CN108795976A - A method of conversion wild rice cDNA library improves rice varieties - Google Patents
A method of conversion wild rice cDNA library improves rice varieties Download PDFInfo
- Publication number
- CN108795976A CN108795976A CN201810731902.0A CN201810731902A CN108795976A CN 108795976 A CN108795976 A CN 108795976A CN 201810731902 A CN201810731902 A CN 201810731902A CN 108795976 A CN108795976 A CN 108795976A
- Authority
- CN
- China
- Prior art keywords
- rice
- added
- callus
- wild rice
- wild
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Abstract
The invention discloses a kind of methods that conversion wild rice cDNA library improves rice varieties, are related to molecular biology field.The cDNA library that the present invention passes through structure wild rice, and entered in rice genome by agrobacterium mediation converted, high throughput improvement rice varieties, individual of the screening with excellent genes characteristic in the transgenosis system of acquisition, transgenosis system is compared with wild type, apparent variation is showed in terms of plant height, tiller, heading stage, leaf, leaf color, species test is analysis shows that 23 Transgenic Rice systems are related to yield promotion.The present invention is short, efficient with the time, rice mutant character is abundant.Transgenosis verification analysis is carried out to the rice plant for occurring changing, genetic background is clear, screens available excellent genes and is improved for the targeting of follow-up rice.
Description
Technical field
The present invention relates to molecular biology domain, more particularly to a kind of method of conversion wild rice cDNA library improvement rice varieties.
Background technology
Rice yield is all agricultural science and technology worker focus of attention and hot spot all the time concerning world food safety.
We can improve rice yield by various means at present, for example, fertilising laxative, scientific farming, Rational Irrigation, develop it is miscellaneous
Rice, development ratooning rice, the triple cropping of rice is handed over to plant, improve rice etc. by transgenic technology.With the development of the society, to build at us
If friendly environment society and in the case of requiring food security, rice is improved energetically, saving chemical fertilizer and go and buy Chinese medicine less is one and knows together,
And just have here at 2 points and merit attention, when development hybrid paddy rice, such as red lotus type hybrid paddy rice " excellent No. 8 of road " and " excellent No. 10 of Lip river ',
With high yield, high-quality, wide suitable, saving agriculture chemical；Second is that excavating Fineness gene rice transformation improves rice yield and degeneration-resistant anti-
Pest and disease damage ability such as significantly improves the corn gene shrunken-2 (Sh2) of rice yield, Bph14/I S brown planthopper resistant genes
Deng.
Research finds that the host that Agrobacterium is infected is more, and Agrobacterium transgenosis is first in dicotyledon (such as arabidopsis and tobacco
Deng) in applied, be also applied monocotyledon (rice, corn, sorghum, wheat etc.) is inner later.Agrobacterium turns
The unique advantage that efficient and its of gene technology have so that multiple large size mutant libraries are fabricated success；Researcher can be with
The flanking sequence of insertion point, and some flanking sequences are identified using certain methods such as connector PCR, cyclisation PCR, TaiL-PCR etc.
Oneself refers to for other researchers in need and analyzes through being submitted on website information, and benefit is just omitted our expenses
When laborious map based cloning work.
The advantages of agriculture bacillus mediated transgenic technology.1, since the T-DNA sequences of insertion are known, this can be from
The relationship of forward genetics technique study gene and phenotype, and clone gene is more relatively easy；Although 2, Agrobacterium transgenosis
Multiple copies can be inserted into, but it is comparatively still very low, be conducive to obtain the homozygous single plant that can stablize heredity, meet Meng
Dare heredity law of segregation etc.；3, current but also to have randomness research shows that T-DNA is inserted with Preference, and in large size
It is applied in the structure of mutant library.
Wild rice is the relative genus of Chinese Second Class Key Protected Plant kind and rice, has biomass big, disease-resistant from cold-resistant etc.
Many merits, in recent years important sources by numerous researchers as rice breeding fine genes library.However, needle
Still at an early stage to the molecular biology research of wild rice, the hereditary information of wild rice is still far from perfect, to wild rice gene information
Its research and application as rice breeding fine genes library is seriously hindered known to limited, therefore develops a kind of efficient profit
The method that rice varieties improvement is carried out with the fine genes library of wild rice is particularly significant.
Currently, rice breeding is divided into conventional hybridization breeding and gene recombination, conventional hybridization breeding has genetic background
It is single, the disadvantage of screening period length, can not efficiently concentrating excellent genes, gene recombination is limited to the survey to term single gene again
Sequence, positioning and clone, can not the excellent Transgenic Rice of high flux screening.Therefore, exploitation is a kind of quickly, simple, efficient
High-throughput conversion wild rice cDNA library improvement rice varieties method it is very necessary.
Invention content
The technical problems to be solved by the invention：For at present to being asked present in the utilization of wild rice genetic resources and rice breeding
Topic, the invention discloses methods a kind of quick, that simple, efficiently high-throughput conversion wild rice cDNA library improves rice varieties.
In order to solve the above technical problems, the present invention provides technical solution below：
A method of conversion wild rice cDNA library improves rice varieties, including following operating procedure：
(1) structure of wild rice cDNA library；
(2) E.coli wild rices cDNA library plasmid in large scale extracts；
(3) wild rice purpose cDNA is overexpressed Library plasmid electrotransformation Agrobacterium, and method is as follows：
(A) 6 Agrobacterium competence are taken out and are positioned over from -70 DEG C first and melted on ice；
(B) 2 μ L Plasmid DNA are added before electricity turns in 100 μ L competent cells, mixing is gently blown and beaten with pipette tips；
(C) the LB mixtures of plasmid and cell are added to the electric revolving cup being pre-chilled on ice from side, electricity is wiped clean with blotting paper
Then moisture content outside revolving cup is placed on electroporation and is shocked by electricity with 2500V high pressures；
(D) rapid to take out electric revolving cup, the LB culture solutions (being free of antibiotic) of 900 μ L precoolings are added, gently blow and beat mixing, and
Bacterium solution is sucked out to be transferred in 2mL centrifuge tubes, 27 DEG C, 250rpm shaken cultivation 2h, electricity is carried out to 6 Agrobacterium competence successively
Turn, then same condition carries out shaking bacterium；
(E) it when applying tablet, often manages and 100 μ L bacterium solutions is taken to be coated on the LB tablets containing ampicillin, 28 DEG C are inverted culture
Then 2-3d counts the bacterium colony on tablet.
(4) agriculture bacillus mediated wild rice cDNA conversions improvement rice varieties：
(a) selection glume clean and bright, current year seed, peels off glume, 100mL is put on aseptic operating platform
In the conical flask of sterilizing.Seed is cleaned with the distilled water of sterilizing 3 times, then with 75% alcohol disinfecting 2 times, then each 1min is used
The distillation of sterilizing is washed after 3 removing alcohol, is sterilized 15min with 0.15% mercuric chloride, is during which shaken with hands conical flask, discard
Mercuric chloride cleans seed 3 times with aqua sterilisa, then eliminates extra moisture.Seed is inoculated into N6 by 10 seeds of every plate
On solid medium, sealed membrane is sealed, and under 28 DEG C of dark conditions, is cultivated 35 days；
(b) yellow embryo callus is inoculated on new subculture medium, 28 DEG C are protected from light culture 20d, select bright orange
Color, drying compact embryogenic callus be inoculated on precultivation medium, this culture medium is added with carboxyl acetosyringone, 28 DEG C of dark
Under the conditions of cultivate 3 days；
(c) Agrobacterium containing wild rice cDNA is coated on the LB solid mediums containing Rif and ampicillin, 28 DEG C
Dark culturing 28h.On aseptic operating platform, draws Agrobacterium suspension medium with pipette tips and gently blow and beat the agriculture bar containing wild rice cDNA
Then bacterium draws these solution and is added in 50mL Agrobacterium suspension mediums, while 50uL is added again, the carboxyl of 50mg/mL
Acetosyringone demarcates OD600It is 0.1.Then it is added and grows 3 days callus on AS, heat is incubated under the conditions of 42 DEG C
30min；
(d) it eliminates bacterium solution as possible on aseptic operating platform, callus is spread out to be placed in and sterilized is put down with filter paper
Ware up-draught 1h, until callus surface moisture is dried.Then, it is transferred into and co-cultures on culture medium, it is 22 DEG C, dark
Lower culture 3d；
(e) on aseptic operating platform, it is to be gone out with 2L in 250mL triangular flasks that the callus after co-cultivation, which is put into size,
The ddH of bacterium2O is washed 5 times, is washed 2 times with the aseptic double-distilled water of the cephalosporin containing 400mg/L, and each duration 15min uses hand
It shakes, then callus is spread out and carries out dry tack free on the plate with aseptic filter paper；
(f) callus of above-mentioned dry tack free is inoculated into containing 450mg/L, cephalosporin 60mg/L ampicillins
Screening and culturing medium on screened, callus 15 is placed per plate, is cultivated 20 days under 28 DEG C of dark conditions, then by callus
Tissue be inoculated into it is new containing carrying out programmed screening on 450mg/L cephalosporins, 60mg/L ampicillin screening and culturing mediums,
It is cultivated 20 days under 28 DEG C of dark conditions；
(g) callus by the yellow grown densification breaks up, and prepares differential medium placement 4~6 days, then,
Callus to be broken up is inoculated on culture medium, is grown 15~20 days under 28 DEG C of light, seedling grows to 2~4cm, moves it to
It takes root on 1/2MS root medias；
(h) when one seedling root system of transgenosis is flourishing enough, hardening can be carried out to it when can adapt to soil-grown environment,
It is placed on growing in planting environment 3 days, then adds sterile ddH2O hardening 4d directly take transgenic seedling from culture medium
Go out and cultivates in soil；
(i) the Transgenic Rice system that transgenosis obtains screens excellent by plantation and the Phenotypic Observation in T0 generations, T1 generations and T2 generations
Good rice strain.
2. preferably, the wild rice cDNA library structure includes following operating procedure：
(1) wild rice Total RNAs extraction, liquid feeding nitrogen grind the young stem of wild rice in mortar, a variety of materials are extracted respectively with TRIzoL
Total serum IgE, and take a small amount of RNA for agarose gel electrophoresis and measure its OD260/OD280, OD260/OD230Value；
(2) with reference to Creator SMART cDNA Construction Kit specifications one is synthesized using LD PCR methods
Two chains, and the cDNA products of synthesis are then carried out homogenization processing by electrophoresis detection result with DSN double-stranded specifics nuclease,
Sample after homogenization carries out PCR amplification, and electrophoresis detection result；
(3) end adds A after the PCR product purifying recycling after uniforming, and adds A products with PCR clean up Kit recycling,
It is connected on pMD19T-simpLe Vector carriers, is transformed into E.coli, be coated on containing ampicillin (25pg/mL)
LB tablets carry out culture and carry out PCR amplification rear electrophoresis identification, root to 100 single bacterium colonies of random picking using M13 universal primers
The size and small fragment rate of Insert Fragment are estimated according to electrophoresis result, and calculate storage capacity.
Preferably, the agrobacterium strains are EHA105, and E.coli bacterial strains are DH10B or TOP10, and the rice varieties are
Nipponbare.
Preferably, transgenosis system T0 generations plantation and greenhouse, bagging selfing, T1~T2 are planted for group in outdoor crop field.
Preferably, the E.coli wild rices cDNA library plasmid in large scale method for extracting is as follows：
(A) it takes the E.coli wild rice purposes library bacterium solution of 400 μ L to be connected in the 1L conical flasks containing 200mL LB culture mediums, adds
200uL ampicillins, 37 DEG C, 300rpm cultivates 16h；
(B) it takes four 100mL centrifuge tubes to centrifuge bacterium solution, collects precipitation, condition is 4 DEG C, and 12000g centrifuges 2min；
(C) each centrifuge tube is separately added into 10mLP1 (P1 will ensure that RNase A and LyseBLue is added before using), then will
Mixing is precipitated, not there is lumpy precipitate；
(D) each centrifuge tube is respectively added the P2 of 10mL37 DEG C of preheating and buckles lid immediately, and action is soft, turns upside down 10
Secondary thorough mixing bacterium solution, until bacterial suspension becomes indigo plant, 25 DEG C of incubation time 3min of room temperature；
(E) often the P3 of 10mL precoolings should be added in pipe in time after above-mentioned bacterium solution becomes basket, and existing side by side engraves lower gentle inversion 10 times
Mixing bacterium solution, it is seen that blue becomes clear, White Flocculus occurs, then be incubated 20min on ice；
(F) after being incubated, 4 DEG C, 12000g centrifuges 30min, draws supernatant, discards precipitation；
(G) it centrifuges again with 4 DEG C, 12000g centrifuges 15min, equally draws supernatant.
(H) it uses QBT equilibrium liquids to balance pillar, takes a QIAGEN-tip 500, QBT 10mL are added, are made by gravity
With making QBT liquid flow sky naturally；
(I) pillar is added in the supernatant containing plasmid, it is made to flow down naturally through filter membrane, wash 3 times with cleaning solution QC, often
Secondary 30mL flows empty mode and cleans pillar, then uses 15mL plasmid eluent QF eluted dnas naturally；
(J) DNA is precipitated, is added in isopropanol 10.5mL (according to 0.7 times of volume of eluent) to eluent, at once up and down
Reverse mixing, then 4 DEG C, 12000g centrifuges 30min, discards supernatant；
(K) 75% alcohol washes of 6mL, 12000g is used to centrifuge 15min, abandon supernatant；
(L) precipitation 15min is spontaneously dried, adds 100 μ LTE, PH8.0 dissolving precipitations, plasmid is measured with Nanodroping
Concentration.
Preferably, the wild rice be non-Bei Gu ?powder bacterium infection the solid caryopsis wild rice of Chinese Wild.
The advantageous effect that the present invention obtains：
The gene of wild rice is entered by the structure high throughput conversion of cDNA library in rice genome, in the transgenosis of acquisition
Individual of the screening with excellent genes characteristic in system, transgenosis system is compared with wild type, in plant height, tiller, heading stage, it is leaf,
Apparent variation is showed in terms of leaf color, species test is analysis shows that 23 Transgenic Rice systems are related to yield promotion.The present invention
With the time is short, efficient, rice mutant character is abundant.Transgenosis verification analysis is carried out to the rice plant for occurring changing, is lost
It is clear to pass background, screens available excellent genes and targets improvement for follow-up rice, also using the mutation of transgenic paddy rice
Character reversely studies the function of single or multiple genes in wild rice cDNA library.
Description of the drawings
Fig. 1 ampicillin primer PCRs identify positive transgenic strain
M：DNA Marker
Specific implementation mode
Below by the description to embodiment, specific embodiments of the present invention will be described in further detail, with side
Those skilled in the art is helped to have more complete, accurate and deep understanding to the inventive concept of the present invention, technical solution.
Embodiment 1：
It converts the solid caryopsis wild rice cDNA library of Chinese Wild and improves rice varieties
(1) structure of the solid caryopsis wild rice cDNA library of Chinese Wild：
(1.1) the solid caryopsis wild rice Total RNAs extraction of Chinese Wild, liquid feeding nitrogen grind the solid caryopsis wild rice of Chinese Wild in mortar
Young stem, extract the total serum IgE of a variety of materials respectively with TRIzoL, and take a small amount of RNA for agarose gel electrophoresis and measure its
OD260/OD280, OD260/OD230Value；
(1.2) it is synthesized using LD PCR methods with reference to Creator SMART cDNA Construction Kit specifications
One or two chains, and electrophoresis detection result then carries out the cDNA products of synthesis with DSN double-stranded specifics nuclease at homogenization
Reason, the sample after homogenization carry out PCR amplification, and electrophoresis detection result；
(1.3) end adds A (condition is template after the PCR product purifying recycling after uniforming:10 μ L, 10 × PCR
Buffer:5 μ L, dNTPmix:1 μ L, rTaq enzymes:0.3 μ L, H2O:33.7 μ L, 72 DEG C, 30min), with PCR cLean up Kit
Recycling plus A products, are connected on pMD19T-simpLe Vector carriers, are transformed into competence E.coli DH10B, are coated with
50 single bacterium colonies of the culture using M13 universal primers to random picking are carried out in the LB tablets containing ampicillin (25pg/mL)
PCR amplification rear electrophoresis identification is carried out, the size and small fragment rate of Insert Fragment are estimated according to electrophoresis result, and calculates storage capacity
Amount；
(2) the solid caryopsis wild rice cDNA library plasmid in large scale extracting of E.coli DH10B Chinese Wilds：
(A) the solid caryopsis wild rice purpose library bacterium solution of E.coli DH10B Chinese Wilds of 400uL is taken to be connected to containing 200mL LB
In the 1L conical flasks of culture medium, add 200 μ L ampicillins, 37 DEG C, 300rpm cultivates 16h；
(B) it takes four 100mL centrifuge tubes to centrifuge bacterium solution, collects precipitation, condition is 4 DEG C, and 12000g centrifuges 2min；
(C) each centrifuge tube adds 10mL P1 (P1 will ensure that RNase A and LyseBLue is added before using) respectively, then will
Mixing is precipitated, not there is lumpy precipitate；
(D) each centrifuge tube is respectively added the P2 of 10mL37 DEG C of preheating and buckles lid immediately, and action is soft, turns upside down 10
Secondary thorough mixing bacterium solution, until bacterial suspension becomes indigo plant, 25 DEG C of incubation time 3min of room temperature；
(E) often the P3 of 10mL precoolings should be added in pipe in time after above-mentioned bacterium solution becomes basket, and existing side by side engraves lower gentle inversion 10 times
Mixing bacterium solution, it is seen that blue becomes clear, White Flocculus occurs, then be incubated 20min on ice；
(F) after being incubated, 4 DEG C, 12000g centrifuges 30min, draws supernatant, discards precipitation；
(G) it centrifuges again with 4 DEG C, 12000g centrifuges 15min, equally draws supernatant.
(H) it uses QBT equilibrium liquids to balance pillar, takes a QIAGEN-tip 500, QBT 10mL are added, are made by gravity
With making QBT liquid flow sky naturally；
(I) pillar is added in the supernatant containing plasmid, it is made to flow down naturally through filter membrane, wash 3 times with cleaning solution QC, often
Secondary 30mL flows empty mode and cleans pillar, then uses 15mL plasmid eluent QF eluted dnas naturally；
(J) DNA is precipitated, is added in isopropanol 10.5mL (according to 0.7 times of volume of eluent) to eluent, at once up and down
Reverse mixing, then 4 DEG C, 12000g centrifuges 30min, discards supernatant；
(K) 75% alcohol washes of 6mL, 12000g is used to centrifuge 15min, abandon supernatant；
(L) precipitation 15min is spontaneously dried, 100 μ LTE, PH8.0 dissolving precipitations, as recombinant plasmid solution are added.
(3) the solid caryopsis wild rice purpose cDNA of Chinese Wild is overexpressed Library plasmid electrotransformation Agrobacterium EHA105, and method is such as
Under：
(A) 6 Agrobacterium EHA105 competence are taken out and are positioned over from -70 DEG C first and melted on ice；
(B) 2 μ L Plasmid DNA are added before electricity turns in 100 μ L competent cells, mixing is gently blown and beaten with pipette tips；
(C) the LB mixtures of plasmid and cell are added to the electric revolving cup being pre-chilled on ice from side, electricity is wiped clean with blotting paper
Then moisture content outside revolving cup is placed on electroporation and is shocked by electricity with 2500V high pressures；
(D) rapid to take out electric revolving cup, the LB culture solutions (being free of antibiotic) of 900 μ L precoolings are added, gently blow and beat mixing, and
Be sucked out bacterium solution be transferred in 2mL centrifuge tubes, 27 DEG C, 250rpm shaken cultivation 2h, successively to 6 Agrobacterium EHA105 competence into
Row electricity turns, and then same condition carries out shaking bacterium；
(E) it when applying tablet, often manages and 100 μ L bacterium solutions is taken to be coated on the LB tablets containing ampicillin, 28 DEG C are inverted culture
Then 2-3d counts the bacterium colony on tablet.
(4) Agrobacterium EHA105 mediates the solid caryopsis wild rice cDNA conversion improvement rice " Nipponbare " of Chinese Wild：
(a) selection Nipponbare glume clean and bright, current year seed, peels off glume, is set on aseptic operating platform
In the conical flask for entering 100mL sterilizings.Seed is cleaned with the distilled water of sterilizing 3 times, then with 75% alcohol disinfecting 2 times, each 1min,
Then it is washed 3 times with the distillation of sterilizing after removing alcohol, sterilizes 15min with 0.15% mercuric chloride, during which shake with hands taper
Bottle, discards mercuric chloride, cleans seed 3 times with aqua sterilisa, then eliminate extra moisture.Seed is connect by 10 seeds of every plate
In kind to N6 solid mediums, sealed membrane is sealed, and under 28 DEG C of dark conditions, is cultivated 35 days；
(b) yellow embryo callus is inoculated on new subculture medium, 28 DEG C are protected from light culture 20d, select bright orange
Color, drying compact embryogenic callus be inoculated on precultivation medium, this culture medium is added with carboxyl acetosyringone, 28 DEG C of dark
Under the conditions of cultivate 3 days；
(c) the Agrobacterium EHA105 containing the solid caryopsis wild rice cDNA of Chinese Wild is coated on containing Rif and ammonia benzyl mould
On the LB solid mediums of element, 28 DEG C of dark culturing 28h.On aseptic operating platform, draws Agrobacterium EHA105 with pipette tips and suspend
Culture medium gently blows and beats the Agrobacterium EHA105 containing the solid caryopsis wild rice cDNA of Chinese Wild, then draws the addition of these solution again
Into 50mL Agrobacterium EHA105 suspension mediums, while 50uL is added, the carboxyl acetosyringone of 50mg/mL demarcates OD600
It is 0.1.Then it is added and grows 3 days callus on AS, heat is incubated 30min under the conditions of 42 DEG C；
(d) it eliminates bacterium solution as possible on aseptic operating platform, callus is spread out to be placed in and sterilized is put down with filter paper
Ware up-draught 1h, until callus surface moisture is dried.Then, it is transferred into and co-cultures on culture medium, it is 22 DEG C, dark
Lower culture 3d；
(e) on aseptic operating platform, it is to be gone out with 2L in 250mL triangular flasks that the callus after co-cultivation, which is put into size,
The ddH of bacterium2O is washed 5 times, is washed 2 times with the aseptic double-distilled water of the cephalosporin containing 400mg/L, and each duration 15min uses hand
It shakes, then callus is spread out and carries out dry tack free on the plate with aseptic filter paper；
(f) callus of above-mentioned dry tack free is inoculated into containing 450mg/L cephalosporins, 60mg/L ampicillins
Screening and culturing medium on screened, callus 15 is placed per plate, is cultivated 20 days under 28 DEG C of dark conditions, then by callus
Tissue be inoculated into it is new containing carrying out programmed screening on 450mg/L cephalosporins, 60mg/L ampicillin screening and culturing mediums,
It is cultivated 20 days under 28 DEG C of dark conditions；
(g) callus by the yellow grown densification breaks up, and prepares differential medium placement 4~6 days, then,
Callus to be broken up is inoculated on culture medium, is grown 15~20 days under 28 DEG C of light, seedling grows to 2~4cm, moves it to
It takes root on 1/2MS root medias；
(h) when one seedling root system of transgenosis is flourishing enough, hardening can be carried out to it when can adapt to soil-grown environment,
It is placed on growing in planting environment 3 days, then adds sterile ddH2O hardening 4d directly take transgenic seedling from culture medium
Go out and cultivates in soil；
(i) the Transgenic Rice system that transgenosis obtains is by plantation and the Phenotypic Observation in T0 generations, T1 generations and T2 generations, transgenosis
It is T0 generations plantation and greenhouse, bagging selfing, for T1~T2 for group's plantation in outdoor crop field, every part of material plants 30~50 plants,
Often 10 plants of row, conventional rice Cultivate administration screen excellent rice strain.
(5) positive transgenic system PCR is identified：
It first takes the T2 of 10cm long for rice leaf first, is added in 2mL centrifuge tubes, is used in combination scissors to be cut into 0.5mL big
It is small, 100 μ L of 2xCTAB are added, rice leaf is smashed on proof press, adds the 2xCTAB of 600 μ L in 65 DEG C of water-baths
Middle water-bath 1h.It is then cooled to room temperature the chloroform for adding 700 μ L:Isoamyl alcohol (24:1) room temperature is carried out after, turning upside down 10 times
12000rpm centrifuges 15min.500 μ L of supernatant are drawn after centrifugation, are added 500 μ L isopropanols, are put into -20 DEG C of refrigerators after mixing
30min is precipitated, after precipitation, 12000rpm centrifuges 15min under the conditions of 4 DEG C.It discards supernatant at this time, then with 75% alcohol washes
It precipitates, 12000rpm, 15min is centrifuged under the conditions of 4 DEG C.Alcohol is discarded, is dried up on sterile platform, the sterile ddH20 dissolvings of 100 μ L are added
Precipitate DNA.
According to the ampicillin gene sequence fragment design primer on transgene carrier pMD19T-simpLe Vector
(table 1) carries out PCR positive identifications to transgenic line, and condition is as follows：
PCR system：ddH2O 6.0 μ L, 10 × buffer 1.0 μ L, TaqMIX 1.5 μ L, 1 μ L of template, 0.5 μ L of primer；
PCR reaction conditions：95 DEG C of 10min, 95 DEG C of 45s, 63.5 DEG C of 45s, 72 DEG C of 1min, 35 cycles, 72 DEG C of 10min.
1 ampicillin of table verifies primer sequence
| Primer | Upstream | Downstream |
| AMP | CAATGACCGCTGTTATGCGG | CTCGGAGGGCGAAGAATCTC |
Experimental result is as follows：
The solid caryopsis wild rice cDNA library storage capacity of Chinese Wild is 6.2 × 106CFU/mL, transformation efficiency is 100%, and is pressed
It is big according to identification Insert Fragment in library construction Kit CloneMinerTM II cDNA Library Construction Kit
Small method identifies the size for the segment being inserted into carrier between 1kb~3kb by way of BsrGI digestions.
23 yield that the screening of table 2 obtains promote the phenotype of transgenosis system
As shown in Table 2, had in 23 gene lines for increasing production potential quality according to what phenotype Integrated Selection came out, single plant yield,
Plant height and tiller number dramatically increase, and provide the foundation for the volume increase of kind, breeding time is obviously shortened, and can increase the unit interval
Interior soil planting benefit, leaf to be significantly changed compared with wild type, final result is also the increase in leaf surface product, is photosynthetic work
It is laid the first stone with accumulation nutriment.
The plantation for passing through T0, T1, T2 generation as shown in Figure 1, the positive transgenic system for stablizing heredity foreign gene are still big absolutely
It is most, it is seen that the present invention also has both genetic stability while efficiently improvement rice varieties, to integrate the excellent genes of wild rice
Reliable method is provided into rice, the positive colony filtered out can be additionally used in gene functional research and positioning, be further
The gene function offer for understanding wild rice may.
In conclusion the present invention has, the time is short, efficient, rice mutant character is abundant.The rice for occurring changing is planted
Strain progress transgenosis verification analysis, genetic background is clear, screens available excellent genes and targets improvement for follow-up rice, also
The function of single or multiple genes in wild rice cDNA library is reversely studied using the mutant character of transgenic paddy rice.
Above example is merely illustrative of the invention's technical idea, and protection scope of the present invention cannot be limited with this, every
According to technological thought proposed by the present invention, any change done on the basis of technical solution each falls within the scope of the present invention
Within；The technology that the present invention is not directed to can be realized by the prior art.
Claims (6)
1. a kind of method of conversion wild rice cDNA library improvement rice varieties, which is characterized in that include following operating procedure：
(1) structure of wild rice cDNA library；
(2) E.coli wild rices cDNA library plasmid in large scale extracts；
(3) wild rice purpose cDNA is overexpressed Library plasmid electrotransformation Agrobacterium, and method is as follows：
(A) it takes out Agrobacterium competence from -70 DEG C first and is positioned over and melt on ice；
(B) 2 μ L Plasmid DNA are added before electricity turns in 100 μ L competent cells, mixing is gently blown and beaten with pipette tips；
(C) the LB mixtures of plasmid and cell are added to the electric revolving cup being pre-chilled on ice from side, electric revolving cup is wiped clean with blotting paper
Then the moisture content of outside is placed on electroporation and is shocked by electricity with 2500V high pressures；
(D) rapid to take out electric revolving cup, the antibiotic-free LB culture solutions of 900 μ L precoolings are added, gently blow and beat mixing, and bacterium solution is sucked out
It is transferred in 2mL centrifuge tubes, 27 DEG C, 250rpm shaken cultivation 2h, carrying out electricity to Agrobacterium competence successively turns, then same
Condition carries out shaking bacterium；
(E) it when applying tablet, often manages and 100 μ L bacterium solutions is taken to be coated on the LB tablets containing ampicillin, 28 DEG C are inverted culture 2-3d,
Then the bacterium colony on tablet is counted；
(4) agriculture bacillus mediated wild rice cDNA conversions improvement rice varieties：
(a) selection glume clean and bright, current year seed, peels off glume, and 100mL sterilizings are put on aseptic operating platform
Conical flask in, seed is cleaned 3 times with the distilled water of sterilizing, then with 75% alcohol disinfecting 2 times, each 1min, then with sterilizing
Distillation wash 3 times remove alcohol after, with 0.15% mercuric chloride sterilize 15min, during which shake with hands conical flask, discard liter
Mercury, cleans seed 3 times with aqua sterilisa, then eliminates extra moisture, and seed, which is inoculated into N6, by 10 seeds of every plate consolidates
On body culture medium, sealed membrane is sealed, and under 28 DEG C of dark conditions, is cultivated 35 days；
(b) yellow embryo callus is inoculated on new subculture medium, 28 DEG C are protected from light culture 20d, select glassy yellow, do
Dry compact embryogenic callus is inoculated on precultivation medium, this culture medium is added with carboxyl acetosyringone, 28 DEG C of dark conditions
Lower culture 3 days；
(c) Agrobacterium containing wild rice cDNA is coated on the LB solid mediums containing Rif and ampicillin, 28 DEG C of dark
28h is cultivated, on aseptic operating platform, Agrobacterium suspension medium is drawn with pipette tips and gently blows and beats the Agrobacterium containing wild rice cDNA,
Then these solution are drawn again to be added in 50mL Agrobacterium suspension mediums, while 50uL is added, the carboxyl acetyl of 50mg/mL
Syringone demarcates OD600It is 0.1, is then added and grows 3 days callus on AS, heat is incubated 30min under the conditions of 42 DEG C；
(d) it eliminates bacterium solution as possible on aseptic operating platform, callus is spread out and is placed in sterilized carry on filter paper plate
Dry 1h, until callus surface moisture is dried, then, is transferred into and co-cultures on culture medium, 22 DEG C, the lower training of dark
Support 3d；
(e) on aseptic operating platform, it is in 250mL triangular flasks, with 2L sterilizings that the callus after co-cultivation, which is put into size,
ddH2O is washed 5 times, is washed 2 times with the aseptic double-distilled water of the cephalosporin containing 400mg/L, and each duration 15min shakes with hands,
Then callus is spread out and carries out dry tack free on the plate with aseptic filter paper；
(f) callus of above-mentioned dry tack free is inoculated into the sieve containing 450mg/L cephalosporin 60mg/L ampicillins
It selects and is screened on culture medium, callus 15 is placed per plate, cultivate 20 days under 28 DEG C of dark conditions, then by callus
Be inoculated into it is new containing carrying out programmed screening on 450mg/L cephalosporins, 60mg/L ampicillin screening and culturing mediums, 28 DEG C
It is cultivated 20 days under dark condition；
(g) callus by the yellow grown densification breaks up, and prepares differential medium and places 4~6 days, then, will wait for
The callus of differentiation is inoculated on culture medium, is grown 15~20 days under 28 DEG C of light, seedling grows to 2~4cm, moves it to 1/
It takes root on 2MS root medias；
(h) hardening can be carried out to it, put when transgenic seedling root system is flourishing enough, can adapt to soil-grown environment
It is placed in planting environment and grows 3 days, then add sterile ddH2Transgenic seedling is directly taken out and is planted from culture medium by O hardening 4d
It trains in soil；
(i) excellent water screens by plantation and the Phenotypic Observation in T0 generations, T1 generations and T2 generations in the Transgenic Rice system that transgenosis obtains
Rice strain.
2. according to a kind of method that conversion wild rice cDNA library improves rice varieties in claim 1, which is characterized in that the wild rice
CDNA library structure includes following operating procedure：
(1) wild rice Total RNAs extraction, liquid feeding nitrogen grind the young stem of wild rice in mortar, extract the total of a variety of materials respectively with TRIzoL
RNA, and take a small amount of RNA for agarose gel electrophoresis and measure its OD260/OD280, OD260/OD230Value；
(2) one or two chains are synthesized using LD PCR methods with reference to Creator SMART cDNA Construction Kit specifications,
And the cDNA products of synthesis are then carried out homogenization processing by electrophoresis detection result with DSN double-stranded specifics nuclease, homogenization
Sample afterwards carries out PCR amplification, and electrophoresis detection result；
(3) end adds A after the PCR product purifying recycling after uniforming, with PCR clean up Kit recycling plus A products, connection
It onto pMD19T-simpLe Vector carriers, is transformed into E.coli, is coated on the LB tablets of the ampicillin containing 25pg/mL
It carries out culture and PCR amplification rear electrophoresis identification is carried out to 100 single bacterium colonies of random picking using M13 universal primers, according to electrophoresis
As a result estimate the size and small fragment rate of Insert Fragment, and calculate storage capacity.
3. according to a kind of method that conversion wild rice cDNA library improves rice varieties in claim 1, it is characterised in that：The agriculture bar
Bacteria strain is EHA105, and E.coli bacterial strains are DH10B, and the rice varieties are Nipponbare.
4. according to a kind of method that conversion wild rice cDNA library improves rice varieties in claim 1, it is characterised in that：Transgenosis system
T0 generations plantation and greenhouse, bagging selfing, T1~T2 are planted for group in outdoor crop field.
5. according to a kind of method that conversion wild rice cDNA library improves rice varieties in claim any one of 1-5, which is characterized in that
The E.coli wild rices cDNA library plasmid in large scale method for extracting is as follows：
(A) it takes the E.coli wild rice purposes library bacterium solution of 400 μ L to be connected in the 1L conical flasks containing 200mL LB culture mediums, adds 200uL
Ampicillin, 37 DEG C, 300rpm cultivates 16h；
(B) it takes four 100mL centrifuge tubes to centrifuge bacterium solution, collects precipitation, condition is 4 DEG C, and 12000g centrifuges 2min；
(C) each centrifuge tube is separately added into 10mLP1, and P1 will ensure that RNase A and LyseBLue is added before using, then will precipitation
Mixing not have lumpy precipitate；
(D) each centrifuge tube is respectively added the P2 of 10mL37 DEG C of preheating and buckles lid immediately, and action is soft, turn upside down 10 times it is thorough
Bottom mixing bacterium solution, until bacterial suspension becomes indigo plant, 25 DEG C of incubation time 3min of room temperature；
(E) often the P3 of 10mL precoolings should be added in pipe in time after above-mentioned bacterium solution becomes basket, exist side by side and engrave 10 mixings of lower gentle inversion
Bacterium solution, it is seen that blue becomes clear, White Flocculus occurs, then be incubated 20min on ice；
(F) after being incubated, 4 DEG C, 12000g centrifuges 30min, draws supernatant, discards precipitation；
(G) it centrifuges again with 4 DEG C, 12000g centrifuges 15min, equally draws supernatant；
(H) it uses QBT equilibrium liquids to balance pillar, takes a QIAGEN-tip 500, QBT 10mL are added to be made by gravity
QBT liquid flows sky naturally；
(I) pillar is added in the supernatant containing plasmid, it is made to flow down naturally through filter membrane, wash 3 times with cleaning solution QC, every time
30mL flows empty mode and cleans pillar, then uses 15mL plasmid eluent QF eluted dnas naturally；
(J) precipitate DNA, be added 0.7 times of volume of eluent isopropanol, turn upside down mixing at once, then 4 DEG C, 12000g from
Heart 30min, discards supernatant；
(K) 75% alcohol washes of 6mL, 12000g is used to centrifuge 15min, abandon supernatant；
(L) precipitation 15min is spontaneously dried, adds 100 μ LTE, PH8.0 dissolving precipitations, the concentration of plasmid is measured with Nanodroping.
6. the method for improveing rice varieties according to a kind of conversion wild rice cDNA library in claim 1, which is characterized in that the wild rice
For non-Bei Gu ?powder bacterium infection the solid caryopsis wild rice of Chinese Wild.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810731902.0A CN108795976A (en) | 2018-07-05 | 2018-07-05 | A method of conversion wild rice cDNA library improves rice varieties |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810731902.0A CN108795976A (en) | 2018-07-05 | 2018-07-05 | A method of conversion wild rice cDNA library improves rice varieties |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108795976A true CN108795976A (en) | 2018-11-13 |
Family
ID=64075136
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810731902.0A Pending CN108795976A (en) | 2018-07-05 | 2018-07-05 | A method of conversion wild rice cDNA library improves rice varieties |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108795976A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108795977A (en) * | 2018-07-05 | 2018-11-13 | 安徽袁粮水稻产业有限公司 | A method of conversion oryza officinalis cDNA library improves rice varieties |
| CN116555333A (en) * | 2023-04-21 | 2023-08-08 | 中国农业科学院烟草研究所 | Application of Chinese wild rice ZlMYB1 and ZlMYB2 genes in improving anthocyanin content of rice seeds |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030221218A1 (en) * | 2002-05-17 | 2003-11-27 | The Regents Of The University Of California | Bioengineering cotton fiber properties |
| CN106636069A (en) * | 2016-12-28 | 2017-05-10 | 广东菰稻农业有限公司 | A kind of construction method of wild rice cDNA library |
-
2018
- 2018-07-05 CN CN201810731902.0A patent/CN108795976A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030221218A1 (en) * | 2002-05-17 | 2003-11-27 | The Regents Of The University Of California | Bioengineering cotton fiber properties |
| CN106636069A (en) * | 2016-12-28 | 2017-05-10 | 广东菰稻农业有限公司 | A kind of construction method of wild rice cDNA library |
Non-Patent Citations (2)
| Title |
|---|
| 秦克周: "高通量转化高梁cDNA文库改良水稻", 《中国博士学位论文全文数据库农业科技辑》 * |
| 高雪英等: "水稻全长均一化cDNA文库构建及SDG725结合蛋白筛选", 《复旦学报（自然科学版）》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108795977A (en) * | 2018-07-05 | 2018-11-13 | 安徽袁粮水稻产业有限公司 | A method of conversion oryza officinalis cDNA library improves rice varieties |
| CN116555333A (en) * | 2023-04-21 | 2023-08-08 | 中国农业科学院烟草研究所 | Application of Chinese wild rice ZlMYB1 and ZlMYB2 genes in improving anthocyanin content of rice seeds |
| CN116555333B (en) * | 2023-04-21 | 2023-11-24 | 中国农业科学院烟草研究所 | Application of Chinese wild rice ZlMYB1 and ZlMYB2 genes in improving anthocyanin content of rice seeds |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107988229A (en) | A kind of method for obtaining the rice that tiller changes using CRISPR-Cas modification OsTAC1 genes | |
| CN109266646A (en) | The method and application of cabbage type rape BnMAX1 gene are knocked out using CRISPR-Cas9 system | |
| CN104846009B (en) | A kind of construction method of Rice Engineering maintainer and its application | |
| CN102234651A (en) | Nucleotide sequence of gene for resistance to Cereal cyst nematode, Heterodera avenae and application thereof | |
| CN105985965A (en) | Gene GW7 for controlling grain shape, exterior quality and yield of rice and applications of gene GW7 | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN104611359B (en) | The application of ZmSPL1 albumen and its encoding gene in regulation and control Maize Kernel Development | |
| CN104558128B (en) | The albumen related to anti-Fusarium graminearum stem rot and its encoding gene and application | |
| CN108823242A (en) | A kind of method of maize transformation cDNA library improvement rice varieties | |
| CN108795976A (en) | A method of conversion wild rice cDNA library improves rice varieties | |
| CN107012147A (en) | A kind of arid and/or high salt evoked promoter SlWRKY8P and its application from tomato | |
| CN106868036B (en) | A kind of method and its application of rite-directed mutagenesis initiative corn compact plant germplasm | |
| CN111635904B (en) | Gene CsWRKY10 for enhancing cucumber target spot disease resistance and application thereof | |
| CN104593381B (en) | A kind of corn resistant gene of salt and its application | |
| CN104593380B (en) | For the gene ZmHKT1 for the coding corn HKT transport proteins for improving plant salt endurance;1a and its application | |
| CN108486149A (en) | A kind of application of cucumber CsWRKY50 genes in enhancing cucumber downy mildew resistance | |
| CN1149918C (en) | Method for transferring agrobacterium mediated plant germination seed gene | |
| CN110373417A (en) | Cotton GhMADS41-A04 gene is promoting the application in flowering of plant | |
| CN110204600A (en) | BnSPL14 gene, albumen and its application in control cabbage type rape plant type | |
| CN105255938A (en) | Agrobacterium rhizogenes mediated genetically modified Erigeron breviscapus hairy root transformation method | |
| CN109852634A (en) | A method of cultivating high nodulation and nitrogen fixation genetically modified plants | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN108396035A (en) | A kind of agriculture bacillus mediated rice transformation method | |
| CN110106200A (en) | Corn BBM1 gene is improving the application in Genetic Transformation in Higher Plants efficiency | |
| CN108018286A (en) | Initiative, detection and the application of corn transformation event ZM8-143 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181113 |