CN113913454B - Artificial gene editing system for rice - Google Patents

Abstract

The application relates to a set of artificial gene editing system for gene editing of rice, which comprises the following components: a regulatory element of item I comprising a nucleotide sequence capable of encoding, for example, an amino acid sequence I comprising, for example, one of an I-1 amino acid sequence, an I-2 amino acid sequence and an I-3 amino acid sequence; a II regulatory element comprising a II-1 nucleotide sequence and a II-2 nucleotide sequence in tandem sequentially from the 5 'end to the 3' end; the II-1 th nucleotide sequence comprises a target nucleotide sequence; the target nucleotide sequence is derived from the genome of a target organism and contains a target site to be mutated in the genome of the target organism; the II-2 nucleotide sequence comprises an sgRNA nucleic acid sequence derived from streptococcus pyogenes; the II-1 nucleotide sequence and the II-2 nucleotide sequence are transcriptionally fused.

Description

Artificial gene editing system for rice

The application is a divisional application with the application number 201811320030.8, and the name of the patent is a set of artificial gene editing system for paddy rice, which is filed on the 11 th month 07 of 2018.

Technical Field

The application relates to an artificial gene editing system for rice.

Background

Rice (Oryza sativa l.) is one of the major food crops in the world, and fosters nearly half of the world population, including nearly the entire east and south east asia population. China is the country with the highest total rice yield in the world, and the rice yield accounts for about 30% of the total world. In the production process, three diseases of rice mainly including rice blast, false smut and sheath blight seriously restrict the growth and development of the rice, so that the yield and quality of the rice are reduced, and the global grain safety is threatened. Therefore, the research of increasing the yield, improving the rice quality, increasing the disease resistance, stress resistance and the like of rice plants so as to ensure the stable supply of grains is an important subject for sustainable development of human society. Rice is used as a model plant of monocotyledonous plants, and research technology, methods, theory and achievements of the rice have important guiding effects on other gramineous plants, such as wheat, corn, sorghum and the like.

The CRISPR/Cas9 system developed in recent years is extremely applicable because it allows site-directed modification of the genome. However, CRISPR/Cas9 systems require the recognition of PAM sequences conserved at the 3' end of guide RNAs (grnas) when performing nucleic acid cleavage. The most commonly used PAM sequence identified by SpCas9 at present is mainly NGG, although SpCas9 can also identify NAG, spCas9 (VQR) can identify NGA and the like, the editing efficiency is low; meanwhile, the base editing technology developed based on the CRISPR/SpCas9 system can also cause the limitation of base editing efficiency due to the specificity of the edited target site and the possible lack of proper PAM sequence, and the application of the CRISPR/Cas9 system in rice genome editing is greatly limited.

Therefore, if a CRISPR/Cas9 system which can edit plant genome, especially rice genome at fixed points can be developed, the efficiency of editing the plant genome can be greatly improved, and the CRISPR/Cas9 system can be widely applied to aspects of plant gene function research, crop breeding and the like, and the progress of the field of editing the plant genome can be greatly promoted.

Disclosure of Invention

The present application provides a set of artificial gene editing systems comprising:

a regulatory element of type I comprising a nucleotide sequence capable of encoding, for example, an amino acid sequence I; wherein the amino acid sequence I comprises one of an I-1 amino acid sequence, an I-2 amino acid sequence and an I-3 amino acid sequence, wherein the I-1 amino acid sequence is an amino acid sequence shown as SEQ ID No. 1; the I-2 amino acid sequence comprises an amino acid sequence shown as SEQ ID No.2, SEQ ID No.1 and SEQ ID No.3 which are sequentially connected in series from the N end to the C end; the I-3 amino acid sequence comprises an amino acid sequence shown as SEQ ID No.4 and SEQ ID No.1 which are sequentially connected in series from the N end to the C end;

a II regulatory element comprising a II-1 nucleotide sequence and a II-2 nucleotide sequence in tandem sequentially from the 5 'end to the 3' end; the II-1 th nucleotide sequence comprises a target nucleotide sequence; the target nucleotide sequence is derived from the genome of a target organism and contains a target site to be mutated in the genome of the target organism; the nucleotide sequence II-2 comprises an sgRNA nucleic acid sequence derived from streptococcus pyogenes (Streptococcus pyogenes); the II-1 nucleotide sequence and the II-2 nucleotide sequence are transcribed and fused, and the product can guide the protein encoded by the I regulatory element to a target site to be mutated in the genome of a target organism, and mutate the base generated at the target site;

when the number of the II regulatory elements is plural, the II-1 nucleotide sequences contained in each of the II regulatory elements are different from each other. In addition, when the II-th regulating element is plural, these II-th regulating elements may be connected together in series.

In the present application, the target nucleotide sequence in the artificial gene editing system is determined by the artificial gene editing system itself together with the target site to be mutated in the genome of the target organism, and, as described above, the target nucleotide sequence is derived from the genome of the target organism, and thus, the target site on the target nucleotide sequence coincides with the target site sequence to be mutated in the genome of the target organism, and thus, for the sake of simplicity of expression, both are referred to as target sites, but mutation occurs on the sequence of the genome of the target organism, not on the sequence of the artificial gene editing system.

In a specific embodiment, when the I-1 amino acid sequence is used, the target site in the target nucleotide sequence is at any one of the 3 to 5 positions in the 3 'to 5' direction of the target nucleotide sequence; when the I-2 amino acid sequence is used, the target site in the target nucleotide sequence is base C in the 2 to 10 positions of the target nucleotide sequence in the 5 'to 3' direction; when the I-3 amino acid sequence is used, the target site in the target nucleotide sequence is base A in the 2 to 8 positions of the target nucleotide sequence in the 5 'to 3' direction.

When the amino acid sequence I is an I-1 amino acid sequence, the deletion or insertion mutant corresponding to the rice gene can be obtained by deleting or inserting one or a plurality of bases at a specific endogenous site in the rice genome by utilizing the artificial gene editing system. For these deletion or insertion mutants, there is a possibility that the function of the original gene is lost, and also that the function of the original gene is reduced or enhanced, depending on the actual situation, and those mutants which have completed the detection of the gene sequence are selected to be retained or discarded according to the actual need.

Alternatively, when the amino acid sequence I is an I-2 amino acid sequence, the I-th regulatory element can be used for carrying out site-directed mutagenesis on a specific base C endogenous in a rice genome into one of T, A or G by utilizing the artificial gene editing system, and screening to obtain a rice gene function correction mutant. Or for the reverse complementary sequence, G is subjected to site-directed mutagenesis to one of A, T or C, and a rice gene function correction mutant is obtained by screening, wherein the target nucleotide sequence is the nucleotide sequence on the strand C at the target site.

Or when the amino acid sequence I is an I-3 amino acid sequence, the specific base A endogenous in the rice genome can be subjected to site-directed mutagenesis into G by utilizing the artificial gene editing system, and the rice gene function correction mutant can be obtained by screening. Or for the reverse complementary sequence, T is subjected to site-directed mutagenesis to form C, and the rice gene function correction mutant is obtained by screening, wherein the target nucleotide sequence is the nucleotide sequence on the A chain at the target site.

In a specific embodiment, the target organism is rice, the nucleotide sequence of the first regulatory element is a nucleotide sequence suitable for expression in rice, and the nucleotide sequence of the second regulatory element is a nucleotide sequence suitable for transcription in rice.

In a specific embodiment, the nucleotide coding sequence capable of encoding the amino acid sequence shown as SEQ ID No.1 is shown as SEQ ID No. 5. The nucleotide coding sequence shown as SEQ ID No.5 can be preferably used in rice.

In a specific embodiment, the nucleotide coding sequence capable of encoding the amino acid sequence shown as SEQ ID No.2 is shown as SEQ ID No. 6. The nucleotide coding sequence shown as SEQ ID No.6 can be preferably used in rice.

In a specific embodiment, the nucleotide coding sequence capable of encoding the amino acid sequence shown as SEQ ID No.3 is shown as SEQ ID No. 7. The nucleotide coding sequence shown as SEQ ID No.7 can be preferably used in rice.

In a specific embodiment, the nucleotide coding sequence capable of encoding the amino acid sequence shown as SEQ ID No.4 is shown as SEQ ID No. 8. The nucleotide coding sequence shown as SEQ ID No.8 can be preferably used in rice.

In a specific embodiment, the nucleotide sequence of II-2 is shown as SEQ ID No. 9.

In a specific embodiment, the II-1 nucleotide sequence further comprises a cloning site comprising a cleavage site for a type IIS restriction enzyme, into which the target nucleotide sequence is cloned via the cloning site on the II-1 nucleotide sequence (e.g., the target nucleotide sequence is linked to the cloning site by cleavage-ligation) such that the II-1 nucleotide sequence is transcriptionally fused to the II-2 sequence; when the II-th regulatory element is plural, the cleavage sites of the type IIS restriction enzymes for cloning different target nucleotide sequences are different from each other.

Wherein, since the target nucleotide sequence is varied according to the base editing site, other elements including the cleavage site of the restriction enzyme cloned in advance to the relevant position can be constructed. The target nucleotide sequence is cloned by cleavage of the restriction enzyme cleavage site according to the purpose of base editing, before use. When the number of the II-th regulatory elements is plural, restriction enzyme cleavage sites of restriction enzymes contained in the plural II-1 nucleotide sequences are different from each other, and thus, different target nucleotides can be effectively ensured to be successfully cloned to the target position. Multiple target nucleotide sequences can be used for base substitution of multiple target sites to be mutated on the genome of the target organism.

In a specific embodiment, it is preferred that the nucleotide sequence of the cloning site comprises SEQ ID No.10 and/or SEQ ID No.11.

In one embodiment, the target nucleotide sequence is determined by:

1) Determining a nucleotide sequence to be modified on a rice genome;

2) Judging that the nucleotide sequence to be modified determined in the step 1) is a specific sequence in a genome (the higher the specificity of the modified nucleotide sequence is, the more accurate the gene editing is, otherwise erroneous recognition may occur),

judging whether the change caused by the mutation of the base of the nucleotide site to be mutated meets the expectations or not according to the I-th regulating element; or judging whether the change caused by mutation of the reverse complementary base of the nucleotide site to be mutated meets the expectations or not according to the I-th regulatory element;

for the predictors, the nucleotide sites to be mutated are potential target sites;

3) Screening a target sequence in a nucleotide sequence to be modified or its reverse complement: searching in the 3' direction of the potential target site to confirm the presence of a recognition module capable of being recognized by the amino acid sequence I encoded by the I-th regulatory element, and

when the amino acid sequence I is an amino acid sequence such as I-1, the target site is at a position from-3 to-5 upstream of the 5 'end of the recognition module, whereby the 17 to 21 nucleotide sequence upstream of the 5' end of the recognition module is determined to be the target nucleotide sequence;

when the amino acid sequence I is an I-2 amino acid sequence, the target site is at a position from-19 to-11 upstream of the 5 '-end of the recognition module, whereby the 17-21 nucleotide sequence upstream of the 5' -end of the recognition module is determined to be the target nucleotide sequence;

when the amino acid sequence I is, for example, an I-3 amino acid sequence, the target site is located at a position from-19 to-13 upstream of the 5 '-end of the recognition module, and the 17-21 nucleotide sequence upstream of the 5' -end of the recognition module thus determined is the target nucleotide sequence.

In one embodiment, the identified motif is 5' -N ₁ GN ₂ -3', 17 to 21 nucleotide sequences upstream of the target nucleotide sequence, eliminating nucleotide sequences containing five consecutive T's; wherein the N is ₁ And N ₂ A, G, C and T, independently.

In a specific embodiment, the target nucleotide sequence is at least one of the sequences shown as SEQ ID No.16, SEQ ID No.17 and SEQ ID No. 18.

In one embodiment, the artificial gene editing system further comprises a first promoter at the 5' end of the ith regulatory element that can be used in rice and that can initiate transcription of the ith regulatory element; and/or the artificial gene editing system further comprises a second promoter at the 5' end of the II regulatory element that can be used in rice and that can initiate transcription of the II regulatory element.

In a specific embodiment, the first promoter is an RNA polymerase II promoter; and/or the second promoter is an RNA polymerase type III promoter.

In a specific embodiment, the first promoter is SEQ ID No.12; and/or the second promoter is SEQ ID No.13.

In one embodiment, the artificial gene editing system further comprises a first terminator at the 3' end of the ith regulatory element capable of terminating transcription of the ith regulatory element; and/or the artificial gene editing system further comprises a second terminator at the 3' end of the II regulatory element capable of terminating transcription of the II regulatory element.

In a specific embodiment, the first terminator is SEQ ID No.14; and/or the second terminator is SEQ ID No.15.

In a specific embodiment, the I-th regulatory element and the II-th element can be cloned onto at least one vector. For example, the I-regulatory element expression cassette and the II-regulatory element transcription cassette can be cloned or integrated into the same vector. Or the I-regulatory element expression cassette and the II-regulatory element transcription cassette are respectively positioned on different vectors, the two cassettes or the vectors containing the two cassettes can be introduced into rice callus or protoplast cells by adopting a gene gun method, an agrobacterium infection method or a PEG-mediated transformation method.

In a specific embodiment, the ith regulatory element can be cloned into pCAMBIA 1300; the II regulatory element was cloned into the entry vector pENTR 4. pCAMBIA1300 is a binary vector based on Gateway reaction and used for genetic transformation of rice, and other similar binary vectors can be used.

In a specific embodiment, the first promoter, the ith regulatory element and the first terminator can be cloned into the pCAMBIA1300 vector.

In a specific embodiment, the second promoter, the second regulatory element II and the second terminator are cloned into pENTR4 vector. When the number of the II regulatory elements is plural, the number of the second promoter at the 5 'end and the number of the terminator at the 3' end are plural. I.e.the second promoter, the second regulatory element II and the second terminator form a set, and are present in sets. Multiple groups containing different II regulatory elements may be connected together in series. Wherein, the difference of the II regulatory elements mainly refers to the difference of the II-1 nucleotide sequence.

In a specific embodiment, the I-th regulatory element and the II-th regulatory element can be integrated on the same carrier or distributed on both carriers for use together.

The second application provides the application of any artificial gene editing system as one of the application in the mutation of rice genome.

The third application provides a method for realizing fixed-point editing of rice genome, which comprises the following steps:

1) Introducing any artificial gene editing system in the application into rice callus or rice protoplast through one of agrobacterium-mediated, gene gun bombardment or PEG-mediated transformation, and culturing to obtain rice plants;

2) Screening to obtain rice plants containing the required mutation; further, the rice plant is capable of producing a rice seed comprising the mutation.

In the case of introducing the artificial gene editing system, the PEG-mediated transformation method may be used, or the artificial gene editing system may be introduced into rice protoplasts or calli by one of a gene gun method or an Agrobacterium infection method, as will be readily appreciated by those skilled in the art. It is well known to those skilled in the art that rice genomic DNA consists of two strands, and thus, the target nucleotide sequence may be on either strand complementary thereto. For example, when the target nucleotide sequence is located in a sense strand of a functional gene, if a deletion or insertion of one to several bases occurs at a specific site of the functional gene and if one of the mutations is capable of obtaining the desired frame shift mutation to result in gene inactivation, this can be achieved by using the system, i.e., by directly performing a base deletion or insertion on the sense strand, a rice gene knockout mutant can be obtained; when the target nucleotide sequence is positioned in the sense strand of a certain functional gene, if C on a specific site of the functional gene is subjected to site-directed mutation to T, and if one mutation can obtain the expected amino acid in the corresponding functional protein, the system can be adopted, namely, the substitution of C in a triplet codon for T can be realized by directly carrying out base substitution on the sense strand, so that a rice gene function correction mutant is obtained; or when the target nucleotide sequence is located in the antisense strand of a certain functional gene, if G at a specific site of the functional gene is subjected to site-directed mutagenesis to A, and if one mutation can obtain the expected amino acid in the corresponding functional protein, the system can also be adopted, namely, the function correction mutant of the rice gene can be obtained by changing the triplet codon coded amino acid in the sense strand by site-directed mutagenesis of C in the antisense strand to T and then changing the corresponding complementary G in the sense strand to A; when the target nucleotide sequence is positioned in an antisense strand of a certain functional gene, if T on a specific site of the functional gene is subjected to site-directed mutagenesis to form C, and if one mutation can obtain the expected amino acid in the corresponding functional protein, the system can be adopted, namely, the function correction mutant of the rice gene can be obtained by changing the triplet codon coded amino acid in the sense strand by site-directed mutagenesis of A in the antisense strand to G and then replacing the corresponding complementary T in the sense strand with C; or when the target nucleotide sequence is located in the sense strand of a certain functional gene, if A at a specific site of the functional gene is subjected to site-directed mutation to G, and if one mutation can obtain the amino acid in the expected corresponding functional protein, the system can be adopted to realize that A in a triplet codon is replaced by G by directly carrying out base substitution on the sense strand, so that the rice gene function correction mutant is obtained.

The beneficial effects of this application lie in:

a) The number of the II regulatory elements can be plural, so that plural gene target sites in the rice cells can be edited at the same time.

b) Gene knockout (including deletion or insertion) in the rice genome, or substitution from base pair AT to base pair GC, or substitution from base pair GC to base pair AT, can be achieved by selecting different ith regulatory elements in the artificial gene editing system of the present application.

c) The novel gene editing tool box expands the PAM sequence of the existing gene editing tool box, has wider and wider PAM sequence, and can be widely applied to knockout of target genes or directed mutation of single base in rice genome, thereby creating gene functional inactivation or acquired mutant materials. In particular the use of base editing systems in plants is more efficient and economical than gene replacement by HR or gene insertion by NHEJ; the wide PAM sequence increases the possibility of realizing the base substitution of any site, provides an important gene function research tool for scientific researchers in the field of plant research, and provides a new strategy for cultivating new rice varieties in the directions of rice gene function research and molecular breeding.

Drawings

FIG. 1 shows a graph of the editing effect of pUbi:Cas9NG at the OsCERK1 gene target site.

FIG. 2 shows the effect of editing using pUbi rBE at the target site of the OsRLCK185 gene.

FIG. 3 shows the effect of editing using pUbi rBE23 at the target site of the Os03g02040 gene.

Detailed Description

The foregoing of the present application is further illustrated in detail by the following examples, which are not to be construed as limiting the invention.

Reagents in the examples of the present application are all commercially available unless otherwise specified.

pCAMBIA1300 was derived from the BioVector NTCC collection of typical cultures. An attR1-ccdB-attR2 module was inserted in pCAMBIA1300 for gateway reactions to accept the attL 1-targeting sequence transcription module-attL 2 module from the entry vector.

Source of pENTR4 vector: purchased from Invitrogen, usa.

Source of pBlueScript SK vector: purchased from Clontech corporation.

Example 1

Construction of recombinant plasmids

The technical route for constructing the vector is as follows:

1.1 pUbi-Cas 9NG recombinant plasmid construction

The amino acid sequence of Cas9NG is determined as shown in SEQ ID No.1, the gene sequence SEQ ID No.5 for expression in rice is determined according to the amino acid sequence of Cas9NG, the 4299bp nucleotide sequence shown in SEQ ID No.5 is artificially synthesized, cloned into pUC57 and named pUC57:Cas9NG (completed by Beijing Optimago Biotechnology Co., ltd.). SEQ ID No.12 (maize ubiquitin promoter Ubip), SEQ ID No.5, SEQ ID No.14 (Nos terminator) were then cloned into the pCAMBIA1300 vector in the 5 'to 3' direction, designated pUbi: cas9NG.

The main constitution of the plasmid pUbi:Cas9NG is as follows: the CaMV35S promoter (genebank accession number FJ362600.1, nucleotide sequence 10382 to 11162), hygromycin gene (genebank accession number KY 420085.1), NOS terminator (SEQ ID No. 14), pVS1 RepA (genebank accession number KY420084.1, nucleotide sequence 5755 to 6435), pVS1 origin of replication (genebank accession number KY420084.1, nucleotide sequence 4066 to 5066), attR1 (genebank accession number KR233518.1, nucleotide sequence 2055 to 2174), ccdB expression cassette genbank accession number KR233518.1, nucleotide sequence 3289 to 3594), attR2 (genebank accession number KR233518.1, nucleotide sequence 3635 to 3759), ubip promoter (SEQ ID No. 12), 9NG gene (SEQ ID No. 5), NOS terminator (Cas 14).

1.2 Construction of pUbi rBE recombinant plasmid

The present laboratory self-vector pUbi: rBE9 (Improved base editor for efficiently inducing genetic variations in rice with CRISPR/Cas9.Ren Bin, yan Fang, kuang Yongjie, li Na, zhang Dawei, zhou Xueping, lin Honghui and Zhou Huanbin. Molecular Plant,2018, 11:623-626) was digested with EcoR I and Spe I to recover a 5.05kb fragment; double digestion of cloning vector pBlueScript SK with EcoR I and SpeI, recovering 3kb linearized vector backbone; then the two are connected, and the obtained recombinant plasmid is named pBS rBE9 after transformation, colony PCR and enzyme digestion verification.

rAPO-R1 (SEQ ID No.19: agcaagtccgattgaatact) and UGI-F1 (SEQ ID No.20: tccggcggaagtacaaac) were used as primers, recombinant plasmid pBS: rBE9 was used as template, and I-5 was used ^TM PCR amplification was performed with 2X HighFidelity Master Mix (available from Clausin (Beijing) Biotechnology Co., ltd.) to obtain a vector backbone of about 4.0 kb; meanwhile, osCas9-Fg1-F1 (SEQ ID No.21: attgggacaaactctgtgg and OsCas9-Fg2-R1 (SEQ ID No.22: gtcaccgcccaactgcga) are used as primers, pUC57:Cas9NG is used as a template, and I-5 is utilized ^TM 2X HighFidelity Master Mix, a PCR fragment of about 4.3kb Cas9NG gene was obtained, which was purified, phosphorylated, ligated to the 4.0kb vector backbone, transformed, colony PCR and restriction enzyme verified, sequenced, and the recombinant plasmid was designated pBS rBE22.

pBS rBE was double digested with BamH I and SpeI and rBE 22.03 kb fragment was recovered; the vector pUbi:cas9NG was digested with BamH I and SpeI and an about 12kb vector backbone was recovered; the two were ligated and verified by transformation, colony PCR and cleavage, and the obtained recombinant plasmid was designated pUbi rBE.

The construction of the plasmid pUbi rBE is as follows: the CaMV35S promoter (genebank accession number FJ362600.1, 10382 to 11162 nucleotide sequence), hygromycin gene (genebank accession number KY 420085.1), NOS terminator (SEQ ID No. 14), pVS1 RepA (genebank accession number KY420084.1, 5755 to 6435 nucleotide sequence), pVS1 origin of replication (genebank accession number KY420084.1, 4066 to 5066 nucleotide sequence), attR1 (genebank accession number KR233518.1, 2055 to 2174 nucleotide sequence), ccdB expression cassette genbank accession number KR233518.1, 3289 to 3594 nucleotide sequence), attR2 (genebank accession number KR233518.1, 3635 to 3759 nucleotide sequence), ubip promoter (SEQ ID No. 12), AID gene (SEQ ID No. 6), cas9 gene (SEQ ID No. 5), UGID gene (SEQ ID No. 14), and UGI 2 terminator (SEQ ID No. 14).

1.3 Construction of pUbi rBE recombinant plasmid

The gene sequence SEQ ID No.8 for expression in rice was determined based on the amino acid sequence SEQ ID No.4, and a 1191bp nucleotide sequence as shown in SEQ ID No.8 was artificially synthesized, cloned into pUC57, designated pUC57: tadA (completed by Beijing qingke Biotechnology Co., ltd.).

pUC57-F1 (SEQ ID No.23: gcgcgcttggcgtaatca) and TadA-R1 (SEQ ID No.24: agccagaccaattgagtattttttgtc) were used as primers, and pUC57:TadA as a vector was used as a template, using I-5 ^TM 2X HighFidelity Master Mix, and purifying to obtain a carrier skeleton of 4.13 kb; then uses OsCas9-Fg1-F1 (SEQ ID No. 21) and NLS-R2 (SEQ ID No.25: cactagttcacccgccaac) as primers and pUC57:Cas9NG as a template to utilize I-5 ^TM 2X HighFidelity Master Mix, obtaining PCR fragment of Cas9NG gene of about 4.3kb, purifying, phosphorylating, connecting with the 4.13kb carrier skeleton, transforming, colony PCR and enzyme cutting, and sequencing for standby, the obtained recombinant plasmid is named pUC57: rBE23.

pUC57: rBE23 was digested with BamH I and SpeI and a 5.33kb rBE23 fragment was recovered; the vector pUbi: cas9NG was subjected to BamH I and SpeI and an about 12kb vector backbone was recovered; then the two are connected, and the recombinant plasmid obtained by sequencing after transformation, colony PCR and enzyme digestion verification is named pUbi: rBE23.

The construction of the plasmid pUbi rBE is as follows: the CaMV35S promoter (genebank accession number FJ362600.1, 10382 to 11162 nucleotide sequence), hygromycin gene (genebank accession number KY 420085.1), NOS terminator (SEQ ID No. 14), pVS1 RepA (genebank accession number KY420084.1, 5755 to 6435 nucleotide sequence), pVS1 origin of replication (genebank accession number KY420084.1, 4066 to 5066 nucleotide sequence), attR1 (genebank accession number KR233518.1, 2055 to 2174 nucleotide sequence), ccdB expression cassette genbank accession number KR233518.1, 3289 to 3594 nucleotide sequence), attR2 (genebank accession number KR233518.1, 3635 to 3759 nucleotide sequence), ubip promoter (SEQ ID No. 12), tadA gene (SEQ ID No. 8), cas9 gene (SEQ ID No. 14) terminator (SEQ ID No. 14).

1.4 Construction of pENTR 4-sgRNA

The sequence of the U6 promoter (SEQ ID No. 13), the nucleotide sequence containing two BtgZI cleavage sites (SEQ ID No. 10), the sequence of the gRNA scaffold (SEQ ID No. 9), (T) 8 termination sequence (SEQ ID No. 15), the sequence of the U6 promoter (SEQ ID No. 13), the nucleotide sequence containing two BsaI cleavage sites (SEQ ID No. 11), the sequence of the sgRNA (SEQ ID No. 9), (T) 8 termination sequence (SEQ ID No. 15) which are connected in sequence were synthesized artificially in the direction from the 5 'end to the 3' end and cloned into the pENTR4 vector and named pENTR4: sgRNA. Two BtgZ I or Bsa I cleavage sites are used for cloning target nucleotide sequences in specific genes.

Example 2: knockout of Rice endogenous Gene OsCERK1 Using pUbi: cas9NG

2.1 design and cloning of recognition sequences for OsCERK1 Gene

The transcribed sequence and the genomic sequence of the OsCERK1 (LOC_Os 08g 42580) gene are obtained from the MSU/TIGR rice genome databasehttp://rice.plantbiology.msu.edu/)。

For the OsCERK1 gene, a target nucleotide sequence (SEQ ID No.16: ggccttccttg) was designed containing a match to the end ligation of Btgz I cleavage siteggatccggcga, underlined as BamH I cleavage site, bolded as PAM sequence) primers were as follows: gOsCERK1-F1 (SEQ ID No.26: tgttggccttccttgggatccgg) and gOsCERK1-R1 (SEQ ID No.27: aaacccggatcccaaggaaggcc). After synthesis of the primer, the primer was phosphorylated using T4 polynucleotide kinase, annealed to form a double strand, and gOsCERK1-F1/R1 was cloned into the BtgZ I cleavage site of pENTR4: sgRNA vector, and sequencing confirmed that the insert was completely correct and named pENTR4: sgRNA-gOsCERK1.

2.2 PEG-mediated pUbi Cas9NG system transformed japonica rice variety Kitaake protoplast and gene editing detection

1) Preparation of rice protoplast:

treating the shelled mature rice seeds with 50% commercial disinfectant for 25min; cleaning with sterile water for 3-5 times, transferring the seeds into a sterile culture dish, and sucking out excessive water; seeds were placed on 1/2MS medium (2.2 g/LMS powder; 30g/L sucrose; 6g/L plant gel; pH 5.7) and incubated in a light incubator for 10 days. Cutting stem and leaf of rice seedling with scissors, cutting stem with single-sided blade, transferring the cut rice material into sterile triangular flask, adding 10ml enzymolysis liquid (1.5% cellulase; 0.3% segregation enzyme R-10;0.4M mannitol; 2mM 2- (N-morpholino) ethanesulfonic acid (MES); 0.1 XW 5 solution; pH5.7), lightly mixing, wrapping the flask body with tinfoil paper, vacuumizing for 30min, and placing in horizontal shaking table (rotation speed about 60 rpm), and performing enzymolysis for 6 hr. After the enzymolysis, a nylon mesh (pore size: 35 μm) was used for filtration and collection of the protoplast solution. Centrifuging the protoplast solution at room temperature (centrifugal force 1000g, time 5 min), discarding supernatant, adding the lower protoplast precipitate into W5 solution (154mM NaCl;125mM CaCl) ₂ The method comprises the steps of carrying out a first treatment on the surface of the 25mM KCl;2mM MES; pH 5.7) and 1000g centrifuged for 5min, the supernatant was discarded, and an appropriate amount of MMG solution (0.4M mannitol was added; 20mM CaCl ₂ The method comprises the steps of carrying out a first treatment on the surface of the 25mM MES; pH 5.7) the protoplasts were resuspended.

2) PEG-mediated transformation of rice protoplasts and extraction of genomic DNA from protoplasts

Mu.l of plasmid pUbi: cas9NG (concentration 1000 NG/. Mu.l), 20. Mu.l of plasmid pENTR4: sgRNA-gOsCERK1 (concentration 1000 NG/. Mu.l), 400. Mu.l of protoplasts, 440. Mu.l (equal volume) of 40% PEG4000 solution (40% (w/v) PEG 4000;0.4M mannitol; 100mM Ca (NO) ₃ ) ₂ The method comprises the steps of carrying out a first treatment on the surface of the pH 5.7), gently mixed, and left for 15min. The transformation was stopped by dilution with 1ml of W5 solution and centrifugation at 1000g for 2min. The supernatant was discarded, 1ml of the W5 solution was added, the protoplast was resuspended and transferred into a 12-well cell culture plate, the protoplast was collected after 2 days of incubation at room temperature with a tinfoil paper wrap protected from light, and the genomic DNA of the protoplast was extracted by the CTAB method.

3) Detection of mutation type at target site

Specific PCR primers for identification were designed based on the target site DNA sequence of the OsCERK1 gene: osCERK1-F1 (SEQ ID No.28: gacgtctacgcctttggtgt), osCERK1-R1 (SEQ ID No.29: gtcagctgcaaaatgcaatg), PCR product fragment 393bp. Firstly, carrying out enzyme digestion on genomic DNA of the protoplast by utilizing BamH I for 2 hours, then taking enzyme digestion products as templates, taking OsCERK1-F1 (SEQ ID No. 28) and OsCERK1-R1 (SEQ ID No. 29) as primers, and utilizing I-5 ^TM PCR amplification was performed at 2X High Fidelity Master Mix to obtain 393bp PCR fragment. The PCR product is subjected to BamHI enzymolysis for 3 hours, the PCR product of which the target site is not successfully edited is removed by agarose gel electrophoresis, the fragment of which the target site is subjected to alkali deletion or insertion is recovered by using an AxyPrep gel recovery kit, and the TA cloning vector and Sanger sequencing are connected to analyze the mutation type. As shown in FIG. 1, random sequencing resulted in 11 monoclonal sequences, 6 mutation types were detected in total, base deletion (-1, -2 and-4 bp), base insertion (+T and +A), and base substitution (G for A), respectively, indicating that Cas9NG can recognize the NGA PAM motif to complete gene editing.

Example 3: substitution of base C to T of rice endogenous gene OsRLCK185 by pUbi rBE22

The transcribed sequence and the genomic sequence of the OsRLCK185 (LOC_Os05g 30870) gene are obtained from an MSU/TIGR rice genome databasehttp://rice.plantbiology.msu.edu/)。

For the OsRLCK185 gene, designContains a target nucleotide sequence (SEQ ID No.17:gtgcactgccaagctcacactgc underlined as Alw 44I cleavage site, bolded as PAM sequence) primers were as follows: gOsRLCK185-F1 (SEQ ID No.30: gtgtgtgcactgccaagctcacac) and gOsRLCK185-R1 (SEQ ID No.31: aaacgtgtgattggcagtgcac). After synthesis of the primer, the primer was phosphorylated using T4 polynucleotide kinase, annealed to form a double strand, and the gOsRLCK185-F1/R1 was cloned into the Bsa I cleavage site of pENTR4: sgRNA vector, and sequencing confirmed that the insert was completely correct, designated pENTR4: sgRNA-gOsRLCK185.

The other operations are the same as in example 2.

Specific PCR primers for identification were designed based on the target site DNA sequence of the OsRLCK185 gene: osRLCK185-F1 (SEQ ID No.32: tccatggccttgttcctctt), osRLCK185-R1 (SEQ ID No.33: tgctgctagacacatccaca) and PCR fragment of 484bp. Firstly, carrying out enzyme digestion on genomic DNA of protoplast for 2 hours by utilizing Alw 44I, then taking enzyme digestion products as templates, taking OsRLCK185-F1 (SEQ ID No. 32) and OsRLCK185-R1 (SEQ ID No. 33) as primers, and utilizing I-5 ^TM PCR amplification was performed at 2X High Fidelity Master Mix to obtain a 484bp PCR fragment. The PCR product is subjected to enzymolysis for 3 hours by Alw 44I, the PCR product of which the target site is not successfully edited is removed by agarose gel electrophoresis, the fragment of which the target site base is successfully replaced is recovered by using an AxyPrep gel recovery kit, and the TA cloning vector and Sanger sequencing are connected to analyze the mutation type. As shown in FIG. 2, 10 monoclonal sequences were obtained by random sequencing, each of which detected the mutation of the target base G to A, of which there were 3 mutation types, G respectively _4,6 >A、G _4,6,9 >A and G _4,6,9,14 >A, this suggests that rBE can recognize the NGC PAM motif to complete base editing.

Example 4: substitution of the rice endogenous gene Os03G02040 by the base A to G Using pUbi rBE23

The transcribed sequence and the genomic sequence of the Os03g02040 gene are obtained from an MSU/TIGR rice genome databasehttp://rice.plantbiology.msu.edu/)。

For the Os03g02040 gene, a target containing a linkage matching with the end of Bsa I cleavage site was designedNucleotide sequence (SEQ ID No.18: aga)tctagaggttggtctacgt underlined as Xba I cleavage site, bolded as PAM sequence) primers are as follows: gOs03g02040-F1 (SEQ ID No.34: tgttgagatctagaggttggtcta) and gOs g02040-R1 (SEQ ID No.35: aaactagaccaacctctagatctc). After synthesis of the primer, the primer was phosphorylated using T4 polynucleotide kinase, annealed to form a double strand, gOs g02040-F1/R1 was cloned into the Bsa I cleavage site of pENTR4:sgRNA vector, and sequencing confirmed that the insert was completely correct, designated pENTR4:sgRNA-gOs g02040.

The other operations are the same as in example 2.

Specific PCR primers for identification were designed based on the target site DNA sequence of the Os03g02040 gene: os03g02040-F1 (SEQ ID No.36: cactagcacgacgcactttc), os03g02040-R1 (SEQ ID No.37: agaacacgcgcatcatatc), PCR fragment 493bp. The genome DNA of the protoplast is digested by Alw 44I for 2 hours, and then the digested product is used as a template, os03g02040-F1 (SEQ ID No. 36) and Os03g02040-R1 (SEQ ID No. 37) are used as primers, and I-5 is used ^TM PCR amplification was performed at 2X High Fidelity Master Mix to obtain a 493bp PCR fragment. And (3) after the PCR product is subjected to enzymolysis for 3 hours by Xba I, removing the PCR product of which the target site is not successfully edited by agarose gel electrophoresis, and recovering fragments of the base of the target site successfully replaced by using an AxyPrep gel recovery kit, and connecting a TA cloning vector and Sanger sequencing to analyze mutation types. As shown in fig. 3, sequencing results showed that the target base T mutation was detected to C, where this indicated that rBE23 can recognize the NGT PAM motif to complete base editing.

Sequence listing

<110> institute of plant protection of national academy of agricultural sciences

<120> set of artificial gene editing system for rice

<130> LHA2160702-D1

<160> 37

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1417

<212> PRT

<213> Artificial sequence (non)

<400> 1

Met Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp

1 5 10 15

Tyr Lys Asp Asp Asp Asp Lys Met Ala Pro Lys Lys Lys Arg Lys Val

20 25 30

Gly Ile His Gly Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu

35 40 45

Asp Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr

50 55 60

Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His

65 70 75 80

Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu

85 90 95

Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr

100 105 110

Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu

115 120 125

Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe

130 135 140

Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn

145 150 155 160

Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His

165 170 175

Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu

180 185 190

Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu

195 200 205

Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe

210 215 220

Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile

225 230 235 240

Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser

245 250 255

Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys

260 265 270

Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr

275 280 285

Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln

290 295 300

Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln

305 310 315 320

Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser

325 330 335

Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr

340 345 350

Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His

355 360 365

Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu

370 375 380

Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly

385 390 395 400

Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys

405 410 415

Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu

420 425 430

Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser

435 440 445

Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg

450 455 460

Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu

465 470 475 480

Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg

485 490 495

Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile

500 505 510

Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln

515 520 525

Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu

530 535 540

Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr

545 550 555 560

Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro

565 570 575

Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe

580 585 590

Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe

595 600 605

Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp

610 615 620

Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile

625 630 635 640

Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu

645 650 655

Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu

660 665 670

Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys

675 680 685

Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys

690 695 700

Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp

705 710 715 720

Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile

725 730 735

His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val

740 745 750

Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly

755 760 765

Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp

770 775 780

Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile

785 790 795 800

Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser

805 810 815

Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser

820 825 830

Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu

835 840 845

Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp

850 855 860

Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile

865 870 875 880

Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu

885 890 895

Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu

900 905 910

Glu Val Val Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala

915 920 925

Lys Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg

930 935 940

Gly Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu

945 950 955 960

Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser

965 970 975

Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val

980 985 990

Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp

995 1000 1005

Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His

1010 1015 1020

Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr

1025 1030 1035 1040

Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp

1045 1050 1055

Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr

1060 1065 1070

Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu

1075 1080 1085

Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr

1090 1095 1100

Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala

1105 1110 1115 1120

Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys

1125 1130 1135

Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Arg Pro Lys

1140 1145 1150

Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys

1155 1160 1165

Lys Tyr Gly Gly Phe Val Ser Pro Thr Val Ala Tyr Ser Val Leu Val

1170 1175 1180

Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys

1185 1190 1195 1200

Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn

1205 1210 1215

Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp

1220 1225 1230

Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly

1235 1240 1245

Arg Lys Arg Met Leu Ala Ser Ala Arg Phe Leu Gln Lys Gly Asn Glu

1250 1255 1260

Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His

1265 1270 1275 1280

Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu

1285 1290 1295

Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile

1300 1305 1310

Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys

1315 1320 1325

Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln

1330 1335 1340

Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro

1345 1350 1355 1360

Arg Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Val Tyr Arg

1365 1370 1375

Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr

1380 1385 1390

Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Arg

1395 1400 1405

Pro Lys Lys Lys Arg Lys Val Gly Gly

1410 1415

<210> 2

<211> 211

<212> PRT

<213> Artificial sequence (non)

<400> 2

Met Asp Ser Leu Leu Met Asn Arg Arg Glu Phe Leu Tyr Gln Phe Lys

1 5 10 15

Asn Val Arg Trp Ala Lys Gly Arg Arg Glu Thr Tyr Leu Cys Tyr Val

20 25 30

Val Lys Arg Arg Asp Ser Ala Thr Ser Phe Ser Leu Asp Phe Gly Tyr

35 40 45

Leu Arg Asn Lys Asn Gly Cys His Val Glu Leu Leu Phe Leu Arg Tyr

50 55 60

Ile Ser Asp Trp Asp Leu Asp Pro Gly Arg Cys Tyr Arg Val Thr Trp

65 70 75 80

Phe Ile Ser Trp Ser Pro Cys Tyr Asp Cys Ala Arg His Val Ala Asp

85 90 95

Phe Leu Arg Gly Asn Pro Asn Leu Ser Leu Arg Ile Phe Thr Ala Arg

100 105 110

Leu Tyr Phe Cys Glu Asp Arg Lys Ala Glu Pro Glu Gly Leu Arg Arg

115 120 125

Leu His Arg Ala Gly Val Gln Ile Ala Ile Met Thr Phe Lys Asp Tyr

130 135 140

Phe Tyr Cys Trp Asn Thr Phe Val Glu Asn His Gly Arg Thr Phe Lys

145 150 155 160

Ala Trp Glu Gly Leu His Glu Asn Ser Val Arg Leu Ser Arg Gln Leu

165 170 175

Arg Arg Ile Leu Leu Pro Leu Tyr Glu Val Asp Asp Leu Arg Asp Ala

180 185 190

Phe Arg Thr Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr

195 200 205

Pro Glu Ser

210

<210> 3

<211> 91

<212> PRT

<213> Artificial sequence (non)

<400> 3

Ser Gly Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly

1 5 10 15

Lys Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val

20 25 30

Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr

35 40 45

Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp

50 55 60

Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly

65 70 75 80

Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser

85 90

<210> 4

<211> 397

<212> PRT

<213> Artificial sequence (non)

<400> 4

Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu

1 5 10 15

Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala

20 25 30

Val Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro

35 40 45

Ile Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg

50 55 60

Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu

65 70 75 80

Tyr Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His

85 90 95

Ser Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly

100 105 110

Ala Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His

115 120 125

Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu

130 135 140

Leu Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys

145 150 155 160

Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser

165 170 175

Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser

180 185 190

Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr

195 200 205

Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg

210 215 220

Glu Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly

225 230 235 240

Glu Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala

245 250 255

Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg

260 265 270

Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys

275 280 285

Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val

290 295 300

Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His

305 310 315 320

Tyr Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala

325 330 335

Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln

340 345 350

Val Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly

355 360 365

Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser

370 375 380

Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser

385 390 395

<210> 5

<211> 4254

<212> DNA

<213> Artificial sequence (non)

<400> 5

atggactata aggatcacga tggcgactac aaggatcatg acattgacta taaggatgac 60

gacgataaga tggcacctaa gaagaaaagg aaagtcggca ttcatggcgt tccggcagcc 120

gacaaaaagt atagcatcgg cctcgatatt gggacaaact ctgtgggctg ggcggtaatt 180

accgacgagt acaaggtgcc tagtaagaaa tttaaagtgc tcggaaacac tgacaggcac 240

tctataaaga agaacctgat cggggcactg cttttcgact ccggagagac ggcggaggcg 300

acgcgtctca agcgtaccgc gcgccgcagg tacacaagaa ggaagaatag gatctgctac 360

ttgcaggaaa tcttcagtaa cgagatggcg aaggtcgacg atagtttctt tcatcggttg 420

gaagaatcgt tcctcgtaga ggaggacaaa aagcacgagc gtcacccaat attcgggaat 480

attgttgacg aggttgccta ccatgagaaa tatcctacaa tatatcacct ccgtaagaag 540

cttgtcgatt caactgataa ggctgatctc agactcatct atcttgccct cgcacatatg 600

attaagtttc gtggccactt cttgattgaa ggcgacctca acccggacaa ctcagatgtt 660

gacaagcttt ttatacagct cgtccagaca tataaccagc tgtttgaaga gaatcccatc 720

aatgcgagtg gggttgatgc taaagccatt ttgtccgcca ggttgtccaa atctcgcaga 780

ctggaaaacc tgatcgcaca gcttcccggt gaaaagaaaa acgggctctt cggcaatctc 840

atcgcactgt ccctcggcct caccccaaac ttcaagtcta acttcgacct ggccgaggat 900

gcgaagctcc agctgtcaaa agatacatac gacgacgatt tggacaatct gcttgcgcaa 960

ataggcgacc agtatgcgga cctgttcctg gctgccaaaa atctgtcaga tgcaatcctc 1020

ctgtccgata tattgcgtgt gaacaccgaa atcacgaagg caccgcttag cgcatccatg 1080

atcaagagat acgacgagca ccatcaggac ctcacactcc tcaaggcgct tgttcgtcag 1140

cagcttcccg agaaatataa ggaaattttt ttcgatcaaa gcaagaatgg atatgctggc 1200

tatattgacg gtggcgcttc gcaggaggag ttctataaat tcattaagcc gattctggag 1260

aagatggacg gaacggagga gctcctcgtc aagcttaacc gggaagacct gttgcggaag 1320

cagaggactt ttgataacgg ctctattccg caccaaatcc atctgggtga gttgcacgca 1380

atcttgagaa gacaagagga tttctacccg ttccttaagg ataacagaga gaagatagaa 1440

aaaatactga ccttcaggat accatactat gtgggcccac tggcgcgcgg aaatagtcgt 1500

ttcgcatgga tgactagaaa gtccgaagaa acgatcacgc catggaattt tgaggaagtg 1560

gtcgacaagg gcgcctctgc ccagagcttc atcgaaagga tgaccaattt tgacaaaaat 1620

ctgcctaacg aaaaggtgct tccgaagcac agcctgttgt atgaatactt cacagtttat 1680

aacgagctca ctaaggtcaa gtacgtcacg gagggcatgc gtaagcctgc tttcctgtct 1740

ggtgaacaaa aaaaggcgat tgtggacctc cttttcaaga cgaaccgtaa agttactgtg 1800

aagcaactga aagaggatta ctttaagaaa attgagtgct tcgacagtgt ggagatttcc 1860

ggtgtcgagg accggtttaa cgccagcctg ggtacgtatc atgacctgct taaaattatc 1920

aaggataaag atttcctgga taatgaagag aacgaagata tactggagga cattgtgttg 1980

actttgaccc tcttcgagga cagagagatg attgaggaaa gactgaagac ctacgcacac 2040

ctttttgatg acaaggtcat gaaacaactc aagcgccggc gctatactgg ctggggccgg 2100

ctttctcgca agctcatcaa tgggattcgg gataagcaat caggcaagac aattttggac 2160

ttcctcaaat ccgacggatt cgcaaatagg aattttatgc agctgataca tgacgactct 2220

ttgacattca aagaagacat acagaaggct caggtcagcg gccaaggaga ttctttgcac 2280

gagcatatcg ctaacttggc aggtagcccc gccataaaaa agggcattct tcaaacggta 2340

aaagttgttg acgaactcgt gaaggttatg ggccgtcata agccggaaaa cattgttatt 2400

gaaatggcta gggaaaatca gacgacccag aagggacaga aaaatagcag ggagcggatg 2460

aagagaattg aagagggaat taaggagctt ggatctcaga ttcttaagga gcaccctgtg 2520

gagaacaccc aacttcagaa tgaaaagctc tacctttact accttcaaaa cggccgggat 2580

atgtacgtcg atcaggaact tgacattaac cggttgagcg attatgacgt tgaccatatt 2640

gtgccccaat ctttccttaa agacgactct atcgacaata aagtgctgac gcgcagcgat 2700

aaaaatcgcg gtaagtcgga taatgtcccg tcggaagagg tggttaaaaa aatgaagaac 2760

tattggaggc aactcctgaa tgccaagctg atcactcaga ggaaattcga caatctcacc 2820

aaggcagaaa ggggtggact tagcgagctc gacaaggccg gttttatcaa aagacagctg 2880

gtggagacac gccaaatcac caaacacgtt gcccagatcc tggattcgag gatgaacacg 2940

aagtatgacg agaacgacaa gttgattagg gaagtcaagg tcatcacttt gaagtccaag 3000

ctggtgagcg actttcgcaa agacttccag ttttacaaag tcagggaaat taataactac 3060

caccacgccc acgacgccta ccttaacgcc gtggttggca cagcactcat caagaaatac 3120

cctaagctcg aatctgagtt cgtctatggc gactataagg tctacgacgt tagaaaaatg 3180

atcgcgaaat ctgagcagga aataggcaag gcaactgcca agtacttctt ctattccaat 3240

atcatgaact tttttaagac ggagattacc ctggcgaatg gtgagatccg caagcgccct 3300

ttgattgaga caaacggaga aacaggagag atcgtatggg acaaagggcg ggactttgct 3360

actgttagga aggtgctctc tatgccacaa gttaacattg tcaaaaaaac tgaagtgcag 3420

acaggtgggt ttagcaagga atctatccgc ccgaagagga actctgacaa gctgatcgcc 3480

cgcaagaaag attgggaccc gaaaaagtac ggaggattcg tttcccccac agttgcgtac 3540

tccgtgcttg tcgtggccaa agtggagaag ggcaagtcta agaagctcaa gagcgtcaaa 3600

gagttgttgg ggatcacgat tatggagcgg tcgtctttcg aaaagaatcc gatagatttt 3660

ctcgaggcca agggttataa agaagtcaag aaggatctta tcatcaagct ccctaagtac 3720

tccctctttg agcttgaaaa cggacggaaa agaatgctgg cttcagcgcg ctttcttcag 3780

aagggtaatg aactcgctct gccctcaaaa tatgtgaatt tcctttacct ggcatcacac 3840

tatgagaagc ttaagggttc tccagaggac aacgagcaga agcaactgtt cgttgaacaa 3900

cacaagcact accttgacga gattatcgag caaatcagcg agtttagcaa gcgcgttata 3960

ctggcagacg caaatcttga taaggtcctt agcgcctaca acaagcatag agacaaaccc 4020

atccgggagc aggccgagaa cattattcat ctcttcacct tgacgaatct tggggccccg 4080

cgcgcgttca agtacttcga tactaccata gacagaaagg tctatcgctc gacaaaggaa 4140

gttcttgacg ccacgctgat ccaccaaagt ataacaggcc tctatgagac acgcatcgac 4200

ctttcgcagt tgggcggtga ccgccccaaa aagaagagga aagttggcgg gtga 4254

<210> 6

<211> 633

<212> DNA

<213> Artificial sequence (non)

<400> 6

atggatagcc ttctcatgaa cagaagagag tttctctatc agtttaaaaa tgttcggtgg 60

gcgaagggga ggagagagac atatctctgc tatgttgtta agcggagaga ttctgcgacc 120

tcattctcac tcgattttgg ttatttgagg aacaagaatg gatgtcatgt cgaattgttg 180

tttctccggt atatttccga ctgggatttg gacccagggc ggtgttaccg ggtcacatgg 240

tttatttcct ggagtccatg ttacgactgt gcgcgccatg tcgccgactt cctcaggggt 300

aatcctaact tgtccttgcg gatttttaca gccagactct atttctgtga ggatcggaag 360

gcggaacccg aggggctgag aagactgcac cgcgctggcg tccaaatcgc catcatgact 420

tttaaggatt atttctactg ttggaacacg ttcgtcgaga accacggtcg gaccttcaaa 480

gcctgggaag ggctgcatga aaattccgtg aggttgtccc ggcaactccg cagaatactc 540

ctgccccttt atgaggtcga cgatctcaga gacgccttta gaactagcgg aagcgagacg 600

ccagggactt ctgaatcggc cacccccgag agc 633

<210> 7

<211> 273

<212> DNA

<213> Artificial sequence (non)

<400> 7

tccggcggaa gtacaaacct ttcagacatt atagaaaagg aaaccggcaa gcaactcgtc 60

atccaggaat ccatacttat gctccctgaa gaggtggaag aagtgatcgg taataaacca 120

gagagcgaca tacttgtcca caccgcttat gacgaaagta cagacgaaaa cgtcatgctt 180

ctgacgagtg atgcccccga atacaaacct tgggcgctcg tcatccagga ttccaatggg 240

gagaataaaa taaagatgct ctctggaggc agc 273

<210> 8

<211> 1191

<212> DNA

<213> Artificial sequence (non)

<400> 8

atgtccgaag tggaatttag ccatgaatat tggatgcggc acgccctcac gcttgccaag 60

agagcctggg atgagaggga ggttcccgtc ggtgccgtgt tggtccataa caacagggtg 120

attggggaag gatggaacag acccattggg cgccatgatc caactgccca tgcagagatt 180

atggcgctca ggcaaggggg gttggttatg caaaactacc ggcttattga cgcaaccctg 240

tatgtcaccc ttgaaccctg tgttatgtgc gcgggggcca tgatacactc tcggataggg 300

cgggtggtgt tcggggctcg ggatgctaag accggagctg ctggttccct catggatgtc 360

ttgcatcatc ctggtatgaa ccatagagtc gagattactg aaggcattct cgcagacgaa 420

tgcgctgccc ttctctcaga tttctttaga atgcgcagac aggaaataaa ggctcaaaaa 480

aaagcacaga gttccacgga ttccggcggg tcgagcggtg gcagctccgg ctccgagaca 540

cccggtacga gtgaatccgc tacgcccgaa tcctcggggg gaagctctgg aggctcatca 600

gaagtcgagt tctcccatga gtattggatg aggcacgccc tcactcttgc gaagagggcc 660

agggacgaga gggaggtgcc ggtcggtgct gtcctggtct tgaataacag ggtgataggc 720

gaaggttgga acagggctat tggccttcat gaccctactg ctcatgcgga aatcatggca 780

cttagacagg ggggcctcgt tatgcaaaat taccgcctga tcgacgccac tctttatgtc 840

acatttgaac catgtgttat gtgtgcgggc gctatgatcc attcacgcat aggtcgcgtg 900

gtttttggag ttcgcaacgc gaaaacaggg gctgcaggct ctctgatgga cgttttgcac 960

tatccgggaa tgaaccatag agtcgaaatc acagaaggga ttttggcaga cgaatgcgcg 1020

gctcttcttt gttatttttt cagaatgccc cgccaagtgt ttaatgctca aaagaaagcg 1080

cagagtagca cagactcggg gggatcttct gggggctcgt ctggttccga gactcccgga 1140

acttccgagt cggcaacacc tgaatcctcc ggcggctctt cgggcggatc t 1191

<210> 9

<211> 76

<212> DNA

<213> Artificial sequence (non)

<400> 9

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgc 76

<210> 10

<211> 25

<212> DNA

<213> Artificial sequence (non)

<400> 10

tgtgtagaga ccaaaggagg tctca 25

<210> 11

<211> 41

<212> DNA

<213> Artificial sequence (non)

<400> 11

tgttggctag gatccatcgc agtcagcgat gagtacagca a 41

<210> 12

<211> 1765

<212> DNA

<213> Artificial sequence (non)

<400> 12

gcagcgtgac ccggtcgtgc ccctctctag agataatgag cattgcatgt ctaagttata 60

aaaaattacc acatattttt tttgtcacac ttgtttgaag tgcagtttat ctatctttat 120

acatatattt aaactttact ctacgaataa tataatctat agtactacaa taatatcagt 180

gttttagaga atcatataaa tgaacagtta gacatggtct aaaggacaat tgagtatttt 240

gacaacagga ctctacagtt ttatcttttt agtgtgcatg tgttctcctt tttttttgca 300

aatagcttca cctatataat acttcatcca ttttattagt acatccattt agggtttagg 360

gttaatggtt tttatagact aattttttta gtacatctat tttattctat tttagcctct 420

aaattaagaa aactaaaact ctattttagt ttttttattt aataatttag atataaaata 480

gaataaaata aagtgactaa aaattaaaca aatacccttt aagaaattaa aaaaactaag 540

gaaacatttt tcttgtttcg agtagataat gccagcctgt taaacgccgt cgacgagtct 600

aacggacacc aaccagcgaa ccagcagcgt cgcgtcgggc caagcgaagc agacggcacg 660

gcatctctgt cgctgcctct ggacccctct cgagagttcc gctccaccgt tggacttgct 720

ccgctgtcgg catccagaaa ttgcgtggcg gagcggcaga cgtgagccgg cacggcaggc 780

ggcctcctcc tcctctcacg gcacggcagc tacgggggat tcctttccca ccgctccttc 840

gctttccctt cctcgcccgc cgtaataaat agacaccccc tccacaccct ctttccccaa 900

cctcgtgttg ttcggagcgc acacacacac aaccagatct cccccaaatc cacccgtcgg 960

cacctccgct tcaaggtacg ccgctcgtcc tccccccccc cccctctcta ccttctctag 1020

atcggcgttc cggtccatgg ttagggcccg gtagttctac ttctgttcat gtttgtgtta 1080

gatccgtgtt tgtgttagat ccgtgctgct agcgttcgta cacggatgcg acctgtacgt 1140

cagacacgtt ctgattgcta acttgccagt gtttctcttt ggggaatcct gggatggctc 1200

tagccgttcc gcagacggga tcgatttcat gatttttttt gtttcgttgc atagggtttg 1260

gtttgccctt ttcctttatt tcaatatatg ccgtgcactt gtttgtcggg tcatcttttc 1320

atgctttttt tttgtcttgg ttgtgatgat gtggtgtggt tgggcggtcg ttcattcgtt 1380

ctagatcgga gtagaatact gtttcaaact acctggtgta tttattaatt ttggaactgt 1440

atgtgtgtgt catacatctt catagttacg agtttaagat ggatggaaat atcgatctag 1500

gataggtata catgttgatg tgggttttac tgatgcatat acatgatggc atatgcagca 1560

tctattcata tgctctaacc ttgagtacct atctattata ataaacaagt atgttttata 1620

attattttga tcttgatata cttggatgat ggcatatgca gcagctatat gtggattttt 1680

ttagccctgc cttcatacgc tatttatttg cttggtactg tttcttttgt cgatgctcac 1740

cctgttgttt ggtgttactt ctgca 1765

<210> 13

<211> 322

<212> DNA

<213> Artificial sequence (non)

<400> 13

aagaacgaac taagccggac aaaaaaagga gcacatatac aaaccggttt tattcatgaa 60

tggtcacgat ggatgatggg gctcagactt gagctacgag gccgcaggcg agagaagcct 120

agtgtgctct ctgcttgttt gggccgtaac ggaggatacg gccgacgagc gtgtactacc 180

gcgcgggatg ccgctgggcg ctgcgggggc cgttggatgg ggatcggtgg gtcgcgggag 240

cgttgagggg agacaggttt agtaccacct cgcctaccga acaatgaaga acccacctta 300

taaccccgcg cgctgccgct tg 322

<210> 14

<211> 253

<212> DNA

<213> Artificial sequence (non)

<400> 14

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 180

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

<210> 15

<211> 8

<212> DNA

<213> Artificial sequence (non)

<400> 15

tttttttt 8

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence (non)

<400> 16

ggccttcctt gggatccggc ga 22

<210> 17

<211> 23

<212> DNA

<213> Artificial sequence (non)

<400> 17

gtgcactgcc aagctcacac tgc 23

<210> 18

<211> 22

<212> DNA

<213> Artificial sequence (non)

<400> 18

agatctagag gttggtctac gt 22

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 19

agcaagtccg attgaatact 20

<210> 20

<211> 18

<212> DNA

<213> Artificial sequence (non)

<400> 20

tccggcggaa gtacaaac 18

<210> 21

<211> 19

<212> DNA

<213> Artificial sequence (non)

<400> 21

attgggacaa actctgtgg 19

<210> 22

<211> 18

<212> DNA

<213> Artificial sequence (non)

<400> 22

gtcaccgccc aactgcga 18

<210> 23

<211> 18

<212> DNA

<213> Artificial sequence (non)

<400> 23

gcgcgcttgg cgtaatca 18

<210> 24

<211> 27

<212> DNA

<213> Artificial sequence (non)

<400> 24

agccagacca attgagtatt ttttgtc 27

<210> 25

<211> 18

<212> DNA

<213> Artificial sequence (non)

<400> 25

actagttcac ccgccaac 18

<210> 26

<211> 23

<212> DNA

<213> Artificial sequence (non)

<400> 26

tgttggcctt ccttgggatc cgg 23

<210> 27

<211> 23

<212> DNA

<213> Artificial sequence (non)

<400> 27

aaacccggat cccaaggaag gcc 23

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 28

gacgtctacg cctttggtgt 20

<210> 29

<211> 19

<212> DNA

<213> Artificial sequence (non)

<400> 29

tcagctgcaa aatgcaatg 19

<210> 30

<211> 24

<212> DNA

<213> Artificial sequence (non)

<400> 30

gtgtgtgcac tgccaagctc acac 24

<210> 31

<211> 22

<212> DNA

<213> Artificial sequence (non)

<400> 31

aaacgtgtga ttggcagtgc ac 22

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 32

tccatggcct tgttcctctt 20

<210> 33

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 33

tgctgctaga cacatccaca 20

<210> 34

<211> 24

<212> DNA

<213> Artificial sequence (non)

<400> 34

tgttgagatc tagaggttgg tcta 24

<210> 35

<211> 24

<212> DNA

<213> Artificial sequence (non)

<400> 35

aaactagacc aacctctaga tctc 24

<210> 36

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 36

cactagcacg acgcactttc 20

<210> 37

<211> 20

<212> DNA

<213> Artificial sequence (non)

<400> 37

cagaacacgc gcatcatatc 20

Claims (18)

1. An artificial gene editing system for rice, the artificial gene editing system comprising:

a regulatory element of type I encoding a nucleotide sequence such as amino acid sequence I; wherein the amino acid sequence I is an amino acid sequence shown as SEQ ID No. 1;

a II regulatory element which is a II-1 nucleotide sequence and a II-2 nucleotide sequence which are sequentially connected in series from a 5 'end to a 3' end; the II-1 th nucleotide sequence comprises a target nucleotide sequence; the target site in the target nucleotide sequence is positioned at any one of 3 to 5 positions from 3 ʹ end to 5 ʹ end of the target nucleotide sequence, the target nucleotide sequence is derived from rice genome, and the target nucleotide sequence contains the target site to be mutated in rice genome; the nucleotide sequence II-2 is derived from streptococcus pyogenesStreptococcus pyogenes) The nucleotide sequence of II-2 is shown as SEQ ID No. 9; the II-1 nucleotide sequence and the II-2 nucleotide sequence are transcribed and fused, and the product can guide the protein coded by the I regulatory element to a target site to be mutated in rice genome and mutate the base at the target site;

when the number of the II regulatory elements is plural, the II-1 nucleotide sequences contained in each of the II regulatory elements are different from each other;

the target nucleotide sequence is determined by:

1) Determining a nucleotide sequence to be modified on a rice genome;

2) Judging that the nucleotide sequence to be modified determined in the step 1) is a specific sequence in a genome,

judging whether the change caused by the mutation of the base of the nucleotide site to be mutated meets the expectations or not according to the I-th regulating element; or judging whether the change caused by mutation of the reverse complementary base of the nucleotide site to be mutated meets the expectations or not according to the I-th regulatory element;

for the predictors, the nucleotide sites to be mutated are potential target sites;

3) Screening a target sequence in a nucleotide sequence to be modified or its reverse complement: searching in the 3 ʹ end direction of a potential target site to confirm the presence of a recognition motif recognized by the amino acid sequence encoded by the I-th regulatory element and that the target site is at a position-3 to-5 upstream of the 5 ʹ end of the recognition motif, whereby the 17 to 21 nucleotide sequence upstream of the 5 ʹ end of the recognition motif is determined to be the target nucleotide sequence; the recognition module is 5 ʹ -N ₁ GN ₂ -3 ʹ, wherein the N ₁ And N ₂ A, G, C and T, independently.

2. The artificial gene editing system of claim 1, wherein the nucleotide sequence of the I-th regulatory element is a nucleotide sequence suitable for expression in rice and the nucleotide sequence of the II-th regulatory element is a nucleotide sequence suitable for transcription in rice.

3. The artificial gene editing system according to claim 2, wherein the nucleotide coding sequence encoding the amino acid sequence shown as SEQ ID No.1 is shown as SEQ ID No. 5.

4. The artificial gene editing system according to claim 1, wherein the 3' end of the II-1 nucleotide sequence further comprises a cloning site comprising a cleavage site for a type IIs restriction enzyme, into which the target nucleotide sequence is cloned via the cloning site on the II-1 nucleotide sequence, such that the II-1 nucleotide sequence is transcriptionally fused with the II-2 sequence;

when the II-th regulatory element is plural, the cleavage sites of the type IIS restriction enzymes for cloning different target nucleotide sequences are different from each other.

5. The artificial gene editing system according to claim 1, wherein the target nucleotide sequence is 17 to 21 nucleotide sequences upstream of the 5 ʹ end of the recognition module, and nucleotide sequences containing five consecutive T's are eliminated.

6. The artificial gene editing system of claim 1, further comprising a first promoter in rice at the 5 ʹ end of the I regulatory element for initiating transcription of the I regulatory element; and/or the artificial gene editing system further comprises a second promoter for use in rice at the 5 ʹ end of the II regulatory element and for initiating transcription of the II regulatory element.

7. The artificial gene editing system of claim 6, wherein the first promoter is an RNA polymerase II type promoter; and/or the second promoter is an RNA polymerase type III promoter.

8. The artificial gene editing system of claim 6, wherein the sequence of the first promoter is SEQ ID No.12; and/or the sequence of the second promoter is SEQ ID No.13.

9. The artificial gene editing system of any of claims 1 to 8, further comprising a first terminator at the 3' end of the I regulatory element that terminates transcription of the I regulatory element; and/or the artificial gene editing system further comprises a second terminator at the 3' end of the II regulatory element that terminates transcription of the II regulatory element.

10. The artificial gene editing system of claim 9, wherein the sequence of the first terminator is SEQ ID No.14; and/or the sequence of the second terminator is SEQ ID No.15.

11. The artificial gene editing system of claim 1, wherein the I-th regulatory element and the II-th regulatory element are cloned into at least one vector.

12. The artificial gene editing system of claim 1, wherein the I-th regulatory element is cloned into pCAMBIA1300 and the II-th regulatory element is cloned into entry vector pENTR 4.

13. The artificial gene editing system of claim 9, wherein the first promoter, the ith regulatory element and the first terminator are cloned into a pCAMBIA1300 vector.

14. The artificial gene editing system of claim 9, wherein the second promoter, the II regulatory element and the second terminator are cloned into a pENTR4 vector.

15. The artificial gene editing system of claim 1, wherein the I-th regulatory element and the II-th regulatory element are integrated on the same carrier or are distributed on both carriers for use together.

16. Use of the artificial gene editing system of any of claims 1 to 15 for rice genome mutation.

17. A method for mutating a rice genome, comprising the steps of:

1) Introducing the artificial gene editing system according to any one of claims 1 to 15 into rice callus or rice protoplast by one of agrobacterium-mediated, gene gun bombardment, or PEG-mediated transformation, and then culturing to obtain rice plants;

2) Screening to obtain rice plants containing the required mutation.

18. The method of claim 17, wherein said rice plant produces a rice seed comprising said mutation.