg 1080
tattggtttt gtaagctaag ggatgtgttg tatctggttt tgcggttaaa gacgaaattc 1140
aaaatgagcg cgactaaata agggacctaa agtgaactat tccaacttgt gatcctgacc 1200
aggaatcacc tggtccatat tgggccgacc cgaaccagat taaagcggat aacttctatg 1260
cttcatcatg tatactagcc acatgtgccc gcgcttcgct gcggatcatg aatttgtaaa 1320
ttaccatagt aaagaaagtt ttttctaata tgtatactga tccattgttt aaatggttgc 1380
catatatttt attacttaat gataccccac gcgttgttgc agaaaattct caaattttag 1440
ttattgggta gaatgtacaa cctaatgcta aaaagttaga gataaacaaa atgatttttt 1500
gaccaataat tgtgtgaata gcgtaagtca aattctaaaa ataatttagg taacacattt 1560
tagcagaaac ttcaaaagat gtacatactt tgaggtcatg agttaacata caatgttgta 1620
ctgtattatt catcaaatat tgtcacaatg tagcttactc gtagatataa gattgtatgt 1680
atctagtgag ggacaattta tattgttcac taacatctaa tattgttctc ggaatggtat 1740
ccagagaaat ttttatgatt tagaataaaa tggaacaatg ttgtataaat ctataaaaat 1800
ataattgcat aattatttat atgcttagat ttggcacctc taaatgtggc ctaactacca 1860
ttggaccaca gttagtaggg gctcataaag atgcatcccc tataaaagcc aagggacacc 1920
gagagtcctc tacggaagaa ttccaccctt cccattagga cagtcaaaca ccttattgct 1980
accccaatct tcctttcagt atggagaact cctcaaagaa aacccaagag ttcttcccta 2040
aaggtgggaa tggaggttat gctgagcagc tggagctctt gctgaagcag cttcgttttc 2100
ctaacaagcc gatccaccat gcggagcaag tgatcaaagg attccggaag gattggacga 2160
tgaagatcta cattcaagcc agggaagaga agtgtcaagg acatgtgttc aagtcccgcc 2220
accttcgagc caacaaagag gcagcactcc aggatgcgtc gcgtgaggca ttcatgcgtc 2280
tatgtaagat ctacagcatc gaggttgcaa gtactccgtt ctttctacat ccattccgtg 2340
aatgcggtga ccgccgctgc catattcgga aatttagggg ctttgaggag cagtcgccca 2400
tccacttctc catgtggatg tgggctgcag acgaggccta tgaggaggcc ttagaggaat 2460
tagatatgct tcggtcaaag atcgccggct gggaggagcg gtacaaccac cttgctaaag 2520
aacacaccac tcgtggacaa ctattggaag caatcaagct tcgcctccag tggtattttc 2580
gaaccccatc tcaagctcat atccaacgga ctttgccacc accaccacaa agagtgacaa 2640
gaagtgatgg tgaggactat agtcaaatca atgcacatca ggcatgtctg gaaaggtccg 2700
aagttaaact tgatagggca acttcacaag actatctgca aggatacaag cccccatcag 2760
aatccctcga cgctattgtt tggcctcttg ttgaagggaa gcatgacaat acaagcagtg 2820
gtaggaggaa tgaggtaaag gaaactgctc acaataacca agggaccttg ttgggctagt 2880
cctcggaaag agagttggac cagctacata tctagaagac tgctatgtaa gtgataggtg 2940
gctatatctt gtcacgtagg agtagcatgt gggtgggagt tggaccaatt tcacatatag 3000
gagaccgcta tgtaagtgac aggttatggc ctgtcaccta gcagtactat gtgggtggtc 3060
aagatcacct atcaagtgtg cttgtctatg cctagttgtg gcctaccagt tagagtagta 3120
tgtgagggtg gtagtaagat tgcattccct ttgtccagtt gtgggtggac aagctaggcg 3180
gatagtctag tgtgtttatg tatgcgtggt tgtgatgctt ttgtgcttgg cccgaggaca 3240
ttgagcaata tttgcttaaa aatgcttgtt ttcttctgca atgctacttt gttttcatga 3300
tcatgcaagt tacctaaata catgtgaatt gttctagttg atgggatcta ttgcgataga 3360
atcacatgat ttccaattgt atagtaacgg agctagcaac agtaatataa ccattttgac 3420
caggatggtt caaaagtaaa ccatatagaa aaggagttgt ttattaaata tatgtattgt 3480
atcaactaaa atagtacaca atggccaata attttgcaat gaatttagtt tataattggc 3540
atggtatggt tatttttttt ttgcattttg cagaaggcat gggaaatggc aaaacaagta 3600
aatatataac aaagtaattt ctaacgattg ttagtaaccg gaagatggtt ggtattagat 3660
taccaagttt ggaagtatta ttttaccaga gaacgtataa gtaacatgta tattgttcga 3720
agtgcccaca tttgaattta cgttcgatga agaattgtta tgtaattttt ccttgaaaaa 3780
tgtgcaaaag cacatgttta caaatcatca ccatatctta agatgaaagt aggcataagg 3840
tttaaaaagt caaaggtaat tattaggttt atttttttgt tatgcttaca cacgtattga 3900
cgatacaaag gttcgagcca ttaactctga tgcctaaaaa tatctacaaa gaaaaaaaaa 3960
tcgatcacaa ttgcttgaat aatagtaaga gtatacctaa ctgaatttag ggcccaccaa 4020
tataattact gtacacatcc aactgcacgt ggattgatat gccaaattac tataatcgga 4080
ggtgcctaga ggaaggattt atcctttggt ctataaacat caagacaata ttggaccggt 4140
cctcgaaaag agagttggac cagctgcaca tctaggagac cgctatgtaa gtgacagggt 4200
catatcacat ctaggagacc tctaagtaag tgacagggtc atatcttgtc acctaggagt 4260
agtatgtggg tgagagttgg accaacttca catataggta accgctatgt aagtgatagg 4320
gtcatagcct gtcacctagt agcactatgt gggtgatcaa aatggcctct ctggtgtgct 4380
tgtctatgcc taattgtaat gcttttgtgc ttggctcgag gccaatgagt aatgtatgct 4440
tgaactgcta tgtaagcgac agggtcatag cctgttagtt agagtagtag gtgagggtgg 4500
taataaaatt gtattccctt tgtctagtta tgggtggaca aggtgggtaa tctagtgtgt 4560
ttgtgtatgc gtggttgtga tgcttttgtg cttggcccga ggataatgag caatatttgc 4620
ttaaagttgc atgttttctt ctccaatgca ggtttgtttt catgagcatg caaattatct 4680
aaatacatgc gaattgttct agttgatggg atctattgcg atagaatcaa atggcctcta 4740
atcgtatagt aacagagcta gcagtaatat aaccatctta accaggatgg ttcaaaagca 4800
agccatatat aaaaggagtt gtttattaaa tatatgtatt gtacaaactg gaatattaca 4860
caagggctaa taattttgca atgaatttat ttgataattg gcattgtatg gctattttgt 4920
tttttgcatt ttgcggaagg catgagaaat gccaaaacaa gtaaatatag agcaaagtat 4980
tttacaacga ttgttagtaa gtatttttga ggtagatggt tggtattata ttaccaagtt 5040
tcaaagtatt cttttaccag agaacatata agtaacatat gtatgattcg aagtgcccac 5100
atttgaattt actttcgatg aaggattgat acggattttt tttccttgaa aaatgtgtaa 5160
aagcacatgt ttacaaatca tcaccatatt aagatgaaag taggcatatg gtttaaaaag 5220
ttaaaggagc tcatcaggtt taatttgttt tatgcttaca cacgtattga ggatacaatt 5280
ttaagggttg agccgttagc tcttatgcca aaaatatctc caaagaaaaa aaattgatca 5340
caattgcttg gataattgta tgagtatatc taattgaatt tgggccccat caagatgatt 5400
accatacaca ttcaactgta catggattga tatgccaaat tccggtaagt ggaggtgcca 5460
agaggaagga ggaaggattt atgctttgat ctagaaacat caaggcggca cactttcccc 5520
tttcctatat actgaggaac tcttccaggt aatacgaacc cttagctact ttcctttcat 5580
gctcaatttt cacccttctt gtgattgctt cctcaatatg ctgggaaaca agttagtagt 5640
gattattggt gccacgggaa ctggaaaaac aagactctca attgagatag ccaaggcgat 5700
tggtggggaa gtggtaaatg ctgacaagat gcaaatttac gatggcctgg atattacgac 5760
aaacaaggtt tctttacaag atcgatgcgg catacctcat caccttattg cgtccatccc 5820
tcgcaacgca ggtgattttc ctgtgtcatt ttttcgatct gctgcaaaaa ccacaataaa 5880
ctgcattgcc agacgtggtc acacaccgat tgtggtgggt ggatctaact cacttatcca 5940
tggtctcctt gttgacaatt ttgattcgtc tattgtggat ccttttgggc aattggaggt 6000
tagctatcgg ccgacgcctc gatcgcaatg ttgttttcta tgggttcatg ttaatgaggt 6060
gattcttaat gagtatttga aacgtcgtgt tgacaacatg gttgatgctg ggttagttga 6120
ggaaattgaa gaatattttg acacattatc agttaatgga catgttccat atgtgggatt 6180
agggaaggcc attggtgttc cagagctaag cgagtatttt actggacggg tgagttgtag 6240
tgatgctctt tctatgatga agaccaatac acagattctt gcacgatctc aagtcacaaa 6300
gattcatcgc atggttgatg tgtggggatg gcatgttcat gcccttgatt gtactgaaac 6360
tattctagca catcttactg gatcaaataa gtatatggag gatttggtgt ggaaacgtga 6420
tgtaagtgac cctggacttg ctgctataca agattttctg tgataatatc agaagatggg 6480
aagctagttt ctcaaacaca tcggctattg attttgtcta caataatggt ttaatcgtct 6540
ggcttgctta gtaattttac agatcatggc atagtaagtt aacttggatc attttgggtg 6600
tgtttggaag gagcaaacat caattggtgt atatgaaatt acttggaggc cttttgtacc 6660
ttaaacactt ggatgccttt tattttacat aatagttata tatagttgtt gttcataatt 6720
ttttgatgtc atcaatattc atacgtgctg atgcgattct tattgattat ctctaataga 6780
tatgatgtgg tgccaacaaa aacaacaaac atggaagtca caaatagcca tataagaaaa 6840
taatagaggg ttcccagttg ttcatgcacc aagcttaata caaataggaa ataaacatga 6900
tagtccaatg acaatggacc aagtttagag tagcaccaca cacaatgctt gttcacttac 6960
tgatacaaca taaataataa agagttaagt atgacaacac aaaaaacatc ccctgcaaca 7020
aagagcccac atagagagta tacataaagt ccaaaaacaa tgtttttgtt aaatctctgg 7080
ttgggaagta attatttgtc gttacagtcg aaattttcaa acttgaaaac ttaaccatag 7140
gaatttttgg agagcccggc ctttgaggat ggacttagaa tttggaggaa attttctaag 7200
aggttgatag aacccaaacc tcaagattca aatatttgga tcaagacttt tgggcttggg 7260
atttggtgtt tgaagaaaca gcgggatttg agagtactgg cacataatcc taaatacact 7320
caaagaatca aaagatttta aacataggtt tcaaataaaa aaaatcaacc gaggcaaaac 7380
ccaaggcgtt gcaatcctac cccctattaa tagaatcttg tcctgagatt tcggccaaag 7440
aagggtagca gaatgttatt gtggctcctg ttcagtgata ggctcaatac cagggccatg 7500
ttggatagaa gacattgtgc aaaggaagat gatgatctaa catgtgttgt gtgtaatggt 7560
gagtgtagag aaactcggct tcatctcttc tctgcctacc ctagcattag atgtaggcaa 7620
cacctgggaa ttgaatggaa acataacctg gaatttttcc caacggttgt tctcgcgaga 7680
ttgaggtttg gtcggagagg ttttctagaa atatttttta tagcctcatg tatatttgga 7740
aacagagaaa gaggcttatc ttccaaaata tcctgcctat gttccagtct tggaggttgc 7800
tttttgtgaa tgaagttctt ctacatatgt gtagaatgaa ggatcctcta aaacaatctg 7860
tttttgattg gttacaaacc ttataggttt tgagttttcc ctgtaatctg taactcttgt 7920
aaatatttcc cttgttttaa tgaaccttgt tttaatgaaa atacactgct aggcaaagcc 7980
ctggcagtat ttgcagttaa aaaaataggg tccttgaaac tatacatggt ctatgtgctg 8040
accttttcct ttggtggttg cggcattcct atcccatctt ttactgagtg atacatgggc 8100
cactgtttga cccaaaattt ttgaactcaa gtgtcgactc tgaactgata ctgtctttgt 8160
tgagaatcta aagttcttct ttggtgtcag tgctggtgtt gttatgtcct gatcgggaaa 8220
taatggggac ctctatttgg atgtgttgtg gccatatcct gcatccttgc cggttgttat 8280
gacggtcatt cggggtattc gaggtcattt ctcagcctct atacatgttc accaacatac 8340
ttttttttac ctcgtgcact tgggtaccca tttcattcag cgcaccctta tcttcggggg 8400
cccgtctctg tctccttgga gtggttttgg tcgtgcacgc aggtgtggcg agtggaggcg 8460
gtg 8463
<210>43
<211>590
<212>PRT
＜213〉paddy rice
<220>
<221>CHAIN
<222>(0)...(0)
＜223〉OsIPT11 aminoacid sequence (006475_2)
<400>43
Met Glu Asn Ser Ser Lys Lys Thr Gln Glu Phe Phe Pro Lys Gly Gly
1 5 10 15
Asn Gly Gly Tyr Ala Glu Gln Leu Glu Leu Leu Leu Lys Gln Leu Arg
20 25 30
Phe Pro Asn Lys Pro Ile His His Ala Glu Gln Val Ile Lys Gly Phe
35 40 45
Arg Lys Asp Trp Thr Met Lys Ile Tyr Ile Gln Ala Arg Glu Glu Lys
50 55 60
Cys Gln Gly His Val Phe Lys Ser Arg His Leu Arg Ala Asn Lys Glu
65 70 75 80
Ala Ala Leu Gln Asp Ala Ser Arg Glu Ala Phe Met Arg Leu Cys Lys
85 90 95
Ile Tyr Ser Ile Glu Val Ala Ser Thr Pro Phe Phe Leu His Pro Phe
100 105 110
Arg Glu Cys Gly Asp Arg Arg Cys His Ile Arg Lys Phe Arg Gly Phe
115 120 125
Glu Glu Gln Ser Pro Ile His Phe Ser Met Trp Met Trp Ala Ala Asp
130 135 140
Glu Ala Tyr Glu Glu Ala Leu Glu Glu Leu Asp Met Leu Arg Ser Lys
145 150 155 160
Ile Ala Gly Trp Glu Glu Arg Tyr Asn His Leu Ala Lys Glu His Thr
165 170 175
Thr Arg Gly Gln Leu Leu Glu Ala Ile Lys Leu Arg Leu Gln Trp Tyr
180 185 190
Phe Arg Thr Pro Ser Gln Ala His Ile Gln Arg Thr Leu Pro Pro Pro
195 200 205
Pro Gln Arg Val Thr Arg Ser Asp Gly Glu Asp Tyr Ser Gln Ile Asn
210 215 220
Ala His Gln Ala Cys Leu Glu Arg Ser Glu Val Lys Leu Asp Arg Ala
225 230 235 240
Thr Ser Gln Asp Tyr Leu Gln Gly Tyr Lys Pro Pro Ser Glu Ser Leu
245 250 255
Asp Ala Ile Val Trp Pro Leu Val Glu Gly Lys His Asp Asn Thr Ser
260 265 270
Ser Gly Arg Arg Asn Glu Lys Ala Trp Glu Met Ala Lys Gln Val Ile
275 280 285
Arg Thr Leu Ser Tyr Phe Pro Phe Met Leu Asn Phe His Pro Ser Cys
290 295 300
Asp Cys Phe Leu Asn Met Leu Gly Asn Lys Leu Val Val Ile Ile Gly
305 310 315 320
Ala Thr Gly Thr Gly Lys Thr Arg Leu Ser Ile Glu Ile Ala Lys Ala
325 330 335
Ile Gly Gly Glu Val Val Asn Ala Asp Lys Met Gln Ile Tyr Asp Gly
340 345 350
Leu Asp Ile Thr Thr Asn Lys Val Ser Leu Gln Asp Arg Cys Gly Ile
355 360 365
Pro His His Leu Ile Ala Ser Ile Pro Arg Asn Ala Gly Asp Phe Pro
370 375 380
Val Ser Phe Phe Arg Ser Ala Ala Lys Thr Thr Ile Asn Cys Ile Ala
385 390 395 400
Arg Arg Gly His Thr Pro Ile Val Val Gly Gly Ser Asn Ser Leu Ile
405 410 415
His Gly Leu Leu Val Asp Asn Phe Asp Ser Ser Ile Val Asp Pro Phe
420 425 430
Gly Gln Leu Glu Val Ser Tyr Arg Pro Thr Pro Arg Ser Gln Cys Cys
435 440 445
Phe Leu Trp Val His Val Asn Glu Val Ile Leu Asn Glu Tyr Leu Lys
450 455 460
Arg Arg Val Asp Asn Met Val Asp Ala Gly Leu Val Glu Glu Ile Glu
465 470 475 480
Glu Tyr Phe Asp Thr Leu Ser Val Asn Gly His Val Pro Tyr Val Gly
485 490 495
Leu Gly Lys Ala Ile Gly Val Pro Glu Leu Ser Glu Tyr Phe Thr Gly
500 505 510
Arg Val Ser Cys Ser Asp Ala Leu Ser Met Met Lys Thr Asn Thr Gln
515 520 525
Ile Leu Ala Arg Ser Gln Val Thr Lys Ile His Arg Met Val Asp Val
530 535 540
Trp Gly Trp His Val His Ala Leu Asp Cys Thr Glu Thr Ile Leu Ala
545 550 555 560
His Leu Thr Gly Ser Asn Lys Tyr Met Glu Asp Leu Val Trp Lys Arg
565 570 575
Asp Val Ser Asp Pro Gly Leu Ala Ala Ile Gln Asp Phe Leu
580 585 590
<210>44
<211>4470
<212>DNA
＜213〉paddy rice
<220>
<221>CDS
<222>(1484)...(2470)
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT2 full length sequence (018830_1)
<221>misc_feature
<222>2876，2877，2878，2879，2880，2881，2882，2883，2884，2885，2886，2887，2888，2889，2890，2891，2892，2893，2894，2895，2896，2897，2898，2899，2900，2901，2902，2903，2904，2905，2906，2907，2908，2909，2910，2911，2912，2913，2914
<223>n＝A，T，C or G
<221>misc_featute
<222>2915，2916，2917，2918，2919，2920，2921，2922，2923，2924，2925，2926，2927，2928，2929，2930，2931，2932，2933，2934，2935，2936，2937，2938，2939，2940，2941，2942，2943，2944，2945，2946，2947，2948，2949，2950，2951，2952，2953
<223>n＝A，T，C or G
<221>misc_feature
<222>2954，2955，2956，2957，2958，2959，2960，2961，2962，2963，2964，2965，2966，2967，2968，2969，2970，2971，2972，2973，2974，2975
<223>n＝A，T，C or G
<400>44
aaaacaatca cacactgtta tgagctctgt tattatgccc gcaataattt ctaatctata 60
ggctacaagt aaaaaaaaag agcagaggta agtactagac tccatgcatt ctgtatattt 120
actttactct ctaagataga gttccactaa attatggatt tcaggatagg gatatcagta 180
ctacatattt tcaggcataa ataaagaata aaccatgctc acattataca aacttgcgtg 240
atagatgtaa atagatacaa cttaccaatc gttcgtcccg atgcatcaac tttcctagtc 300
cattcaaacc caggctaaaa cattccatgc aaacagaaat aatctatgcg gtacacatgt 360
aagtttaggt attgaaccac atgcttgtgt tatgcactac tatagcaaat taactgaact 420
agagcaaata ggaatacaaa atccctcaga tgcaactgag ttttggcatt gaatcagtac 480
agaagctact gcttgatttt aattctttag tgcttgaacc atcataaaat agccgcaaag 540
attaaaaaaa aaacaacaac acaatatata gagaccatca tagtaatctg atccttccac 600
tttcactttt gtacgaagct gctgcatttc tgctgtctaa tcaacattct ataaacaaca 660
tcataatgtt gtctcattac acaactgtaa cctagagtat cagccagctt gggctaggat 720
atagacctaa atttcatcaa tgagtgccac atcgaatcat tttcacttac gtgcattgtt 780
ttggcccgag tttgcacgag ataagcaagt cgttctatct acttcacgta acatgtgagt 840
ttgtgcaccg cgagtgcaat ttactcaaaa taaattgcat catcatcttt ttgtgatact 900
ccgtggtttc gaaactatta agattcagat agttgtattg catagtttca aatataaaca 960
aatcacattt ttttttgtgt gtgtgtgtgt gggggggggg ggggttaaat tatggtgttc 1020
catagtttca cttgacaatt tcactttaaa ttcaaattta aaatttggag cctttaagtt 1080
tgtgaacaaa agtacgagat tggtcctcca caaattgaat catgtgcatg aagttgtcac 1140
aggctcacag cgactgcaca acagcagctg gaataacaca aaaaaggcca tttttatcac 1200
tatgccattc atatgtatta aattatctct actctttctg ttcgagtgat ttgaacattt 1260
tcacatccag gtataatcca tgctaacacc aggacgtgtt ctcatttcag ctataaatag 1320
caaaaaaaat tcaaatatgt ataaacccgt caccgttctc atccaaaatt atctactttc 1380
ccgataattt cattttcatt aactccattc ccgatcagtg agattttgct acgcattgtt 1440
attgatataa aaagatggct ataccttgga tgcgagtgtg gcc atg gag cac tgc 1495
Met Glu His Cys
1
aat ggc atc gcc gcc gtt ggg cgc tgg ttg tcc acc aag ccc aag gtt 1543
Asn Gly Ile Ala Ala Val Gly Arg Trp Leu Ser Thr Lys Pro Lys Val
5 10 15 20
atc ttc gtg ctc ggc gcc acc gcc acc ggc aag tcc aag ctc gcc atc 1591
Ile Phe Val Leu Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu Ala Ile
25 30 35
cgc ctc gcc gcg cgc ttc gac ggc gag gtc atc aac tcc gac aag atc 1639
Arg Leu Ala Ala Arg Phe Asp Gly Glu Val Ile Asn Ser Asp Lys Ile
40 45 50
cag gcg cac gac ggc ttc ccg gtc atc acc aac aag gtc acc gac gag 1687
Gln Ala His Asp Gly Phe Pro Val Ile Thr Asn Lys Val Thr Asp Glu
55 60 65
gag cgt gcc ggc gtc gcg cac cac ctc ctc ggc ggc gtc agc ccc gac 1735
Glu Arg Ala Gly Val Ala His His Leu Leu Gly Gly Val Ser Pro Asp
70 75 80
gcc gac ttc acc gcg gag gac ttc cgc cgc gag gcg gcc gcc gcc gtc 1783
Ala Asp Phe Thr Ala Glu Asp Phe Arg Arg Glu Ala Ala Ala Ala Val
85 90 95 100
gcc cgc gtc cac gcg gcc ggc cgc ctc ccc gtc gtc gcc ggc ggg tcg 1831
Ala Arg Val His Ala Ala Gly Arg Leu Pro Val Val Ala Gly Gly Ser
105 110 115
aac atc tac gtc gag gcg ctc gtg gcc ggc ggc ggc ggc gcg ttc ctc 1879
Asn Ile Tyr Val Glu Ala Leu Val Ala Gly Gly Gly Gly Ala Phe Leu
120 125 130
gcg gcg tac gac tgc ctc ttc ctg tgg acc gac gtc gcg ccg gac ctg 1927
Ala Ala Tyr Asp Cys Leu Phe Leu Trp Thr Asp Val Ala Pro Asp Leu
135 140 145
ctg cgg tgg tac acg gcg gcg cgc gtg gac gac atg gtg cgg cgc ggg 1975
Leu Arg Trp Tyr Thr Ala Ala Arg Val Asp Asp Met Val Arg Arg Gly
150 155 160
ctg gtt ggc gag gcc cgc gcc ggg ttc gac gcc ggg gcg gac tac acc 2023
Leu Val Gly Glu Ala Arg Ala Gly Phe Asp Ala Gly Ala Asp Tyr Thr
165 170 175 180
cgc ggc gtg cgc cgc gcc atc ggg cta ccc gag atg cac ggc tac ctg 207l
Arg Gly Val Arg Arg Ala Ile Gly Leu Pro Glu Met His Gly Tyr Leu
185 190 195
ctg gcg gag cgc gag ggc ggc gcc ggc gcc gag gac gac gac gac ctc 2119
Leu Ala Glu Arg Glu Gly Gly Ala Gly Ala Glu Asp Asp Asp Asp Leu
200 205 210
ctc gcc ggc atg ctc gag gcc gcc gtg cgc gag atc aag gac aac acg 2167
Leu Ala Gly Met Leu Glu Ala Ala Val Arg Glu Ile Lys Asp Asn Thr
215 220 225
ttc cgc ctc acc gtg tcg cag gtg gcc aag atc cgg cgc ctc agc gcg 2215
Phe Arg Leu Thr Val Ser Gln Val Ala Lys Ile Arg Arg Leu Ser Ala
230 235 240
ctg ccc ggg tgg gac gtc cgg cgc gtg gac gcg acg gcg gtg gtg gcg 2263
Leu Pro Gly Trp Asp Val Arg Arg Val Asp Ala Thr Ala Val Val Ala
245 250 255 260
cgc atg gcg gag ggc gcg ccc cac ggc gag acg tgg agg gag gtg gtg 2311
Arg Met Ala Glu Gly Ala Pro His Gly Glu Thr Trp Arg Glu Val Val
265 270 275
tgg gag ccg tgc gag gag atg gtc agc cgc ttc ctc gag acg ccc gcc 2359
Trp Glu Pro Cys Glu Glu Met Val Ser Arg Phe Leu Glu Thr Pro Ala
280 285 290
gcc gcc gcc gcc gtc gtt gcc aac ggc aaa gtc gac gtg aac gtc ggc 2407
Ala Ala Ala Ala Val Val Ala Asn Gly Lys Val Asp Val Asn Val Gly
295 300 305
gac gcg gcc gcc ggc ttg cct gag gct gcc gcc gcc gcc gtc gtt gcg 2455
Asp Ala Ala Ala Gly Leu Pro Glu Ala Ala Ala Ala Ala Val Val Ala
310 315 320
gcg ggt gtg gtc taa ctctaagtag gatacgcggc gacggtgcat gtttgcatgg 2510
Ala Gly Val Val *
325
tgggtggcgg ctcatgttgc ggttttgggt tggctttggc gtggctgggc caggtggctt 2570
gcaatatttc attatttatt tatttatttt tattttgagc tgcagcgata tgagattttg 2630
agtgagaaag gagagggagg gagacacaag tatctttgag cttgtttaag cttagtgtta 2690
caagagatta ttttgttatg ttttcagaat atataaaatg ctagcgcctc tagtataatc 2750
ggtagtattt gacaccgcac aaaatagtag agaatgctac gcagcgtcaa atattaccag 2810
ttgagggaat acaaattcta aagtgtttac ttgtcttttg atttgaagtt taaaaccatc 2870
gaaatnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 2930
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncgtgc gaggagatgg 2990
tcagccgctt cctcgagacg cccgccgccg ccgccgccgt cgttgccaac ggcaaagtcg 3050
acgtgaacgt cggcgacgcg gccgccggcg tgcctgaggc tgccgccgcc gccgtcgttg 3110
cggcgggtgt ggtctaactc taagtaggat acgcggcgac ggtgcatgtt tgcatggtgg 3170
gtggcggctc atgttgcggt tttgggttgg ctttggcgtg gctgggccag gtggcttgca 3230
atatttcatt atttatttat ttttattttg agctgcagtg atatgagatc ttgagtgaga 3290
aaggagaggt agggagacac aagtatcttt gagcttgttt aagcttagtg ttacaagaga 3350
ttattttgtt atgttttcag aatatataaa atgctagcgc ctctagtata atcggtagta 3410
tttgacaccg cacaaaatag tagagaatgc tacgcagcgt caaatattac cagttgaggg 3470
aatacaaatt ctaaagtgtt tacttgtctt ttgatttgaa gtttaaaacc aatcgaaatt 3530
cttaactgtc ttttgaaatt cgaagtgttt tctcccttat tagggcctgt tcggaacaaa 3590
aggataaaaa acacagaaat atgatagagc gtaaattgga aaactcaggg actgtaaaac 3650
ttgagctgtt tggaacagag gaatgctagg ggatagatac acaagcacac aactaatgtg 3710
aaggaaaatt tcctttagga ggaaccttat ttttctttgt ttccttttaa agtatatgat 3770
ttcaaaaaac aatatttgga gggagagatg tccctccaaa taatttttaa gaaaaaaata 3830
tgagcgtgtt ggagattaaa cacggagttc aaacaaacaa gatttggagg gagagacgtc 3890
cctccaaaca ttttttaaga aaaaattatg agcgtgttgg ggattaaaca cggaacctca 3950
gggttgaaat catatatctc ttgtcactgc actatcaagt acatctcaaa gtacagagtt 4010
tctcaatgct cttttctttg atccaaacaa catcatagga agattttcca aaggaaacta 4070
aacctccaca attcctttaa aattcctttg atccaaccat gccttggtta ctgcatattt 4130
gttttagtat aaccttatat tgcttgaaac taaacttccc ttcttttcat actacctgac 4190
agattgttag ttctaagagt atgcttatct aacatacgga ttataagcca tagacaattt 4250
taaaatttcg atcttaattt tcgaattaat ttagttttat ttcttatttt cagccttagt 4310
ttttgaaatg ctaagactag aagtataaat ttcttactag ttgctttggt cacgcgttgt 4370
tggcttataa accacagcac acaagaggaa attatttatt tgtatttaca aatctgtacc 4430
ttcaagtatt cttagtttac cgcacggtgg caaagaaatg 4470
<210>45
<211>984
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT2 encoding sequence (018830_1)
<221>CDS
<222>(1)...(984)
<400>45
atg gag cac tgc aat ggc atc gcc gcc gtt ggg cgc tgg ttg tcc acc 48
Met Glu His Cys Asn Gly Ile Ala Ala Val Gly Arg Trp Leu Ser Thr
1 5 10 15
aag ccc aag gtt atc ttc gtg ctc ggc gcc acc gcc acc ggc aag tcc 96
Lys Pro Lys Val Ile Phe Val Leu Gly Ala Thr Ala Thr Gly Lys Ser
20 25 30
aag ctc gcc atc cgc ctc gcc gcg cgc ttc gac ggc gag gtc atc aac 144
Lys Leu Ala Ile Arg Leu Ala Ala Arg Phe Asp Gly Glu Val Ile Asn
35 40 45
tcc gac aag atc cag gcg cac gac ggc ttc ccg gtc atc acc aac aag 192
Ser Asp Lys Ile Gln Ala His Asp Gly Phe Pro Val Ile Thr Asn Lys
50 55 60
gtc acc gac gag gag cgt gcc ggc gtc gcg cac cac ctc ctc ggc ggc 240
Val Thr Asp Glu Glu Arg Ala Gly Val Ala His His Leu Leu Gly Gly
65 70 75 80
gtc agc ccc gac gcc gac ttc acc gcg gag gac ttc cgc cgc gag gcg 288
Val Ser Pro Asp Ala Asp Phe Thr Ala Glu Asp Phe Arg Arg Glu Ala
85 90 95
gcc gcc gcc gtc gcc cgc gtc cac gcg gcc ggc cgc ctc ccc gtc gtc 336
Ala Ala Ala Val Ala Arg Val His Ala Ala Gly Arg Leu Pro Val Val
100 105 110
gcc ggc ggg tcg aac atc tac gtc gag gcg ctc gtg gcc ggc ggc ggc 384
Ala Gly Gly Ser Asn Ile Tyr Val Glu Ala Leu Val Ala Gly Gly Gly
115 120 125
ggc gcg ttc ctc gcg gcg tac gac tgc ctc ttc ctg tgg acc gac gtc 432
Gly Ala Phe Leu Ala Ala Tyr Asp Cys Leu Phe Leu Trp Thr Asp Val
130 135 140
gcg ccg gac ctg ctg cgg tgg tac acg gcg gcg cgc gtg gac gac atg 480
Ala Pro Asp Leu Leu Arg Trp Tyr Thr Ala Ala Arg Val Asp Asp Met
145 150 155 160
gtg cgg cgc ggg ctg gtt ggc gag gcc cgc gcc ggg ttc gac gcc ggg 528
Val Arg Arg Gly Leu Val Gly Glu Ala Arg Ala Gly Phe Asp Ala Gly
165 170 175
gcg gac tac acc cgc ggc gtg cgc cgc gcc atc ggg cta ccc gag atg 576
Ala Asp Tyr Thr Arg Gly Val Arg Arg Ala Ile Gly Leu Pro Glu Met
180 185 190
cac ggc tac ctg ctg gcg gag cgc gag ggc ggc gcc ggc gcc gag gac 624
His Gly Tyr Leu Leu Ala Glu Arg Glu Gly Gly Ala Gly Ala Glu Asp
195 200 205
gac gac gac ctc ctc gcc ggc atg ctc gag gcc gcc gtg cgc gag atc 672
Asp Asp Asp Leu Leu Ala Gly Met Leu Glu Ala Ala Val Arg Glu Ile
210 215 220
aag gac aac acg ttc cgc ctc acc gtg tcg cag gtg gcc aag atc cgg 720
Lys Asp Asn Thr Phe Arg Leu Thr Val Ser Gln Val Ala Lys Ile Arg
225 230 235 240
cgc ctc agc gcg ctg ccc ggg tgg gac gtc cgg cgc gtg gac gcg acg 768
Arg Leu Ser Ala Leu Pro Gly Trp Asp Val Arg Arg Val Asp Ala Thr
245 250 255
gcg gtg gtg gcg cgc atg gcg gag ggc gcg ccc cac ggc gag acg tgg 816
Ala Val Val Ala Arg Met Ala Glu Gly Ala Pro His Gly Glu Thr Trp
260 265 270
agg gag gtg gtg tgg gag ccg tgc gag gag atg gtc agc cgc ttc ctc 864
Arg Glu Val Val Trp Glu Pro Cys Glu Glu Met Val Ser Arg Phe Leu
275 280 285
gag acg ccc gcc gcc gcc gcc gcc gtc gtt gcc aac ggc aaa gtc gac 912
Glu Thr Pro Ala Ala Ala Ala Ala Val Val Ala Asn Gly Lys Val Asp
290 295 300
gtg aac gtc ggc gac gcg gcc gcc ggc ttg cct gag gct gcc gcc gcc 960
Val Asn Val Gly Asp Ala Ala Ala Gly Leu Pro Glu Ala Ala Ala Ala
305 310 315 320
gcc gtc gtt gcg gcg ggt gtg gtc 984
Ala Val Val Ala Ala Gly Val Val
325
<210>46
<211>328
<212>PRT
＜213〉paddy rice
<400>46
Met Glu His Cys Asn Gly Ile Ala Ala Val Gly Arg Trp Leu Ser Thr
1 5 10 15
Lys Pro Lys Val Ile Phe Val Leu Gly Ala Thr Ala Thr Gly Lys Ser
20 25 30
Lys Leu Ala Ile Arg Leu Ala Ala Arg Phe Asp Gly Glu Val Ile Asn
35 40 45
Ser Asp Lys Ile Gln Ala His Asp Gly Phe Pro Val Ile Thr Asn Lys
50 55 60
Val Thr Asp Glu Glu Arg Ala Gly Val Ala His His Leu Leu Gly Gly
65 70 75 80
Val Ser Pro Asp Ala Asp Phe Thr Ala Glu Asp Phe Arg Arg Glu Ala
85 90 95
Ala Ala Ala Val Ala Arg Val His Ala Ala Gly Arg Leu Pro Val Val
100 105 110
Ala Gly Gly Ser Asn Ile Tyr Val Glu Ala Leu Val Ala Gly Gly Gly
115 120 125
Gly Ala Phe Leu Ala Ala Tyr Asp Cys Leu Phe Leu Trp Thr Asp Val
130 135 140
Ala Pro Asp Leu Leu Arg Trp Tyr Thr Ala Ala Arg Val Asp Asp Met
145 150 155 160
Val Arg Arg Gly Leu Val Gly Glu Ala Arg Ala Gly Phe Asp Ala Gly
165 170 175
Ala Asp Tyr Thr Arg Gly Val Arg Arg Ala Ile Gly Leu Pro Glu Met
180 185 190
His Gly Tyr Leu Leu Ala Glu Arg Glu Gly Gly Ala Gly Ala Glu Asp
195 200 205
Asp Asp Asp Leu Leu Ala Gly Met Leu Glu Ala Ala Val Arg Glu Ile
210 215 220
Lys Asp Asn Thr Phe Arg Leu Thr Val Ser Gln Val Ala Lys Ile Arg
225 230 235 240
Arg Leu Ser Ala Leu Pro Gly Trp Asp Val Arg Arg Val Asp Ala Thr
245 250 255
Ala Val Val Ala Arg Met Ala Glu Gly Ala Pro His Gly Glu Thr Trp
260 265 270
Arg Glu Val Val Trp Glu Pro Cys Glu Glu Met Val Ser Arg Phe Leu
275 280 285
Glu Thr Pro Ala Ala Ala Ala Ala Val Val Ala Asn Gly Lys Val Asp
290 295 300
Val Asn Val Gly Asp Ala Ala Ala Gly Leu Pro Glu Ala Ala Ala Ala
305 310 315 320
Ala Val Val Ala Ala Gly Val Val
325
<210>47
<211>4114
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT1 genome sequence (006704_3)
<221>CDS
<222>(2001)...(2978)
<400>47
tttgcttgca aggttttgtg tcgcaatgct agtttctttt tcttttttct tgttaatatc 60
catttttctt tttcttttat caaaaaaaaa tatgtgggtg taggggtgga tctaggggga 120
aaaaagcagg ggctaaaaaa actagacaaa gctccaactc attttcggcc tttctgtatc 180
tttatcggaa aattttggag gctcaagggt ctctaataat ccatatatta gtagcgggcg 240
ctcgaacctc gtctccgtga tagatccata tatatgggtg gtttttgttt gatctaaaaa 300
gatttttttt tctttgtaat ccttatgttg agcgatagat attttatttt tacgttagat 360
atattagata tctaagttga ggcttttttt aagggctaat atttttcatt cacatagatc 420
tcaatgttat tataattttt ccatgtcata tataaactta agaccgaact aatgcatctt 480
gtttttacct ttgactttta attacctttc aataggacct aaaagggatt agggagtcct 540
aattgcccta ggctttgtct ttaccccttg tatgatgtga acaccagaca taggttcaat 600
aggaatgaat agtttgcgga tacatatgag ataatgtttt gcgctatatg tcaaagttag 660
aaggtggtga acataaaaca aagttaaagt ttcactgaat aataactagc gacgatgaac 720
ataaagaaat tattgaagtt taccctcaag aagtagtaat attaatgatt gattttgtta 780
attttgctag ctagaatatg catacagcag cagatgttat catccttttt atttatacgt 840
actgtcatcc ttttctcctt tggtatagat tggttttatg aagttgatgg aaaattgacc 900
acagatgagt ttattattca ttcatgaacc gtgaacttct cttaaaaaaa gtaaaataag 960
gaagttcaat gcgaataatc tatatggggg attaattact tgtcaatgct tttcatgata 1020
tttaatgttt tcgactgtaa gattaacaaa ttgtgcagag atgtattttt catgcatgat 1080
aatttggaag tgcacccaca ttgttccatg aacttgcatt gctagtttta tgttaaattc 1140
tcgttcacaa caaattaact agagacaatt aattatcatg atatataggt aatttagcat 1200
caaactgatc atttacaatc tgcattactg tttttgaaaa caaaaataat aaaaaaatgc 1260
tatatcgtta caacggtggt ttattttact aacatcatca tgacatcaac atgggatcta 1320
ggtatcaata ctgttaccta tgggtatcat gtatgatacc ccgatattag atatggttcc 1380
tatgtttatc atgtctaatg ctagtatcat ataagtacca aatttgtgcc atgctggcgt 1440
tatggtgatg ccagaaataa agtattccat tctggaatgg tatagtgtct tctggtaatc 1500
cttatttaga aaatgtatta taaccattta aatatagtat atgttcccct tccatctcaa 1560
aatataaatg attttgggta gatgtaatct atagtcctta aaatgttagt agttctggtg 1620
gtgtccattc ccacaccatc tctactacta ccgtgtgagc cccacaatct atactattac 1680
attatctttt aacgagtcct cccccgtttc accgttggct cttagtactt ggactaaata 1740
agtttttgtt aattgattta ataaattaga aactcaattt gttgtccgtt acaaagcaca 1800
agctcttagc tatcctaata ttattaatct gaacaaactt atatcacatc catctaaaat 1860
ctcgtgtatt atattttggg acgggggagt aagaatgatc gagtgcacgt acattttagg 1920
tcgtaaattt actatctttg caaaaagtaa ttaacgatgg cttatatacc tcttctccgg 1980
tgagcagctc accttcatca atg gag tac cac gtc ggc ggt gtc atc gga cag 2033
Met Glu Tyr His Val Gly Gly Val Ile Gly Gln
1 5 10
tca ccc aag ccc aag gtc gtc ttc gtg ctc ggc gcc acc gcc acc ggc 2081
Ser Pro Lys Pro Lys Val Val Phe Val Leu Gly Ala Thr Ala Thr Gly
15 20 25
aag tcc aag ctc gcc atc tcc atc gcc gag cgg ttc ggc ggc gag gtg 2129
Lys Ser Lys Leu Ala Ile Ser Ile Ala Glu Arg Phe Gly Gly Glu Val
30 35 40
atc aac tcc gac aag atc cag gtg cac gac ggg ttc ccc atc atc acg 2177
Ile Asn Ser Asp Lys Ile Gln Val His Asp Gly Phe Pro Ile Ile Thr
45 50 55
aac aag gtc acc gag gag gag cgc gcc ggc gtc ccc cac cac ctc ctc 2225
Asn Lys Val Thr Glu Glu Glu Arg Ala Gly Val Pro His His Leu Leu
60 65 70 75
ggc gtc ctc cac ccg gac gcc gac ttc acc gcc gag gac ttc cgg cgc 2273
Gly Val Leu His Pro Asp Ala Asp Phe Thr Ala Glu Asp Phe Arg Arg
80 85 90
gag gcg gcc gcc gcc gtc gcc cgc gtc ctc gcg gcg ggc cgc ctc ccc 2321
Glu Ala Ala Ala Ala Val Ala Arg Val Leu Ala Ala Gly Arg Leu Pro
95 100 105
gtc gtg gcc ggc ggg tcg aac acc tac gtc gag gcg ctg gtg gag ggc 2369
Val Val Ala Gly Gly Ser Asn Thr Tyr Val Glu Ala Leu Val Glu Gly
110 115 120
ggc ggc ggc gcg ttc cgc gcg gcg cac gac tgc ctc ttc ctg tgg acc 2417
Gly Gly Gly Ala Phe Arg Ala Ala His Asp Cys Leu Phe Leu Trp Thr
125 130 135
gac gtc gcg ccg ggc ctg ctg cgg tgg tac acc gcg gcg cgc gtg gac 2465
Asp Val Ala Pro Gly Leu Leu Arg Trp Tyr Thr Ala Ala Arg Val Asp
140 145 150 155
gac atg gtg cgg cgc ggg ctg gtg ggc gag gcg cgc gcc ggg ttc gtc 2513
Asp Met Val Arg Arg Gly Leu Val Gly Glu Ala Arg Ala Gly Phe Val
160 165 170
gac ggc gcc ggc gcc gcg gac tac tac acc cgc ggc gtg cgc cgc gcc 2561
Asp Gly Ala Gly Ala Ala Asp Tyr Tyr Thr Arg Gly Val Arg Arg Ala
175 180 185
atc ggg atc ccg gag atg cac ggg tac ctc ctg gcc gag cgc tcg ggc 2609
Ile Gly Ile Pro Glu Met His Gly Tyr Leu Leu Ala Glu Arg Ser Gly
190 195 200
ggc gag gcg gcc gac gac ggc gag ctc gcc gcc atg ctc gac ggc gcc 2657
Gly Glu Ala Ala Asp Asp Gly Glu Leu Ala Ala Met Leu Asp Gly Ala
205 210 215
gtg cgc gag atc aag gcc aac acc tac cgc ctc gcc gcg acg cag gtg 2705
Val Arg Glu Ile Lys Ala Asn Thr Tyr Arg Leu Ala Ala Thr Gln Val
220 225 230 235
gcg aag atc cgg cgg ctg agc gcg ctg gac ggg tgg gac gtg cgg cgc 2753
Ala Lys Ile Arg Arg Leu Ser Ala Leu Asp Gly Trp Asp Val Arg Arg
240 245 250
gtg gac gcg acg gtg gtg gtg gcg cgc atg gcg gag ggg gcg ccg cac 2801
Val Asp Ala Thr Val Val Val Ala Arg Met Ala Glu Gly Ala Pro His
255 260 265
agg gag acg tgg gag gcg gtg gtg tgg aag ccg tgc gag gag atg gtc 2849
Arg Glu Thr Trp Glu Ala Val Val Trp Lys Pro Cys Glu Glu Met Val
270 275 280
ggc cgc ttc ctc gag gcg tcc gcc gcc gtg gat gac gac gac aat gcc 2897
Gly Arg Phe Leu Glu Ala Ser Ala Ala Val Asp Asp Asp Asp Asn Ala
285 290 295
gcc tcc ggt tcg ccg gcg gcg ttg gca ccg atg acg gcg gcg tgt cgc 2945
Ala Ser Gly Ser Pro Ala Ala Leu Ala Pro Met Thr Ala Ala Cys Arg
300 305 310 315
ctg agg gcg cag ctg gtg cag ctg caa tac taa ttagagtgga gtggcttggc 2998
Leu Arg Ala Gln Leu Val Gln Leu Gln Tyr *
320 325
gttggctagc gttagtgcta ccactataat taatatatat atagtgcaag cagatcgcgt 3058
ttgattagag tgacaattat atgtcgtcga aagtacgttt tgtgatggaa gtaacatcat 3118
ccagtcgcta taagtgggac ccatatgtca tcagtttaat taaagagatg attttttttg 3178
cggggaaatt aaagagatga ttaggaagaa ggttttcctt atttattcac agtggagtgc 3238
tattttacaa atagttctag tatataaata tagggagatg gattttcata attggagagg 3298
acatgcattc cctcgttttt ttataccacc tatatatata gaaaaaaatg ataatataat 3358
taatacaaaa tatatcactt cacagcctcc atgttcaaat ttgtaaacaa aacaaattaa 3418
accgatacta attaatgtat gttcatagtt atatatattt gtatatttca tggtaatgat 3478
ggttttcttg cattttatat tataagatgt tttgattttt tttaaacttt taaaatttaa 3538
ttgattttat aggaaagcgt agcaacattt aatataacgc caaattaatt ttactaaatc 3598
cgacatctat agaaatgtta ctacatgcct ttatttttat aaatttgttt gaatttaaaa 3658
caatttgatt gaaaaaaaat tcaaacattg tataatataa aacaaaggaa gtatataatt 3718
aaggtattgt agttcgttgt tgcacgtgga atctcgtgtc tggaactcga tgatctttag 3778
ttccaagaga ggaagcaaag gtagcggacg gcagggttga tcgatggcga gtggcgagat 3838
ccaatgccga ctgcaaccgt gcaactaacc gccggcgccg ccgtctgatt cgctgcgaca 3898
agctgggctg ctgggcagca gctaagcaac cgagatcatc gagacggtct cagaatctga 3958
ttctccggac cggaccagac tcggattgga caaccagtag tttaatcgat cgatcgcctg 4018
tatatatatt ttgggttagt ttatcccgta cacatagaat cgattgatcg atcggcacta 4078
ctatacagcg agcgagagag attgatcggt cgagag 4114
<210>48
<211>975
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT1 encoding sequence (006704_3)
<221>CDS
<222>(1)...(975)
<400>48
atg gag tac cac gtc ggc ggt gtc atc gga cag tca ccc aag ccc aag 48
Met Glu Tyr His Val Gly Gly Val Ile Gly Gln Ser Pro Lys Pro Lys
1 5 10 15
gtc gtc ttc gtg ctc ggc gcc acc gcc acc ggc aag tcc aag ctc gcc 96
Val Val Phe Val Leu Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu Ala
20 25 30
atc tcc atc gcc gag cgg ttc ggc ggc gag gtg atc aac tcc gac aag 144
Ile Ser Ile Ala Glu Arg Phe Gly Gly Glu Val Ile Asn Ser Asp Lys
35 40 45
atc cag gtg cac gac ggg ttc ccc atc atc acg aac aag gtc acc gag 192
Ile Gln Val His Asp Gly Phe Pro Ile Ile Thr Asn Lys Val Thr Glu
50 55 60
gag gag cgc gcc ggc gtc ccc cac cac ctc ctc ggc gtc ctc cac ccg 240
Glu Glu Arg Ala Gly Val Pro His His Leu Leu Gly Val Leu His Pro
65 70 75 80
gac gcc gac ttc acc gcc gag gac ttc cgg cgc gag gcg gcc gcc gcc 288
Asp Ala Asp Phe Thr Ala Glu Asp Phe Arg Arg Glu Ala Ala Ala Ala
85 90 95
gtc gcc cgc gtc ctc gcg gcg ggc cgc ctc ccc gtc gtg gcc ggc ggg 336
Val Ala Arg Val Leu Ala Ala Gly Arg Leu Pro Val Val Ala Gly Gly
100 105 110
tcg aac acc tac gtc gag gcg ctg gtg gag ggc ggc ggc ggc gcg ttc 384
Ser Asn Thr Tyr Val Glu Ala Leu Val Glu Gly Gly Gly Gly Ala Phe
115 120 125
cgc gcg gcg cac gac tgc ctc ttc ctg tgg acc gac gtc gcg ccg ggc 432
Arg Ala Ala His Asp Cys Leu Phe Leu Trp Thr Asp Val Ala Pro Gly
130 135 140
ctg ctg cgg tgg tac acc gcg gcg cgc gtg gac gac atg gtg cgg cgc 480
Leu Leu Arg Trp Tyr Thr Ala Ala Arg Val Asp Asp Met Val Arg Arg
145 150 155 160
ggg ctg gtg ggc gag gcg cgc gcc ggg ttc gtc gac ggc gcc ggc gcc 528
Gly Leu Val Gly Glu Ala Arg Ala Gly Phe Val Asp Gly Ala Gly Ala
165 170 175
gcg gac tac tac acc cgc ggc gtg cgc cgc gcc atc ggg atc ccg gag 576
Ala Asp Tyr Tyr Thr Arg Gly Val Arg Arg Ala Ile Gly Ile Pro Glu
180 185 190
atg cac ggg tac ctc ctg gcc gag cgc tcg ggc ggc gag gcg gcc gac 624
Met His Gly Tyr Leu Leu Ala Glu Arg Ser Gly Gly Glu Ala Ala Asp
195 200 205
gac ggc gag ctc gcc gcc atg ctc gac ggc gcc gtg cgc gag atc aag 672
Asp Gly Glu Leu Ala Ala Met Leu Asp Gly Ala Val Arg Glu Ile Lys
210 215 220
gcc aac acc tac cgc ctc gcc gcg acg cag gtg gcg aag atc cgg cgg 720
Ala Asn Thr Tyr Arg Leu Ala Ala Thr Gln Val Ala Lys Ile Arg Arg
225 230 235 240
ctg agc gcg ctg gac ggg tgg gac gtg cgg cgc gtg gac gcg acg gtg 768
Leu Ser Ala Leu Asp Gly Trp Asp Val Arg Arg Val Asp Ala Thr Val
245 250 255
gtg gtg gcg cgc atg gcg gag ggg gcg ccg cac agg gag acg tgg gag 816
Val Val Ala Arg Met Ala Glu Gly Ala Pro His Arg Glu Thr Trp Glu
260 265 270
gcg gtg gtg tgg aag ccg tgc gag gag atg gtc ggc cgc ttc ctc gag 864
Ala Val Val Trp Lys Pro Cys Glu Glu Met Val Gly Arg Phe Leu Glu
275 280 285
gcg tcc gcc gcc gtg gat gac gac gac aat gcc gcc tcc ggt tcg ccg 912
Ala Ser Ala Ala Val Asp Asp Asp Asp Asn Ala Ala Ser Gly Ser Pro
290 295 300
gcg gcg ttg gca ccg atg acg gcg gcg tgt cgc ctg agg gcg cag ctg 960
Ala Ala Leu Ala Pro Met Thr Ala Ala Cys Arg Leu Arg Ala Gln Leu
305 310 315 320
gtg cag ctg caa tac 975
Val Gln Leu Gln Tyr
325
<210>49
<211>325
<212>PRT
＜213〉paddy rice
<400>49
Met Glu Tyr His Val Gly Gly Val Ile Gly Gln Ser Pro Lys Pro Lys
1 5 10 15
Val Val Phe Val Leu Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu Ala
20 25 30
Ile Ser Ile Ala Glu Arg Phe Gly Gly Glu Val Ile Asn Ser Asp Lys
35 40 45
Ile Gln Val His Asp Gly Phe Pro Ile Ile Thr Asn Lys Val Thr Glu
50 55 60
Glu Glu Arg Ala Gly Val Pro His His Leu Leu Gly Val Leu His Pro
65 70 75 80
Asp Ala Asp Phe Thr Ala Glu Asp Phe Arg Arg Glu Ala Ala Ala Ala
85 90 95
Val Ala Arg Val Leu Ala Ala Gly Arg Leu Pro Val Val Ala Gly Gly
100 105 110
Ser Asn Thr Tyr Val Glu Ala Leu Val Glu Gly Gly Gly Gly Ala Phe
115 120 125
Arg Ala Ala His Asp Cys Leu Phe Leu Trp Thr Asp Val Ala Pro Gly
130 135 140
Leu Leu Arg Trp Tyr Thr Ala Ala Arg Val Asp Asp Met Val Arg Arg
145 150 155 160
Gly Leu Val Gly Glu Ala Arg Ala Gly Phe Val Asp Gly Ala Gly Ala
165 170 175
Ala Asp Tyr Tyr Thr Arg Gly Val Arg Arg Ala Ile Gly Ile Pro Glu
180 185 190
Met His Gly Tyr Leu Leu Ala Glu Arg Ser Gly Gly Glu Ala Ala Asp
195 200 205
Asp Gly Glu Leu Ala Ala Met Leu Asp Gly Ala Val Arg Glu Ile Lys
210 215 220
Ala Asn Thr Tyr Arg Leu Ala Ala Thr Gln Val Ala Lys Ile Arg Arg
225 230 235 240
Leu Ser Ala Leu Asp Gly Trp Asp Val Arg Arg Val Asp Ala Thr Val
245 250 255
Val Val Ala Arg Met Ala Glu Gly Ala Pro His Arg Glu Thr Trp Glu
260 265 270
Ala Val Val Trp Lys Pro Cys Glu Glu Met Val Gly Arg Phe Leu Glu
275 280 285
Ala Ser Ala Ala Val Asp Asp Asp Asp Asn Ala Ala Ser Gly Ser Pro
290 295 300
Ala Ala Leu Ala Pro Met Thr Ala Ala Cys Arg Leu Arg Ala Gln Leu
305 310 315 320
Val Gln Leu Gln Tyr
325
<210>50
<211>2599
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT5 genome sequence (027814_1)
<221>CDS
<222>(1827)...(2579)
<400>50
acctgacatc ataatacgaa caaatactgg cttgccaagt atgtggttaa caacgtgtaa 60
catagtacca atcatttagg gtggcaagac gtggcaacaa accaaacaag ccagcgagct 120
ccaggtgagt tattctgctc ttgcctcaag cccacaatcc aagttcgcac ttgatctttg 180
atctttggaa aggccatcat cgggagactg gacatgatcc aacctctcgc tttttctctt 240
cccgctacag ccaccagggc aagcagcacc gcccctgtcc aggctgattt cgcatgggtt 300
gctgatgatg gtcctcgacc tatcatccgg ctgggattat tacatgatta ttaagtaata 360
gctaattttt ttaaaaaaaa atagattaat ttgatttttt taagtaactt tcgtatagaa 420
accttttata aaaaacgtat cgtttaacag tttaaaaagc gtgcgtgcgg aaaacgagaa 480
agaggggttg ggaactcgaa ggaaagaaca cagccgggtt gggaacttgt tgctgtcacc 540
ctactccctg atgaatcctc ttgtccaggt ttttgcatgg agtaggaagt aggaactatc 600
atatcaacct agcctactag tttctcaggc atcagtagcc cagtagtgga tgcacgaacg 660
aattttacct gttgggggtg agaagctaga accgggcagg gggggaagga aggaccagca 720
acaagtggac ggatgatatg gaggctgatg gaaccgatcg tccggaggca acttgcaagc 780
aatgctacat ttgctcccgc agttgcgttg cacgacgtac tacatatgta accagaaaaa 840
tgccacgacg atgcagatcg atatatagtc aggcagcatt agcgtggtcg agtccccaac 900
gctcggcatt gcctcatcag ttaatccgca ctcgcctttt tgttagcggg acacgcatgc 960
gctgtgtgtg tgtgtgctcc cttcgatcgg gcacgagctg tgtgcggtgg catgggcgca 1020
tggcagcgac tggtcgaaac gcggccgcac gacggacacg ccgctcgatc ccccgcgcgg 1080
ctgccgtgct ccccctctcg tctggatcac cggcggcgtg ggcggctctc ttccacgagg 1140
catgagctcg gttttttttt accctctgct cgcgacggag agggaaaagg ctgctgcttc 1200
ttattcttat tccctggagc gatcagcttt ttctccgccc ctcggaggtg aaaacaaagc 1260
aacgaatgga accatggaaa cgaagtgaag gagcgtgcct tcgcaatcat ggcctgaggc 1320
cctgagcggc tgagcccctg aggcctcctg agtatatata aaccaagcat ggtttgcctc 1380
ctgcattgcc cgtgtgaatg ccaatgatac agagcccccc aagagcagag caagcgcgag 1440
aacacacacc aacaacgcaa caaaccacca ggcgtgcgcg tgcaagcgca aggcttgaaa 1500
cggagagaca cgaaaagcgc caaggtgttc gcccatcatt ataatcagct tataagggcg 1560
cgagcgaaac cgcacagttg tacacttgga ctcgcaaact agactctccg tctccttgcg 1620
ctgcgcgtta tatcggctct gcctatataa gtgtgctgag gcgactgggg ctcggtgagt 1680
gttttgggtg ggccggcttt atgagcagtc tcggtttgaa gatccgcacc gtcgtccgct 1740
cacctatggc ggccgcggcc gtcgctggcg tcggaaggga tggtagcttc gcctcccaga 1800
agcggccacg tcgggttagt gtgaga atg gag aga agc aga gtc ggg gac ggt 1853
Met Glu Arg Ser Arg Val Gly Asp Gly
1 5
tgc tgc tgc tcc tgc tct ggc cgc ggc ggg gtg gcg tcc act acg gcg 1901
Cys Cys Cys Ser Cys Ser Gly Arg Gly Gly Val Ala Ser Thr Thr Ala
10 15 20 25
gtc cgg ccg tcc acg ggg atg gtg gtg atc gtc ggc gcc acg ggc acg 1949
Val Arg Pro Ser Thr Gly Met Val Val Ile Val Gly Ala Thr Gly Thr
30 35 40
ggg aag acc aag ctt tcc atc gac gcg gcg cag gag ctc gcc ggc gag 1997
Gly Lys Thr Lys Leu Ser Ile Asp Ala Ala Gln Glu Leu Ala Gly Glu
45 50 55
gtg gtg aac gct gac aag att cag ctg tac gac ggc ctc gac gtc acc 2045
Val Val Asn Ala Asp Lys Ile Gln Leu Tyr Asp Gly Leu Asp Val Thr
60 65 70
acg aac aag gtg tcg ctc gcc gac cgc cgg ggc gtc ccg cac cac ctc 2093
Thr Asn Lys Val Ser Leu Ala Asp Arg Arg Gly Val Pro His His Leu
75 80 85
ctc ggc gca atc cgc gcc gag gcc ggg gag ctg ccg ccg tcg tcg ttc 2141
Leu Gly Ala Ile Arg Ala Glu Ala Gly Glu Leu Pro Pro Ser Ser Phe
90 95 100 105
cgc tcg ctc gcc gcc gcc gcc gcg gcc ggc atc gcg tcg cgc ggg cgc 2189
Arg Ser Leu Ala Ala Ala Ala Ala Ala Gly Ile Ala Ser Arg Gly Arg
110 115 120
gtg ccg gtc gtg gcc ggc ggg tcc aac tcg ctc atc cac gcg ctc ctc 2237
Val Pro Val Val Ala Gly Gly Ser Asn Ser Leu Ile His Ala Leu Leu
125 130 135
gct gac ccc atc gat gcc gcg ccg cgt gac cct ttc gcg gac gcc gat 2285
Ala Asp Pro Ile Asp Ala Ala Pro Arg Asp Pro Phe Ala Asp Ala Asp
140 145 150
gtc ggg tac cgg ccg gcg ctc cgg ttc ccg tgc tgc ctc ctc tgg gtc 2333
Val Gly Tyr Arg Pro Ala Leu Arg Phe Pro Cys Cys Leu Leu Trp Val
155 160 165
gac gtc gac gac gat gtt ctc gac gaa tac ctc gac cgg cgc gtg gac 2381
Asp Val Asp Asp Asp Val Leu Asp Glu Tyr Leu Asp Arg Arg Val Asp
170 175 180 185
gac atg gtc ggc gag ggg atg gtc gag gag ctc gag gaa tac ttc gcg 2429
Asp Met Val Gly Glu Gly Met Val Glu Glu Leu Glu Glu Tyr Phe Ala
190 195 200
acg acg tcg gcc tcg gag cgg gcc tcg cac gcc ggg ctg ggc aag gcc 2477
Thr Thr Ser Ala Ser Glu Arg Ala Ser His Ala Gly Leu Gly Lys Ala
205 210 215
atc ggc gtg ccg gag ctc ggc gac tac ttc gcc ggg cgc aag agc ctc 2525
Ile Gly Val Pro Glu Leu Gly Asp Tyr Phe Ala Gly Arg Lys Ser Leu
220 225 230
gac gcg gcg ata gac gag atc aag gcc aac acg cgg gtc ctc gcg ggc 2573
Asp Ala Ala Ile Asp Glu Ile Lys Ala Asn Thr Arg Val Leu Ala Gly
235 240 245
cgc cag gtcggcaaga tccgacgcat 2599
Arg Gln
250
<210>51
<211>773
<212>DNA
＜213〉paddy rice
<220>
<221>CDS
<222>(1)...(773)
<400>51
atg gag aga agc aga gtc ggg gac ggt tgc tgc tgc tcc tgc tct ggc 48
Met Glu Arg Ser Arg Val Gly Asp Gly Cys Cys Cys Ser Cys Ser Gly
1 5 10 15
cgc ggc ggg gtg gcg tcc act acg gcg gtc cgg ccg tcc acg ggg atg 96
Arg Gly Gly Val Ala Ser Thr Thr Ala Val Arg Pro Ser Thr Gly Met
20 25 30
gtg gtg atc gtc ggc gcc acg ggc acg ggg aag acc aag ctt tcc atc 144
Val Val Ile Val Gly Ala Thr Gly Thr Gly Lys Thr Lys Leu Ser Ile
35 40 45
gac gcg gcg cag gag ctc gcc ggc gag gtg gtg aac gct gac aag att 192
Asp Ala Ala Gln Glu Leu Ala Gly Glu Val Val Asn Ala Asp Lys Ile
50 55 60
cag ctg tac gac ggc ctc gac gtc acc acg aac aag gtg tcg ctc gcc 240
Gln Leu Tyr Asp Gly Leu Asp Val Thr Thr Asn Lys Val Ser Leu Ala
65 70 75 80
gac cgc cgg ggc gtc ccg cac cac ctc ctc ggc gca atc cgc gcc gag 288
Asp Arg Arg Gly Val Pro His His Leu Leu Gly Ala Ile Arg Ala Glu
85 90 95
gcc ggg gag ctg ccg ccg tcg tcg ttc cgc tcg ctc gcc gcc gcc gcc 336
Ala Gly Glu Leu Pro Pro Ser Ser Phe Arg Ser Leu Ala Ala Ala Ala
100 105 110
gcg gcc ggc atc gcg tcg cgc ggg cgc gtg ccg gtc gtg gcc ggc ggg 384
Ala Ala Gly Ile Ala Ser Arg Gly Arg Val Pro Val Val Ala Gly Gly
115 120 125
tcc aac tcg ctc atc cac gcg ctc ctc gct gac ccc atc gat gcc gcg 432
Ser Asn Ser Leu Ile His Ala Leu Leu Ala Asp Pro Ile Asp Ala Ala
130 135 140
ccg cgt gac cct ttc gcg gac gcc gat gtc ggg tac cgg ccg gcg ctc 480
Pro Arg Asp Pro Phe Ala Asp Ala Asp Val Gly Tyr Arg Pro Ala Leu
145 150 155 160
cgg ttc ccg tgc tgc ctc ctc tgg gtc gac gtc gac gac gat gtt ctc 528
Arg Phe Pro cys cys Leu Leu Trp Val Asp Val Asp Asp Asp Val Leu
165 170 175
gac gaa tac ctc gac cgg cgc gtg gac gac atg gtc ggc gag ggg atg 576
Asp Glu Tyr Leu Asp Arg Arg Val Asp Asp Met Val Gly Glu Gly Met
180 185 190
gtc gag gag ctc gag gaa tac ttc gcg acg acg tcg gcc tcg gag cgg 624
Val Glu Glu Leu Glu Glu Tyr Phe Ala Thr Thr Ser Ala Ser Glu Arg
195 200 205
gcc tcg cac gcc ggg ctg ggc aag gcc atc ggc gtg ccg gag ctc ggc 672
Ala Ser His Ala Gly Leu Gly Lys Ala Ile Gly Val Pro Glu Leu Gly
210 215 220
gac tac ttc gcc ggg cgc aag agc ctc gac gcg gcg ata gac gag atc 720
Asp Tyr Phe Ala Gly Arg Lys Ser Leu Asp Ala Ala Ile Asp Glu Ile
225 230 235 240
aag gcc aac acg cgg gtc ctc gcg ggc cgc cag gtc ggc aag atc cga 768
Lys Ala Asn Thr Arg Val Leu Ala Gly Arg Gln Val Gly Lys Ile Arg
245 250 255
cgc at 773
Arg
<210>52
<211>257
<212>PRT
＜213〉paddy rice
<400>52
Met Glu Arg Ser Arg Val Gly Asp Gly Cys Cys Cys Ser Cys Ser Gly
1 5 10 15
Arg Gly Gly Val Ala Ser Thr Thr Ala Val Arg Pro Ser Thr Gly Met
20 25 30
Val Val Ile Val Gly Ala Thr Gly Thr Gly Lys Thr Lys Leu Ser Ile
35 40 45
Asp Ala Ala Gln Glu Leu Ala Gly Glu Val Val Asn Ala Asp Lys Ile
50 55 60
Gln Leu Tyr Asp Gly Leu Asp Val Thr Thr Asn Lys Val Ser Leu Ala
65 70 75 80
Asp Arg Arg Gly Val Pro His His Leu Leu Gly Ala Ile Arg Ala Glu
85 90 95
Ala Gly Glu Leu Pro Pro Ser Ser Phe Arg Ser Leu Ala Ala Ala Ala
100 105 110
Ala Ala Gly Ile Ala Ser Arg Gly Arg Val Pro Val Val Ala Gly Gly
115 120 125
Ser Asn Ser Leu Ile His Ala Leu Leu Ala Asp Pro Ile Asp Ala Ala
130 135 140
Pro Arg Asp Pro Phe Ala Asp Ala Asp Val Gly Tyr Arg Pro Ala Leu
145 150 155 160
Arg Phe Pro Cys Cys Leu Leu Trp Val Asp Val Asp Asp Asp Val Leu
165 170 175
Asp Glu Tyr Leu Asp Arg Arg Val Asp Asp Met Val Gly Glu Gly Met
180 185 190
Val Glu Glu Leu Glu Glu Tyr Phe Ala Thr Thr Ser Ala Ser Glu Arg
195 200 205
Ala Ser His Ala Gly Leu Gly Lys Ala Ile Gly Val Pro Glu Leu Gly
210 215 220
Asp Tyr Phe Ala Gly Arg Lys Ser Leu Asp Ala Ala Ile Asp Glu Ile
225 230 235 240
Lys Ala Asn Thr Arg Val Leu Ala Gly Arg Gln Val Gly Lys Ile Arg
245 250 255
Arg
<210>53
<211>1284
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT7 genome sequence (34911308 aka NM_192112)
<221>CDS
<222>(1)...(1284)
<400>53
atg gca gcg act ggt cga aac gcg gcc gca cga cgg aca cgc cgc tcg 48
Met Ala Ala Thr Gly Arg Asn Ala Ala Ala Arg Arg Thr Arg Arg Ser
1 5 10 15
atc ccc cgc gcg gct gcc gtg ctc ccc ctc tcg tct gga tca ccg gcg 96
Ile Pro Arg Ala Ala Ala Val Leu Pro Leu Ser Ser Gly Ser Pro Ala
20 25 30
gct gtg ctg agg cga ctg ggg ctc ggt gag tgt ttt ggg tgg gcc ggc 144
Ala Val Leu Arg Arg Leu Gly Leu Gly Glu Cys Phe Gly Trp Ala Gly
35 40 45
ttt atg agc agt ctc ggt ttg aag atc cgc acc gtc gtc cgc tca cct 192
Phe Met Ser Ser Leu Gly Leu Lys Ile Arg Thr Val Val Arg Ser Pro
50 55 60
atg gcg gcc gcg gcc gtc gct ggc gtc gga agg gat ggt agc ttc gcc 240
Met Ala Ala Ala Ala Val Ala Gly Val Gly Arg Asp Gly Ser Phe Ala
65 70 75 80
tcc cag aag cgg cca cgt cgg gtt agt gtg aga atg gag aga agc aga 288
Ser Gln Lys Arg Pro Arg Arg Val Ser Val Arg Met Glu Arg Ser Arg
85 90 95
gtc ggg gac ggt tgc tgc tgc tcc tgc tct ggc cgc ggc ggg gtg gcg 336
Val Gly Asp Gly Cys Cys Cys Ser Cys Ser Gly Arg Gly Gly Val Ala
100 105 110
tcc act acg gcg gtc cgg ccg tcc acg ggg atg gtg gtg atc gtc ggc 384
Ser Thr Thr Ala Val Arg Pro Ser Thr Gly Met Val Val Ile Val Gly
115 120 125
gcc acg ggc acg ggg aag acc aag ctt tcc atc gac gcg gcg cag gag 432
Ala Thr Gly Thr Gly Lys Thr Lys Leu Ser Ile Asp Ala Ala Gln Glu
130 135 140
ctc gcc ggc gag gtg gtg aac gct gac aag att cag ctg tac gac ggc 480
Leu Ala Gly Glu Val Val Asn Ala Asp Lys Ile Gln Leu Tyr Asp Gly
145 150 155 160
ctc gac gtc acc acg aac aag gtg tcg ctc gcc gac cgc cgg ggc gtc 528
Leu Asp Val Thr Thr Asn Lys Val Ser Leu Ala Asp Arg Arg Gly Val
165 170 175
ccg cac cac ctc ctc ggc gca atc cgc gcc gag gcc ggg gag ctg ccg 576
Pro His His Leu Leu Gly Ala Ile Arg Ala Glu Ala Gly Glu Leu Pro
180 185 190
ccg tcg tcg ttc cgc tcg ctc gcc gcc gcc gcc gcg gcc ggc atc gcg 624
Pro Ser Ser Phe Arg Ser Leu Ala Ala Ala Ala Ala Ala Gly Ile Ala
195 200 205
tcg cgc ggg cgc gtg ccg gtc gtg gcc ggc ggg tcc aac tcg ctc atc 672
Ser Arg Gly Arg Val Pro Val Val Ala Gly Gly Ser Asn Ser Leu Ile
210 215 220
cac gcg ctc ctc gct gac ccc atc gat gcc gcg ccg cgt gac cct ttc 720
His Ala Leu Leu Ala Asp Pro Ile Asp Ala Ala Pro Arg Asp Pro Phe
225 230 235 240
gcg gac gcc gat gtc ggg tac cgg ccg gcg ctc cgg ttc ccg tgc tgc 768
Ala Asp Ala Asp Val Gly Tyr Arg Pro Ala Leu Arg Phe Pro Cys Cys
245 250 255
ctc ctc tgg gtc gac gtc gac gac gat gtt ctc gac gaa tac ctc gac 816
Leu Leu Trp Val Asp Val Asp Asp Asp Val Leu Asp Glu Tyr Leu Asp
260 265 270
cgg cgc gtg gac gac atg gtc ggc gag ggg atg gtc gag gag ctc gag 864
Arg Arg Val Asp Asp Met Val Gly Glu Gly Met Val Glu Glu Leu Glu
275 280 285
gaa tac ttc gcg acg acg tcg gcc tcg gag cgg gcc tcg cac gcc ggg 912
Glu Tyr Phe Ala Thr Thr Ser Ala Ser Glu Arg Ala Ser His Ala Gly
290 295 300
ctg ggc aag gcc atc ggc gtg ccg gag ctc ggc gac tac ttc gcc ggg 960
Leu Gly Lys Ala Ile Gly Val Pro Glu Leu Gly Asp Tyr Phe Ala Gly
305 310 315 320
cgc aag agc ctc gac gcg gcg ata gac gag atc aag gcc aac acg cgg 1008
Arg Lys Ser Leu Asp Ala Ala Ile Asp Glu Ile Lys Ala Asn Thr Arg
325 330 335
gtc ctc gcg gcc cgc cag gtc ggc aag atc cga cgc atg gcc gac gtt 1056
Val Leu Ala Ala Arg Gln Val Gly Lys Ile Arg Arg Met Ala Asp Val
340 345 350
tgg ggc tgg ccc atc cgc cgc ctc gac gcc acg gcc acc atc cgg gcg 1104
Trp Gly Trp Pro Ile Arg Arg Leu Asp Ala Thr Ala Thr Ile Arg Ala
355 360 365
cgg ctc tcc ggc gcc ggc cgc gcc gcc gag gcc gcc gcg tgg gag cgc 1152
Arg Leu Ser Gly Ala Gly Arg Ala Ala Glu Ala Ala Ala Trp Glu Arg
370 375 380
gac gtg cgc ggg cca ggc ctc gcc gcg atg cgt cag ttc gtc ggc cgc 1200
Asp Val Arg Gly Pro Gly Leu Ala Ala Met Arg Gln Phe Val Gly Arg
385 390 395 400
gcc gac ttc aac gcc gca gcg gtc gac cag cta gcc gcg cgg agt cgg 1248
Ala Asp Phe Asn Ala Ala Ala Val Asp Gln Leu Ala Ala Arg Ser Arg
405 410 415
agg caa tgc ctt cgc ggt ggc atg gtg gcc ggc tga 1284
Arg Gln Cys Leu Arg Gly Gly Met Val Ala Gly *
420 425
<210>54
<211>427
<212>PRT
＜213〉paddy rice
<400>54
Met Ala Ala Thr Gly Arg Asn Ala Ala Ala Arg Arg Thr Arg Arg Ser
1 5 10 15
Ile Pro Arg Ala Ala Ala Val Leu Pro Leu Ser Ser Gly Ser Pro Ala
20 25 30
Ala Val Leu Arg Arg Leu Gly Leu Gly Glu Cys Phe Gly Trp Ala Gly
35 40 45
Phe Met Ser Ser Leu Gly Leu Lys Ile Arg Thr Val Val Arg Ser Pro
50 55 60
Met Ala Ala Ala Ala Val Ala Gly Val Gly Arg Asp Gly Ser Phe Ala
65 70 75 80
Ser Gln Lys Arg Pro Arg Arg Val Ser Val Arg Met Glu Arg Ser Arg
85 90 95
Val Gly Asp Gly Cys Cys Cys Ser Cys Ser Gly Arg Gly Gly Val Ala
100 105 110
Ser Thr Thr Ala Val Arg Pro Ser Thr Gly Met Val Val Ile Val Gly
115 120 125
Ala Thr Gly Thr Gly Lys Thr Lys Leu Ser Ile Asp Ala Ala Gln Glu
130 135 140
Leu Ala Gly Glu Val Val Asn Ala Asp Lys Ile Gln Leu Tyr Asp Gly
145 150 155 160
Leu Asp Val Thr Thr Asn Lys Val Ser Leu Ala Asp Arg Arg Gly Val
165 170 175
Pro His His Leu Leu Gly Ala Ile Arg Ala Glu Ala Gly Glu Leu Pro
180 185 190
Pro Ser Ser Phe Arg Ser Leu Ala Ala Ala Ala Ala Ala Gly Ile Ala
195 200 205
Ser Arg Gly Arg Val Pro Val Val Ala Gly Gly Ser Asn Ser Leu Ile
210 215 220
His Ala Leu Leu Ala Asp Pro Ile Asp Ala Ala Pro Arg Asp Pro Phe
225 230 235 240
Ala Asp Ala Asp Val Gly Tyr Arg Pro Ala Leu Arg Phe Pro Cys Cys
245 250 255
Leu Leu Trp Val Asp Val Asp Asp Asp Val Leu Asp Glu Tyr Leu Asp
260 265 270
Arg Arg Val Asp Asp Met Val Gly Glu Gly Met Val Glu Glu Leu Glu
275 280 285
Glu Tyr Phe Ala Thr Thr Ser Ala Ser Glu Arg Ala Ser His Ala Gly
290 295 300
Leu Gly Lys Ala Ile Gly Val Pro Glu Leu Gly Asp Tyr Phe Ala Gly
305 310 315 320
Arg Lys Ser Leu Asp Ala Ala Ile Asp Glu Ile Lys Ala Asn Thr Arg
325 330 335
Val Leu Ala Ala Arg Gln Val Gly Lys Ile Arg Arg Met Ala Asp Val
340 345 350
Trp Gly Trp Pro Ile Arg Arg Leu Asp Ala Thr Ala Thr Ile Arg Ala
355 360 365
Arg Leu Ser Gly Ala Gly Arg Ala Ala Glu Ala Ala Ala Trp Glu Arg
370 375 380
Asp Val Arg Gly Pro Gly Leu Ala Ala Met Arg Gln Phe Val Gly Arg
385 390 395 400
Ala Asp Phe Asn Ala Ala Ala Val Asp Gln Leu Ala Ala Arg Ser Arg
405 410 415
Arg Gln Cys Leu Arg Gly Gly Met Val Ala Gly
420 425
<210>55
<211>5030
<212>DNA
＜213〉paddy rice
<220>
<221>misc_featute
<222>(0)...(0)
＜223〉OsIPT6 genome sequence (011783_3)
<221>CDS
<222>(1777)...(3031)
<400>55
acggagacga caagccacgg gaggacgacg tcggctatcg gacgagcttc ggggtgccct 60
aaggaaggag aagagaggga ttagagagag ggagatgaac cacggcgatc ggaaaccatg 120
gccgaaggcg gcggtggagg tggtgctcac ccgtgcgcga ggggatgggg gctccggcga 180
cgaacttcga cggaggaggg gtggacgagg tggatctcgg ccacgcgaat cgaacggcgg 240
cgacggcgca agacggcggc gagcctagcg gcggctagcg gcggccggag tagcggaaaa 300
aaacggcggc aaggggttgc acgacgcggg gacgatgggg agcacgggag aggtcggcgt 360
aatggggaaa aagagagagg gggtgccggc gatgcttaaa aagggggaga gagaaccgga 420
cgtggccggg aggggcggga atcgccggcc gacgtgggga gagggggagg agagagaggc 480
gggattcgat tttcgaatcc cggccatctc gggcgcgggc gcgagcggga gagagaggga 540
agtgggcccg ggagacgcgg cgcacgcgcg ggcgtggtcg acgtggcccg gggaaggcgg 600
agacgtgggc gcggcgacgg ttgcgggcgc ggcggcgcgc tgggatcggc gggaggaggg 660
agacgggccc gacaggtggg ccccacctgt cggcgacccc gagagaggag acagcggggc 720
ggcctggctg ccgggctggg cctcggcctg cggccggccc agcagagagg agggggaagg 780
aaaggagaaa tgggccgacg gcccatttcg caaaaaggag gaaaaagaga ggaaaaaaaa 840
agaaaaagga aaaaggattt tccctggaat aaaatattgc ttgctcaatt ttaattggtt 900
aaaattattt ctagagctct gaaaattcca ctaaaaatcc tgttaatgaa tttcgacatg 960
tagaactcaa gaaaaattcc acatgtcaaa tccgattatt atttgcatta tttccttagg 1020
gttttctcct gatttcacct gcattttctt agggtcattt ataaaaatta caattttggc 1080
ttgggaggaa aacttcgggg tgtgacacgc ctctccccgt aactccgatg ggaggagccc 1140
cacgagccgc tccaccatgg catcgactcc aaccgccccc tctcctccct cccaggctca 1200
ccggccgcct ctccccccct ttccagccgc ccactgccgc tgccccctct ctcttaggct 1260
ccctatgccg ccggcagcct cggagaaaga gtagagaaga tactcgaata ggagaaagaa 1320
aagagaaaag aaaagcaaaa agcagtgtgg gtcccacatt ttttcttctc acttacatgt 1380
gggtcccata aattttttta ttttttgctg acacgtcagc aaaaccagag atcaatactg 1440
tatagggacc ttttttacac agttttgtat agtttagggc cgagatttct ggttttgtgg 1500
ttagagggcc ttaaaaaagc tcgctgttaa gttgagggac ctccagtgaa cttattccaa 1560
aatagaatgt ccaatttggg cctgaaagcc caatacttgt ttgtttgttt tgggcctcta 1620
catctgcaca ggctctcttt cagaaatccc atccatctcc tcctctatcc tcttcccttc 1680
ccttccacac gaagccgccg cccgccggcc ggccgcccag aaccagaaag ctcctcctcc 1740
tcctcctccg cgcgccatca gatctcccag tgcggt atg cag tat gga tgc agg 1794
Met Gln Tyr Gly Cys Arg
1 5
cgc ccc gcc gtg tgg aag aga agt tgg tcc ccg gct gcc gcc gcc gcc 1842
Arg Pro Ala Val Trp Lys Arg Ser Trp Ser Pro Ala Ala Ala Ala Ala
10 15 20
acc aag aac aag gtc atc gtc atc tca ggc ccc acc ggc gcc ggc aag 1890
Thr Lys Asn Lys Val Ile Val Ile Ser Gly Pro Thr Gly Ala Gly Lys
25 30 35
acc agg ctc gcc ttg gac ctc gcc aag agg ctc tcc ggg gag atc atc 1938
Thr Arg Leu Ala Leu Asp Leu Ala Lys Arg Leu Ser Gly Glu Ile Ile
40 45 50
agc gcc gac tcc gtc cag gtc tac cgg ggc ctc gac gtc ggc tcc gcc 1986
Ser Ala Asp Ser Val Gln Val Tyr Arg Gly Leu Asp Val Gly Ser Ala
55 60 65 70
aag ccc tcc tct tcc gac agg gcc gcc gtg ccg cac cac ctc atc gac 2034
Lys Pro Ser Ser Ser Asp Arg Ala Ala Val Pro His His Leu Ile Asp
75 80 85
atc ctc cac gcc tcc gac gac tac tcc gcc ggg gac ttc ttc cac gac 2082
Ile Leu His Ala Ser Asp Asp Tyr Ser Ala Gly Asp Phe Phe His Asp
90 95 100
gcc cgc gca gca acc gac cac ctc ctc gcc cga gcc cgc gtc ccc att 2130
Ala Arg Ala Ala Thr Asp His Leu Leu Ala Arg Ala Arg Val Pro Ile
105 110 115
gtc gcc gga ggg act ggc ctc tac ctc cgc tgg tac atc tat ggc aag 2178
Val Ala Gly Gly Thr Gly Leu Tyr Leu Arg Trp Tyr Ile Tyr Gly Lys
120 125 130
ccc agt gtc ccg cag tct tcc atg gac gtc acc tcc gcc gtc tgg tcc 2226
Pro Ser Val Pro Gln Ser Ser Met Asp Val Thr Ser Ala Val Trp Ser
135 140 145 150
gag ctc tcc cgc ttc cgg gac acc ggc cgc tgg gaa gaa gcc gtc gac 2274
Glu Leu Ser Arg Phe Arg Asp Thr Gly Arg Trp Glu Glu Ala Val Asp
155 160 165
ctg gtt gcc aac gcc ggc gac ccc aaa gct cgg gac ctg tca gtc aac 2322
Leu Val Ala Asn Ala Gly Asp Pro Lys Ala Arg Asp Leu Ser Val Asn
170 175 180
aac tgg tca agg tta agg aga agc ctt gag atc atc agg tct tca ggc 2370
Asn Trp Ser Arg Leu Arg Arg Ser Leu Glu Ile Ile Arg Ser Ser Gly
185 190 195
tca cct ccc tct gcc ttc tcc ttg ccc tac aat gct tac aat ctc aat 2418
Ser Pro Pro Ser Ala Phe Ser Leu Pro Tyr Asn Ala Tyr Asn Leu Asn
200 205 210
cac cac cgt cgt ctc agt ctc acc aac caa gcc gat caa ccc acg gag 2466
His His Arg Arg Leu Ser Leu Thr Asn Gln Ala Asp Gln Pro Thr Glu
215 220 225 230
ctg gag ctg gac tac gac ttc ctc tgc atc ttc ctc gcg tgc cca cgc 2514
Leu Glu Leu Asp Tyr Asp Phe Leu Cys Ile Phe Leu Ala Cys Pro Arg
235 240 245
gtt gag ctc tac aga tca atc gat ctg agg tgc gaa gag atg ctg gcc 2562
Val Glu Leu Tyr Arg Ser Ile Asp Leu Arg Cys Glu Glu Met Leu Ala
250 255 260
gac aca ggt ggc cta ctc tct gaa gcc tcc tgg ctc ctc gac atc ggc 2610
Asp Thr Gly Gly Leu Leu Ser Glu Ala Ser Trp Lau Leu Asp Ile Gly
265 270 275
ttg agt cct ggc atg aac tcg gct acc tgc gca atc ggc tac agg caa 2658
Leu Ser Pro Gly Met Asn Ser Ala Thr Cys Ala Ile Gly Tyr Arg Gln
280 285 290
gcc atg gag tac ttg ctt cag tgt agg cac aac gga ggc agc agc tcc 2706
Ala Met Glu Tyr Leu Leu Gln Cys Arg His Asn Gly Gly Ser Ser Ser
295 300 305 310
cca caa gag ttc ttg gag ttc ctg acc aag ttt cag act gcc tcc agg 2754
Pro Gln Glu Phe Leu Glu Phe Leu Thr Lys Phe Gln Thr Ala Ser Arg
315 320 325
aac ttc tca aag agg cag atg aca tgg ttc cgc aac gag aag att tac 2802
Asn Phe Ser Lys Arg Gln Met Thr Trp Phe Arg Asn Glu Lys Ile Tyr
330 335 340
cag tgg gtt gat gcc tcg cag cct ttc gac gcc att gcg cag ttt atc 2850
Gln Trp Val Asp Ala Ser Gln Pro Phe Asp Ala Ile Ala Gln Phe Ile
345 350 355
tgt gat gct tac cat gac cgt gct gca agg ctg gtt cct gat tca ctg 2898
Cys Asp Ala Tyr His Asp Arg Ala Ala Arg Leu Val Pro Asp Ser Leu
360 365 370
gaa atg aag agg gag agt tgc agg cac gag agc cgt gat ctc aag acc 2946
Glu Met Lys Arg Glu Ser Cys Arg His Glu Ser Arg Asp Leu Lys Thr
375 380 385 390
tac cgt tct gag aac agg gtg ttc cgt ggg gat gat gat tgt tgc cac 2994
Tyr Arg Ser Glu Asn Arg Val Phe Arg Gly Asp Asp Asp Cys Cys His
395 400 405
gtt ttg gat tgg atc aca agg aca cag agg aag tga c ctctactgct 3041
Val Leu Asp Trp Ile Thr Arg Thr Gln Arg Lys *
410 415
ctctcttgtt atctcttttc ccgccaggaa actatcctgc tgctgtgttt ggagatgtta 3101
caataggaaa tttcagcctt tttttgtcag aaaaatacag atacttgttt tgcaaatgtt 3161
ataccaaaag tgttttcaac tttggaattc aatgaaaatt cactagtgtt tcttcagcat 3221
atttctgtct gtattaactc tatgaaaaga agatatatga cattacagct tagagggtgt 3281
tttgcttgtg aatgtgagca tggagtttgc atggtctgaa actgaagttg gaagcatcac 3341
aaattttgtg agattcagag tactaaacag atgggagact tcacttcact tcacttgccg 3401
tgttacctgt atcactcttg ctcggttgtg gacgctgttt gtcaaccttc ttgtacttgt 3461
gctgcagcac ggcaatgtgg ttaatactaa tatttttgta tctgaaatct cccgtagtgc 3521
ttagtgctgt atttgtcaaa gcattgtacc cattactgaa gaagatgtgc aaaaccaaaa 3581
tgtgttgctg tctgcggtcg cattatcttc ctgctttccc ccaatcaaac actatctgca 3641
atttgcaatg gataagagat aaaaacaaaa catagcaaaa ggaagaaaaa gaaaacggcc 3701
gggagattga aagatgactt gttgggctac cagccatgtc tgatactctg atgcatcatg 3761
catatggtac tctcaagcaa ccaacgcaca agtggcagca gagtacatat aattctatcc 3821
ccttgtgtaa ggcaaccgtt ggcatctgat ctgagtatat tactacctcc gtattttaat 3881
gtatgacgcc gttgactttt cgacaacgtt tgaccattcg ttttattcta aaattttgtg 3941
taaatatgaa aatatttacg tcatgcttaa agaacatttg atgatgaatc aagtcataat 4001
aaaataaata ataattacat aaatttttcg aataagacga atggtcaaac attgggaaaa 4061
aaagtcaacg tcatcataca ttaaaatatg gaggtagtac aacatattgt gccagaagaa 4121
gttcctctaa ttacccaaac tgacatggca tatgttgccc tgaaacatgt tgtaaggcaa 4181
ggtcaatgga ttcaattgga agtcagatta aggattaagt agttagcaca actgcaattg 4241
aaggaccaga atatatacaa ggttgaatga ttgcacgtgc tctggactag ctttctggtc 4301
agctctttgg acggtcacaa gctctgaata taacaactgg tgcactttct tgctgatcga 4361
tcattagtca gggatccaac gttgccaatg atctgtagca caactaagga gatcatcatc 4421
atatatatga tggtgcggtt gtaaccgcgt ctgcacctaa ctaaggaaaa agaaacatgt 4481
cgttttcggc tgtagcagag aaagttgcag gacaacccaa aatatgtata gccaacagaa 4541
atactgttcc aaatcttatg gttatatgca atgataccca ccaaacattt tggagggatg 4601
cactcgacat aatttgctct ccatgaaaaa ggcaggagag aaggaaaatg cagaaaagac 4661
agtgcaaaag cagtggtgtc atgtgtgtgc ccaccttgat gtaaagcacc agctcttata 4721
tagcttcaaa agcgtgaaga ttctttgtca aacagcaagg taagtactag tgcttgtcaa 4781
tactttttga agaaaatagg cactccaagg agcagcattt gttttatgcc tacatgctta 4841
ctcttgctat acgagtacat atgagtagta catcatttca ggcctgcttg ctagagctgc 4901
aagaaggaag gagccgcaga tgctcacaag tcatgattaa ggattaatat taatgccgaa 4961
gcttttgcta ggtcttcatc ttttcctttt aaattttttt tgggggggga gatagagggg 5021
attgatctg 5030
<210>56
<211>1254
<212>DNA
＜213〉paddy rice
<220>
<221>CDS
<222>(1)...(1254)
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT6 encoding sequence
<400>56
atg cag tat gga tgc agg cgc ccc gcc gtg tgg aag aga agt tgg tcc 48
Met Gln Tyr Gly Cys Arg Arg Pro Ala Val Trp Lys Arg Ser Trp Ser
1 5 10 15
ccg gct gcc gcc gcc gcc acc aag aac aag gtc atc gtc atc tca ggc 96
Pro Ala Ala Ala Ala Ala Thr Lys Asn Lys Val Ile Val Ile Ser Gly
20 25 30
ccc acc ggc gcc ggc aag acc agg ctc gcc ttg gac ctc gcc aag agg 144
Pro Thr Gly Ala Gly Lys Thr Arg Leu Ala Leu Asp Leu Ala Lys Arg
35 40 45
ctc tcc ggg gag atc atc agc gcc gac tcc gtc cag gtc tac cgg ggc 192
Leu Ser Gly Glu Ile Ile Ser Ala Asp Ser Val Gln Val Tyr Arg Gly
50 55 60
ctc gac gtc ggc tcc gcc aag ccc tcc tct tcc gac agg gcc gcc gtg 240
Leu Asp Val Gly Ser Ala Lys Pro Ser Ser Ser Asp Arg Ala Ala Val
65 70 75 80
ccg cac cac ctc atc gac atc ctc cac gcc tcc gac gac tac tcc gcc 288
Pro His His Leu Ile Asp Ile Leu His Ala Ser Asp Asp Tyr Ser Ala
85 90 95
ggg gac ttc ttc cac gac gcc cgc gca gca acc gac cac ctc ctc gcc 336
Gly Asp Phe Phe His Asp Ala Arg Ala Ala Thr Asp His Leu Leu Ala
100 105 110
cga gcc cgc gtc ccc att gtc gcc gga ggg act ggc ctc tac ctc cgc 384
Arg Ala Arg Val Pro Ile Val Ala Gly Gly Thr Gly Leu Tyr Leu Arg
115 120 125
tgg tac atc tat ggc aag ccc agt gtc ccg cag tct tcc atg gac gtc 432
Trp Tyr Ile Tyr Gly Lys Pro Ser Val Pro Gln Ser Ser Met Asp Val
130 135 140
acc tcc gcc gtc tgg tcc gag ctc tcc cgc ttc cgg gac acc ggc cgc 480
Thr Ser Ala Val Trp Ser Glu Leu Ser Arg Phe Arg Asp Thr Gly Arg
145 150 155 160
tgg gaa gaa gcc gtc gac ctg gtt gcc aac gcc ggc gac ccc aaa gct 528
Trp Glu Glu Ala Val Asp Leu Val Ala Asn Ala Gly Asp Pro Lys Ala
165 170 175
cgg gac ctg tca gtc aac aac tgg tca agg tta agg aga agc ctt gag 576
Arg Asp Leu Ser Val Asn Asn Trp Ser Arg Leu Arg Arg Ser Leu Glu
180 185 190
atc atc agg tct tca ggc tca cct ccc tct gcc ttc tcc ttg ccc tac 624
Ile Ile Arg Ser Ser Gly Ser Pro Pro Ser Ala Phe Ser Leu Pro Tyr
195 200 205
aat gct tac aat ctc aat cac cac cgt cgt ctc agt ctc acc aac caa 672
Asn Ala Tyr Asn Leu Asn His His Arg Arg Leu Ser Leu Thr Asn Gln
210 215 220
gcc gat caa ccc acg gag ctg gag ctg gac tac gac ttc ctc tgc atc 720
Ala Asp Gln Pro Thr Glu Leu Glu Leu Asp Tyr Asp Phe Leu Cys Ile
225 230 235 240
ttc ctc gcg tgc cca cgc gtt gag ctc tac aga tca atc gat ctg agg 768
Phe Leu Ala Cys Pro Arg Val Glu Leu Tyr Arg Ser Ile Asp Leu Arg
245 250 255
tgc gaa gag atg ctg gcc gac aca ggt ggc cta ctc tct gaa gcc tcc 816
Cys Glu Glu Met Leu Ala Asp Thr Gly Gly Leu Leu Ser Glu Ala Ser
260 265 270
tgg ctc ctc gac atc ggc ttg agt cct ggc atg aac tcg gct acc tgc 864
Trp Leu Leu Asp Ile Gly Leu Ser Pro Gly Met Asn Ser Ala Thr Cys
275 280 285
gca atc ggc tac agg caa gcc atg gag tac ttg ctt cag tgt agg cac 912
Ala Ile Gly Tyr Arg Gln Ala Met Glu Tyr Leu Leu Gln Cys Arg His
290 295 300
aac gga ggc agc agc tcc cca caa gag ttc ttg gag ttc ctg acc aag 960
Asn Gly GlV Ser Ser Ser Pro Gln Glu Phe Leu Glu Phe Leu Thr Lys
305 310 315 320
ttt cag act gcc tcc agg aac ttc tca aag agg cag atg aca tgg ttc 1008
Phe Gln Thr Ala Ser Arg Asn Phe Ser Lys Arg Gln Met Thr Trp Phe
325 330 335
cgc aac gag aag att tac cag tgg gtt gat gcc tcg cag cct ttc gac 1056
Arg Asn Glu Lys Ile Tyr Gln Trp Val Asp Ala Ser Gln Pro Phe Asp
340 345 350
gcc att gcg cag ttt atc tgt gat gct tac cat gac cgt gct gca agg 1104
Ala Ile Ala Gln Phe Ile Cys Asp Ala Tyr His Asp Arg Ala Ala Arg
355 360 365
ctg gtt cct gat tca ctg gaa atg aag agg gag agt tgc agg cac gag 1152
Leu Val Pro Asp Ser Leu Glu Met Lys Arg Glu Ser Cys Arg His Glu
370 375 380
agc cgt gat ctc aag acc tac cgt tct gag aac agg gtg ttc cgt ggg 1200
Ser Arg Asp Leu Lys Thr Tyr Arg Ser Glu Asn Arg Val Phe Arg Gly
385 390 395 400
gat gat gat tgt tgc cac gtt ttg gat tgg atc aca agg aca cag agg 1248
Asp Asp Asp Cys Cys His Val Leu Asp Trp Ile Thr Arg Thr Gln Arg
405 410 415
aag tga 1254
Lys *
<210>57
<211>417
<212>PRT
＜213〉paddy rice
<400>57
Met Gln Tyr Gly Cys Arg Arg Pro Ala Val Trp Lys Arg Ser Trp Ser
1 5 10 15
Pro Ala Ala Ala Ala Ala Thr Lys Asn Lys Val Ile Val Ile Ser Gly
20 25 30
Pro Thr Gly Ala Gly Lys Thr Arg Leu Ala Leu Asp Leu Ala Lys Arg
35 40 45
Leu Ser Gly Glu Ile Ile Ser Ala Asp Ser Val Gln Val Tyr Arg Gly
50 55 60
Leu Asp Val Gly Ser Ala Lys Pro Ser Ser Ser Asp Arg Ala Ala Val
65 70 75 80
Pro His His Leu Ile Asp Ile Leu His Ala Ser Asp Asp Tyr Ser Ala
85 90 95
Gly Asp Phe Phe His Asp Ala Arg Ala Ala Thr Asp His Leu Leu Ala
100 105 110
Arg Ala Arg Val Pro Ile Val Ala Gly Gly Thr Gly Leu Tyr Leu Arg
115 120 125
Trp Tyr Ile Tyr Gly Lys Pro Ser Val Pro Gln Ser Ser Met Asp Val
130 135 140
Thr Ser Ala Val Trp Ser Glu Leu Ser Arg Phe Arg Asp Thr Gly Arg
145 150 155 160
Trp Glu Glu Ala Val Asp Leu Val Ala Asn Ala Gly Asp Pro Lys Ala
165 170 175
Arg Asp Leu Ser Val Asn Asn Trp Ser Arg Leu Arg Arg Ser Leu Glu
180 185 190
Ile Ile Arg Ser Ser Gly Ser Pro Pro Ser Ala Phe Ser Leu Pro Tyr
195 200 205
Asn Ala Tyr Asn Leu Asn His His Arg Arg Leu Ser Leu Thr Asn Gln
210 215 220
Ala Asp Gln Pro Thr Glu Leu Glu Leu Asp Tyr Asp Phe Leu Cys Ile
225 230 235 240
Phe Leu Ala Cys Pro Arg Val Glu Leu Tyr Arg Ser Ile Asp Leu Arg
245 250 255
Cys Glu Glu Met Leu Ala Asp Thr Gly Gly Leu Leu Ser Glu Ala Ser
260 265 270
Trp Leu Leu Asp Ile Gly Leu Ser Pro Gly Met Asn Ser Ala Thr Cys
275 280 285
Ala Ile Gly Tyr Arg Gln Ala Met Glu Tyr Leu Leu Gln Cys Arg His
290 295 300
Asn Gly Gly Ser Ser Ser Pro Gln Glu Phe Leu Glu Phe Leu Thr Lys
305 310 315 320
Phe Gln Thr Ala Ser Arg Asn Phe Ser Lys Arg Gln Met Thr Trp Phe
325 330 335
Arg Asn Glu Lys Ile Tyr Gln Trp Val Asp Ala Ser Gln Pro Phe Asp
340 345 350
Ala Ile Ala Gln Phe Ile Cys Asp Ala Tyr His Asp Arg Ala Ala Arg
355 360 365
Leu Val Pro Asp Ser Leu Glu Met Lys Arg Glu Ser Cys Arg His Glu
370 375 380
Ser Arg Asp Leu Lys Thr Tyr Arg Ser Glu Asn Arg Val Phe Arg Gly
385 390 395 400
Asp Asp Asp Cys Cys His Val Leu Asp Trp Ile Thr Arg Thr Gln Arg
405 410 415
Lys
<210>58
<211>8306
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT10 genome sequence (011410_2)
＜221〉exon
<222>(2001)...(2675)
＜221〉exon
<222>(3415)...(3438)
＜221〉exon
<222>(3922)...(4065)
＜221〉exon
<222>(5392)...(6306)
<400>58
tagagacata tgggaagatc tctcaccgag aaactgatcc atgagtttaa gcaaaactgg 60
tcattataat aaagaaaaat ctacaaaatt actgttgtta attcccttga actactgtca 120
tcaagaaaga ttggttgatg atggacatgt ccgcagcaat ggagggtcac cgcgtcgtct 180
ccatcggcag cgagatctgc gagcaggatc acgccggcgg cgaccagcgc tccaccgccg 240
gcgacgatgg cgacggcgac ggtgacggcc cttacgtctc cctcttcgag ctcgcgccca 300
tcgtggcgcg cgcaccgcag gacgaggacg gacacggcca ggaagacagc catgcccaag 360
aggtgttcga tgacctgccg gccgagctgc ggcgcgacgg cgacggcgcg ctgaccgtgg 420
gcgggctcgc agcggcgctc cgggcgcagc ggagggagct ggaggccgtt cgcgccgagc 480
tcgacggcga gcggcgcgcg ggcgcggagg cggcggagta ccagcggcag ctggaggagc 540
agggggagtt cgaccgggag gcggtgcgcc tcgccatgca gctcgtccac gaggccgaga 600
cggagaagca cgccctgcag caccagctcg acgcgttccg ggtcaaggcc cagctctacg 660
actacgaggc cgccgccacc gccgccgcca gggaccacga cgcggccggc gacggcggcg 720
gcggcggcaa caactaccag tcgctggtgg acttcttgcc ggggtcggtg ttctcctcct 780
cgccggacct ggccaacctg ctcaagctct acaccgaggg caatggcggc ggccgtcgac 840
tgaccgacgc gccggtgccg gtggtcaccg aggtggttga ggaagaagag gaagaggagg 900
aggaggagga ggaggaagtc gccgtcgcgg ccatcggtgg cgtggattcg aacgggaacg 960
gtggtgctgc cgccaccatc gccatcgccg gcgattcttt gcaggaagga agcagtgatc 1020
acctcgaacc cacagaagtg tcaccgcaac ggtgaattgt gaatcttggg attaatacaa 1080
ccttgtcaat atatacatat catgtaatta tatttgacta gccacatgtg cccgcgcttc 1140
gttgcggatc atgaatttgt aaattaccgt agtaaagaaa gttttttcta atatgtatac 1200
tgatccattg tttaaatggc tgcaatatat tttattactt aatgataccc cacgcgttgt 1260
tgcagaaaat tctcaaattt tagttattgg gtagaatgta caacctaatg ctaaaaagtt 1320
agagaaacaa aatgattttt tggaccaata attgtgtgaa tagcgtaagt caaattctaa 1380
aaataattta ggtaacacat tttagcagaa acttcaaaag atgtacatac tttgaggtca 1440
tgagttaaca tacaatgttg tactgtatta ttcatcaaat attgtcacaa tgtagcttac 1500
tcatagatat aagattgtat gtatctagtg agggacaatt tatattgttc actaacatct 1560
aatattgttc tcggaatggt atccagagaa atttttatga tttagaataa aatggaacaa 1620
tgttgtataa atctataaaa atataattgc ttaattattt atatgcttag atttggcacc 1680
tctaaatgtg gcctaactac cattggacca cagtaagtag gggctcataa agatgcatcc 1740
cctataaaag ccaagggaca ccgagagtcc tctacggaag aattctaccc ttcccattag 1800
gacagtcaaa caccttattg ctactccaat cttcctttca gtatggagaa ctcctcaaag 1860
aaaacccaag agttcttccc taaaggtggg aatggaggtt atgctgagca gctggatctc 1920
ttgctgaagc agcttcgttt tcctaacaac cgatccacca tgcggagcaa gtgatcaaag 1980
gattccagaa ggattggacg atgaagatct acattcaagc cagggaagag aagtgtcaag 2040
gacatgtgtt caagtcccgc caccttcgag ccaacaaaga ggcagcactc caggatgcgt 2100
cgcgtgaggc attcatgcgt ctatgtaaga tctacagcat cgaggttgcg agtactccgt 2160
tctttctaca tccattccgt gaatgcggtg accgccgctg ccatattcgg aaatttaggg 2220
gctttgagga gcactctccc atccacttct ccatgtggat gtgggctgca gacgaggcct 2280
atgaggaggc cttagaggaa ttagatatgc ttcggtcaaa gattgccggc tgggaggagc 2340
ggtacaacca ccttgctaaa gaacacacca ctcgtggaca actattggaa gcaatcaagc 2400
ttcgcctcca gtggtatttt cgaaccccat ctcaagctca aatccaacgg actttgtcac 2460
caccaccaca aagagtgaca agaagtgatg gtgaggacta tagtcaaatc aatgcacagc 2520
aggcatgtct ggaaaggtcc gaagttaaac ttgatagggc aacttcacaa gactatctgc 2580
aaggatacaa gcccccatca gaatccctcg acgctattgt ttggcctctt gttgaaggga 2640
agcatgacaa tacaagcagc ggtaggagga atgaggtaaa ggaaactgct cacaataacc 2700
aagggaccct gttgggctag tcctcggaaa gagagttgga ccagctacat atctagaaga 2760
ccacaatgta agtgacaggg ctatatcttg tcacgtagga gtagcatgtg ggtgggagtt 2820
ggaccaattt cacatatagg agaccgctat gtaagtgaca ggttatagcc tgtcacctag 2880
cagtactatg tgggtggtca agatcaccta tcaagtgtgc ttgtctatgc ctagttgtga 2940
cctaccagtt agagtagtat gtgagggtgg tagtaagatt gtattccctt tgtccagttg 3000
tgggtggaca agctaggcgg atagtctagt gtgtttgtgt atgcgtggtt gtgatgcttt 3060
tgtgcttggc ccgaggacaa tgagcaatat ttgcttaaaa gtgcttgttt tcttctgcaa 3120
tgctactttg ttttcatgat catgcaagtt acctaaatac atgtgaattg ttctagttga 3180
tgggatctat tgcgatagaa tcaaatgatt tccaattgta tagtaacgga gctagcaaca 3240
gtaatataac cattttgacc aggatggttc aaaagtaaac catatagaaa aggagttgtt 3300
tattaaatat atgtattgta tcaactaaaa tagtacacaa tggccaataa ttttgcaatg 3360
aatttagttg ataattggca tggtatggtt tttttttttt tttgcttttt gcagaaggca 3420
tgggaaatgg caaaacaagt aaatatatta caaagtaatt tctaacgatt gttagtaacc 3480
ggaagatggt tggtattaga ttaccaagtt tggaagtatt attttaccag agaacgtata 3540
agtaacatgt atattgttcg aagtgcccac atttgaattt acattcgatg aaggattgtt 3600
atgtaatttt tccttgaaaa atgtgcaaaa gcacatgttt acaaatcatc accatatctt 3660
aagatgaaag taggcataag gtttaaaaag tcaaaggtaa ttattaggtt tatttttttg 3720
ttatgcttac acacgtattg acgatacaaa ggtttgagcc attaactctg atgcctaaaa 3780
atatcttcaa agaaaaaaaa tcgatcacaa ttgcttgaat aatagtaaga gtatacctaa 3840
ctgaatttgg ggcccaccaa tataattacc gtacacatcc aactgcacat ggattgatag 3900
gccaaattac tataattgga ggtgcctaga ggaaggattt atgctttggt ctataaacat 3960
caagacaata ttggactggt ccttgaaaag agagttggac cagctgcaca tctaggagac 4020
cgctatgtaa gtgacagggt catatcacat ctaggagacc tctatgtaag tgacagggtc 4080
atatgttgtc acctaggagt agtatgtggg taagagttgg accaacttca catataggta 4140
accgctatgt aagtgatagg gtcatagcct gtcacctagc agcactatgt gggtgatcaa 4200
aatggcctct ctggtgtgct tgtctatgcc taattgtaat gcttttgtgc ttggctcgag 4260
gccaatgagt aatgtatgct tgaactgcta tgtaagcgac agggtcatag cctattagtt 4320
agagtagtag gtgagggtgg taataaaatt gtattccctt tgtctagtta tgggtggaca 4380
aggtgggtaa tctagtgtgt ttgtgtatgc gtggttgtga tgcttttgtg cttggcccga 4440
ggataatgag caatatttgc ttaaagttgc atgttttctt ctccaatgca ggtttgtttt 4500
catgagcatg caaattatct aaatacatgt gaattgttct agttgatggg atctattgcg 4560
atagaatcaa atggcctcta atcgtatagt aacagagcta gcaacagtaa tataaccatc 4620
ttaaccagga tggttcaaaa gcaaaccata tataaaagga gttgtttatt aaatatatgt 4680
attgtatcaa ccggaatatt acacaagggc taataatttt gcaatgaatt tatttgataa 4740
ttggcattgt atggctattt tgttttttgc attttgcgga aggcatgaga aatgccaaaa 4800
caagtaaata tagagcaaag tattttacaa cgattgttag taagtatttt tgaggtagat 4860
ggttggtatt atattaccaa gtttcaaagt attcttttac cagagaacat ataagtaaca 4920
tatgtatgat ttgaattgcc cacatttgaa tttactttcg atgaaggatt gatacggatt 4980
ttttttcctt gaaaaatgtg taaaagcaca tgtttacaaa tcatcaccat attaagatga 5040
aagtaggcat attgtttaaa aagttaaagg agcttatcag gtttaatttg ttttatgctt 5100
acacacgtat tgaggataca attttaaggg ttgagccgtt aactcttatg ccaaaaatat 5160
ctccaaagaa aaaaaatcga tcacaattgc ttggataatt gtatgagtat atctaattga 5220
atttgggccc catcaagatg attaccatac acattcaact gtacatggat tgatatgcca 5280
aattccggta agtggaggtg ccaagaggaa ggaggaagga tttatgcttt gatctagaaa 5340
catcaaggcg gcacactttc ccctttccta tatactgagg aactcttcca ggtaatacga 5400
acccttagct actttccttt catgctcaat tttcaccctt cttgtgattg cttcctcaat 5460
atgctgggaa acaagttagt agtgattatt ggtgccacgg gaactggaaa aacaagactc 5520
tcaattgaga ttgccaaggc gattggtggg gaagtggtaa atggtgacaa gatgcaaatt 5580
tatgatggcc tggatattac gacaaacaag gtttctttac aagatcgatg cggcatacct 5640
catcacctta ttgcgtccat ccctcacaac gcaggtgatt ttcctgtgtc attttttcga 5700
tatgctgcaa aaaccacaat aaactgcatt gccagacgtg gtcacacacc gattgtggtg 5760
ggtggatcta actcacttat ccatggtctc cttgttgaca attttgattt gtctattgtg 5820
gatccttttg ggcaattgga ggttagctat cagccgacgc ctcaatggca atgttgtttt 5880
ctatgggttc atgttaatga ggtgattctt aatgagtatt tgaaacgtcg tgttgacggc 5940
atggttgatg ctgggttagt tgaggaaatt gaagaatatt ttgacacatt atcagttaat 6000
ggacatgttc catatgtggg attagggaag gccattggtg ttccagagct aagcgagtat 6060
tttactggac gggtgagttg tagtgatgct ctttctatga tgaagaccaa tacacagatt 6120
cttgcacgat ctcaagtcac aaagattcat cgcatggttg atgtgtgggg atggcatgtt 6180
catgcccttg attgtactga aactattcta gcacatctta ctggatcaaa taagtatatg 6240
gaggatttgg tgtggaaacg tgatgtaagt gactctggac ttgctgctat acaagatttt 6300
ctgtgataat atcagaagat gggaagctag tttctcaaac acatcggcta ttgattttgt 6360
ctacaataat ggtttaatcg tctggcttgc ttagtaattt tacagatcat ggcatactaa 6420
gttaacttgg atcattttgg gtgtgtttgg aaggagcaaa cgtcaattgg tgtatatgaa 6480
attacttgga ggccttttgt accttaaaca cttggatgcc ttttatttta cataatagtt 6540
atatatagtt gttgttcata attttttgat gtcatcaata ttcatacgtg gtgatgcaat 6600
tcttattgat tatctctaat agatatgatg tcgtgccaac aaaaacaaca aacatggaag 6660
tcacaaatag tcatataaga aaataataga gggttcccag ttgttcatgc accaagctta 6720
atacaaatag gaaataaaca tgatagtcca atgacaatgg accaagttta gagtagcacc 6780
acacacaatg cttgttcact tactgataca acataaataa taaagagtta agtatgacaa 6840
cacaaaaaac atcccctgca acaaagagcc cacatagaga gtatacataa aatccaaaaa 6900
caatgttttt gttaaatctc tggttgggaa gtaattattt gtcattacag tcgaaatttt 6960
caaacttgaa aacttaacca taggaatttt tggagagccc agcctttgag gatggactta 7020
gaatttggag gaaattttct aagaggttga taaacccaaa cctcaagatt caaatatttg 7080
gatcaagact tttgggcttg ggatttggtg tttgaagaaa cagcgggatt tgagagtact 7140
ggcacataat cctaaataca ctcaaagaat caaaagattt taaacatagg tttcaaataa 7200
aaaaaatcaa ccgaggcaaa acccaaggcg ttgcaatcct accccctatt aatagaatct 7260
cgtcttgaga tttcggccaa agaagggtag cagaatgttg ttgtggctcc tgttcagtga 7320
taggctcaat accagggaca tgttggatag aagacattgt gcaaaggaag atgatgatct 7380
aacatgtgtt gtgtgtaatg gtgagtgtag agaaactcgg cttcatctct tttctgccta 7440
ccctagcatc agatgtaggc aacacttggg aattgaatgg aaacataacc tggaattttt 7500
cccaacggtt gttctcgcga gattgaggtt tggtcggaga ggttttctgg aaatattttt 7560
tatagcctca tggcatattt ggaaacagag aaagaggctt attttccaaa atatcctgcc 7620
tatgttccag tcttggaggt tgctttttgt gaatgaagtt cttctacata tgtgtagaat 7680
gaaggatcct ctaaaacaat ctgtttttga ttggttacaa accttatagg ttttgagttt 7740
tccctgtaat tgttttaatg aaaatacact gctaggcaaa gccctggcag tatttgcagt 7800
taaaaaaata gggtccttga aatgatacat ggtctatgtg ctgacctttt cctttggtga 7860
ttgaggcatt cctatcccat cttttactga gtgatacatg ggccactgtt tgacccaaaa 7920
tttttgaact caagtgtcga ctctgaactg atactgtctt tgttgagaat ctaaagttct 7980
tctttggtgt cagtgctggt gttgttatgt cctgatcggg caataatggg gacctctatt 8040
tggacgtgtt gtggccatat cctgcatcct tgccggttgt tatgatagtc attcggggta 8100
ttcgagatca tttctcagcc tctatacatg ttcaccaaca tacttttttt ttacctcgtg 8160
cacttgggta cccatttcat tgagcgcacc cttatcttcg ggggcccatc tctgtctcct 8220
tggagtggtt ttggtcgtgc acgcgggtgt ggcgagtgga ggcggtgtag ctcgggcgag 8280
gcgaaaaaat ggagcggagg ttcgac 8306
<210>59
<211>585
<212>PRT
＜213〉paddy rice
<220>
<221>CHAIN
<222>(0)...(0)
＜223〉OsIPT10 aminoacid sequence (011410_2)
<400>59
Met Lys Ile Tyr Ile Gln Ala Arg Glu Glu Lys Cys Gln Gly His Val
1 5 10 15
Phe Lys Ser Arg His Leu Arg Ala Asn Lys Glu Ala Ala Leu Gln Asp
20 25 30
Ala Ser Arg Glu Ala Phe Met Arg Leu Cys Lys Ile Tyr Ser Ile Glu
35 40 45
Val Ala Ser Thr Pro Phe Phe Leu His Pro Phe Arg Glu Cys Gly Asp
50 55 60
Arg Arg Cys His Ile Arg Lys Phe Arg Gly Phe Glu Glu His Ser Pro
65 70 75 80
Ile His Phe Ser Met Trp Met Trp Ala Ala Asp Glu Ala Tyr Glu Glu
85 90 95
Ala Leu Glu Glu Leu Asp Met Leu Arg Ser Lys Ile Ala Gly Trp Glu
100 105 110
Glu Arg Tyr Asn His Leu Ala Lys Glu His Thr Thr Arg Gly Gln Leu
115 120 125
Leu Glu Ala Ile Lys Leu Arg Leu Gln Trp Tyr Phe Arg Thr Pro Ser
130 135 140
Gln Ala Gln Ile Gln Arg Thr Leu Ser Pro Pro Pro Gln Arg Val Thr
145 150 155 160
Arg Ser Asp Gly Glu Asp Tyr Ser Gln Ile Asn Ala Gln Gln Ala Cys
165 170 175
Leu Glu Arg Ser Glu Val Lys Leu Asp Arg Ala Thr Ser Gln Asp Tyr
180 185 190
Leu Gln Gly Tyr Lys Pro Pro Ser Glu Ser Leu Asp Ala Ile Val Trp
195 200 205
Pro Leu Val Glu Gly Lys His Asp Asn Thr Ser Ser Gly Arg Arg Asn
210 215 220
Glu Lys Ala Trp Glu Met Ala Lys Gln Val Pro Arg Gly Arg Ile Tyr
225 230 235 240
Ala Leu Val Tyr Lys His Gln Asp Asn Ile Gly Leu Val Leu Glu Lys
245 250 255
Arg Val Gly Pro Ala Ala His Leu Gly Asp Arg Tyr Val Ser Asp Arg
260 265 270
Val Ile Ser His Leu Gly Asp Leu Tyr Val Ile Arg Thr Leu Ser Tyr
275 280 285
Phe Pro Phe Met Leu Asn Phe His Pro Ser Cys Asp Cys Phe Leu Asn
290 295 300
Met Leu Gly Asn Lys Leu Val Val Ile Ile Gly Ala Thr Gly Thr Gly
305 310 315 320
Lys Thr Arg Leu Ser Ile Glu Ile Ala Lys Ala Ile Gly Gly Glu Val
325 330 335
Val Asn Gly Asp Lys Met Gln Ile Tyr Asp Gly Leu Asp Ile Thr Thr
340 345 350
Asn Lys Val Ser Leu Gln Asp Arg Cys Gly Ile Pro His His Leu Ile
355 360 365
Ala Ser Ile Pro His Asn Ala Gly Asp Phe Pro Val Ser Phe Phe Arg
370 375 380
Tyr Ala Ala Lys Thr Thr Ile Asn Cys Ile Ala Arg Arg Gly His Thr
385 390 395 400
Pro Ile Val Val Gly Gly Ser Asn Ser Leu Ile His Gly Leu Leu Val
405 410 415
Asp Asn Phe Asp Leu Ser Ile Val Asp Pro Phe Gly Gln Leu Glu Val
420 425 430
Ser Tyr Gln Pro Thr Pro Gln Trp Gln Cys Cys Phe Leu Trp Val His
435 440 445
Val Asn Glu Val Ile Leu Asn Glu Tyr Leu Lys Arg Arg Val Asp Gly
450 455 460
Met Val Asp Ala Gly Leu Val Glu Glu Ile Glu Glu Tyr Phe Asp Thr
465 470 475 480
Leu Ser Val Asn Gly His Val Pro Tyr Val Gly Leu Gly Lys Ala Ile
485 490 495
Gly Val Pro Glu Leu Ser Glu Tyr Phe Thr Gly Arg Val Ser Cys Ser
500 505 510
Asp Ala Leu Ser Met Met Lys Thr Asn Thr Gln Ile Leu Ala Arg Ser
515 520 525
Gln Val Thr Lys Ile His Arg Met Val Asp Val Trp Gly Trp His Val
530 535 540
His Ala Leu Asp Cys Thr Glu Thr Ile Leu Ala His Leu Thr Gly Ser
545 550 555 560
Asn Lys Tyr Met Glu Asp Leu Val Trp Lys Arg Asp Val Ser Asp Ser
565 570 575
Gly Leu Ala Ala Ile Gln Asp Phe Leu
580 585
<210>60
<211>7608
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT9 genome sequence (005021_3)
＜221〉exon
<222>(2001)...(3079)
＜221〉exon
<222>(3322)...(3390)
＜221〉exon
<222>(4363)...(4436)
＜221〉exon
<222>(5516)...(5608)
<400>60
taatgttatg atctgctcgc tccatttaaa agtcttaagc atatttttta tattttttaa 60
taaatgagat ggtcatattt atattcaaga cttaaatgta gagattatct tttcatattg 120
tcgcagtgct aaattaaatt attgatccga acccaagtag ttatcttaat atatatttat 180
atgttgtata tattagtgta gcttttttta atttgttaca tgtgcattga gttgattttt 240
tcatggtttt gattatagaa aatgagaaaa ttgtaatatt gtgacctaaa ttttttggat 300
agagggagta tgaccggtga aatctccaaa actactgcag ggtaggagta ctcgtagtac 360
ttctaaccag cctgaccaca ttcaaacgca cagtagtaca gtacttggag gacattcaag 420
tcacagtaca caaatgtttc cagcacaata aaactacttg gaacagtact gtgggcagca 480
gctctttgca ggccgcaggc gagtacagat ggaccctcat cgaaacgaaa cgaaacccat 540
gccaagaacc tgcgtgctct ttgatgagcc agtcattcct cgaggcatct tttcatcaga 600
tcagaattca gagcctcgcg agaaagaaag gctggcccaa tcctgcagct gcacagatcc 660
cagcagctgc agctgtagct gtagtagtag ctgtagtcga tcgacagtgt ccgagccaat 720
ccatcgccgc aaacaagcca aggggaagaa atatatatag ccctggccac gtactacgta 780
ctagcctctg ccgatctgcc atgggcgcta gtatagccat gtgaccgtgc gagagtgcaa 840
gtgatgggta cagacgttgt tagcaccaat ctgggaggct tatctccaaa cccccaaatt 900
ctctccattc cattgccgtc cgtcgtgtgg ctgccgcacg ctggaggggc agcggcaatc 960
gctagattta cgagggtccc acggcgcagt ggcacgacga cgcagcaccg tccgggattt 1020
tcaacggcac ccgaacctgg gcgtatcaat cgctttgtct cccggaaaag agaacgacat 1080
gggatcgtat taccccaagc gtcgccgatg atcgccaaaa gtcaaaaaaa cgtatcaccg 1140
tccaccgacc gaaccgaggt cgctaccacg tactaccagt agtagtagta gtagtacgcg 1200
gactcgcgac cagccagccg ctcgggttgt ctcctctttt ttttttttct tgccgggatg 1260
ggagcgtgca ccggtggctg cactcaccgt caccggccag tagtctaggc gacacacgaa 1320
gcggcggcct gcgtcgccga aaggcggggg aaaaccccga aaatacagga gaattctgcg 1380
tttcccgcgg gcgcgagagc ccgcgacccc gcgcacggtg agacagggac cacgaccccg 1440
cgcgaactcc cccttcaggt ggacgaccaa cccagcccag ccagccgcgc gggggtttgt 1500
agctttgccg aatccaacgc ttgcacacac caccgcggcg ccgtatgccg ggtcccccac 1560
ttgcattcca cccggtcgtc gcgtcgcgtg atcgcgtcac gtcccggcgc gccaggatac 1620
gggtgcttgg ctccgcctcc ggcttattat ttaagcacgc gacgccgcgg ccatgtctag 1680
tctcctcggc tgctactact actgcgttgt gcgcacaatg ccaagcgacc cactactgcc 1740
ctgcgtctgc gtgtgccgcg tatccgcaca agccaaagag aatttttagg cgggtagaaa 1800
caaaaatcag acccagtttc gcgcaaaaaa aaaacaaaga gaagcccggg ggtaagagag 1860
agagagagaa tttgagagat gtgagacgga agcaacaagc acatgagcgt tttgtgatta 1920
ggaacggaca aaacaaggtc ataaggcggc ctaatcagga ttggaggaga ggtctagtct 1980
ccctttctag tttcccctac atgaccagcg ttgccaccag gattgccacg ctcgtgcggg 2040
ccgcggcggc ggcgagccgg ccattgcggc tccaccgccg gcccggcggc gaggatacga 2100
ggatggtggt gatcgtcggc gccacgggca ccgggaagac caagctgtcc atcgacgccg 2160
ccaaggtgat cggcggcgag gttgtcaacg ccgacaagat tcagctctat gacggcctcg 2220
acgtgaccac caacaaggtg agcctcgccg accgccgcgg cgtgccgcac cacctcctcg 2280
gagccatccg ccccgaggcc ggcgagctcc cgccgtcgtc cttccggtcc ctcgccgccg 2340
ccacggccgc gtcgatcgcg gcgaggcggc tcgtgccggt catcgccggt gggtcgaact 2400
ccctcatcca cgccctcctc gccgaccact tcgacgcctc cgctggcgat cccttctccc 2460
ccgccgccgc cttccgccac taccgcccgg cgctccggtt cccgtgctgc ctgctctggg 2520
tccacgtcga tgaggcgctc ctcgacgagt acctcgaccg ccgcgtggac gacatggtgg 2580
acgctggcat ggtcgaggag ctccgggagt acttcgccac gacaaccgcc gcggagcgcg 2640
ccgcgcactc cgggctgggc aaggccatcg gcgtccccga gctcggcgac tacttcgccg 2700
ggcgcaagac cttctccgag gcgatcgacg acatcaaagc caacacccgc gtcctcgccg 2760
ccgcgcaggt gtccaagatc cgccgcatgt ccgacgcctg gggctggccc atccaccgcc 2820
tcgacgcctc cgacacagtc cgcgccaggc tcacgcgggc gggctccgcc gccgagtccg 2880
cctcctggga gcgcgacgtg cgcggcccag gcctcgccac catccgcagc ttcctcgccg 2940
atcagtcacc gccaccgcgc agcgagggca ccaacgacta cctgtacgcc atggagacgg 3000
aaccagagcc gccgccgccg ccgacgttgc cgccgcggct gctccggttg ccgcggatgc 3060
agtactgcga catggtgggg tgagctcgcc gccgccgccg ccgccgccgc acggcgccgc 3120
agtcacttca ttgaaggctt ttgggggttc gagggtttag gccgccaatt ttccagtgtc 3180
ccggcggcgc ccttctctga cactgctcgg tgggcccaga aaaagcagcc agtgacatag 3240
aaagaagaga caaaggtaat taacgtagag agagagaagc taagctatgc aactgatgag 3300
aagtgttctt cttcattgca gcagaatttg tgtactcttt cttggagagg tggtgattca 3360
tcacatcgct ctcctcctaa ccgcggcact gtatgtatgt agtgagtagt actaatcatc 3420
taattatcca ccgtgttcag aattttgaga cagataatga gtacagtcta gtatatgatt 3480
tttcatcagt gtttgttgca gtgcaacggg tgacctgctc tatttccgga gctgaatttt 3540
ttttggtttg gttttgtttg ttttgtttgt ttaattaatc ctcctcctcc tcctgctgct 3600
gctgctagta gtagtagttt gaggtggcta atgccatggt ggatgcttga catgttccat 3660
ccattttcca gctggttgtt gttgggatga ttggatgggt aatgccacgc ttagtgtgtg 3720
atttctgatc gagggggaga aggattgtgt tgggcgtgtg ggttggtgcc tggtgttctt 3780
gctgttgcca gctaggaaca aacaaattcg tccccgtctc ctactctttt ttctttcttt 3840
ctttctttct ttctttcttt ctttctgttt tttttttctt ttacccctcc tctccagttt 3900
tcccgtacgg tcaaagagct ggaattcagt ggcattacga ttttcactct cttttggatt 3960
gttttctttc ttgtttggat tctacagcag cagtctaccg catcagattt tcagcatcgt 4020
tttatactgt cgcggacttc aggcattgga tactcgcttc cagaagtttc tggtcatttt 4080
tttctttttc tttttcaaaa aaaattgcac ttcacatggt cggttggtac gcgtatgtgt 4140
acgttgtatg cagagttgta cattgtttta tgcgtatgta taccttgtag gcgacacgtc 4200
cgacataacc caggcttttt atacactgtc atcgatcacc tgccctcaaa tcgccatgat 4260
tagcagcaat gcaagtactg tgttttgctc gaagcggttc tactgtaata taatgtcgca 4320
gtactatacc actgctctat ggtactgtac tccctatttc agtatactcc agtccagtac 4380
ttttgcctgt accatcgctg cagtgtacga atgccaagtc tcctggataa tcgcaagtaa 4440
gcagattctt ggggacggct cggcccaaat agaatgcagc atcgcaaccc tgaagaagcc 4500
cagcaactgc cgtcaagctg tcatacggct atttcactac tcctttcatt tcatcctaaa 4560
atatactccc tccgtttcac aatgtaagtt attctagcat tttccacatt tatattgatg 4620
ttagaaagtg aaacggagga agtaaagaat tatacccttt aaatttatat gaaaatataa 4680
gtaattttgt aatcccaaga cagtacttta ttcctcactt atcatctttt atatagttta 4740
tttttcactt atcacctttt gtattgatgg atttcccgtc taatcacttt tttactactt 4800
tgttcttcca accatttgta tcgtgatttg ttcttttact attatcttaa tttttgtaaa 4860
aacaaatagt agaatccctt atattcacgg acggaaggag tacttcctta ctagtcagaa 4920
gggattgaac cggactacta gttgtggtta acaacagaat gatagacctg cgtttgggct 4980
ccgtcatcat tagctttttg catttttact tctgcttatt gaaatataac tggccaattt 5040
agtttgaaaa agaaaaaaga actgacgagc aaatgcaccg ttatttgagc caatagactg 5100
acagagtatc agacagttta agtgtgctgg gccgcgtcag ccttggccaa caatttcata 5160
tcctctgatc gtctcatcca atagtaggaa aggatgttca caagagtgtt caagctacgc 5220
tctaacttta ccacatgaag gattcagata tcagaactcg tcactgtttc ttgacatgat 5280
caaatttcgt ttgtaaaact gtgcaatatc acttccaggc tttgcctccg gcctattttg 5340
caggattgct gtactggatg agacagtcaa ggtatgggcc agactaacga aagggcctct 5400
cagtctcatc cccagccttt catgtactgc aatgtggaac atcaactgta attacagaac 5460
acttgttgta catctgaggg aatgttttgt gctgttcttc ccaatccaat tgcaggagtt 5520
agatatttgg aagcttaaga tagccaatgg atttctaaaa attacaatgt gtctgaaaga 5580
ttggtcaggc tatccccttg gagtgtgatc ttgatgtcgt gtgctgcatg ccacacgttc 5640
agagaaacat tccccacgtt ggattttttg aaggttctca catcaccaaa tgaggcattc 5700
agaaagtaca gtaaagtcac atctcgagga tgacaaaaga cgttcaaagg ataattgggt 5760
agggagttgg cacaaatgta cactatctca tcaacgcagt tctgcactag tttgaacaaa 5820
cacactctct tgtgcgatta caacaccagc gacatgtcca tgaaaaagaa gagaacggac 5880
acgtccaaaa ggcactcaac aatattgctt tcgccaaaat tcatatgaat taatccagca 5940
gatattttaa acatgatcag tatataggta tgctaataat tactagtttc agttagtcag 6000
tagccacaag aatctggact atggagaact ggaacggctg gaagggcgca ctgatcatgc 6060
atcaagccac tcaagagtga agaacatcat ctagctctag ccaaacggca ctacctgtca 6120
ggaacaaagc ctggagatac tgatggttca gccaaaaaag ataagcattt tacctgaaaa 6180
ataactcata aacctaacat ggaatttctg aaatttgatg tccacaggac cacagcagaa 6240
gtaaaatgac tacttgtacc accattctgc gtctgcaaga gtaaaacatt gacactacag 6300
gctggatgga gacccgcatc agacatataa tgcaaaccac tggaaccaaa tcaaccaatt 6360
atgtgcaaca tgtaaaattg taaatcgtga acatgaagca ctattaagtt ttaactcttg 6420
atttacaaaa taaaaaatca atcataggaa atgatcagac agacaaaatt gaagtcccag 6480
ggcatactgt caatcaaata atccaataac accagctccg aacacaaccg tgcataactt 6540
aaaaacctga ttaccgactc accatggatg tcatcagaat actaaattag tgcataatta 6600
gattgctaag tgagtatgga aaaaggacac aatgcaacaa tcaagcagtc tttcagctcc 6660
tgcatagtgc acacaggtac acaactggtg ttccatatgt caagaacgat aagcagaagt 6720
tcaaattatt aatgcactta gcaaatcgtt ctaataagca gtgtcaggat atgactagtg 6780
aacacttcgt ctcctccaaa agtgcaaaac agagatcaga cgaaaaacag aagtatcagc 6840
attcgagaag caagaatgat gtgcaccagc ttttgcaaac aacagaatat tgcaaaatga 6900
acaaatatat tgaacaaagg tatatgtaaa aatgaacaac taattctgga agaggtaatt 6960
aatgccagct aagacctttc ttaattgaaa attggcaatg attttgccgt tctgttaaaa 7020
aaaattaatg cgagctatac ttacaagcag gagattataa caaagcgcac ccttgataac 7080
tagtttgatt tcctacctga atttcactag ctgagatttc tttttctctt ttcaaaccac 7140
tttgttgcac cccaagtaca ctttcatttt cttcggtatc aatgtccaac tcaagacatg 7200
atatatgccc tgcagagaaa ccaaagctgc atctttttcc ctctatctac aatgcagaaa 7260
gtagagctta atacaaggaa atatcatcct cactaacact acaaaaccac atagtgatat 7320
catagccaac aacttgcaga gttgaagcga tttgcaccga aagaaatatt tcacagactg 7380
aaaccatgta tataacatga cagctaacca aacatcacac cacatatgcc acagggcaca 7440
aacatcgcat acgattccac ctttcttcta attagaaaac ctattcacaa tcaaccataa 7500
aatctatatc catcctctga tctagaagaa ccaacataat tattggatgg acatgttagc 7560
cgtcagaaga aaaaaaagca aaacatggga acatctgaaa agttgctc 7608
<210>61
<211>455
<212>PRT
＜213〉paddy rice
<220>
<221>CHAIN
<222>(0)...(0)
<223>OsIPT9 amino acidi(005021_3)
<400>61
Met Thr Ser Val Ala Thr Arg Ile Ala Thr Leu Val Arg Ala Ala Ala
1 5 10 15
Ala Ala Ser Arg Pro Leu Arg Leu His Arg Arg Pro Gly Gly Glu Asp
20 25 30
Thr Arg Met Val Val Ile Val Gly Ala Thr Gly Thr Gly Lys Thr Lys
35 40 45
Leu Ser Ile Asp Ala Ala Lys Val Ile Gly Gly Glu Val Val Asn Ala
50 55 60
Asp Lys Ile Gln Leu Tyr Asp Gly Leu Asp Val Thr Thr Asn Lys Val
65 70 75 80
Ser Leu Ala Asp Arg Arg Gly Val Pro His His Leu Leu Gly Ala Ile
85 90 95
Arg Pro Glu Ala Gly Glu Leu Pro Pro Ser Ser Phe Arg Ser Leu Ala
100 105 110
Ala Ala Thr Ala Ala Ser Ile Ala Ala Arg Arg Leu Val Pro Val Ile
115 120 125
Ala Gly Gly Ser Asn Ser Leu Ile His Ala Leu Leu Ala Asp His Phe
130 135 140
Asp Ala Ser Ala Gly Asp Pro Phe Ser Pro Ala Ala Ala Phe Arg His
145 150 155 160
Tyr Arg Pro Ala Leu Arg Phe Pro Cys Cys Leu Leu Trp Val His Val
165 170 175
Asp Glu Ala Leu Leu Asp Glu Tyr Leu Asp Arg Arg Val Asp Asp Met
180 185 190
Val Asp Ala Gly Met Val Glu Glu Leu Arg Glu Tyr Phe Ala Thr Thr
195 200 205
Thr Ala Ala Glu Arg Ala Ala His Ser Gly Leu Gly Lys Ala Ile Gly
210 215 220
Val Pro Glu Leu Gly Asp Tyr Phe Ala Gly Arg Lys Thr Phe Ser Glu
225 230 235 240
Ala Ile Asp Asp Ile Lys Ala Asn Thr Arg Val Leu Ala Ala Ala Gln
245 250 255
Val Ser Lys Ile Arg Arg Met Ser Asp Ala Trp Gly Trp Pro Ile His
260 265 270
Arg Leu Asp Ala Ser Asp Thr Val Arg Ala Arg Leu Thr Arg Ala Gly
275 280 285
Ser Ala Ala Glu Ser Ala Ser Trp Glu Arg Asp Val Arg Gly Pro Gly
290 295 300
Leu Ala Thr Ile Arg Ser Phe Leu Ala Asp Gln Ser Pro Pro Pro Arg
305 310 315 320
Ser Glu Gly Thr Asn Asp Tyr Leu Tyr Ala Met Glu Thr Glu Pro Glu
325 330 335
Pro Pro Pro Pro Pro Thr Leu Pro Pro Arg Leu Leu Arg Leu Pro Arg
340 345 350
Met Gln Tyr Cys Asp Met Val Gly Arg Ile Cys Val Leu Phe Leu Gly
355 360 365
Glu Val Val Ile His His Ile Ala Leu Leu Leu Thr Ala Ala Leu Ile
370 375 380
Leu Gln Ser Ser Thr Phe Ala Cys Thr Ile Ala Ala Val Tyr Glu Cys
385 390 395 400
Gln Val Ser Trp Ile Ile Ala Ser Phe Ala Ser Gly Leu Phe Cys Arg
405 410 415
Ile Ala Val Leu Asp Glu Thr Val Lys Glu Leu Asp Ile Trp Lys Leu
420 425 430
Lys Ile Ala Asn Gly Phe Leu Lys Ile Thr Met Cys Leu Lys Asp Trp
435 440 445
Ser Gly Tyr Pro Leu Gly Val
450 455
<210>62
<211>5075
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT3 genome sequence (002374_2)
＜221〉exon
<222>(2001)...(2503)
＜221〉exon
<222>(2544)...(3075)
<400>62
atataaaaaa cgaaaaattg tacttaaagt actttggata ataaagtaag tcaaaaaaat 60
aataattcta ttttttaaat aagacgagtg gtcaaacagt gaaaaaaaac tcaaaatccg 120
ttatattacg gaacggagga agtagcttac acggtgtagt acagtggcag cagtacgtcg 180
tctgttggct ctggtcaact gtaccgttat atataaagtg tcactcactt tgagagaaaa 240
agaggcatca tgacacgggc accaccattt gtatggatac gtaactacca tccatatata 300
tgcatatcag tgtcgaatgc aatcagctca tctcgatcca gtctccaatt tcaaaagaga 360
agatgtttga aattttaaca ttttagtttc ttttttgaaa atttactaca caaatatact 420
tcttaaaaaa actaattcta tatacctcgc ctcaaaaaaa atctctaaat tgatttgtct 480
gctcaagcta gtctcttttt aaaaaatgaa taagacaact ccattgttca gatagcccaa 540
cacagttgaa ctgctagcta ctccctccat cccataatat aagggatttt gagtttttac 600
ttgtaacgtt tgatcactcg tcttattcaa atttttttaa aactattatt tattttattt 660
gtgacttact ttattatcta cagaacttta agcacaactt ttcgtctttt atatttgaaa 720
aaaaatttga atgagacgag tggtcaaacg ttgcaatcaa aaactcaaaa tcccttatat 780
tgtgggacgg agggagaacc aaattacaaa caatgtctgg gaatccttca agccaaacaa 840
agtgactttg tagacctaga gatgcgtcaa ttttagcaag ctcatgggta acacgattat 900
gttctctagg acaattcata acttgataga caaaaaaaaa tcattgtaag cgcataaatt 960
tggcctatct aatgataaca acttttactc ttgatcagac agcaagagtt tttttttatt 1020
gacaaaattt aggcatatta tctgaaaacc ccaggtggcc gcgtgtggcc gcgcgcgtcc 1080
gcggcgtgct tcttctgaat gctcacaatg acgccatcct catcagccgc tgcggagcac 1140
tccaccaagg tcagcatcct cgacgcaccg gcgcagcgta cgtctcatgc atgcatcctt 1200
tatcgtacaa gaactattac tccatccggt ttcatattcc taacatttta aacaaggtta 1260
aggacgttaa ggtctctttt agaattttgc actatcaata actacaccag cggcatacat 1320
agattactct taaaaagcac tatcaataaa gtaaatattt atttattcac tgtatatata 1380
ttataataga aaactataac taaagaaatg ttttggcgat cgtgcatgtg gaaaatataa 1440
tttgttgtat tattgtagtg actctctcac agatatatat agagtatatg tgagatagag 1500
atttagagta caatacaaat tttaaaacag atttatttct agaactacat ttatctataa 1560
taatattcta tctctagaat tctatcttat ctctataatt tatatttaaa ctttcctccg 1620
aacatttatt ttaagaagaa attattagcg tattgggaat tgaacgcggg atttttaggg 1680
ttgaaaccac atacctcttg tcactgcact atcaaatgca tctcagagca ctgcagcatg 1740
atcactaaac tccctctccc cctaacgact gcaaggcgcc gcgtcctcca acccacagtg 1800
tgggtgatcg cccttcacat tccagagcgc cctctccccc cctataaata ccccactgcc 1860
agcctcatct tcctccacag catccatcgc aaaatccacc tcagctagct acccaagcgc 1920
acgcgccacc gcccgcgcgc gagctgagct aacgatcaac accggtcgaa cacctagcga 1980
gcatcaccac catcatcacc atgcaggcgt acatggcggt cgccgccgct ccggcgccac 2040
cggcctcgct gacgctgctg ccgcgcacca ccaccgtcat cagggacagg gagcgcttcg 2100
acgcggccgt cccggtggcg ccgctcgtgc tgaggcatgg cgccggcgtc aagcacaagg 2160
ccgtcgtggt gatgggcgcc acgggcaccg ggaagtcacg cctcgccgtc gacctcgccc 2220
tgcggttcgg cggcgaggtc atcaactccg acaagatgca gatacattcc gggttggatg 2280
tggtgacgaa caaggtgacc gaggaggagt gcgccggcgt gccgcaccac ctgatcggcg 2340
tggcgcgccc cgacgacgag ttcacggccg ccgacttccg ccgcgaggcg gcgcgcgccg 2400
cggcgggggc ggttgagagg gggaggttgc ccatcatcgc cggggggtcc aactcctacg 2460
tcgaggagct cgtcgaaggc gacggccgcg cgttccggga gcggtacgag tgctgcttcc 2520
tctgggtcga cgtggatctc gaggtgctcc gcggtttcgt cgcccgccgc gtcgacgaga 2580
tgtgccggcg aggcctcgtc cgggaggtgg ccgcagcgtt cgacccgcgc cgcaccgact 2640
actcccaggg gcatctggcg cgccatcggc gtgccggagc tcgacgcgta cctccgctcc 2700
cgcggcgacg gcgccgacga ggaggagcgg gcgcgcatgc tcgccgcggc cgtcgcggag 2760
atcaagtcga acacgttccg gctcgcgtgc cgccagcacc gcaagatcga gaggctggac 2820
cgcatgtggc gcgcccgccg cgtcgacgcc acggaggtgt tcaggaggcg cggccacgcc 2880
gccgacgacg cgtggcagcg gctcgtcgcc gcgccgtgca tcgacgccgt ccggtcattc 2940
ctcttcgagg accaagaacg cagcagcatc gccgccggca aacctcccct cttcgccgcc 3000
ggcaaggcca cttcaggcaa catctccgtc ttcgcctccg cggccgccgc catggcggcg 3060
gccgctgcaa tctgagaagc gcaggcacca acctacttac atacacatac atgaccaaac 3120
acaaaaacgc agagcaccat gccactctca agacattcag gctgctgcca atcgccattg 3180
ccgatcaaat tcagagctcg tcagtcggat caaacgatga aggctgctgc ttctgcggtc 3240
aacatctcga tgacctgcca attgcaatgc aaagcaagat tgttcatata ctggtaactg 3300
gttgactcct ttttgttttt gctgggtttc tttgtgatat gaggagattg atgaattgcg 3360
cgcgagaatg taacttatga gttttgagtt tttttttctt tttggtttct cctctgattt 3420
tgggtgtgta acagtaggag taaaaactaa aaagtattga cttggatgtt aattggggga 3480
ttgatgtaat agcctctcct tgtaacatag aaatcatgag ctgaaataat taaatcgttg 3540
agaccttgca aagaaaaagg gggaaaaaca aaagaaggaa tcttgtgaaa ggggaatatt 3600
tggcagtctt tatcgtaata tatcaacttt ttcaaggtct tcactgagct ttgctattga 3660
gaatctcact tgccgcgcac ttcaatagtc tatgactatg ctctacactg tccttgttct 3720
taattcgaga ccgcatactt tgagtgacat gttgtgggta tgagtaaaac tcggtggcac 3780
gcaatactaa tttttcttta catgaaaact tataattcgc acaattttgt gtcaaaaaaa 3840
aattcgcgca atccttttgc gcattcccta taaaaactta taaattgtct gtatttataa 3900
tttttatttt cttacgttct ctatttcatt cagaaaactc ctggccaatc accatgacag 3960
gtgatacatg caacatttgg cctggaaaac tagtggcagt cagccagtca ttcctcttgt 4020
gcaatgtgtg gctctatgct gtatctgtct gtggatacaa gttggcatct gcatcagttc 4080
tggttgcttc tttgacatca tattcccaag tcttgtttct tggtcatgga gacactctca 4140
tgcatgattg ggaactgggt attagttagg gcagtgcttg catgtcaaag gtcaagccca 4200
tcatcttctt gttcaaagtc aacttcacat tctgaatgca tatgcacatt tttacaagga 4260
taagcttgat ttaacacata ttttagagtt cacttgaaca ttgtcaaact ctttcgtaga 4320
atgcagtggt gatctctctg gatagtatgg agaccagaag actcagcgat catcggttca 4380
gaatattata taagattcag aaggtcaaca tgaacaaata tttatatgaa atagtaaaat 4440
tggtcaggta aatgataact ttgacttaat cctactacag ttagacagtc aaaatggcat 4500
ttcttgatgc tacatttttt ttctacatgg attgacaaaa acgaatgaac gaatcagagt 4560
tatttgacca atttatcaaa ttatgtcaag tggatgatca gagaataaga tctgaatatc 4620
gcgataggaa tgaaatcttt ggtcaagggt caatgtgcag ttcctgcatt tccttcccca 4680
aatcaaacct agaactggtt gacacttgac agagaatgca acgactctgt ttttgttttc 4740
atttttttgg aagattcttc tatgaacact ggctctttga ccaactgcct acatatctct 4800
actgatacat gagtgatcag taataatttc tgttgtacaa tgttttctat agcattctga 4860
tttgccaata ataattaaca aagtcaaaag cttttttttt tctgaaggag aaagtcaaac 4920
tgttcttctc aaatacagag tccaacttgc aacatggtga acaaaacaaa aggaggaaaa 4980
tacgaaagga atcagcaaat agctaacaag ctgatcattg agcaatgaga aaaatatcac 5040
atttaataaa ggtttaaagt caacactaga gcttg 5075
<210>63
<211>344
<212>PRT
＜213〉paddy rice
<220>
<221>CHAIN
<222>(0)...(0)
＜223〉OsIPT3 aminoacid sequence (002374_2)
<400>63
Met Gln Ala Tyr Met Ala Val Ala Ala Ala Pro Ala Pro Pro Ala Ser
1 5 10 15
Leu Thr Leu Leu Pro Arg Thr Thr Thr Val Ile Arg Asp Arg Glu Arg
20 25 30
Phe Asp Ala Ala Val Pro Val Ala Pro Leu Val Leu Arg His Gly Ala
35 40 45
Gly Val Lys His Lys Ala Val Val Val Met Gly Ala Thr Gly Thr Gly
50 55 60
Lys Ser Arg Leu Ala Val Asp Leu Ala Leu Arg Phe Gly Gly Glu Val
65 70 75 80
Ile Asn Ser Asp Lys Met Gln Ile His Ser Gly Leu Asp Val Val Thr
85 90 95
Asn Lys Val Thr Glu Glu Glu Cys Ala Gly Val Pro His His Leu Ile
100 105 110
Gly Val Ala Arg Pro Asp Asp Glu Phe Thr Ala Ala Asp Phe Arg Arg
115 120 125
Glu Ala Ala Arg Ala Ala Ala Gly Ala Val Glu Arg Gly Arg Leu Pro
130 135 140
Ile Ile Ala Gly Gly Ser Asn Ser Tyr Val Glu Glu Leu Val Glu Gly
145 150 155 160
Asp Gly Arg Ala Phe Arg Glu Arg Cys Ser Ala Val Ser Ser Pro Ala
165 170 175
Ala Ser Thr Arg Cys Ala Gly Glu Ala Ser Ser Gly Arg Trp Pro Gln
180 185 190
Arg Ser Thr Arg Ala Ala Pro Thr Thr Pro Arg Gly Ile Trp Arg Ala
195 200 205
Ile Gly Val Pro Glu Leu Asp Ala Tyr Leu Arg Ser Arg Gly Asp Gly
210 215 220
Ala Asp Glu Glu Glu Arg Ala Arg Met Leu Ala Ala Ala Val Ala Glu
225 230 235 240
Ile Lys Ser Asn Thr Phe Arg Leu Ala Cys Arg Gln His Arg Lys Ile
245 250 255
Glu Arg Leu Asp Arg Met Trp Arg Ala Arg Arg Val Asp Ala Thr Glu
260 265 270
Val Phe Arg Arg Arg Gly His Ala Ala Asp Asp Ala Trp Gln Arg Leu
275 280 285
Val Ala Ala Pro Cys Ile Asp Ala Val Arg Ser Phe Leu Phe Glu Asp
290 295 300
Gln Glu Arg Ser Ser Ile Ala Ala Gly Lys Pro Pro Leu Phe Ala Ala
305 310 315 320
Gly Lys Ala Thr Ser Gly Asn Ile Ser Val Phe Ala Ser Ala Ala Ala
325 330 335
Ala Met Ala Ala Ala Ala Ala Ile
340
<210>64
<211>4777
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT4 genome sequence (000911_6)
<221>CDS
<222>(1734)...(2778)
<400>64
gaacagagat taagtgatta acacatacga gaggcaagat gatggacaca cccacaggat 60
cgcctgccga tcgatggcac gccgtccgac caggtcgatg gagacccaga agccggccaa 120
caactaatgc catagaaaaa ttttacagcc tagagacaaa catatttgaa aaaattttag 180
atatatattt tcaaaccata gagtttcccg gatggttatg gatccacccc tggcaacagg 240
acaagtcatc tagatggaga gtaaaaagtc gcgcgaggac gaagctgatg aacctcgtct 300
ttttttttct taacctgaaa aacaactagt atgtacaact aaagttgcat ttagggttat 360
tatatccttg ttagtattga tttcaaatga aagttatcag tggtaaataa gaaaaagttg 420
tacaagaata tctggaatgg cttcattgcc tttaataatt gacaatgaca atcaagaaaa 480
gaaaaaaaaa gataacattt ctaggtgttc acaaactcac gaagagtgtc gacaagtttg 540
caacaacatg tatttgaaat cggagaaagt actctctcta tactaaaata attttttttt 600
aaattttatc atttgttcta aaataaattt acttttatca ccttatttac cctaattgat 660
gcaccaattg aaagcttatt atttaaatat ctcttaccta cctatccact aatatactat 720
actttcttat taactagata atgtatcgca ctttgctatg agatatatgt tagttattga 780
agatacaata aaataatttg gattgaaata ttatgaaaat gatttgagaa tgatgattta 840
gcatgtgtat gtttagtttt agaatgaaat aagttgtaga tataattact acgtgcttgc 900
atgttgaact ttgtgtgttt tataggttga tgtggcatgc ttgcatgcag attttaggag 960
tgctaataaa tactccctat atttgcatgt tgagttttag gtgtttagtg gatattagct 1020
ttatacaaag aagagataaa gagcacttcg tttttttcct ctgataattt gaaatccatt 1080
ggctaaagat gaagttattt tagatggagg tagtactttt tttatctgat agtgcactac 1140
atctctctac cttgtgcatt tgttttcatt cttgtttttc attcttgtgg tcctctacat 1200
aaaagatgtt acgtagtctc tatcgacact aaggatttct ttggagaagc ttctagcagc 1260
tacaactata ttaaaaatct ctaacttttt gctatatatt ttgaatctct agctccctaa 1320
gcagtataga ttctcgctcc aaattttaag agttagtaca tgtaaaattt agaaataaac 1380
tagtagctaa aagcagcgga gcttcgatct ctcaagattc tcataagtta tttcttagaa 1440
tctataattc cccaaatata gcatatatgt ttttagtaga tggctaaact tatactttat 1500
gcctcaaatt aaaactcgtt aattctgttg agtatctttg ttgtttgttc tccacttggt 1560
tttggttagc taactccata taaatacaca tccaaacaca cccacaagac agcaaccaac 1620
tccaagcttg ctaactaaca aagcatcttg aattcctctt gaccaagtag ttaagtagct 1680
aagctaatta gtggtctaac tttgaacaca acacaacaaa acacacacac atc atg 1736
Met
1
gcc acg tca cta tcc ttg gcg ccc aaa ccc gcc gcc gtc gcc gtc gcc 1784
Ala Thr Ser Leu Ser Leu Ala Pro Lys Pro Ala Ala Val Ala Val Ala
5 10 15
gcc gcc gcc atc ccg agg ctt gtt ccg ccg ccg tct atc gac atg tcg 1832
Ala Ala Ala Ile Pro Arg Leu Val Pro Pro Pro Ser Ile Asp Met Ser
20 25 30
gcg ctg tcg ccg ccg ccg ccg ctc gtc agc gtc agc agg agc atg gta 1880
Ala Leu Ser Pro Pro Pro Pro Leu Val Ser Val Ser Arg Ser Met Val
35 40 45
gcg aag cac aag gcc gtg gtt gtg atg ggc gcg acg ggg acg ggg aag 1928
Ala Lys His Lys Ala Val Val Val Met Gly Ala Thr Gly Thr Gly Lys
50 55 60 65
acg cgg ctc gcc gtc gac ctc gcg ctc cag ttc ggc ggc gag gtg atc 1976
Thr Arg Leu Ala Val Asp Leu Ala Leu Gln Phe Gly Gly Glu Val Ile
70 75 80
aac gcc gac aag ctg cag ctg cac cgg ggg ctc gac gtg gcc acc aac 2024
Asn Ala Asp Lys Lau Gln Leu His Arg Gly Leu Asp Val Ala Thr Asn
85 90 95
aag gcc acc gcc gac gag cgc gcc ggc gtg ccg cac cac ctg atc ggg 2072
Lys Ala Thr Ala Asp Glu Arg Ala Gly Val Pro His His Leu Ile Gly
100 105 110
gtg gcg cac ccg gac gag gag ttc acg gcc gcg gac ttc cgc cgc gcc 2120
Val Ala His Pro Asp Glu Glu Phe Thr Ala Ala Asp Phe Arg Arg Ala
115 120 125
gcg tcg cgc gcc gcc gcc gcg gtc gcc gcg cgc ggc gcg ctg ccc atc 2168
Ala Ser Arg Ala Ala Ala Ala Val Ala Ala Arg Gly Ala Leu Pro Ile
130 135 140 145
atc 9cc ggc ggc tcc aac tcc tac atc gag gag ctc gtc gac ggc gac 2216
Ile Ala Gly Gly Ser Asn Ser Tyr Ile Glu Glu Leu Val Asp Gly Asp
150 155 160
cgc cgc gcg ttc cgc gac cgg tac gac tgc tgc ttc ctg tgg gtg gac 2264
Arg Arg Ala Phe Arg Asp Arg Tyr Asp Cys Cys Phe Leu Trp Val Asp
165 170 175
gtg cag ctc ccc gtg ctc cac ggc ttc gtc ggc cgc cgc gtc gac gac 2312
Val Gln Leu Pro Val Leu His Gly Phe Val Gly Arg Arg Val Asp Asp
180 185 190
atg tgc ggc cgc ggg atg gtc gcc gag atc gag gcg gcg ttc gac ccg 2360
Met Cys Gly Arg Gly Met Val Ala Glu Ile Glu Ala Ala Phe Asp Pro
195 200 205
gac cgc acc gac tac tcc cgc ggc gtc tgg cgc gcc atc ggc gtg ccg 2408
Asp Arg Thr Asp Tyr Ser Arg Gly Val Trp Arg Ala Ile Gly Val Pro
210 215 220 225
gag ctc gac gcg tac ctc cgc tcg tgc gcc gcc gcc ggc ggc gag gag 2456
Glu Leu Asp Ala Tyr Leu Arg Ser Cys Ala Ala Ala Gly Gly Glu Glu
230 235 240
gaa cgc gcg cgg ctg ctg gcc aat gcc atc gag gac atc aag gcg aac 2504
Glu Arg Ala Arg Leu Leu Ala Asn Ala Ile Glu Asp Ile Lys Ala Asn
245 250 255
acc cgc tgg ctg tcg tgc cgg cag cgc gcc aag atc gtg agg cta gac 2552
Thr Arg Trp Leu Ser Cys Arg Gln Arg Ala Lys Ile Val Arg Leu Asp
260 265 270
cgc cta tgg cga atc cgc cgc gtg gac gcc acg gag gcg ttc cgg cgg 2600
Arg Leu Trp Arg Ile Arg Arg Val Asp Ala Thr Glu Ala Phe Arg Arg
275 280 285
cgc ggc ggc gcc gcc aac gag gcg tgg gag cgg cac gtc gcc gcg ccg 2648
Arg Gly Gly Ala Ala Asn Glu Ala Trp Glu Arg His Val Ala Ala Pro
290 295 300 305
agc att gac acc gtg cga tcc ttc ctc cac ggc gaa ttc acc acc gcc 2696
Ser Ile Asp Thr Val Arg Ser Phe Leu His Gly Glu Phe Thr Thr Ala
310 315 320
gcc gaa act acg gcg gcg ccg gtg ccg cca ccg ccg ttc ctc ccc atg 2744
Ala Glu Thr Thr Ala Ala Pro Val Pro Pro Pro Pro Phe Leu Pro Met
325 330 335
ttt gct ctc gcc gcg gcg ggc gcc ggc gtc taa g ctcagctcag 2788
Phe Ala Leu Ala Ala Ala Gly Ala Gly Val *
340 345
ctcgaaacga cagtaaaaat tttaaaaaac ttgcagagat ggatggggag cttaataagt 2848
gtgaagtgaa ggtaattaag aagaaattaa ccactgtttg atgtaatgac attgatattg 2908
accaggccaa aaaagggaga gaaaaagagc agcagatgtg gaggagtgta ccatctgtgg 2968
actgagagtg acccttccga ttagggatgg acattggtcg atccacaaga acttcttgac 3028
ccactctgat tcagctaaat gaactaattt atacgattgg agttttgaaa ataaatttag 3088
ttcatatagc taaactagga tggttaagga gtattcgtgg gtcggcccac tctaacccct 3148
agctactttg gatcacagga ttttatggcg gtattttcac tttacaaatt agtatgagat 3208
ctttataagg ttgttgtgca ttgcatatgt aaatgcgatg gtctagtagg gtatgaatgt 3268
cgggcctctg tatgattctg ttgagagtga ttaatattag tttttctttg ttatttattt 3328
gaactacaat aaaaaaatac ggttgtgtga ttgagctagt gttacccaac cttcacctta 3388
attctgctta ttctggattg tttattcatc ttacttggaa atattaattt gtgagtgaga 3448
tgatctgatg atgaatgtaa taattatttg aggtgattga gtattgatct tgttatctat 3508
atattgtgtt ttgtattatc agattataca actagctagt tttttttcaa ttgatcgaga 3568
tatataactc ctatagctag ttgacctata tgggaagcta ggctagctag cttgtctgta 3628
ttgctaacat aaatgtgaat acatgataat tacatgttga ttgaaataac tctcagataa 3688
agaaactaat taaataagct agtagtgcac atgattttga taatgaaggc aaatttggct 3748
aatgtgcact gcgctggttg atattttctg atagtaatca agaatatatt ggtgctagtg 3808
ggcaccatga atttgtgcca gttgctaaca caaatggatc gaggccagct aacaagaata 3868
tataaaacac ctgagcttca accttagtag catgcatgca gttgatttaa ttatcatcat 3928
tgtaatatct tgtaatatga ccttttcaac ttaatcatga aaaaaaattc cttcaagaaa 3988
ctagtaagtg acatcgttgc acatctggag aagtccatcg atcaacttga agtgcattca 4048
cagttgcaca agctaaatct gaattatggt tcctaggcta atatataatt cgaaaatacc 4108
ttctttgaaa aaaaactaac acaacttttg gtaaatatga aaatgcatag catggtatta 4168
aaattttcag aatattcaat attaaattta taccacttct taaccaattt aattagttct 4228
gctggtttca tgaatatttt taggcatatt ctgagtggat aaaaatatta aaatctaggc 4288
agtgatataa aataatttat caataatatc gttcattaaa ttaataattt tgcagtgtgg 4348
aagaaggtga tgctgtaatg catgaggaaa aatgggtccc cctatcctcc ggtaagaaaa 4408
ttccttaaga taaagcatca tatataaata tgttgattta gaaaatataa taattttaaa 4468
ttgtagccaa ttatatacac atatccgata caaattctaa caataattat taggttggta 4528
aaatgaattc atcagacata tattagccgt cggacatatg ttgtggttag tttatgtttc 4588
agtaagcttt taaacaaaat aggcgaattc taagagattg catgaaaacc acctttttga 4648
aacaaagtaa agcctataaa ccaccttagc ccgatcgaca tgttctaatg aatgagctat 4708
ggctacaaat atataactgt tctattagga accatattct ggaaatatat taaattaagt 4768
tccctcttt 4777
<210>65
<211>1044
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT4 encoding sequence (000911_6)
<221>CDS
<222>(1)...(1044)
<400>65
atg gcc acg tca cta tcc ttg gcg ccc aaa ccc gcc gcc gtc gcc gtc 48
Met Ala Thr Ser Leu Ser Leu Ala Pro Lys Pro Ala Ala Val Ala Val
1 5 10 15
gcc gcc gcc gcc atc ccg agg ctt gtt ccg ccg ccg tct atc gac atg 96
Ala Ala Ala Ala Ile Pro Arg Leu Val Pro Pro Pro Ser Ile Asp Met
20 25 30
tcg gcg ctg tcg ccg ccg ccg ccg ctc gtc agc gtc agc agg agc atg 144
Ser Ala Leu Ser Pro Pro Pro Pro Leu Val Ser Val Ser Arg Ser Met
35 40 45
gta gcg aag cac aag gcc gtg gtt gtg atg ggc gcg acg ggg acg ggg 192
Val Ala Lys His Lys Ala Val Val Val Met Gly Ala Thr Gly Thr Gly
50 55 60
aag acg cgg ctc gcc gtc gac ctc gcg ctc cag ttc ggc ggc gag gtg 240
Lys Thr Arg Leu Ala Val Asp Leu Ala Leu Gln Phe Gly Gly Glu Val
65 70 75 80
atc aac gcc gac aag ctg cag ctg cac cgg ggg ctc gac gtg gcc acc 288
Ile Asn Ala Asp Lys Leu Gln Leu His Arg Gly Leu Asp Val Ala Thr
85 90 95
aac aag gcc acc gcc gac gag cgc gcc ggc gtg ccg cac cac ctg atc 336
Asn Lys Ala Thr Ala Asp Glu Arg Ala Gly Val Pro His His Leu Ile
100 105 110
ggg gtg gcg cac ccg gac gag gag ttc acg gcc gcg gac ttc cgc cgc 384
Gly Val Ala His Pro Asp Glu Glu Phe Thr Ala Ala Asp Phe Arg Arg
115 120 125
gcc gcg tcg cgc gcc gcc gcc gcg gtc gcc gcg cgc ggc gcg ctg ccc 432
Ala Ala Ser Arg Ala Ala Ala Ala Val Ala Ala Arg Gly Ala Leu Pro
130 135 140
atc atc gcc ggc ggc tcc aac tcc tac atc gag gag ctc gtc gac ggc 480
Ile Ile Ala Gly Gly Ser Asn Ser Tyr Ile Glu Glu Leu Val Asp Gly
145 150 155 160
gac cgc cgc gcg ttc cgc gac cgg tac gac tgc tgc ttc ctg tgg gtg 528
Asp Arg Arg Ala Phe Arg Asp Arg Tyr Asp Cys Cys Phe Leu Trp Val
165 170 175
gac gtg cag ctc ccc gtg ctc cac ggc ttc gtc ggc cgc cgc gtc gac 576
Asp Val Gln Leu Pro Val Leu His Gly Phe Val Gly Arg Arg Val Asp
180 185 190
gac atg tgc ggc cgc ggg atg gtc gcc gag atc gag gcg gcg ttc gac 624
Asp Met Cys Gly Arg Gly Met Val Ala Glu Ile Glu Ala Ala Phe Asp
195 200 205
ccg gac cgc acc gac tac tcc cgc ggc gtc tgg cgc gcc atc ggc gtg 672
Pro Asp Arg Thr Asp Tyr Ser Arg Gly Val Trp Arg Ala Ile Gly Val
210 215 220
ccg gag ctc gac gcg tac ctc cgc tcg tgc gcc gcc gcc ggc ggc gag 720
Pro Glu Leu Asp Ala Tyr Leu Arg Ser Cys Ala Ala Ala Gly Gly Glu
225 230 235 240
gag gaa cgc gcg cgg ctg ctg gcc aat gcc atc gag gac atc aag gcg 768
Glu Glu Arg Ala Arg Leu Leu Ala Asn Ala Ile Glu Asp Ile Lys Ala
245 250 255
aac acc cgc tgg ctg tcg tgc cgg cag cgc gcc aag atc gtg agg cta 816
Asn Thr Arg Trp Leu Ser Cys Arg Gln Arg Ala Lys Ile Val Arg Leu
260 265 270
gac cgc cta tgg cga atc cgc cgc gtg gac gcc acg gag gcg ttc cgg 864
Asp Arg Leu Trp Arg Ile Arg Arg Val Asp Ala Thr Glu Ala Phe Arg
275 280 285
cgg cgc ggc ggc gcc gcc aac gag gcg tgg gag cgg cac gtc gcc gcg 912
Arg Arg Gly Gly Ala Ala Asn Glu Ala Trp Glu Arg His Val Ala Ala
290 295 300
ccg agc att gac acc gtg cga tcc ttc ctc cac ggc gaa ttc acc acc 960
Pro Ser Ile Asp Thr Val Arg Ser Phe Leu His Gly Glu Phe Thr Thr
305 310 315 320
gcc gcc gaa act acg gcg gcg ccg gtg ccg cca ccg ccg ttc ctc ccc 1008
Ala Ala Glu Thr Thr Ala Ala Pro Val Pro Pro Pro Pro Phe Leu Pro
325 330 335
atg ttt gct ctc gcc gcg gcg ggc gcc ggc gtc taa 1044
Met Phe Ala Leu Ala Ala Ala Gly Ala Gly Val *
340 345
<210>66
<211>347
<212>PRT
＜213〉paddy rice
<400>66
Met Ala Thr Ser Leu Ser Leu Ala Pro Lys Pro Ala Ala Val Ala Val
1 5 10 15
Ala Ala Ala Ala Ile Pro Arg Leu Val Pro Pro Pro Ser Ile Asp Met
20 25 30
Ser Ala Leu Ser Pro Pro Pro Pro Leu Val Ser Val Ser Arg Ser Met
35 40 45
Val Ala Lys His Lys Ala Val Val Val Met Gly Ala Thr Gly Thr Gly
50 55 60
Lys Thr Arg Leu Ala Val Asp Leu Ala Leu Gln Phe Gly Gly Glu Val
65 70 75 80
Ile Asn Ala Asp Lys Leu Gln Leu His Arg Gly Leu Asp Val Ala Thr
85 90 95
Asn Lys Ala Thr Ala Asp Glu Arg Ala Gly Val Pro His His Leu Ile
100 105 110
Gly Val Ala His Pro Asp Glu Glu Phe Thr Ala Ala Asp Phe Arg Arg
115 120 125
Ala Ala Ser Arg Ala Ala Ala Ala Val Ala Ala Arg Gly Ala Leu Pro
130 135 140
Ile Ile Ala Gly Gly Ser Asn Ser Tyr Ile Glu Glu Leu Val Asp Gly
145 150 155 160
Asp Arg Arg Ala Phe Arg Asp Arg Tyr Asp Cys Cys Phe Leu Trp Val
165 170 175
Asp Val Gln Leu Pro Val Leu His Gly Phe Val Gly Arg Arg Val Asp
180 185 190
Asp Met Cys Gly Arg Gly Met Val Ala Glu Ile Glu Ala Ala Phe Asp
195 200 205
Pro Asp Arg Thr Asp Tyr Ser Arg Gly Val Trp Arg Ala Ile Gly Val
210 215 220
Pro Glu Leu Asp Ala Tyr Leu Arg Ser Cys Ala Ala Ala Gly Gly Glu
225 230 235 240
Glu Glu Arg Ala Arg Leu Leu Ala Asn Ala Ile Glu Asp Ile Lys Ala
245 250 255
Asn Thr Arg Trp Leu Ser Cys Arg Gln Arg Ala Lys Ile Val Arg Leu
260 265 270
Asp Arg Leu Trp Arg Ile Arg Arg Val Asp Ala Thr Glu Ala Phe Arg
275 280 285
Arg Arg Gly Gly Ala Ala Asn Glu Ala Trp Glu Arg His Val Ala Ala
290 295 300
Pro Ser Ile Asp Thr Val Arg Ser Phe Leu His Gly Glu Phe Thr Thr
305 310 315 320
Ala Ala Glu Thr Thr Ala Ala Pro Val Pro Pro Pro Pro Phe Leu Pro
325 330 335
Met Phe Ala Leu Ala Ala Ala Gly Ala Gly Val
340 345
<210>67
<211>484
<212>PRT
＜213〉artificial sequence
<220>
＜223〉consensus sequence
＜221〉variant
<222>3，4，5，6，7，8，9，10，11，12，13，14，15，16，17，18，19，20，21，22，23，24，25，26，27，28，29，30，31，32，33，34，35，36，37，38，39，40，41，42，43，44，45，46，47，48，49，50，51，52，53，54，55，56，57，58，59，60，61，62
＜223〉Xaa=arbitrary amino acid
＜221〉variant
<222>63，64，65，66，67，68，69，70，71，72，73，74，75，76，77，78，79，80，81，82，83，84，85，86，87，88，89，90，92，114，116，117，145，148，157，159，172，173，176，180，182，183，204，205，206，207，209，210，211，212，213，214
＜223〉Xaa=arbitrary amino acid
＜221〉variant
<222>215，216，217，218，219，220，221，222，223，224，225，226，227，228，229，230，231，232，233，234，235，236，237，238，239，240，241，242，243，244，245，246，247，248，249，250，251，252，253，254，255，256，257，258，259，260，261
＜223〉Xaa=arbitrary amino acid
＜221〉variant
<222>262，263，264，265，266，267，268，269，270，271，272，273，274，275，276，277，278，279，280，281，282，283，284，285，286，287，288，289，290，291，292，293，294，295，296，297，298，299，300，301，302，303，304，305，306，319，320
＜223〉Xaa=arbitrary amino acid
＜221〉variant
<222>321，324，325，328，333，336，339，340，347，352，353，354，356，357，358，359，360，361，362，363，364，365，366，369，383，384，385，386，387，388，389，390，391，392，393，394，395，396，397，398，399，400，401，402，403，406，409
＜223〉Xaa=arbitrary amino acid
<400>67
Ser Ser Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1 5 10 15
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
20 25 30
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
35 40 45
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
50 55 60
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
65 70 75 80
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Lys Xaa Lys Val Val Val
85 90 95
Ile Met Gly Ala Thr Gly Thr Gly Lys Ser Arg Leu Ser Ile Asp Leu
100 105 110
Ala Xaa Arg Xaa Xaa Phe Gly Gly Glu Val Ile Asn Ser Asp Lys Ile
115 120 125
Gln Val Tyr Ala Asp Gly Leu Asp Val Ala Thr Asn Lys Val Thr Leu
130 135 140
Xaa Glu Arg Xaa Gly Val Pro His His Leu Leu Gly Xaa Ile Xaa Pro
145 150 155 160
Glu Ala Gly Glu Leu Thr Ala Ser Asp Phe Arg Xaa Xaa Ala Ala Xaa
165 170 175
Ala Ile Ala Xaa Ile Xaa Xaa Ala Arg Gly Arg Leu Pro Ile Val Ala
180 185 190
Gly Gly Ser Asn Ser Tyr Ile His Ala Leu Leu Xaa Xaa Xaa Xaa Asp
195 200 205
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
210 215 220
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
225 230 235 240
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
245 250 255
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
260 265 270
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
275 280 285
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
290 295 300
Xaa Xaa Leu Arg Tyr Asp Cys Cys Phe Leu Trp Val Asp Val Xaa Xaa
305 310 315 320
Xaa Val Leu Xaa Xaa Tyr Leu Xaa Arg Arg Val Asp Xaa Met Val Xaa
325 330 335
Asp Ser Xaa Xaa Gly Leu Val Glu Glu Leu Xaa Glu Phe Phe Asp Xaa
340 345 350
Xaa Xaa Ala Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gly Ile
355 360 365
Xaa Lys Ala Ile Gly Val Pro Glu Leu Asp Glu Tyr Phe Arg Xaa Xaa
370 375 380
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
385 390 395 400
Xaa Xaa Xaa Leu Asp Xaa Ala Val Xaa Glu Ile Lys Xaa Asn Thr Xaa
405 410 415
Xaa Leu Ala Xaa Arg Gln Val Xaa Lys Ile Xaa Arg Leu Xaa Xaa Xaa
420 425 430
Xaa Gly Trp Xaa Ile Xaa Xaa Arg Val Asp Ala Thr Glu Xaa Phe Xaa
435 440 445
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
450 455 460
Xaa Glu Xaa Trp Glu Arg Xaa Val Xaa Xaa Pro Xaa Val Xaa Xaa Val
465 470 475 480
Arg Xaa Phe Leu
<210>68
<211>8
<212>PRT
＜213〉artificial sequence
<220>
＜223〉consensus sequence of ATP binding domains
＜221〉variant
<222>(1)...(1)
＜223〉the 1st amino acid can be G
＜221〉variant
<222>(8)...(8)
＜223〉the 8th amino acid can be T
＜221〉variant
<222>(2)...(5)
＜223〉amino acid of 2-5 position can be arbitrary amino acid
＜221〉variant
<222>2，3，4，5
＜223〉Xaa=arbitrary amino acid
<400>68
Ala Xaa Xaa Xaa Xaa Gly Lys Ser
1 5
<210>69
<211>1035
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT3 encoding sequence
<221>CDS
<222>(1)...(1035)
<400>69
atg cag gcg tac atg gcg gtc gcc gcc gct ccg gcg cca ccg gcc tcg 48
Met Gln Ala Tyr Met Ala Val Ala Ala Ala Pro Ala Pro Pro Ala Ser
1 5 10 15
ctg acg ctg ctg ccg cgc acc acc acc gtc atc agg gac agg gag cgc 96
Leu Thr Leu Leu Pro Arg Thr Thr Thr Val Ile Arg Asp Arg Glu Arg
20 25 30
ttc gac gcg gcc gtc ccg gtg gcg ccg ctc gtg ctg agg cat ggc gcc 144
Phe Asp Ala Ala Val Pro Val Ala Pro Leu Val Leu Arg His Gly Ala
35 40 45
ggc gtc aag cac aag gcc gtc gtg gtg atg ggc gcc acg ggc acc ggg 192
Gly Val Lys His Lys Ala Val Val Val Met Gly Ala Thr Gly Thr Gly
50 55 60
aag tca cgc ctc gcc gtc gac ctc gcc ctg cgg ttc ggc ggc gag gtc 240
Lys Ser Arg Leu Ala Val Asp Leu Ala Leu Arg Phe Gly Gly Glu Val
65 70 75 80
atc aac tcc gac aag atg cag ata cat tcc ggg ttg gat gtg gtg acg 288
Ile Asn Ser Asp Lys Met Gln Ile His Ser Gly Leu Asp Val Val Thr
85 90 95
aac aag gtg acc gag gag gag tgc gcc ggc gtg ccg cac cac ctg atc 336
Asn Lys Val Thr Glu Glu Glu Cys Ala Gly Val Pro His His Leu Ile
100 105 110
ggc gtg gcg cgc ccc gac gac gag ttc acg gcc gcc gac ttc cgc cgc 384
Gly Val Ala Arg Pro Asp Asp Glu Phe Thr Ala Ala Asp Phe Arg Arg
115 120 125
gag gcg gcg cgc gcc gcg gcg ggg gcg gtt gag agg ggg agg ttg ccc 432
Glu Ala Ala Arg Ala Ala Ala Gly Ala Val Glu Arg Gly Arg Leu Pro
130 135 140
atc atc gcc ggg ggg tcc aac tcc tac gtc gag gag ctc gtc gaa ggc 480
Ile Ile Ala Gly Gly Ser Asn Ser Tyr Val Glu Glu Leu Val Glu Gly
145 150 155 160
gac ggc cgc gcg ttc cgg gag cgg tgc tcc gcg gtt tcg tcg ccc gcc 528
Asp Gly Arg Ala Phe Arg Glu Arg Cys Ser Ala Val Ser Ser Pro Ala
165 170 175
gcg tcg acg aga tgt gcc ggc gag gcc tcg tcc ggg agg tgg ccg cag 576
Ala Ser Thr Arg Cys Ala Gly Glu Ala Ser Ser Gly Arg Trp Pro Gln
180 185 190
cgt tcg acc cgc gcc gca ccg act act ccc agg ggc atc tgg cgc gcc 624
Arg Ser Thr Arg Ala Ala Pro Thr Thr Pro Arg Gly Ile Trp Arg Ala
195 200 205
atc ggc gtg ccg gag ctc gac gcg tac ctc cgc tcc cgc ggc gac ggc 672
Ile Gly Val Pro Glu Leu Asp Ala Tyr Leu Arg Ser Arg Gly Asp Gly
210 215 220
gcc gac gag gag gag cgg gcg cgc atg ctc gcc gcg gcc gtc gcg gag 720
Ala Asp Glu Glu Glu Arg Ala Arg Met Leu Ala Ala Ala Val Ala Glu
225 230 235 240
atc aag tcg aac acg ttc cgg ctc gcg tgc cgc cag cac cgc aag atc 768
Ile Lys Ser Asn Thr Phe Arg Leu Ala Cys Arg Gln His Arg Lys Ile
245 250 255
gag agg ctg gac cgc atg tgg cgc gcc cgc cgc gtc gac gcc acg gag 816
Glu Arg Leu Asp Arg Met Trp Arg Ala Arg Arg Val Asp Ala Thr Glu
260 265 270
gtg ttc agg agg cgc ggc cac gcc gcc gac gac gcg tgg cag cgg ctc 864
Val Phe Arg Arg Arg Gly His Ala Ala Asp Asp Ala Trp Gln Arg Leu
275 280 285
gtc gcc gcg ccg tgc atc gac gcc gtc cgg tca ttc ctc ttc gag gac 912
Val Ala Ala Pro Cys Ile Asp Ala Val Arg Ser Phe Leu Phe Glu Asp
290 295 300
caa gaa cgc agc agc atc gcc gcc ggc aaa cct ccc ctc ttc gcc gcc 960
Gln Glu Arg Ser Ser Ile Ala Ala Gly Lys Pro Pro Leu Phe Ala Ala
305 310 315 320
ggc aag gcc act tca ggc aac atc tcc gtc ttc gcc tcc gcg gcc gcc 1008
Gly Lys Ala Thr Ser Gly Asn Ile Ser Val Phe Ala Ser Ala Ala Ala
325 330 335
gcc atg gcg gcg gcc gct gca atc tga 1035
Ala Met Ala Ala Ala Ala Ala Ile *
340
<210>70
<211>1284
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT7 encoding sequence
<221>CDS
<222>(1)...(1284)
<400>70
atg gca gcg act ggt cga aac gcg gcc gca cga cgg aca cgc cgc tcg 48
Met Ala Ala Thr Gly Arg Asn Ala Ala Ala Arg Arg Thr Arg Arg Ser
1 5 10 15
atc ccc cgc gcg gct gcc gtg ctc ccc ctc tcg tct gga tca ccg gcg 96
Ile Pro Arg Ala Ala Ala Val Leu Pro Leu Ser Ser Gly Ser Pro Ala
20 25 30
gct gtg ctg agg cga ctg ggg ctc ggt gag tgt ttt ggg tgg gcc ggc 144
Ala Val Leu Arg Arg Leu Gly Leu Gly Glu Cys Phe Gly Trp Ala Gly
35 40 45
ttt atg agc agt ctc ggt ttg aag atc cgc acc gtc gtc cgc tca cct 192
Phe Met Ser Ser Leu Gly Leu Lys Ile Arg Thr Val Val Arg Ser Pro
50 55 60
atg gcg gcc gcg gcc gtc gct ggc gtc gga agg gat ggt agc ttc gcc 240
Met Ala Ala Ala Ala Val Ala Gly Val Gly Arg Asp Gly Ser Phe Ala
65 70 75 80
tcc cag aag cgg cca cgt cgg gtt agt gtg aga atg gag aga agc aga 288
Ser Gln Lys Arg Pro Arg Arg Val Ser Val Arg Met Glu Arg Ser Arg
85 90 95
gtc ggg gac ggt tgc tgc tgc tcc tgc tct ggc cgc ggc ggg gtg gcg 336
Val Gly Asp Gly Cys Cys Cys Ser Cys Ser Gly Arg Gly Gly Val Ala
100 105 110
tcc act acg gcg gtc cgg ccg tcc acg ggg atg gtg gtg atc gtc ggc 384
Ser Thr Thr Ala Val Arg Pro Ser Thr Gly Met Val Val Ile Val Gly
115 120 125
gcc acg ggc acg ggg aag acc aag ctt tcc atc gac gcg gcg cag gag 432
Ala Thr Gly Thr Gly Lys Thr Lys Leu Ser Ile Asp Ala Ala Gln Glu
130 135 140
ctc gcc ggc gag gtg gtg aac gct gac aag att cag ctg tac gac ggc 480
Leu Ala Gly Glu Val Val Asn Ala Asp Lys Ile Gln Leu Tyr Asp Gly
145 150 155 160
ctc gac gtc acc acg aac aag gtg tcg ctc gcc gac cgc cgg ggc gtc 528
Leu Asp Val Thr Thr Asn Lys Val Ser Leu Ala Asp Arg Arg Gly Val
165 170 175
ccg cac cac ctc ctc ggc gca atc cgc gcc gag gcc ggg gag ctg ccg 576
Pro His His Leu Leu Gly Ala Ile Arg Ala Glu Ala Gly Glu Leu Pro
180 185 190
ccg tcg tcg ttc cgc tcg ctc gcc gcc gcc gcc gcg gcc ggc atc gcg 624
Pro Ser Ser Phe Arg Ser Leu Ala Ala Ala Ala Ala Ala Gly Ile Ala
195 200 205
tcg cgc ggg cgc gtg ccg gtc gtg gcc ggc ggg tcc aac tcg ctc atc 672
Ser Arg Gly Arg Val Pro Val Val Ala Gly Gly Ser Asn Ser Leu Ile
210 215 220
cac gcg ctc ctc gct gac ccc atc gat gcc gcg ccg cgt gac cct ttc 720
His Ala Leu Leu Ala Asp Pro Ile Asp Ala Ala Pro Arg Asp Pro Phe
225 230 235 240
gcg gac gcc gat gtc ggg tac cgg ccg gcg ctc cgg ttc ccg tgc tgc 768
Ala Asp Ala Asp Val Gly Tyr Arg Pro Ala Leu Arg Phe Pro Cys Cys
245 250 255
ctc ctc tgg gtc gac gtc gac gac gat gtt ctc gac gaa tac ctc gac 816
Leu Leu Trp Val Asp Val Asp Asp Asp Val Leu Asp Glu Tyr Leu Asp
260 265 270
cgg cgc gtg gac gac atg gtc ggc gag ggg atg gtc gag gag ctc gag 864
Arg Arg Val Asp Asp Met Val Gly Glu Gly Met Val Glu Glu Leu Glu
275 280 285
gaa tac ttc gcg acg acg tcg gcc tcg gag cgg gcc tcg cac gcc ggg 912
Glu Tyr Phe Ala Thr Thr Ser Ala Ser Glu Arg Ala Ser His Ala Gly
290 295 300
ctg ggc aag gcc atc ggc gtg ccg gag ctc ggc gac tac ttc gcc ggg 960
Leu Gly Lys Ala Ile Gly Val Pro Glu Leu Gly Asp Tyr Phe Ala Gly
305 310 315 320
cgc aag agc ctc gac gcg gcg ata gac gag atc aag gcc aac acg cgg 1008
Arg Lys Ser Leu Asp Ala Ala Ile Asp Glu Ile Lys Ala Asn Thr Arg
325 330 335
gtc ctc gcg gcc cgc cag gtc ggc aag atc cga cgc atg gcc gac gtt 1056
Val Leu Ala Ala Arg Gln Val Gly Lys Ile Arg Arg Met Ala Asp Val
340 345 350
tgg ggc tgg ccc atc cgc cgc ctc gac gcc acg gcc acc atc cgg gcg 1104
Trp Gly Trp Pro Ile Arg Arg Leu Asp Ala Thr Ala Thr Ile Arg Ala
355 360 365
cgg ctc tcc ggc gcc ggc cgc gcc gcc gag gcc gcc gcg tgg gag cgc 1152
Arg Leu Ser Gly Ala Gly Arg Ala Ala Glu Ala Ala Ala Trp Glu Arg
370 375 380
gac gtg cgc ggg cca ggc ctc gcc gcg atg cgt cag ttc gtc ggc cgc 1200
Asp Val Arg Gly Pro Gly Leu Ala Ala Met Arg Gln Phe Val Gly Arg
385 390 395 400
gcc gac ttc aac gcc gca gcg gtc gac cag cta gcc gcg cgg agt cgg 1248
Ala Asp Phe Asn Ala Ala Ala Val Asp Gln Leu Ala Ala Arg Ser Arg
405 410 415
agg caa tgc ctt cgc ggt ggc atg gtg gcc ggc tga 1284
Arg Gln Cys Leu Arg Gly Gly Met Val Ala Gly *
420 425
<210>71
<211>1353
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT8 encoding sequence
<221>CDS
<222>(1)...(1353)
<400>71
atg gcc cac ctc gcg gcc tct gcc gcc ccg ctt cca agc gct gac ccc 48
Met Ala His Leu Ala Ala Ser Ala Ala Pro Leu Pro Ser Ala Asp Pro
1 5 10 15
gac gcc ggc gag gag tcc tcc cac tct ccg ccg ccg ccg gag aag ggg 96
Asp Ala Gly Glu Glu Ser Ser His Ser Pro Pro Pro Pro Glu Lys Gly
20 25 30
ctg agg aag gtg gtg gtg gtg atg ggc gcg act ggc gcc ggc aag tcg 144
Leu Arg Lys Val Val Val Val Met Gly Ala Thr Gly Ala Gly Lys Ser
35 40 45
cgg ctg gcc gtc gac ctc gcg agc cac ttc gcc ggc gtc gag gtg gtc 192
Arg Leu Ala Val Asp Leu Ala Ser His Phe Ala Gly Val Glu Val Val
50 55 60
agc gcc gac tcc atg caa gtc tac ggt ggg ctc gat gtc ctc acc aac 240
Ser Ala Asp Ser Met Gln Val Tyr Gly Gly Leu Asp Val Leu Thr Asn
65 70 75 80
aag gtc ccc ctc cac gag cag aaa ggc gtt cct cac cat ctc ctg agc 288
Lys Val Pro Leu His Glu Gln Lys Gly Val Pro His His Leu Leu Ser
85 90 95
gtg att gat ccc tct gtg gag ttc act tgc cgc gat ttc cgc gac cat 336
Val Ile Asp Pro Ser Val Glu Phe Thr Cys Arg Asp Phe Arg Asp His
100 105 110
gct gtg ccg att ata gaa ggt ata ttg gat cgt ggc ggc ctc cct gtt 384
Ala Val Pro Ile Ile Glu Gly Ile Leu Asp Arg Gly Gly Leu Pro Val
115 120 125
att gtt ggt ggt aca aac ttc tac atc cag gct ctt gtt agc cca ttc 432
Ile Val Gly Gly Thr Asn Phe Tyr Ile Gln Ala Leu Val Ser Pro Phe
130 135 140
ctc ttt gat gat atg gca cag gat att gag ggt ctt act tta aat gac 480
Leu Phe Asp Asp Met Ala Gln Asp Ile Glu Gly Leu Thr Leu Asn Asp
145 150 155 160
cac cta gat gag ata ggg ctt gat aat gat gat gaa gcc ggt ctg tat 528
His Leu Asp Glu Ile Gly Leu Asp Asn Asp Asp Glu Ala Gly Leu Tyr
165 170 175
gaa cat ttg aag aag att gat cct gtt gct gca caa agg ata cac ccg 576
Glu His Leu Lys Lys Ile Asp Pro Val Ala Ala Gln Arg Ile His Pro
180 185 190
aac aac cat cga aaa ata aaa cgc tac ctt gag ttg tat gaa tcc aca 624
Asn Asn His Arg Lys Ile Lys Arg Tyr Leu Glu Leu Tyr Glu Ser Thr
195 200 205
ggt gcc cta cct agt gat ctt ttc caa ggg caa gcc aca gag gac aga 672
Gly Ala Leu Pro Ser Asp Leu Phe Gln Gly Gln Ala Thr Glu Asp Arg
210 215 220
agt ggg gtc gac cta gta act cca gat ttg act gtt gtt tct tgt gat 720
Ser Gly Val Asp Leu Val Thr Pro Asp Lau Thr Val Val Ser Cys Asp
225 230 235 240
gct gat ctt cat gtt ctg gat cgt tat gtc aat gaa agg gtc gac tgc 768
Ala Asp Leu His Val Leu Asp Arg Tyr Val Asn Glu Arg Val Asp Cys
245 250 255
atg att gat gat ggc ctg cta gat gaa gtg tgt aac ata tat gat cga 816
Met Ile Asp Asp Gly Leu Leu Asp Glu Val Cys Asn Ile Tyr Asp Arg
260 265 270
gag gcc act tat acc caa ggg ctg cgg cag gcc att ggt gtt cgt gaa 864
Glu Ala Thr Tyr Thr Gln Gly Leu Arg Gln Ala Ile Gly Val Arg Glu
275 280 285
ttt gat gag ttt ttc aga ttt tat ttt gca agg aag gaa acc ggt ctc 912
Phe Asp Glu Phe Phe Arg Phe Tyr Phe Ala Arg Lys Glu Thr Gly Leu
290 295 300
cat gat gat aac ctg aag ggc tta ttg gat gaa gca gtc tca caa cta 960
His Asp Asp Asn Leu Lys Gly Leu Leu Asp Glu Ala Val Ser Gln Leu
305 310 315 320
aaa gca aac act cgc aga ctt gtt cga cgt caa aga cga agg ctg cat 1008
Lys Ala Asn Thr Arg Arg Leu Val Arg Arg Gln Arg Arg Arg Leu His
325 330 335
cgg ttg aat aaa tat ttt gag tgg aac ttg cgt cat att gat gca aca 1056
Arg Leu Asn Lys Tyr Phe Glu Trp Asn Leu Arg His Ile Asp Ala Thr
340 345 350
gaa gct ttc tat ggt gcc act gct gac tca tgg aac atg aaa gtt gtg 1104
Glu Ala Phe Tyr Gly Ala Thr Ala Asp Ser Trp Asn Met Lys Val Val
355 360 365
aaa cct tgc gtg gat att gtt aga gat ttc ttg tct gat gat aca att 1152
Lys Pro Cys Val Asp Ile Val Arg Asp Phe Leu Ser Asp Asp Thr Ile
370 375 380
ttg gca agc aga gat ggt tct agt gta act gga agc cct agg atg tct 1200
Leu Ala Ser Arg Asp Gly Ser Ser Val Thr Gly Ser Pro Arg Met Ser
385 390 395 400
tca aga gag ttg tgg act caa tat gtt tgt gag gcc tgt gat aac cgg 1248
Ser Arg Glu Leu Trp Thr Gln Tyr Val Cys Glu Ala Cys Asp Asn Arg
405 410 415
gta ctt cgg gga acg cat gag tgg gag caa cac aag caa ggc cga tgc 1296
Val Leu Arg Gly Thr His Glu Trp Glu Gln His Lys Gln Gly Arg Cys
420 425 430
cac cgt aaa aga gta caa cgt ttg aaa cag aag gct agt aca gtg ata 1344
His Arg Lys Arg Val Gln Arg Leu Lys Gln Lys Ala Ser Thr Val Ile
435 440 445
tca tta tag 1353
Ser Leu *
450
<210>72
<211>1368
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT9 encoding sequence
<221>CDS
<222>(1)...(1368)
<400>72
atg acc agc gtt gcc acc agg att gcc acg ctc gtg cgg gcc gcg gcg 48
Met Thr Ser Val Ala Thr Arg Ile Ala Thr Leu Val Arg Ala Ala Ala
1 5 10 15
gcg gcg agc cgg cca ttg cgg ctc cac cgc cgg ccc ggc ggc gag gat 96
Ala Ala Ser Arg Pro Leu Arg Leu His Arg Arg Pro Gly Gly Glu Asp
20 25 30
acg agg atg gtg gtg atc gtc ggc gcc acg ggc acc ggg aag acc aag 144
Thr Arg Met Val Val Ile Val Gly Ala Thr Gly Thr Gly Lys Thr Lys
35 40 45
ctg tcc atc gac gcc gcc aag gtg atc ggc ggc gag gtt gtc aac gcc 192
Leu Ser Ile Asp Ala Ala Lys Val Ile Gly Gly Glu Val Val Asn Ala
50 55 60
gac aag att cag ctc tat gac ggc ctc gac gtg acc acc aac aag gtg 240
Asp Lys Ile Gln Leu Tyr Asp Gly Leu Asp Val Thr Thr Asn Lys Val
65 70 75 80
agc ctc gcc gac cgc cgc ggc gtg ccg cac cac ctc ctc gga gcc atc 288
Ser Leu Ala Asp Arg Arg Gly Val Pro His His Leu Leu Gly Ala Ile
85 90 95
cgc ccc gag gcc ggc gag ctc ccg ccg tcg tcc ttc cgg tcc ctc gcc 336
Arg Pro Glu Ala Gly Glu Leu Pro Pro Ser Ser Phe Arg Ser Leu Ala
100 105 110
gcc gcc acg gcc gcg tcg atc gcg gcg agg cgg ctc gtg ccg gtc atc 384
Ala Ala Thr Ala Ala Ser Ile Ala Ala Arg Arg Leu Val Pro Val Ile
115 120 125
gcc ggt ggg tcg aac tcc ctc atc cac gcc ctc ctc gcc gac cac ttc 432
Ala Gly Gly Ser Asn Ser Leu Ile His Ala Leu Leu Ala Asp His Phe
130 135 140
gac gcc tcc gct ggc gat ccc ttc tcc ccc gcc gcc gcc ttc cgc cac 480
Asp Ala Ser Ala Gly Asp Pro Phe Ser Pro Ala Ala Ala Phe Arg His
145 150 155 160
tac cgc ccg gcg ctc cgg ttc ccg tgc tgc ctg ctc tgg gtc cac gtc 528
Tyr Arg Pro Ala Leu Arg Phe Pro Cys Cys Leu Leu Trp Val His Val
165 170 175
gat gag gcg ctc ctc gac gag tac ctc gac cgc cgc gtg gac gac atg 576
Asp Glu Ala Leu Leu Asp Glu Tyr Leu Asp Arg Arg Val Asp Asp Met
180 185 190
gtg gac gct ggc atg gtc gag gag ctc cgg gag tac ttc gcc acg aca 624
Val Asp Ala Gly Met Val Glu Glu Leu Arg Glu Tyr Phe Ala Thr Thr
195 200 205
acc gcc gcg gag cgc gcc gcg cac tcc ggg ctg ggc aag gcc atc ggc 672
Thr Ala Ala Glu Arg Ala Ala His Ser Gly Leu Gly Lys Ala Ile Gly
210 215 220
gtc ccc gag ctc ggc gac tac ttc gcc ggg cgc aag acc ttc tcc gag 720
Val Pro Glu Leu Gly Asp Tyr Phe Ala Gly Arg Lys Thr Phe Ser Glu
225 230 235 240
gcg atc gac gac atc aaa gcc aac acc cgc gtc ctc gcc gcc gcg cag 768
Ala Ile Asp Asp Ile Lys Ala Asn Thr Arg Val Leu Ala Ala Ala Gln
245 250 255
gtg tcc aag atc cgc cgc atg tcc gac gcc tgg ggc tgg ccc atc cac 816
Val Ser Lys Ile Arg Arg Met Ser Asp Ala Trp Gly Trp Pro Ile His
260 265 270
cgc ctc gac gcc tcc gac aca gtc cgc gcc agg ctc acg cgg gcg ggc 864
Arg Leu Asp Ala Ser Asp Thr Val Arg Ala Arg Leu Thr Arg Ala Gly
275 280 285
tcc gcc gcc gag tcc gcc tcc tgg gag cgc gac gtg cgc ggc cca ggc 912
Ser Ala Ala Glu Ser Ala Ser Trp Glu Arg Asp Val Arg Gly Pro Gly
290 295 300
ctc gcc acc atc cgc agc ttc ctc gcc gat cag tca ccg cca ccg cgc 960
Leu Ala Thr Ile Arg Ser Phe Leu Ala Asp Gln Ser Pro Pro Pro Arg
305 310 315 320
agc gag ggc acc aac gac tac ctg tac gcc atg gag acg gaa cca gag 1008
Ser Glu Gly Thr Asn Asp Tyr Leu Tyr Ala Met Glu Thr Glu Pro Glu
325 330 335
ccg ccg ccg ccg ccg acg ttg ccg ccg cgg ctg ctc cgg ttg ccg cgg 1056
Pro Pro Pro Pro Pro Thr Leu Pro Pro Arg Leu Leu Arg Leu Pro Arg
340 345 350
atg cag tac tgc gac atg gtg ggc aga att tgt gta ctc ttt ctt gga 1104
Met Gln Tyr Cys Asp Met Val Gly Arg Ile Cys Val Leu Phe Leu Gly
355 360 365
gag gtg gtg att cat cac atc gct ctc ctc cta acc gcg gca ctt ata 1152
Glu Val Val Ile His His Ile Ala Leu Leu Leu Thr Ala Ala Leu Ile
370 375 380
ctc cag tcc agt act ttt gcc tgt acc atc gct gca gtg tac gaa tgc 1200
Leu Gln Ser Ser Thr Phe Ala Cys Thr Ile Ala Ala Val Tyr Glu Cys
385 390 395 400
caa gtc tcc tgg ata atc gca agc ttt gcc tcc ggc cta ttt tgc agg 1248
Gln Val Ser Trp Ile Ile Ala Ser Phe Ala Ser Gly Leu Phe Cys Arg
405 410 415
att gct gta ctg gat gag aca gtc aag gag tta gat att tgg aag ctt 1296
Ile Ala Val Leu Asp Glu Thr Val Lys Glu Leu Asp Ile Trp Lys Leu
420 425 430
aag ata gcc aat gga ttt cta aaa att aca atg tgt ctg aaa gat tgg 1344
Lys Ile Ala Asn Gly Phe Leu Lys Ile Thr Met Cys Leu Lys Asp Trp
435 440 445
tca ggc tat ccc ctt gga gtg tga 1368
Ser Gly Tyr Pro Leu Gly Val *
450 455
<210>73
<211>1758
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT10 encoding sequence
<221>CDS
<222>(1)...(1758)
<400>73
atg aag atc tac att caa gcc agg gaa gag aag tgt caa gga cat gtg 48
Met Lys Ile Tyr Ile Gln Ala Arg Glu Glu Lys Cys Gln Gly His Val
1 5 10 15
ttc aag tcc cgc cac ctt cga gcc aac aaa gag gca gca ctc cag gat 96
Phe Lys Ser Arg His Leu Arg Ala Asn Lys Glu Ala Ala Leu Gln Asp
20 25 30
gcg tcg cgt gag gca ttc atg cgt cta tgt aag atc tac agc atc gag 144
Ala Ser Arg Glu Ala Phe Met Arg Leu Cys Lys Ile Tyr Ser Ile Glu
35 40 45
gtt gcg agt act ccg ttc ttt cta cat cca ttc cgt gaa tgc ggt gac 192
Val Ala Ser Thr Pro Phe Phe Leu His Pro Phe Arg Glu Cys Gly Asp
50 55 60
cgc cgc tgc cat att cgg aaa ttt agg ggc ttt gag gag cac tct ccc 240
Arg Arg Cys His Ile Arg Lys Phe Arg Gly Phe Glu Glu His Ser Pro
65 70 75 80
atc cac ttc tcc atg tgg atg tgg gct gca gac gag gcc tat gag gag 288
Ile His Phe Ser Met Trp Met Trp Ala Ala Asp Glu Ala Tyr Glu Glu
85 90 95
gcc tta gag gaa tta gat atg ctt cgg tca aag att gcc ggc tgg gag 336
Ala Leu Glu Glu Leu Asp Met Leu Arg Ser Lys Ile Ala Gly Trp Glu
100 105 110
gag cgg tac aac cac ctt gct aaa gaa cac acc act cgt gga caa cta 384
Glu Arg Tyr Asn His Leu Ala Lys Glu His Thr Thr Arg Gly Gln Leu
115 120 125
ttg gaa gca atc aag ctt cgc ctc cag tgg tat ttt cga acc cca tct 432
Leu Glu Ala Ile Lys Leu Arg Leu Gln Trp Tyr Phe Arg Thr Pro Ser
130 135 140
caa gct caa atc caa cgg act ttg tca cca cca cca caa aga gtg aca 480
Gln Ala Gln Ile Gln Arg Thr Leu Ser Pro Pro Pro Gln Arg Val Thr
145 150 155 160
aga agt gat ggt gag gac tat agt caa atc aat gca cag cag gca tgt 528
Arg Ser Asp Gly Glu Asp Tyr Ser Gln Ile Asn Ala Gln Gln Ala Cys
165 170 175
ctg gaa agg tcc gaa gtt aaa ctt gat agg gca act tca caa gac tat 576
Leu Glu Arg Ser Glu Val Lys Leu Asp Arg Ala Thr Ser Gln Asp Tyr
180 185 190
ctg caa gga tac aag ccc cca tca gaa tcc ctc gac gct att gtt tgg 624
Leu Gln Gly Tyr Lys Pro Pro Ser Glu Ser Leu Asp Ala Ile Val Trp
195 200 205
cct ctt gtt gaa ggg aag cat gac aat aca agc agc ggt agg agg aat 672
Pro Leu Val Glu Gly Lys His Asp Asn Thr Ser Ser Gly Arg Arg Asn
210 215 220
gag aag gca tgg gaa atg gca aaa caa gtg cct aga gga agg att tat 720
Glu Lys Ala Trp Glu Met Ala Lys Gln Val Pro Arg Gly Arg Ile Tyr
225 230 235 240
gct ttg gtc tat aaa cat caa gac aat att gga ctg gtc ctt gaa aag 768
Ala Leu Val Tyr Lys His Gln Asp Asn Ile Gly Leu Val Leu Glu Lys
245 250 255
aga gtt gga cca gct gca cat cta gga gac cgc tat gta agt gac agg 816
Arg Val Gly Pro Ala Ala His Leu Gly Asp Arg Tyr Val Ser Asp Arg
260 265 270
gtc ata tca cat cta gga gac ctc tat gta ata cga acc ctt agc tac 864
Val Ile Ser His Leu Gly Asp Leu Tyr Val Ile Arg Thr Leu Ser Tyr
275 280 285
ttt cct ttc atg ctc aat ttt cac cct tct tgt gat tgc ttc ctc aat 912
Phe Pro Phe Met Leu Asn Phe His Pro Ser Cys Asp Cys Phe Leu Asn
290 295 300
atg ctg gga aac aag tta gta gtg att att ggt gcc acg gga act gga 960
Met Leu Gly Asn Lys Leu Val Val Ile Ile Gly Ala Thr Gly Thr Gly
305 310 315 320
aaa aca aga ctc tca att gag att gcc aag gcg att ggt ggg gaa gtg 1008
Lys Thr Arg Leu Ser Ile Glu Ile Ala Lys Ala Ile Gly Gly Glu Val
325 330 335
gta aat ggt gac aag atg caa att tat gat ggc ctg gat att acg aca 1056
Val Asn Gly Asp Lys Met Gln Ile Tyr Asp Gly Leu Asp Ile Thr Thr
340 345 350
aac aag gtt tct tta caa gat cga tgc ggc ata cct cat cac ctt att 1104
Asn Lys Val Ser Leu Gln Asp Arg Cys Gly Ile Pro His His Leu Ile
355 360 365
gcg tcc atc cct cac aac gca ggt gat ttt cct gtg tca ttt ttt cga 1152
Ala Ser Ile Pro His Asn Ala Gly Asp Phe Pro Val Ser Phe Phe Arg
370 375 380
tat gct gca aaa acc aca ata aac tgc att gcc aga cgt ggt cac aca 1200
Tyr Ala Ala Lys Thr Thr Ile Asn Cys Ile Ala Arg Arg Gly His Thr
385 390 395 400
ccg att gtg gtg ggt gga tct aac tca ctt atc cat ggt ctc ctt gtt 1248
Pro Ile Val Val Gly Gly Ser Asn Ser Leu Ile His Gly Leu Leu Val
405 410 415
gac aat ttt gat ttg tct att gtg gat cct ttt ggg caa ttg gag gtt 1296
Asp Asn Phe Asp Leu Ser Ile Val Asp Pro Phe Gly Gln Leu Glu Val
420 425 430
agc tat cag ccg acg cct caa tgg caa tgt tgt ttt cta tgg gtt cat 1344
Ser Tyr Gln Pro Thr Pro Gln Trp Gln Cys Cys Phe Leu Trp Val His
435 440 445
gtt aat gag gtg att ctt aat gag tat ttg aaa cgt cgt gtt gac ggc 1392
Val Asn Glu Val Ile Leu Asn Glu Tyr Leu Lys Arg Arg Val Asp Gly
450 455 460
atg gtt gat gct ggg tta gtt gag gaa att gaa gaa tat ttt gac aca 1440
Met Val Asp Ala Gly Leu Val Glu Glu Ile Glu Glu Tyr Phe Asp Thr
465 470 475 480
tta tca gtt aat gga cat gtt cca tat gtg gga tta ggg aag gcc att 1488
Leu Ser Val Asn Gly His Val Pro Tyr Val Gly Leu Gly Lys Ala Ile
485 490 495
ggt gtt cca gag cta agc gag tat ttt act gga cgg gtg agt tgt agt 1536
Gly Val Pro Glu Leu Ser Glu Tyr Phe Thr Gly Arg Val Ser Cys Ser
500 505 510
gat gct ctt tct atg atg aag acc aat aca cag att ctt gca cga tct 1584
Asp Ala Leu Ser Met Met Lys Thr Asn Thr Gln Ile Leu Ala Arg Ser
515 520 525
caa gtc aca aag att cat cgc atg gtt gat gtg tgg gga tgg cat gtt 1632
Gln Val Thr Lys Ile His Arg Met Val Asp Val Trp Gly Trp His Val
530 535 540
cat gcc ctt gat tgt act gaa act att cta gca cat ctt act gga tca 1680
His Ala Leu Asp Cys Thr Glu Thr Ile Lau Ala His Leu Thr Gly Ser
545 550 555 560
aat aag tat atg gag gat ttg gtg tgg aaa cgt gat gta agt gac tct 1728
Asn Lys Tyr Met Glu Asp Lau Val Trp Lys Arg Asp Val Ser Asp Ser
565 570 575
gga ctt gct gct ata caa gat ttt ctg tga 1758
Gly Leu Ala Ala Ile Gln Asp Phe Leu *
580 585
<210>74
<211>1773
<212>DNA
＜213〉paddy rice
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉OsIPT11 encoding sequence
<221>CDS
<222>(1)...(1773)
<400>74
atg gag aac tcc tca aag aaa acc caa gag ttc ttc cct aaa ggt ggg 48
Met Glu Asn Ser Ser Lys Lys Thr Gln Glu Phe Phe Pro Lys Gly Gly
1 5 10 15
aat gga ggt tat gct gag cag ctg gag ctc ttg ctg aag cag ctt cgt 96
Asn Gly Gly Tyr Ala Glu Gln Leu Glu Leu Leu Leu Lys Gln Leu Arg
20 25 30
ttt cct aac aag ccg atc cac cat gcg gag caa gtg atc aaa gga ttc 144
Phe Pro Asn Lys Pro Ile His His Ala Glu Gln Val Ile Lys Gly Phe
35 40 45
cgg aag gat tgg acg atg aag atc tac att caa gcc agg gaa gag aag 192
Arg Lys Asp Trp Thr Met Lys Ile Tyr Ile Gln Ala Arg Glu Glu Lys
50 55 60
tgt caa gga cat gtg ttc aag tcc cgc cac ctt cga gcc aac aaa gag 240
Cys Gln Gly His Val Phe Lys Ser Arg His Leu Arg Ala Asn Lys Glu
65 70 75 80
gca gca ctc cag gat gcg tcg cgt gag gca ttc atg cgt cta tgt aag 288
Ala Ala Leu Gln Asp Ala Ser Arg Glu Ala Phe Met Arg Leu Cys Lys
85 90 95
atc tac agc atc gag gtt gca agt act ccg ttc ttt cta cat cca ttc 336
Ile Tyr Ser Ile Glu Val Ala Ser Thr Pro Phe Phe Leu His Pro Phe
100 105 110
cgt gaa tgc ggt gac cgc cgc tgc cat att cgg aaa ttt agg ggc ttt 384
Arg Glu Cys Gly Asp Arg Arg Cys His Ile Arg Lys Phe Arg Gly Phe
115 120 125
gag gag cag tcg ccc atc cac ttc tcc atg tgg atg tgg gct gca gac 432
Glu Glu Gln Ser Pro Ile His Phe Ser Met Trp Met Trp Ala Ala Asp
130 135 140
gag gcc tat gag gag gcc tta gag gaa tta gat atg ctt cgg tca aag 480
Glu Ala Tyr Glu Glu Ala Leu Glu Glu Leu Asp Met Leu Arg Ser Lys
145 150 155 160
atc gcc ggc tgg gag gag cgg tac aac cac ctt gct aaa gaa cac acc 528
Ile Ala Gly Trp Glu Glu Arg Tyr Asn His Leu Ala Lys Glu His Thr
165 170 175
act cgt gga caa cta ttg gaa gca atc aag ctt cgc ctc cag tgg tat 576
Thr Arg Gly Gln Leu Leu Glu Ala Ile Lys Leu Arg Leu Gln Trp Tyr
180 185 190
ttt cga acc cca tct caa gct cat atc caa cgg act ttg cca cca cca 624
Phe Arg Thr Pro Ser Gln Ala His Ile Gln Arg Thr Leu Pro Pro Pro
195 200 205
cca caa aga gtg aca aga agt gat ggt gag gac tat agt caa atc aat 672
Pro Gln Arg Val Thr Arg Ser Asp Gly Glu Asp Tyr Ser Gln Ile Asn
210 215 220
gca cat cag gca tgt ctg gaa agg tcc gaa gtt aaa ctt gat agg gca 720
Ala His Gln Ala Cys Leu Glu Arg Ser Glu Val Lys Leu Asp Arg Ala
225 230 235 240
act tca caa gac tat ctg caa gga tac aag ccc cca tca gaa tcc ctc 768
Thr Ser Gln Asp Tyr Leu Gln Gly Tyr Lys Pro Pro Ser Glu Ser Leu
245 250 255
gac gct att gtt tgg cct ctt gtt gaa ggg aag cat gac aat aca agc 816
Asp Ala Ile Val Trp Pro Leu Val Glu Gly Lys His Asp Asn Thr Ser
260 265 270
agt ggt agg agg aat gag aag gca tgg gaa atg gca aaa caa gta ata 864
Ser Gly Arg Arg Asn Glu Lys Ala Trp Glu Met Ala Lys Gln Val Ile
275 280 285
cga acc ctt agc tac ttt cct ttc atg ctc aat ttt cac cct tct tgt 912
Arg Thr Leu Ser Tyr Phe Pro Phe Met Leu Asn Phe His Pro Ser Cys
290 295 300
gat tgc ttc ctc aat atg ctg gga aac aag tta gta gtg att att ggt 960
Asp Cys Phe Leu Asn Met Leu Gly Asn Lys Leu Val Val Ile Ile Gly
305 310 315 320
gcc acg gga act gga aaa aca aga ctc tca att gag ata gcc aag gcg 1008
Ala Thr Gly Thr Gly Lys Thr Arg Leu Ser Ile Glu Ile Ala Lys Ala
325 330 335
att ggt ggg gaa gtg gta aat gct gac aag atg caa att tac gat ggc 1056
Ile Gly Gly Glu Val Val Asn Ala Asp Lys Met Gln Ile Tyr Asp Gly
340 345 350
ctg gat att acg aca aac aag gtt tct tta caa gat cga tgc ggc ata 1104
Leu Asp Ile Thr Thr Asn Lys Val Ser Leu Gln Asp Arg Cys Gly Ile
355 360 365
cct cat cac ctt att gcg tcc atc cct cgc aac gca ggt gat ttt cct 1152
Pro His His Leu Ile Ala Ser Ile Pro Arg Asn Ala Gly Asp Phe Pro
370 375 380
gtg tca ttt ttt cga tct gct gca aaa acc aca ata aac tgc att gcc 1200
Val Ser Phe Phe Arg Ser Ala Ala Lys Thr Thr Ile Asn Cys Ile Ala
385 390 395 400
aga cgt ggt cac aca ccg att gtg gtg ggt gga tct aac tca ctt atc 1248
Arg Arg Gly His Thr Pro Ile Val Val Gly Gly Ser Asn Ser Leu Ile
405 410 415
cat ggt ctc ctt gtt gac aat ttt gat tcg tct att gtg gat cct ttt 1296
His Gly Leu Leu Val Asp Asn Phe Asp Ser Ser Ile Val Asp Pro Phe
420 425 430
ggg caa ttg gag gtt agc tat cgg ccg acg cct cga tcg caa tgt tgt 1344
Gly Gln Leu Glu Val Ser Tyr Arg Pro Thr Pro Arg Ser Gln Cys Cys
435 440 445
ttt cta tgg gtt cat gtt aat gag gtg att ctt aat gag tat ttg aaa 1392
Phe Leu Trp Val His Val Asn Glu Val Ile Leu Asn Glu Tyr Leu Lys
450 455 460
cgt cgt gtt gac aac atg gtt gat gct ggg tta gtt gag gaa att gaa 1440
Arg Arg Val Asp Asn Met Val Asp Ala Gly Leu Val Glu Glu Ile Glu
465 470 475 480
gaa tat ttt gac aca tta tca gtt aat gga cat gtt cca tat gtg gga 1488
Glu Tyr Phe Asp Thr Leu Ser Val Asn Gly His Val Pro Tyr Val Gly
485 490 495
tta ggg aag gcc att ggt gtt cca gag cta agc gag tat ttt act gga 1536
Leu Gly Lys Ala Ile Gly Val Pro Glu Leu Ser Glu Tyr Phe Thr Gly
500 505 510
cgg gtg agt tgt agt gat gct ctt tct atg atg aag acc aat aca cag 1584
Arg Val Ser Cys Ser Asp Ala Leu Ser Met Met Lys Thr Asn Thr Gln
515 520 525
att ctt gca cga tct caa gtc aca aag att cat cgc atg gtt gat gtg 1632
Ile Leu Ala Arg Ser Gln Val Thr Lys Ile His Arg Met Val Asp Val
530 535 540
tgg gga tgg cat gtt cat gcc ctt gat tgt act gaa act att cta gca 1680
Trp Gly Trp His Val His Ala Leu Asp Cys Thr Glu Thr Ile Leu Ala
545 550 555 560
cat ctt act gga tca aat aag tat atg gag gat ttg gtg tgg aaa cgt 1728
His Leu Thr Gly Ser Asn Lys Tyr Met Glu Asp Leu Val Trp Lys Arg
565 570 575
gat gta agt gac cct gga ctt gct gct ata caa gat ttt ctg tga 1773
Asp Val Ser Asp Pro Gly Leu Ala Ala Ile Gln Asp Phe Leu *
580 585 590
<210>75
<211>3280
<212>DNA
＜213〉corn
<220>
＜221〉promotor
<222>(1)...(3280)
＜223〉ZmIPT2 promotor (from Mo17)
<400>75
tagtcagaga ggagccaaca acaatgccct ttgaggtggt taaaacctag agggtgaaga 60
agggcttctt tggccatcaa tgaaggatta taaaatcatg gaaccacttg ttactcaatc 120
tctcactatt tgtctattcg atgtgtgatg aagcgttgat gatacattgt gtgttggcac 180
atgggcttgt gttctactca ttacgtaggc catgtgatag gtgagtagtg gctaactcga 240
caagtggtga tcaagtgagg tagggttaca tagtttttat atatatgata ttatttgggc 300
atatattata cctatattat tgggcttatt ttggtcagta tttgaaatgc attctataat 360
gttcgaaggc cctaacgggt aaccaagaag ggtacatagg aaacaggttg attgtaatgt 420
attcgatatc cttctaaaat ttggccataa agccctttat ggggagtgaa aacaacccat 480
caatgtctcg taacggagaa atccctatta tttataaggg attgggcccc atttccatgc 540
ctacggaatg cttatattac aagtgcactc tagaaatgta acttgcacat ggatgacatg 600
attaggattg gtggcatgtg atacaattcc tttttttatt ccacattttt atttgacttt 660
ggtttttagt attttttgtt tgtcctggac acccggtcac tggagtccac ttccttgtca 720
atgaacctta actacccacc accaaaaaat ccctctttct actttcatta tattggtata 780
attgctacag ctaccttgtt agttgcaaaa gactagtccc attgccttac tagtgaccct 840
aatggagggc tacatatcct tggtagatgt ggaggtacca atggttccat cacatccatt 900
agattaggag gacaccatga tagacactag tctcaatatt aaacatagtt cttgttttta 960
ttttaaaatc gaaagcatta ttttgtttta aattctttta gtcgaaataa acttttaaaa 1020
cttcctagtt caatgaagtt tttctaaact tgaaactatg tgtattgttt gtacttgaaa 1080
cttttgactg gagagtttat acttgttggc atttatatga ttgctttatg cttaggacaa 1140
tatacctatt gggcttattt aacttggtca gcgcatgaaa ctctttgtat aaattccaaa 1200
ggcccttgat gggcactcgc tttttattcc ttcgggtagc aaaaacaagg caacacaagt 1260
aagaatgatt aaagcttctc cgcttaatag cttctccttc tgaaatctac cgaggagaga 1320
aggtaaagga gaagctttga cagcttctcc cctcgataac ttctccttct aaaatctatc 1380
aaggggagaa ggtaaagaag aagctttgac atctctttaa ttactaatca aaggacaaaa 1440
caaaagagat tcttattcaa tacattcccg tctagaatca gctttcattc ttgcaacgca 1500
acaacaatta caaatatacc ttctacctcg gtaataggag aaggtatctt tggaggcaga 1560
gcagattagt gttccaagtt cctgctccct ctcaaatgca tggtattgtt gctctattta 1620
tagccacggg gtacagcttt gtatgaaatt acaaacatac ccacaaactt atacaattgg 1680
actaatgaat acataagggg taatgcagtc atttttgttc acttgcctcg ccaatcgggt 1740
ctcttgggtt tctcaccttc ttctcttctt tgatcttcgt tatgtgttgg tcgaagcttc 1800
cttcggcaca taccttcgtg gttggtgctt tgaagcttct ccttcctagt ttttaagatt 1860
ttccaaagga gcttctcctt cctagttttg aagcttctcc gaaggatctt ctcctttcta 1920
gtttttaagc ttctccaaag tagcttctcc tttgcatagt acttgaaatg tattcaatgt 1980
taaagggttt ttgaggatct tcggtgatag aggccctcca atagccgtca acatgggcca 2040
gtaattggga agggtacaca agaaatggta gcctaacccc atcatatata atatagggat 2100
aaattttggc catatagccc ttagtgggga gtgtaacaaa cctatcaagg cccctattcg 2160
gaggaaatcc tctacagaga ttggggcaca ttgtcatacc tattgagatg tttattaaac 2220
acatgcactc ataatgttta tttaaatgta acttgtggat cgatgacgtg atcaagacct 2280
atttttttca cagacctatt tctcctattt tcatccacat tcgtgtaatc tcatttgtct 2340
ctcgtctcta gtcttttctt ttaagttgga aacattattt gtttttaaat cctttctagt 2400
caaagtttta gacaagggaa catatcaggt gcaaccatac cccattagtg taaccgtgca 2460
accaagacac aagaatggtg gtgggaggac cattttaaaa aaattctctt ccacctccat 2520
ccttgtcttg gttgcacggt agcaccaaca gatatggttg catctcatat atatgttccc 2580
tttaaacaaa tggttccatt taaaactttc tagttgaatg aagttttttt ctaaactcaa 2640
ctctttttgt attatttgta agtgaaaatt ttgactttgc gtgtttagac ttcaaactta 2700
attatttcct gctgtgctag aggacaacta gtaccaaaac ccaccaagtt cagtcaggta 2760
gaaatttact caagattatg atatggtcgt ttctttgatt ggagtcaatc gatggagtcc 2820
atgaacccaa acatttccat cggcagtatt gaacgaagat ggcagagtaa agtttggtaa 2880
tctttagtgg ttacaattat agaaatctcg aaacattttt tgaagcaggt aataatgcat 2940
gagctctaaa gaaggaaaaa tataatatct gttaacacat agaatcgagt gctccaatag 3000
atttagatat taacatatat gcattggata tatggaaaaa aaggatactc atgatatgag 3060
cacattaaat ttcctccaag caaacctagt ataaaaaggg aggaatgggt agatgataga 3120
gcagctcgtt ccttaaacca aatacaccac aaatttcttc aaaacaaaca aacacgatac 3180
atactggtct ctgtgcacaa aaaaggcacg gactgcttct ttttctattt ttttgttgtg 3240
tgcacagaat cgagcggcta cgataatcaa gatcaagaca 3280
<210>76
<211>969
<212>DNA
＜213〉corn
<220>
<221>misc_feature
<222>(0)...(0)
＜223〉encoding sequence of the variant of ZmIPT2 (from Mo17)
<221>CDS
<222>(1)...(969)
<400>76
atg gag cac ggt gcc gtc gcc ggg aag ccc aag gtg gtg ttc gtg ctc 48
Met Glu His Gly Ala Val Ala Gly Lys Pro Lys Val Val Phe Val Leu
1 5 10 15
ggc gcg aca gcg aca ggg aag tcg aag ctc gcc atc gcc ctc gcc gag 96
Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu Ala Ile Ala Leu Ala Glu
20 25 30
cgc ttc aac ggt gag gtt atc aac gct gac aaa atc cag gtc cac gat 144
Arg Phe Asn Gly Glu Val Ile Asn Ala Asp Lys Ile Gln Val His Asp
35 40 45
ggc gtg ccc atc atc acg aac aag gtc aca gag gaa gag cag ggc ggg 192
Gly Val Pro Ile Ile Thr Asn Lys Val Thr Glu Glu Glu Gln Gly Gly
50 55 60
gtg ccc cac cac ctg ctc agc gtc cgc cac ccg gac gcc gac ttc act 240
Val Pro His His Leu Leu Ser Val Arg His Pro Asp Ala Asp Phe Thr
65 70 75 80
gcg gag gag ttc cga cgt gag gcg gcc agc gcc gtg gcc cgc gtg ctc 288
Ala Glu Glu Phe Arg Arg Glu Ala Ala Ser Ala Val Ala Arg Val Leu
85 90 95
tcg gcg ggc cgc ctc ccc gtc gtg gca ggc ggg tcc aac acc tac atc 336
Ser Ala Gly Arg Leu Pro Val Val Ala Gly Gly Ser Asn Thr Tyr Ile
100 105 110
gag gca ctg gtg gaa ggc gac ggt gcc gcc ttc cgc ttg gcg cac gac 384
Glu Ala Leu Val Glu Gly Asp Gly Ala Ala Phe Arg Leu Ala His Asp
115 120 125
ctc ctc ttc gtc tgg gtg gac gcg gag cgg gag ctg ttg gag tgg tac 432
Leu Leu Phe Val Trp Val Asp Ala Glu Arg Glu Leu Leu Glu Trp Tyr
130 135 140
gcc gcg ctg cgc gtg gac gag atg gtg gcc cgc ggg ctg gtg agc gag 480
Ala Ala Leu Arg Val Asp Glu Met Val Ala Arg Gly Leu Val Ser Glu
145 150 155 160
gct cgc gcg gcg ttt ggc ggc gcc gga gtt gac tac aac cat ggc gtg 528
Ala Arg Ala Ala Phe Gly Gly Ala Gly Val Asp Tyr Asn His Gly Val
165 170 175
cgc cgc gcc atc ggc ctg ccg gag atg cac gcc tac ctg gtg gcg gag 576
Arg Arg Ala Ile Gly Leu Pro Glu Met His Ala Tyr Leu Val Ala Glu
180 185 190
cac gag ggc gtc gcc ggg gag gcc gag ctc gcg gcc atg ctg gaa cgc 624
His Glu Gly Val Ala Gly Glu Ala Glu Leu Ala Ala Met Leu Glu Arg
195 200 205
gcg gtg cgc gag atc aag gac aac acc ttc cgc ctc gcg cgc acg cag 672
Ala Val Arg Glu Ile Lys Asp Asn Thr Phe Arg Leu Ala Arg Thr Gln
210 215 220
gcg gag aag atc cgg cgc ctc agc acg ctt gac ggc tgg gac gtc cgc 720
Ala Glu Lys Ile Arg Arg Leu Ser Thr Leu Asp Gly Trp Asp Val Arg
225 230 235 240
cgc atc gac gtg acc ccc gtg ttc gcg cgc aag gcc gat ggc act gag 768
Arg Ile Asp Val Thr Pro Val Phe Ala Arg Lys Ala Asp Gly Thr Glu
245 250 255
tgc cac gag ctg act tgg aag aag cag gtg tgg gag ccg tgc gag gag 816
Cys His Glu Leu Thr Trp Lys Lys Gln Val Trp Glu Pro Cys Glu Glu
260 265 270
atg gtg agg gct ttc ctc gag ccg tcc ctg act gcc gtt cca ggt gtt 864
Met Val Arg Ala Phe Leu Glu Pro Ser Leu Thr Ala Val Pro Gly Val
275 280 285
gca gta act gaa gaa ggg aac gcc ggc gtc gtc gct act gct gca ccc 912
Ala Val Thr Glu Glu Gly Asn Ala Gly Val Val Ala Thr Ala Ala Pro
290 295 300
gct ggt gat gtc gtc gtc cca act ggc gat gtc gtc acc gcc gtg gct 960
Ala Gly Asp Val Val Val Pro Thr Gly Asp Val Val Thr Ala Val Ala
305 310 315 320
gat gca taa 969
Asp Ala *
<210>77
<211>322
<212>PRT
＜213〉corn
<400>77
Met Glu His Gly Ala Val Ala Gly Lys Pro Lys Val Val Phe Val Leu
1 5 10 15
Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu Ala Ile Ala Leu Ala Glu
20 25 30
Arg Phe Asn Gly Glu Val Ile Asn Ala Asp Lys Ile Gln Val His Asp
35 40 45
Gly Val Pro Ile Ile Thr Asn Lys Val Thr Glu Glu Glu Gln Gly Gly
50 55 60
Val Pro His His Leu Leu Ser Val Arg His Pro Asp Ala Asp Phe Thr
65 70 75 80
Ala Glu Glu Phe Arg Arg Glu Ala Ala Ser Ala Val Ala Arg Val Leu
85 90 95
Ser Ala Gly Arg Leu Pro Val Val Ala Gly Gly Ser Asn Thr Tyr Ile
100 105 110
Glu Ala Leu Val Glu Gly Asp Gly Ala Ala Phe Arg Leu Ala His Asp
115 120 125
Leu Leu Phe Val Trp Val Asp Ala Glu Arg Glu Leu Leu Glu Trp Tyr
130 135 140
Ala Ala Leu Arg Val Asp Glu Met Val Ala Arg Gly Leu Val Ser Glu
145 150 155 160
Ala Arg Ala Ala Phe Gly Gly Ala Gly Val Asp Tyr Asn His Gly Val
165 170 175
Arg Arg Ala Ile Gly Leu Pro Glu Met His Ala Tyr Leu Val Ala Glu
180 185 190
His Glu Gly Val Ala Gly Glu Ala Glu Leu Ala Ala Met Leu Glu Arg
195 200 205
Ala Val Arg Glu Ile Lys Asp Asn Thr Phe Arg Leu Ala Arg Thr Gln
210 215 220
Ala Glu Lys Ile Arg Arg Leu Ser Thr Leu Asp Gly Trp Asp Val Arg
225 230 235 240
Arg Ile Asp Val Thr Pro Val Phe Ala Arg Lys Ala Asp Gly Thr Glu
245 250 255
Cys His Glu Leu Thr Trp Lys Lys Gln Val Trp Glu Pro Cys Glu Glu
260 265 270
Met Val Arg Ala Phe Leu Glu Pro Ser Leu Thr Ala Val Pro Gly Val
275 280 285
Ala Val Thr Glu Glu Gly Asn Ala Gly Val Val Ala Thr Ala Ala Pro
290 295 300
Ala Gly Asp Val Val Val Pro Thr Gly Asp Val Val Thr Ala Val Ala
305 310 315 320
Asp Ala
<210>78
<211>25
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>78
atcatcaaga caatggagca cggtg 25
<210>79
<211>25
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>79
cgtccgctag ctacttatgc atcag 25
<210>80
<211>53
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>80
ggggacaagt ttgtacaaaa aagcaggctc aatggagcac ggtgccgtcg ccg 53
<210>81
<211>52
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>81
ggggaccact ttgtacaaga aagctgggtc ttatgcatcd gccacggcgg tg 52
<210>82
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉ZmIPT2-F primer
<400>82
tgttgtgtgc acagaatcga gcgg 24
<210>83
<211>25
<212>DNA
＜213〉artificial sequence
<220>
＜223〉ZmIPT2-R primer
<400>83
cgtccgctag ctacttatgc atcag 25
<210>84
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Mu TIR primer
<400>84
agagaagcca acgccawcgc ctcyatttcg tc 32
<210>85
<211>1495
<212>DNA
＜213〉corn
<220>
<221>CDS
<222>(83)...(1048)
<223>ZmIPT2 ORF
<221>polyA_signal
<222>(1411)...(1416)
<221>misc_featute
<222>(1214)...(1230)
＜223〉Lynx mark
<221>misc_feature
<222>(624)...(632)
＜223〉transposon
<400>85
aaaaggcacg gactgcttct ttttctattt tttgttgtgt gcacagaatc gagcggctac 60
aataatcaag atcatcaaga ca atg gag cac ggt gcc gtc gcc ggg aag ccc 112
Met Glu His Gly Ala Val Ala Gly Lys Pro
1 5 10
aag gtg gtg ttc gtg ctc ggc gcc aca gcg aca ggg aag tcg aag ctc 160
Lys Val Val Phe Val Leu Gly Ala Thr Ala Thr Gly Lys Ser Lys Leu
15 20 25
gcc atc gcc ctc gcc gag cgc ttc aac ggt gag gtt atc aac gct gac 208
Ala Ile Ala Leu Ala Glu Arg Phe Asn Gly Glu Val Ile Asn Ala Asp
30 35 40
aaa atc cag gtc cac gat ggc gtg ccc atc atc acg aac aag gtc aca 256
Lys Ile Gln Val His Asp Gly Val Pro Ile Ile Thr Asn Lys Val Thr
45 50 55
gag gaa gag cag ggc ggg gtg ccc cac cac ctg ctc agc gtc cgc cac 304
Glu Glu Glu Gln Gly Gly Val Pro His His Leu Leu Ser Val Arg His
60 65 70
ccg gac gcc gac ttc act gcg gag gag ttc cga cgt gag gcg gcc agc 352
Pro Asp Ala Asp Phe Thr Ala Glu Glu Phe Arg Arg Glu Ala Ala Ser
75 80 85 90
gcc gtg gcc cgc gtg ctc tcg gcg ggc cgc ctc ccc gtc gtg gca ggc 400
Ala Val Ala Arg Val Leu Ser Ala Gly Arg Leu Pro Val Val Ala Gly
95 100 105
ggg tcc aac acc tac atc gag gca ctg gtg gaa ggc gac ggc gcc gcc 448
Gly Ser Asn Thr Tyr Ile Glu Ala Leu Val Glu Gly Asp Gly Ala Ala
110 115 120
ttc cgc gcg gcg cac gac ctc ctc ttc gtc tgg gtg gac gcg gag cag 496
Phe Arg Ala Ala His Asp Leu Leu Phe Val Trp Val Asp Ala Glu Gln
125 130 135
gag ctg ctg gag tgg tac gcc gcg ctg cgc gtg gac gag atg gtg gcc 544
Glu Leu Leu Glu Trp Tyr Ala Ala Leu Arg Val Asp Glu Met Val Ala
140 145 150
cgc ggg ctg gtg agc gag gct cgc gcg gcg ttc ggc ggc gcc ggg gtt 592
Arg Gly Leu Val Ser Glu Ala Arg Ala Ala Phe Gly Gly Ala Gly Val
155 160 165 170
gac tac aac cat ggc gtg cgc cgc gcc atc ggc ctg ccg gag atg cac 640
Asp Tyr Asn His Gly Val Arg Arg Ala Ile Gly Leu Pro Glu Met His
175 180 185
gcc tac ctg gtg gcg gag cgc gag ggc gtc gct ggg gag gcc gag ctc 688
Ala Tyr Leu Val Ala Glu Arg Glu Gly Val Ala Gly Glu Ala Glu Leu
190 195 200
gcg gcc atg ctg gaa cgc gcg gtg cgc gag atc aag gac aac acc ttc 736
Ala Ala Met Leu Glu Arg Ala Val Arg Glu Ile Lys Asp Asn Thr Phe
205 210 215
cgc ctc gcg cgc acg cag gcg gag aag atc cgg cgc ctc agc acg ctc 784
Arg Leu Ala Arg Thr Gln Ala Glu Lys Ile Arg Arg Leu Ser Thr Leu
220 225 230
gac ggc tgg gac gtc cgc cgc atc gac gtg acc ccc gtg ttc gcg cgc 832
Asp Gly Trp Asp Val Arg Arg Ile Asp Val Thr Pro Val Phe Ala Arg
235 240 245 250
aag gcc gat ggc act gag tgc cac gag ctg act tgg aag aag cag gtg 880
Lys Ala Asp Gly Thr Glu Cys His Glu Leu Thr Trp Lys Lys Gln Val
255 260 265
tgg gag ccg tgc gag gag atg gtg agg gct ttc ctc gag ccg tcc ctg 928
Trp Glu Pro Cys Glu Glu Met Val Arg Ala Phe Leu Glu Pro Ser Leu
270 275 280
act gcc gtt cca ggt gtt gca gta act gaa gaa ggg aac gcc ggc gtc 976
Thr Ala Val Pro Gly Val Ala Val Thr Glu Glu Gly Asn Ala Gly Val
285 290 295
gtc gct act gct gca ccc gct ggt gat gtc gtc gtc cca act ggc gat 1024
Val Ala Thr Ala Ala Pro Ala Gly Asp Val Val Val Pro Thr Gly Asp
300 305 310
gtc gtc acc gcc gtg gct gat gca taagtagcta gcggacgtag cgcatgcatg 1078
Val Val Thr Ala Val Ala Asp Ala
315 320
caatgcatgc aggctggctg gctggcttaa ttagtgcctc cgacttgctt taaactcatg 1138
tagctgcgtc catgggagag ggtgagatac aagtttatgc gacttatatt tctttctaaa 1198
tttaaatgga tctcggatcc gtagtatctg gtttaatata attataatat ttccttcgaa 1258
ttattatata tatatgctca cactcagtta gggatatata ctccctccat tcactctatg 1318
tatttggatt catatgcaaa agtattttaa aattatacta cctccattct cgaatatttg 1378
ttacccgctt gtttattttc taaaacatga taaataaaaa aacggagaga atagtatttt 1438
attatttgtt gatgatatat tttgtaagat atgaacggtg aaagttttac cataaag 1495
<210>86
<211>71
<212>DNA
＜213〉artificial sequence
<220>
<223>IPT2 TIR L
<400>86
gagataattg ccattataga agaagagaga aggggattcg acgaaataga ggcgatggcg 60
ttggcttctc t 71
<210>87
<211>67
<212>DNA
＜213〉artificial sequence
<220>
<223>IPT2 TIR R
<400>87
aagccaacgc caacgcctct atttcgtcga atccccttct ctcttcttct ataatggcaa 60
ttatctc 67

Claims (44)

1. isolated polypeptide that comprises SEQ ID NO:2,6,9,12,15,18,23,27 or 77 aminoacid sequence.
2. isolated polypeptide that comprises SEQ ID NO:41,43,46,49,52,54,57,59,61,63 or 66 aminoacid sequence.
3. one kind comprises the isolated polypeptide that is selected from following aminoacid sequence:
(a) with SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 aminoacid sequences with at least 85% sequence identity, wherein said polypeptide has the phytokinin composite reactive.
(b) by with SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73, the complementary sequence of 74 or 76 represented polynucleotide, the aminoacid sequence of the polynucleotide encoding of hybridize under stringent condition, wherein said stringent condition is contained in 37 ℃ at 50% methane amide, 1MNaCl, hybridize among the 1%SDS, in 60 ℃ to 65 ℃ rinsings in 0.1 * SSC, wherein said polypeptide has the phytokinin composite reactive; And,
(d) comprise the aminoacid sequence of at least 50 continuous amino acids among the SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77, wherein said polypeptide has the phytokinin composite reactive.
4. separation polynucleotide that comprise SEQ ID NO:1,3,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28 or 76 nucleotide sequence.
5. separation polynucleotide that comprise SEQ ID NO:40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73 or 74 nucleotide sequence.
6. one kind comprises the separation polynucleotide that are selected from following nucleotide sequence:
(a) coding comprises the nucleotide sequence of SEQ ID NO:2,6,9,12,15,18,23,27,41,43,46,49,52,54,57,59,61,63,66 or 77 aminoacid sequence;
(b) comprise and SEQ ID NO:1,3,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76 nucleotide sequences with at least 85% sequence identity, wherein said polynucleotide encoding has the polypeptide of phytokinin composite reactive;
(c) comprise the nucleotide sequence of at least 50 continuous nucleotides among the SEQ ID NO:1,3,4,5,7,8,10,11,13,14,16,17,19,20,21,22,24,26,28,40,42,44,45,47,48,50,51,53,55,56,58,60,62,64,65,69,70,71,72,73,74 or 76, wherein said polynucleotide encoding has the polypeptide of phytokinin composite reactive; And,
(d) under stringent condition with a) in the nucleotide sequence shown in the polynucleotide of complementary sequence hybridization of the polynucleotide shown in the nucleotide sequence, wherein said stringent condition is included in 37 ℃ hybridizes in 50% methane amide, 1M NaCl, 1%SDS, in 60 ℃ to 65 ℃ rinsings in 0.1 * SSC.
7. transgenic plant, it comprises and start the polynucleotide that expression promoter can be operatively connected in plant, wherein said polynucleotide contain the nucleotide sequence of claim 6, and the phytokinin level in the wherein said plant compares with control plant.
8. the plant of claim 7, wherein said phytokinin level increases.
9. the plant of claim 7, wherein said phytokinin level reduces.
10. the plant of claim 7, wherein said polynucleotide are had a liking for type promotor, constitutive promoter or inducible promoter partially and can be operatively connected with organizing.
11. the plant of claim 10, wherein said promotor are roots has a liking for type promotor, leaf partially and have a liking for the type promotor partially, branch has a liking for the type promotor partially or inflorescence is had a liking for the type promotor partially.
12. the plant of claim 7, wherein said phytokinin level regulation and control can influence colored growth.
13. the plant of claim 7, wherein said phytokinin level regulation and control can influence the growth of root.
14. the plant of claim 7, wherein said plant has the shoot-root ratio of change.
15. the plant of claim 7, wherein seed size or seed weight increase.
16. the plant of claim 7, vigor of wherein said plant or biomass yield increase.
17. the plant of claim 7, the stress tolerance of wherein said plant increases.
18. the plant of claim 7, wherein said plant is a corn, and top grain abortion reduces.
19. the plant of claim 7, wherein said promotor be coerce insensitive and in or the seed of growing when closing on flowering period or relevant female parent tissue in expression.
20. the seed of the plant of a claim 7 through transforming.
21. the plant of claim 7, wherein said plant are corn, wheat, paddy rice, barley, jowar or rye.
22. a plant that has carried out genetic modification at the locus of natural gene group, described genomic locus comprises the polynucleotide of claim 6, and the phytokinin level of wherein said plant is regulated and control.
23. the method for a regulating cell mitogen level in plant comprises that the polynucleotide of using the claim 6 that can be operatively connected with promotor transform described plant.
24. the method for claim 23, the regulation and control of wherein said phytokinin level influence the growth or the shoot-root ratio of root.
25. the method for claim 23, the growth of the regulation and control influence flower of wherein said phytokinin level.
26. the method for claim 23, the regulation and control of wherein said phytokinin level increase seed size or seed weight.
27. the method for claim 23, the regulation and control of wherein said phytokinin level increase stress tolerance in plants.
28. the method for claim 23, the regulation and control of wherein said phytokinin level influence vigor or biomass yield.
29. the method for claim 23, the wherein said promotor that is operatively connected are to organize to have a liking for type and/or inducible promoter partially.
30. the method for claim 23, wherein said promotor be coerce insensitive and in or the seed of growing when closing on flowering period or relevant female parent tissue in expression.
31. the method for claim 23, wherein aging is delayed.
32. the method for claim 23, wherein the storehouse of plant seed is regulated and control by force.
33. the method for claim 32, wherein the phytokinin level among embryo, endosperm and proximal tissue thereof one or more increases.
34. the method for claim 33, wherein said proximal tissue comprises bennet.
35. a method of regulating and control branch regenerated speed or incidence in callus is included in the polynucleotide of expressing the claim 6 that can be operatively connected with allogeneic promoter in the described callus.
36. the method for claim 35, wherein said promotor is an induction type.
37. one kind contains the nucleotide sequence of SEQ ID NO:25 or 75 or the separation polynucleotide of its function fragment or variant.
38. a DNA construct that contains the promotor that can be operatively connected with the target nucleotide sequence, wherein said promotor contains the polynucleotide of claim 37.
39. expression vector that contains the DNA construct of claim 38.
40. plant that contains the DNA construct of at least one claim 38.
41. the method that the goal of regulation and control nucleotide sequence is expressed, described method comprises the DNA construct of introducing claim 38 in plant.
42. the method for claim 41, wherein said target nucleotide sequence are transcribed the RNA molecule that can disturb homology natural nucleotide sequence to express to form.
43. method of in plant, reducing ZmIPT1 or ZmIPT2 expression, comprise with following construct and transform described plant, described construct comprises the exercisable promotor that is connected of polynucleotide with the part of the polynucleotide that contain claim 37, thereby forms the hair clip molecule corresponding to ZmIPT1 promotor or ZmIPT2 promotor.
44. the method for claim 43, wherein said promotor is organized partially and is had a liking for.
CN2005800393688A 2004-09-17 2005-09-19 Isopentenyl transferase sequences and methods of use Expired - Fee Related CN101061228B (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US61065604P 2004-09-17 2004-09-17
US60/610,656 2004-09-17
US63723004P 2004-12-17 2004-12-17
US60/637,230 2004-12-17
US69640505P 2005-07-01 2005-07-01
US60/696,405 2005-07-01
PCT/US2005/033693 WO2006034286A2 (en) 2004-09-17 2005-09-19 Isopentenyl transferase sequences and methods of use

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN2012101300926A Division CN103074310A (en) 2004-09-17 2005-09-19 Isopentenyl transferase sequences and methods of use

Publications (2)

Publication Number Publication Date
CN101061228A true CN101061228A (en) 2007-10-24
CN101061228B CN101061228B (en) 2012-06-20

Family

ID=38866644

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2005800393688A Expired - Fee Related CN101061228B (en) 2004-09-17 2005-09-19 Isopentenyl transferase sequences and methods of use

Country Status (2)

Country Link
CN (1) CN101061228B (en)
ZA (1) ZA200702198B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014101153A1 (en) * 2012-12-31 2014-07-03 创世纪转基因技术有限公司 Cotton isopentenyl transferase ipt2, gene for encoding same, and application thereof
CN105624190A (en) * 2016-03-23 2016-06-01 东北农业大学 Breeding method for isopentenyl-acyltransferase transgenic corn
CN109762837A (en) * 2018-12-24 2019-05-17 中国医学科学院药用植物研究所 Regulate and control ubiquinone synthetic method using Radix Salviae Miltiorrhizae long-chain isopentenyl transferase genes SmPPS2
CN110857439A (en) * 2018-08-20 2020-03-03 中国烟草总公司黑龙江省公司牡丹江烟草科学研究所 Potato Y virus gene segment capable of efficiently generating siRNA, attenuated vaccine, preparation method and application thereof
CN112322592A (en) * 2019-08-05 2021-02-05 中国科学院天津工业生物技术研究所 CYP76B100 protein involved in alkannin biosynthesis, coding gene thereof and application thereof

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014101153A1 (en) * 2012-12-31 2014-07-03 创世纪转基因技术有限公司 Cotton isopentenyl transferase ipt2, gene for encoding same, and application thereof
CN105624190A (en) * 2016-03-23 2016-06-01 东北农业大学 Breeding method for isopentenyl-acyltransferase transgenic corn
CN110857439A (en) * 2018-08-20 2020-03-03 中国烟草总公司黑龙江省公司牡丹江烟草科学研究所 Potato Y virus gene segment capable of efficiently generating siRNA, attenuated vaccine, preparation method and application thereof
CN109762837A (en) * 2018-12-24 2019-05-17 中国医学科学院药用植物研究所 Regulate and control ubiquinone synthetic method using Radix Salviae Miltiorrhizae long-chain isopentenyl transferase genes SmPPS2
CN109762837B (en) * 2018-12-24 2020-12-15 中国医学科学院药用植物研究所 Method for regulating coenzyme Q synthesis by using salvia miltiorrhiza long-chain isopentenyl transferase gene SmPPS2
CN112322592A (en) * 2019-08-05 2021-02-05 中国科学院天津工业生物技术研究所 CYP76B100 protein involved in alkannin biosynthesis, coding gene thereof and application thereof
CN112322592B (en) * 2019-08-05 2021-12-28 中国科学院天津工业生物技术研究所 CYP76B100 protein involved in alkannin biosynthesis, coding gene thereof and application thereof

Also Published As

Publication number Publication date
ZA200702198B (en) 2008-08-27
CN101061228B (en) 2012-06-20

Similar Documents

Publication Publication Date Title
CN101939436B (en) Maize stress-responsive NAC transcription factors and promoter and methods of use
CN101495640B (en) Plants having enhanced yield-related traits and a method formaking the same
US8129512B2 (en) Methods of identifying and creating rubisco large subunit variants with improved rubisco activity, compositions and methods of use thereof
US20100199380A1 (en) Plants having enhanced yield-related traits and a method for making the same
US20140189910A1 (en) Plants having enhanced yield-related traits and a method for making the same
CN101952441B (en) Plants having enhanced yield-related traits and a method for making the same
MX2008000429A (en) Yield increase in plants overexpressing the accdp genes.
CN101583720A (en) Plants having enhanced yield-related traits and a method for method for making the same
CN1798843A (en) Modulation of cytokinin activity in plants
BRPI0718977A2 (en) METHOD FOR INCREASING SEED Yield IN PLANTS IN RELATION TO CONTROL PLANTS, CONSTRUCTION, USE OF THE SAME, PLANT, PART OF PLANT OR PLANT CELL, METHOD FOR THE PRODUCTION OF A TRANSGENIC PLANT HAVING INCREASE IN PLANT SEED CONTROL , Transgenic plant, harvestable parts of a plant, products, and use of a nucleic acid
CN101883783A (en) Has plant of enhanced yield correlated character and preparation method thereof
CN103074310A (en) Isopentenyl transferase sequences and methods of use
CN101268193A (en) Plant yield improvement by group 3 LEA expression
CN101688214A (en) Plant and the method that is used to produce this plant with enhanced yield correlated character
CN101627125A (en) Plants having enhanced yield-related traits and a method for making the same
CN101460611A (en) Plants having improved growth characteristics and method for making the same
CN101778942A (en) Plants having enhanced yield-related traits and a method for making the same
CN101061228B (en) Isopentenyl transferase sequences and methods of use
US20110154531A1 (en) Yield Increase in Plants Overexpressing the MTP Genes
US8993838B2 (en) Yield increase in plants overexpressing the SHSRP genes
AU2006259019B2 (en) Lecitin-like protein kinase stress-related polypeptides and methods of use in plants
US20090055970A1 (en) Yield increase in plants overexpressing the hsrp genes
CN101541970A (en) Transgenic plants comprising as transgene a class i tcp or clavata 1 (clv1) or cah3 polypeptide having increased seed yield and a method for making the same

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20120620

Termination date: 20160919

CF01 Termination of patent right due to non-payment of annual fee