KR102551064B1 - Novel U6 promoter separated form grapevine and use of the same - Google Patents

Abstract

The present invention provides a novel U6 promoter isolated from grape genus plants and having high guide RNA (gRNA) transcriptional activity. The novel U6 promoter isolated from grape plants provided in the present invention has significantly superior target guide RNA (gRNA) transcriptional activity in grape plants compared to the AtU6-26 promoter isolated from Arabidopsis. Therefore, the novel U6 promoter isolated from the vine plant provided in the present invention can increase the efficiency and ease of genome editing of the vine plant using the CRISPR system. Furthermore, using the novel U6 promoter isolated from grape genus plants provided in the present invention and a recombinant vector system including the same, it is possible to easily perform research on gene function or development of new varieties of grapes, which are hybrid varieties.

Description

Novel U6 promoter separated form grapevine and use of the same}

The present invention relates to a novel U6 promoter and its use, and more particularly, to a novel U6 promoter isolated from grapes and having high guide RNA (gRNA) expression efficiency, and a recombinant vector for editing the genome of grape plants using the same, and It relates to a method for editing the genome of vine plants.

Grape is a plant belonging to the family Vitaceae, genus Vitis , and subgenus Euvitis . It produces fruit rich in nutrients and is used as raw fruit or used as wine, raisins, jam, juice, jelly, and vinegar. It is used in the manufacture of processed foods such as , oil, etc. Grapes are grown on more than 7 million hectares of farmland worldwide, and more than 79 million tons are produced annually. In 2007 and 2011, the grape genome information of the Pinot Noir reference variety was announced, and based on this, various varieties are being improved using traditional breeding and biotechnology. The main goals of grape variety improvement include winemaking characteristics, aroma and taste components, presence or absence of seeds (nuclear or non-nuclear fruit), fruit size, and disease resistance.

Biotechnology for genetic improvement of plants includes the use of Agrobacterium bacteria, the production of transgenic plants using a biolistic bombardment, or virus-induced gene silencing (VIGS). ) techniques have been used. These techniques are used to analyze the function of grape genes or to develop new varieties through gene introduction or regulation of expression. The recently proposed CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR) genome editing technology is capable of gene knock-out, displacement, expression control, etc. It can be used for development, etc.

The elements of genome editing technology are CRISPR RNA (crRNA) containing around 20 nucleotide sequences as a target part, trans-activating CRISPR RNA (tracrRNA) having a palindromic structure, or sgRNA (single guide RNA) combining the two into one and; It is a CRISPR-associated systems (Cas) protein that cleave nucleic acids, such as the Cas9 enzyme. These elements are introduced in the form of genes into T-DNA plasmid vectors to be expressed in plants; Alternatively, the intended purpose can be obtained by injecting it into the plant in the form of RNA and protein. In this case, unlike existing technologies, gene function defects can be obtained without introduction of foreign genes, so it is actively used in the development of new grape varieties [Wang X, et al. (2018) CRISPR/Cas9-mediated efficient targeted mutagenesis in grape in the first generation. Plant Biotechnol J 16: 844-855; Ren C, et al. (2016) CRISPR/Cas9-mediated efficient targeted mutagenesis in Chardonnay ( Vitis vinifera L.). Scientific Reports 6: 32289; Sunitha and Rock (2020) CRISPR/Cas9-mediated targeted mutagenesis of TAS4 and MYBA7 loci in grapevine rootstock 101-14. Transgenic Research 29: 355-367; Wan, et al. (2020) CRISPR/Cas9-mediated mutagenesis of VvMLO3 results in enhanced resistance to powdery mildew in grapevine ( Vitis vinifera ). Hortic Res 7: 116)]. It is expected that the CRISPR elements introduced as part of the T-DNA into the plant chromosome by transformation using Agrobacterium can be removed by crossing the transgenic plants thereafter. Recently, nucleic acid-independent genome editing (DNA-free genome editing), in which genes are edited by temporarily injecting CRISPR restriction enzymes such as Cas9 and target-directing guide RNA into protoplasts, and plants are regenerated from these cells. editing) technology was also proposed to avoid social concerns raised about genetically modified plants [Malnoy, et al. (2016) DNA-free genetically edited grapevine and apple protoplast using CRISPR/Cas9 ribonucleoproteins. Front Plant Sci 7: 1904].

On the other hand, the success efficiency of genome editing depends on the selection of crRNA and the active concentration of CRISPR elements. Currently, the expression of sgRNA in grapes mainly uses the AtU6-26 promoter isolated from Arabidopsis thaliana . U6 snRNA (small nuclear RNA) gene promoter, in short, RNA polymerase Ⅲ (RNA polymerase Ⅲ) acts on the U6 promoter [Waibel and Filipowicz (1990) U6 snRNA genes of Arabidopsis are transcribed by RNA polymerase III but contain the same two upstream promoter elements as RNA polymerase II-transcribed U-snRNA genes. Nucleic Acids Res 18: 3451-3458], the transcriptional activity of the U6 promoter is determined by the proximal sequence element (PSE or USE) commonly present in the promoter region and the distal sequence element (PSE or USE) that is less conserved higher than that. Distal Sequence Element, DSE) [Danzeiser, et al. (1993) Functional characterization of elements in a human U6 small nuclear RNA gene distal control region. Molecular and cellular biology 13: 4670-4678; Waibel and Filipowicz (1990) RNA-polymerase specificity of transcription of Arabidopsis U snRNA genes determined by promoter element spacing. Nature 346: 199-202). The transcriptional activity of the U6 promoter differs between species and within a species depending on which U6 snRNA gene is used [Wang, et al. (2008) Hairpin RNAs derived from RNA polymerase II and polymerase III promoter-directed transgenes are processed differently in plants. RNA 14: 903-913.; Li, et al. (2007) Varied transcriptional efficiencies of multiple Arabidopsis U6 small nuclear RNA genes. Journal of Integrative Plant Biology 49: 222-229; Kim and Nam (2013) Isolation and characterization of Medicago truncatula U6 promoters for the construction of small hairpin RNA-mediated gene silencing vectors. Plant Molecular Biology Reporter 31: 581-593]. In addition, transcriptional activity can be increased by redesigning the promoter region [Xia, et al. (2003). An enhanced U6 promoter for synthesis of short hairpin RNA. Nucleic Acids Research 31: e100-e100.; Preece, et al. (2020) 'Mini' U6 Pol III promoter exhibits nucleosome redundancy and supports multiplexed coupling of CRISPR/Cas9 effects. Gene therapy 27: 451-458]. The distal sequence element (DSE) present in the human U6 promoter is important for the Oct-1 binding site consisting of 8 bases, such as the 'ATTTGCAT' sequence [Danzeiser, et al. (1993). Functional characterization of elements in a human U6 small nuclear RNA gene distal control region. Molecular and cellular biology 13: 4670-4678]. The Oct-1 binding site is also conserved in Medicago truncatula among plants, but does not exist in Arabidopsis and rice [Kim and Nam (2013) Isolation and characterization of Medicago truncatula U6 promoters for the construction of small hairpin RNA-mediated gene silencing vectors. Plant Molecular Biology Reporter 31: 581-593]. In addition, the MtU6-6 promoter of Medicago truncatula, the AtU6-26 promoter of Arabidopsis, and the OsU6.11-1 promoter of rice have DSE5, a conserved sequence consisting of 8 bases, similar to the sequence of 'AATCTGAA'. do. Since the transcriptional activity of the Medicago truncatula MtU6-6 promoter excluding DSE5 was reduced by 39%, DSE5 was suggested to be a key factor regulating the transcriptional activity of the MtU6 promoter, at least in Medicago truncatula [Kim and Nam (2013) Isolation and characterization of Medicago truncatula U6 promoters for the construction of small hairpin RNA-mediated gene silencing vectors. Plant Molecular Biology Reporter 31: 581-593].

As such, since the promoter structure is different for each species or for each U6 gene within a species, the activity of transcribing guide RNA (gRNA) for genome editing may be different for each U6 promoter. Improvement in genome editing efficiency using a species-specific U6 promoter has been experimentally confirmed in several plants, such as soybean, cotton, Medicago truncatula, potato, and chicory [Sun, et al. (2015) Targeted mutagenesis in soybean using the CRISPR-Cas9 system. Sci Rep 5: 10342; Long, et al. (2018). Optimization of CRISPR/Cas9 genome editing in cotton by improved sgRNA expression. Plant Methods 14: 85-85; Kim, et al. (2019) MtGA2ox10 encoding C20-GA2-oxidase regulates rhizobial infection and nodule development in Medicago truncatula . Sci Rep 9: 5952; Johansen, (2019). High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato. Sci Rep 9: 17715-17715; Bernard, et al. (2019) Efficient genome editing using CRISPR/Cas9 technology in chicory. Int J Mol Sci 20: 1155].

High expression of guide RNA (gRNA) by the U6 promoter is particularly important in protoplast genome editing. Protoplast genome editing can also be a method to evaluate the genome editing efficiency of guide RNA (gRNA) candidates [Lin, et al. (2018) Application of protoplast technology to CRISPR/Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnology Journal 16: 1295-1310], and can also be used as a DNA-free genome editing technology to obtain genome-edited plants without inserting T-DNA into the genome [Woo, et al. (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol. 33:1162-1164].

Protoplast genome editing is particularly useful for genome editing of grapes and other perennial plants that are maintained as hybrids. In the transformation method using Agrobacterium into which the foreign gene has been inserted, individuals without the foreign gene are obtained only after selection of progeny in which the inserted T-DNA has been eliminated through chromosomal recombination. However, in this process, there is a problem that the original breed has a different genotype. On the other hand, protoplast genome editing has the advantage that the Cas9 protein and sgRNA, which are CRISPR elements injected into the protoplast, exist only temporarily, and then the genome-edited plant regenerated therefrom is free of foreign genes. That is, since most grape varieties are hybrids, protoplast genome editing is useful in terms of breed improvement, and a method for highly efficient expression or delivery of sgRNA is required for grape protoplast genome editing.

Most grape varieties are hybrid genotypes bred by crossing parents with different genetic backgrounds, and protoplast transfection is a better method than transformation using Agrobacterium considering the problem of inserting foreign genes. At this time, the form of the CRISPR element transfected into the protoplast may be in the form of Cas protein and guide RNA (guide RNA, gRNA), or plasmid or mRNA form. A DNA-free genome editing method in which a double Cas protein and a synthetic guide RNA are mixed and injected into protoplasts has been proposed as the best genome editing method because there is no possibility of foreign genes being introduced into the plant genome [Woo, et al. . (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol. 33:1162-1164)], and also verified in grape protoplasts [Malnoy, et al. (2016) DNA-free genetically edited grapevine and apple protoplast using CRISPR/Cas9 ribonucleoproteins. Front Plant Sci 7: 1904]. On the other hand, a recombinant plasmid in which a Cas protein gene and a guide RNA gene are cloned can be used for protoplast genome editing [Lin, et al. (2018) Application of protoplast technology to CRISPR/Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnology J 16: 1295-1310]. Currently, the U6 promoter of Arabidopsis is used as the U6 promoter in grape genome editing using a recombinant plasmid. As mentioned above, there is a possibility that the efficiency of genome editing can be increased by using the unique U6 promoter with high transcription ability in various plant species, but the U6 promoter unique to grapes has not been published yet.

Cases of genome editing in grape protoplasts are rare, and a study has been reported to delete MLO-7, a gene associated with resistance to powdery mildew, a major disease of grapes, through a DNA-free genome editing method using a RNP complex (ribonucleoprotein complex) [Malnoy , et al. (2016) DNA-free genetically edited grapevine and apple protoplast using CRISPR/Cas9 ribonucleoproteins. Front Plant Sci 7: 1904]. However, as a result of examining the target deletion rate using deep sequencing in the above study, the targeting efficiency was very low. In addition, it is difficult to freely apply a large number of candidate sgRNAs due to the cost of synthesizing and purifying the Cas9 protein and sgRNAs. In addition, if the genome editing hit efficiency is low, it is difficult to select genome-edited cells or callus populations in the subsequent plant regeneration step and the final probability of success is lowered in proportion thereto. For these practical reasons, most of the current genome-edited grape plants are obtained through transformation using Agrobacterium.

In order to increase the targeting efficiency of protoplast genome editing, plasmids other than RNP complexes (ribonucleoprotein complexes) can be used. The expected advantage at this time is that sgRNA (single guide RNA) is transcribed and Cas9 protein is produced in vivo, so there is no need for synthesis and purification processes, and the plasmid exists in the protoplast cell for a considerable period of time and repeatedly DNA Because they serve as templates, the level of CRISPR elements can be high. To this end, it is necessary to develop a unique promoter to increase the expression level of sgRNA (single guide RNA) or guide RNA (gRNA).

The present invention was derived under the conventional technical background, and an object of the present invention is to provide a novel U6 promoter isolated from grapes and having high expression efficiency of guide RNA (gRNA).

Another object of the present invention is to provide a recombinant vector for editing the genome of a grape plant or a method for editing the genome of a grape plant, as a use of the novel U6 promoter.

The inventors of the present invention identified the promoter sequence above the grape U6 snRNA gene in order to develop a gene promoter with high expression efficiency of target guide RNA in grape gene editing using the CRISPR system, and transcription of the guide RNA using protoplast genome editing. A novel grape U6 promoter with high activity was selected. In addition, a vector system was constructed for easy cloning of two single guide RNAs (sgRNAs) into one plasmid using the grape U6 promoter selected therefrom. In order to demonstrate the efficacy of the new grape U6 promoter, a plasmid cloned with two single guide RNAs (sgRNAs) and the Cas9 gene under the CaMV 35S promoter targeting two grape genes was 1) introduced into Agrobacterium and then leaf slices was transformed or 2) protoplasts were transfected and the genotype was analyzed, proving that gene deletion occurred with high efficiency.

In order to solve the above object, an example of the present invention consists of a nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence having 90% or more homology with the nucleotide sequence of SEQ ID NO: 2, a U6 promoter isolated from a grape genus plant to provide. In addition, one example of the present invention provides a U6 promoter isolated from a plant of the genus Grape, consisting of the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having 90% or more homology with the nucleotide sequence of SEQ ID NO: 5.

In order to solve the above object, one embodiment of the present invention provides a U6 promoter isolated from a grape genus plant and a recombinant vector comprising a nucleotide sequence operably linked to the U6 promoter and encoding a guide RNA. In addition, an example of the present invention is a guide RNA expression cassette comprising a U6 promoter isolated from a grape genus plant and a polynucleotide sequence operably linked to the U6 promoter and encoding a guide RNA; and a Cas endonuclease expression cassette. In addition, an example of the present invention is a first U6 promoter isolated from a grape plant, a first polynucleotide sequence operably linked to the first U6 promoter and encoding a first guide RNA, a first isolated from a grape plant a dual guide RNA expression cassette comprising 2 U6 promoters and a second polynucleotide sequence operably linked to the second U6 promoter and encoding a second guide RNA; and a Cas endonuclease expression cassette.

In order to solve the above object, an example of the present invention is to co-culture an explant of a plant of the genus Agrobacterium into which the above-described recombinant vector has been introduced, thereby infecting the bacteria of the genus Agrobacterium; and culturing the explant infected with the Agrobacterium genus in a medium for forming callus to form a callus. In addition, transforming the protoplasts by introducing the above-described recombinant vector of the present invention into protoplasts of grape genus plants; And it provides a grape genus plant genome editing method comprising culturing the transformed protoplasts.

The novel U6 promoter isolated from grape plants provided in the present invention can transcribe target guide RNA (gRNA) with high activity in grape plants compared to the AtU6-26 promoter isolated from Arabidopsis. Therefore, the novel U6 promoter isolated from the vine plant provided in the present invention can increase the efficiency and ease of genome editing of the vine plant using the CRISPR system. Furthermore, using the novel U6 promoter isolated from grape genus plants provided in the present invention and a recombinant vector system including the same, it is possible to easily perform research on gene function or development of new varieties of grapes, which are hybrid varieties.

Figure 1 schematically shows the U6 snRNA gene identified in the grape reference genome and the promoter motif present in the upper region.
2 is a map of plasmid vectors pGK1064, pGK1066, pGK1067, pGK1068 and pGK1069 constructed for sgRNA cloning and Cas9 expression in Examples of the present invention.
Figure 3 shows the connection structure of the grape U6 promoter and sgRNA cloning cassette prepared in Example of the present invention.
Figure 4 shows the expression level of gRNA transcripts after culturing protoplasts of grapes of Italian variety, into which plasmid vectors pGK1064, pGK1066, pGK1067, pGK1068, pGK1069, pGK2201 and pGK1025 were introduced by transfection in an embodiment of the present invention. This is a graph comparing the transcriptional activity of the U6 promoter.
Figure 5 is a map (A) of the pVgR6-3 plasmid and pVgR6-7 plasmid prepared in Examples of the present invention and a schematic diagram (B) of PCR primer design for using them as templates.
Figure 6 shows the positions (A) of gR1 (gRNA1) and gR2 (gRNA2) targeting MADS5 and the positions (B) of gR1 (gRNA1) and gR2 (gRNA2) targeting ZAT10 in an embodiment of the present invention. will be.
Figure 7 shows the U6-sgRNA structure (C) of the recombinant plasmid pGK1064-crZAT10-221.273D in which two sgRNAs for targeting ZAT10 were cloned in pGK1064 in an example of the present invention, and two sgRNAs for targeting MADS5 in pGK1064 shows the U6-sgRNA structure of the cloned recombinant plasmid pGK1064-crMADS5-1493.1599D (D).
8 is a map of pBGW-crMADS5-1493.1599D and pBGW-crZAT10-221.273D, which are recombinant binary plasmids prepared in Examples of the present invention.
Figure 9 is the peak of IDAA analysis of MADS5 gene edited callus (sample number: crM5-4-1 to crM5-4-4) obtained by culturing after infection with Agrobacterium in an example of the present invention. This is the result of quantifying the peak area and insertion/deletion (InDel) genotype frequency for each deletion genotype shown in Fig. 9.
FIG. 11 is the IDAA analysis peak of ZAT10 gene-edited callus (sample number: crZ10-4-1 to crZ10-4-4) obtained by culturing after infection with Agrobacterium in an example of the present invention. FIG. 11 is a result of quantifying the peak area for each deletion genotype and the frequency of insertion/deletion (InDel) genotypes.
13 is a photograph of the Cas9-2A-GFP gene expression observed by GFP fluorescence of the plasmid transfected into protoplasts derived from callus of Italian grapes in an example of the present invention.
Figure 14 is the peak of the IDAA analysis of the protoplasts transfected with the pGK1064-crMADS5-1493.1599D plasmid in an example of the present invention, and Figure 15 is the insertion / deletion (InDel) related peak area and insertion / deletion (InDel) shown in FIG. ) is the result of quantifying the genotype frequency.
FIG. 16 shows peaks as a result of IDAA analysis of protoplasts transfected with the pGK1064-crZAT10-221.273D plasmid in an example of the present invention, and FIG. 17 shows peak areas related to insertion/deletion (InDel) and insertion/deletion (InDel) shown in FIG. ) is the result of quantifying the genotype frequency.
18 is a result of confirming the nucleotide sequence structure of a large deletion that occurs when genome editing is performed by transfecting two plasmids, pGK1064-crMADS5-1493.1599D and pGK1064-crZAT10-221.273D, respectively, into grape protoplasts in an example of the present invention. .

Hereinafter, the present invention will be described in detail.

As used herein, the term "promoter" refers to a DNA sequence capable of regulating the expression of a coding sequence or functional RNA. A promoter refers to an upstream nucleic acid sequence that includes a binding site for RNA polymerase and has an activity of initiating transcription of a gene downstream of the promoter into RNA. For example, a promoter sequence consists of a proximal upstream element and a distal upstream element, with the distal upstream element often referred to as an enhancer. An "enhancer" is a DNA sequence capable of stimulating promoter activity, and may be a native element of a promoter or a heterologous element inserted to enhance the level or tissue specificity of the promoter. A promoter may be derived in its entirety from a native gene, or may be composed of different elements derived from different promoters found in nature, or may even contain synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is also recognized that, in most cases, DNA fragments of some variants may have the same promoter activity, since the exact boundaries of regulatory sequences have not been fully defined. As is well known in the art, promoters can be determined by their strength and/or the conditions in which they are active, such as constitutive promoters, strong promoters, weak promoters, inducible/repressible promoters, tissue specific/developmental regulatory promoters, cell It can be classified according to cycle-dependent promoters and the like.

The term "grape U6 promoter" used in the present invention refers to the U6 snRNA promoter present on top of the U6 small nuclear RNA (snRNA) gene of grape plants.

As used herein, the term "guide RNA (guide RNA, gRNA)" is an RNA specific to target DNA, which is expressed through transcription of linear double-stranded DNA delivered into cells to recognize a target gene and activate Cas endonuclease ( RNA that can form a complex with the Cas9 protein) and bring the Cas endonuclease to the target DNA. Accordingly, the guide RNA may include a spacer capable of recognizing the target DNA; and a guide RNA scaffold consisting of a non-variable sequence independent of the target. The spacer refers to a sequence that allows the guide RNA to recognize the target DNA, and may include part or all of protospacer adjacent motifs (PAMs) sequences near the target DNA position. Preferably, sequences adjacent to the PAMs may be used. The guide RNA scaffold may be composed of two RNAs, namely CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA), or a single guide RNA generated by fusion of essential parts of crRNA and tracrRNA. (single guide RNA, sgRNA). The guide RNA may be a dual RNA including crRNA and tracrRNA. Any guide RNA scaffold can be used in the present invention, provided that the guide RNA scaffold includes essential parts of crRNA and tracrRNA and a part complementary to the target. The crRNA contains a sequence sufficiently complementary to the target sequence for hybridization to hybridize with the target DNA, and directs the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. In addition, methods for designing a single guide RNA (sgRNA) containing both crRNA and tracrRNA features are known in the art.

As used herein, the term "Cas endonuclease" relates to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene in which, upon functional binding to one or more guide RNAs, the Cas protein is capable of cleaving a target DNA sequence. [(See "CRISPR-Cas systems and methods for altering expression of gene products" US Patent No. 8697359) Cas protein or its side. Variants of Cas endonuclease that possess guide RNA-guided endonuclease activity are also included in this definition. Cas endonuclease in the present invention is an endonuclease that introduces double-strand breaks into DNA at the target site. Cas endonucleases are guided by guide RNAs that recognize and cleave specific target sites in double-stranded DNA, such as at target sites in the genome of a cell. Cas9, a representative example of a Cas endonuclease, is a component of the CRISPR/Cas (clustered regularly interspaced short palindromic repeats and systems combined therewith) genome editing system, which targets and cleave a DNA target sequence to generate DNA duplexes under the guidance of a guide RNA. strand break (DSB).

As used herein, the term "operably linked" means that a regulatory element (including but not limited to, a promoter sequence, transcription termination sequence, etc.) or an open reading frame). Techniques for operably linking regulatory element regions to nucleic acid molecules are known in the art. For example, a regulatory region or functional domain of a polypeptide or polynucleotide sequence having a known or desired activity, such as an enhancer site, terminator, signal sequence, epitope tag, etc. or is operably linked to a target (eg, gene or polypeptide) in such a way that it can modulate its function. A promoter is operably linked with a coding sequence if it is capable of controlling expression of the coding sequence (ie, the coding sequence is under the transcriptional control of the promoter).

As used herein, the terms “plasmid,” “vector,” and “cassette” refer to an extra chromosomal element that carries a polynucleotide sequence of interest, such as a gene of interest (“expression vector” or “expression cassette”) that is expressed in a cell. do. These elements are generally in the form of double-stranded DNA and are capable of automatically replicating in linear or circular form a sequence of single- or double-stranded DNA or RNA, genomic integration sequence, phage or nucleotide sequence derived from any source, Here, multiple nucleotide sequences have been combined or recombined into unique structures capable of introducing the polynucleotide of interest into cells. A polynucleotide sequence of interest may be a gene encoding a polypeptide or functional RNA to be expressed in a target cell. Expression cassettes/vectors generally contain a gene with operably linked elements allowing expression of that gene in a host cell.

As used herein, the term "recombinant" when used in reference to a biological component or composition refers to the biological component or composition in a state not found in nature. For example, a recombinant vector may differ from its native sequence by one or more nucleotides, may be operably linked to a heterologous sequence (eg, a heterologous promoter, a sequence encoding a non-native or variant signal sequence, etc.), and may contain intronic sequences. may be absent and/or may be present in an isolated form. The recombinant vector can be used as a vector that efficiently transforms a target gene in an appropriate host cell by performing gene editing by inducing a nucleotide sequence double helix defect at a specific gene site using the CRISPR/Cas9 system. The host cell may preferably be a eukaryotic cell, and expression control sequences such as a promoter, terminator, and enhancer, sequences for membrane targeting or secretion, etc. are appropriately selected according to the type of host cell. and can be combined in various ways depending on the purpose.

As used herein, the term "expression" refers to the production of a functional end product (eg, mRNA, guide RNA or protein) in precursor or mature form. For example, expression of a nucleotide sequence can refer to transcription of the nucleotide sequence (eg, transcription to produce mRNA or functional RNA) and/or translation of the RNA into a protein precursor or mature protein.

As used herein, the terms "target sequence", "target site", "target gene", "target DNA" and the like require Cas endonuclease cleavage to promote genomic modification, such as modification of a DNA sequence at a target site. refers to a polynucleotide sequence within the genome of a eukaryotic cell that becomes However, the context in which the term is used may slightly change its meaning. For example, while the target site of a Cas endonuclease is generally very specific and can often be defined by precise nucleotide positions, in some cases the target site for a desired genomic modification is more extensive than just the site where DNA cleavage occurs. can be defined The target site can be an endogenous site within the eukaryotic cell genome or alternatively the target site can be heterologous to the eukaryotic cell so that it does not occur naturally in the genome or the target site can be found at a heterologous genomic location as compared to where it occurs in nature. there is.

As used herein, the term "polynucleotide", "nucleic acid sequence", "nucleotide sequence", or "nucleic acid fragment" refers to a single-stranded or A polymer of double-stranded RNA or DNA. Nucleotides (usually found in their 5'-monophosphate form) are referred to by one letter: "A" for adenylate or deoxyadenylate (RNA or DNA, respectively), cytidylate or “C” for oxycytidylate, “G” for guanylate or deoxyguanylate, “U” for uridylate, “T” for deoxythymidylate, purine (A or G "R" for ), "Y" for pyrimidine (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and any nucleotide For "N".

As used herein, the term "homology" refers to the degree of similarity of the nucleotide sequence or amino acid sequence of a gene encoding a protein. If the homology is sufficiently high, the expression product of the gene may have the same or similar activity. Homology is quantified as a percentage, which refers to a value determined by comparing two sequences that are optimally aligned in a comparison window, wherein the portion of the polynucleotide or polypeptide sequence within the comparison window is the optimal alignment of the two sequences. may contain insertions or deletions (i.e., gaps) compared to a reference sequence (which does not contain insertions or deletions). The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue appears in the two sequences to calculate the number of identical positions, dividing the number of identical positions by the total number of positions in the comparison window, and dividing the result by 100. It is calculated by multiplying to yield the percentage of sequence identity.

As used herein, the term “introduction” refers to the insertion of a polynucleotide or polypeptide (eg, a recombinant DNA construct/expression construct) into a host cell. Methods for achieving the introduction of the desired biomolecule include various means such as "transfection" (also referred to as transfection), "transformation", "transduction", and physical means. . "Introducing" a nucleic acid molecule (eg, plasmid, linear nucleic acid fragment, RNA, etc.) or protein into a plant means transforming a plant cell with a nucleic acid or protein so that the nucleic acid or protein can function in the plant cell. .

As used herein, the term "transformation" refers to a change in the genetic properties of an organism by DNA given from the outside, that is, introduction of DNA, a type of nucleic acid extracted from cells of one lineage, into living cells of another lineage. When DNA enters the cell, the genetic material is changed. It means introducing a gene into a host cell so that it can be expressed in the host cell. In the present invention, "transformation" includes stable transformation and transient transfection. "Stable transformation" means the introduction of an exogenous nucleotide sequence into the plant genome to form a genetically stable inheritance. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the genome of the plant and any successive generations thereof. "Transient transfection" means introducing a nucleic acid molecule or protein into a plant cell to perform its function, but not stably inherited. In transient transfection, exogenous nucleic acid sequences are not inserted into the plant genome. Transformation methods by introducing nucleic acids or recombinant vectors into organisms, cells, tissues or organs in the present invention include transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, and liposomes. Liposem-mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation, gene gun (particle bombardment), calcium phosphate precipitation, calcium chloride precipitation, agitation using silicon carbide fibers, PEG-mediated protoplast transformation, Agrobacterium-mediated transformation, plant virus- mediated transformation (plant virus-mediated transformation), pollen tube approach (pollen tube approach) and ovary injection method (ovary injection approach), etc., but are not limited thereto.

The term "terminator" used in the present invention is linked to the end of a polynucleotide encoding a guide RNA to terminate transcription of the polynucleotide encoding the guide RNA, and can be selected and used at an appropriate level of selection by those skilled in the art according to the promoter. It is not particularly limited, and may be, for example, RNA Polymerase III terminator or -TTTTTT- sequence.

As used herein, the term "donor DNA" includes a polynucleotide sequence of interest to be inserted at or near the target site or to replace a region at or near the target site, with respect to the activity of the Cas/guide RNA complex. refers to a polynucleotide that As such, a polynucleotide sequence of interest in the donor DNA can be compared to a nucleotide sequence to be substituted or/or edited at or near the target site for novel regions and/or modified polynucleotides to be inserted at or near the target site. A nucleotide sequence may be included. In certain embodiments, the donor DNA construct further comprises first and second regions of homology adjacent to the polynucleotide sequence of interest. In addition, the donor DNA may be designed to include a PAM having the same codon after substitution, such that the PAM sequence is included in the donor DNA sequence to prevent additional recognition of the PAM sequence after a base mutation occurs.

As used herein, the term "genome editing" refers to nucleic acid molecules (one or more, such as 1-100,000bp, 1-10,000bp, 1-10,000bp, 1- Loss, alteration, and/or recovery (correction) of gene function by deletion, insertion, substitution, etc. it means.

As used herein, the term "plant" includes the whole plant and all progeny, cells, tissues or parts of the plant. Plants include, but are not limited to, seeds (mature seeds and immature seeds); plant cutting; plant cells; plant cell culture; Plant organs (eg pollen, pear, flower, fruit, shoot, leaf, root, stem and explant) are included. A plant tissue or plant organ can be a seed, protoplast, callus, or any other group of plant cells that organizes a structural or functional unit. A plant cell or tissue culture is capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cells or tissues are obtained, and of having a genotype substantially identical to that of the plant. On the other hand, some plant cells cannot be regenerated to produce plants. Regenerable cells in plant cells or tissue culture include pear, protoplast, meristematic cell, callus, pollen, leaf, anther, root, root tip, silk, flower, kernel, ear, depth ( cob), husk or stalk.

As used herein, the term "protoplast" refers to a plant cell in which the cell wall is completely or partially removed and the lipid bilayer membrane is naked. including, but not limited to, spheroplasts removed only with Typically, protoplasts are isolated plant cells without cell walls that have the ability to regenerate into cell cultures or whole plants.

One aspect of the present invention relates to a novel U6 promoter capable of transcribing a target guide RNA (gRNA) with high activity.

The U6 promoter according to an example of the present invention consists of the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence having 90% or more homology with the nucleotide sequence of SEQ ID NO: 2. The nucleotide sequence of SEQ ID NO: 2 is a grape U6 promoter of type A allele present at the top of the U6 sgRNA gene of grape variety Hongju ( Vitis vinifera Hongju). In the present invention, the grape U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 2 or the U6 promoter isolated from grape plants and having a sequence homology of 90% or more (preferably 95% or more) thereto, or 90% or more (preferably 95% or more) thereof More than 95%) sequence homology and a functionally equivalent mutant promoter is named "VviU6-3 promoter". The nucleotide sequence having 90% or more homology with the nucleotide sequence of SEQ ID NO: 2 may be selected from the nucleotide sequences of SEQ ID NO: 8 to SEQ ID NO: 36. The U6 promoter composed of the nucleotide sequence of SEQ ID NO: 8 is the VviU6-3 promoter of type B allele present in grape variety Thompson seedless. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 9 is the VviU6-3 promoter of the type A allele present in the grape variety Thompson seedless. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 10 is the VviU6-3 promoter of type B allele present in the grape variety Tamnara. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 11 is the VviU6-3 promoter of type B allele present in the grape variety Shiny Star. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 12 is the VviU6-3 promoter of the A-type allele present in the grape variety Shiny Star. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 13 is the VviU6-3 promoter of the type B allele present in the grape variety Ruby Seedless. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 14 is the VviU6-3 promoter of the type A allele present in the grape variety Ruby Seedless. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 15 is the VviU6-3 promoter of the type B allele present in the grape variety Rizamat. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 16 is the VviU6-3 promoter of the A-type allele present in the grape variety Rizamat. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 17 is the VviU6-3 promoter of the type B allele present in the grape variety Red Globe. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 18 is the VviU6-3 promoter of the A-type allele present in the grape variety Red Globe. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 19 is the VviU6-3 promoter of the type B allele present in the grape variety Princess. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 20 is the VviU6-3 promoter of the A-type allele present in the grape variety Princess. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 21 is the VviU6-3 promoter of the A-type allele present in the grape variety Pinot Noir. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 22 is the VviU6-3 promoter of type B allele present in the grape variety Perlon. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 23 is the VviU6-3 promoter of the A-type allele present in the grape variety Perlon. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 24 is the VviU6-3 promoter of the type B allele present in the grape variety Muscat of Alexandria. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 25 is the VviU6-3 promoter of the type A allele present in the grape variety Muscat of Alexandria. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 26 is the VviU6-3 promoter of type B allele present in grape variety Kishmish Chernyi. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 27 is the VviU6-3 promoter of the type A allele present in the grape variety Kishmish Chernyi. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 28 is the VviU6-3 promoter of type B allele present in grape variety Italia. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 29 is the VviU6-3 promoter of the A-type allele present in grape variety Italia. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 30 is the VviU6-3 promoter of the type B allele present in grape variety Hongju. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 31 is the VviU6-3 promoter of the type B allele present in the grape variety Himrod. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 32 is the VviU6-3 promoter of the type A allele present in the grape variety Himrod. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 33 is the VviU6-3 promoter of the type B allele present in the grape variety Campbell Early. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 34 is the VviU6-3 promoter of the A-type allele present in the grape variety Campbell Early. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 35 is the VviU6-3 promoter of the B-type allele present in the grape genus Vitis amurensis . In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 36 is the VviU6-3 promoter of the A-type allele present in the grape genus Vitis amurensis .

The U6 promoter according to an example of the present invention consists of the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having 90% or more homology with the nucleotide sequence of SEQ ID NO: 5. The nucleotide sequence of SEQ ID NO: 5 is a grape U6 promoter of type A allele present at the top of the U6 sgRNA gene of grape variety Hongju ( Vitis vinifera Hongju). In the present invention, the grape U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 5 or the U6 promoter isolated from a grape genus plant and having a sequence homology of 90% or more (preferably 95% or more) thereto, or 90% or more (preferably 95% or more) thereof More than 95%) sequence homology and a functionally equivalent mutant promoter is named "VviU6-7 promoter". The nucleotide sequence having 90% or more homology with the nucleotide sequence of SEQ ID NO: 5 may be selected from the nucleotide sequences of SEQ ID NO: 37 to SEQ ID NO: 63. The U6 promoter composed of the nucleotide sequence of SEQ ID NO: 37 is the VviU6-7 promoter of the type A allele present in the grape variety Thompson seedless. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 38 is the VviU6-7 promoter of type B allele present in the grape variety Tano Red. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 39 is the VviU6-7 promoter of the A-type allele present in the grape variety Tano Red. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 40 is the VviU6-7 promoter of the A-type allele present in the grape variety Tamnara. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 41 is the VviU6-7 promoter of the type B allele present in the grape variety Suffolk Red. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 42 is the VviU6-7 promoter of the type A allele present in the grape variety Suffolk Red. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 43 is the VviU6-7 promoter of the type B allele present in the grape variety Shiny Star. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 44 is the VviU6-7 promoter of the A-type allele present in the grape variety Shiny Star. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 45 is the VviU6-7 promoter of the A-type allele present in the grape variety Ruby Seedless. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 46 is the VviU6-7 promoter of the type B allele present in grape variety Rizamat. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 47 is the VviU6-7 promoter of the type A allele present in the grape variety Rizamat. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 48 is the VviU6-7 promoter of the type A allele present in the grape variety Red Globe. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 49 is the VviU6-7 promoter of the type B allele present in the grape variety Princess. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 50 is the VviU6-7 promoter of the A-type allele present in the grape variety Princess. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 51 is the VviU6-7 promoter of the A-type allele present in the grape variety Pinot Noir. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 52 is the VviU6-7 promoter of the type B allele present in the grape variety Perlon. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 53 is the VviU6-7 promoter of the A-type allele present in the grape variety Perlon. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 54 is the VviU6-7 promoter of the type A allele present in the grape variety Muscat of Alexandria. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 55 is the VviU6-7 promoter of the type B allele present in the grape variety Kishmish Chernyi. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 56 is the VviU6-7 promoter of the type A allele present in the grape variety Kishmish Chernyi. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 57 is the VviU6-7 promoter of the type B allele present in grape variety Italia. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 58 is the VviU6-7 promoter of the A-type allele present in grape variety Italia. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 59 is the VviU6-7 promoter of the type B allele present in grape variety Hongju. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 60 is the VviU6-7 promoter of the type B allele present in the grape variety Himrod. In addition, the U6 promoter composed of the nucleotide sequence of SEQ ID NO: 61 is the VviU6-7 promoter of the type A allele present in the grape variety Himrod. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 62 is the VviU6-7 promoter of allele type 4 present in the grape variety Campbell Early. In addition, the U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 63 is the VviU6-7 promoter of the A-type allele present in the vine plant Vitis amurensis .

One aspect of the present invention relates to various recombinant vectors that can be used in a CRISPR/Cas gene editing system as a use of the novel U6 promoter.

The recombinant vector according to one embodiment of the present invention includes the above-described grape U6 promoter and a polynucleotide sequence operably linked to the U6 promoter and encoding a guide RNA. In addition, the recombinant vector according to a preferred embodiment of the present invention is grape U6 promoter; a polynucleotide sequence encoding a guide RNA; Terminator; and a linear double-strand in which the donor DNA is sequentially linked. The guide RNA is preferably a spacer that recognizes the target DNA; and a single guide RNA scaffold consisting of crRNA and tracrRNA. Also, the target DNA is preferably an endogenous target DNA. In addition, the spacer includes part or all of protospacer adjacent motifs (PAMs) sequences. In addition, the terminator is preferably either RNA Polymerase III terminator or -TTTTTT- sequence. In addition, the donor DNA includes a PAM sequence and consists of a homologous sequence including a variant codon having a mismatch of 1 to 3 nucleotides with respect to the target DNA. A recombinant vector according to a preferred embodiment of the present invention is a structure capable of expressing a guide RNA that recognizes a target gene in the CRISPR/Cas9 gene editing system, and is a structure in which a polynucleotide sequence encoding the guide RNA and a donor DNA are combined. The donor DNA pair matched with the guide RNA is simultaneously transferred into the cell, and when the target DNA is cleaved by the Cas9 protein, the donor DNA containing the mismatched codon instead of the target DNA is included in the genome through homologous recombination of the donor DNA and thus the target DNA The substitution mutation efficiency can be increased.

A recombinant vector according to another embodiment of the present invention includes a guide RNA expression cassette comprising the aforementioned U6 promoter and a polynucleotide sequence operably linked to the U6 promoter and encoding a guide RNA; and a Cas endonuclease expression cassette. The guide RNA expression cassette preferably comprises a grape U6 promoter; a polynucleotide sequence encoding a guide RNA; Terminator; and a linear double-strand in which the donor DNA is sequentially linked. The guide RNA preferably recognizes a target gene of the grape genus, and for this purpose contains a sequence of nucleotides complementary to the target gene or part thereof. Target genes of the grape genus include MADS5 gene or ZAT10 gene, but are not necessarily limited thereto. The Cas endonuclease expression cassette comprises a promoter and a polynucleotide sequence operably linked thereto and encoding a Cas endonuclease. The promoter constituting the Cas endonuclease expression cassette can be selected from various known promoters, for example, the CaMV 35S promoter (preferably the Doubled CaMV 35S promoter, D35S). Specific examples of the recombinant vector according to another example of the present invention include a pGK1064 plasmid vector or a pGK1066 plasmid vector having the map of FIG. 2 .

A recombinant vector according to another embodiment of the present invention includes a first U6 promoter, a first polynucleotide sequence operably linked to the first U6 promoter and encoding a first guide RNA, a second U6 promoter, and the second U6 promoter. a dual guide RNA expression cassette comprising a second polynucleotide sequence operably linked to a promoter and encoding a second guide RNA; and a Cas endonuclease expression cassette. The first U6 promoter and the second U6 promoter are selected from the grape U6 promoter described above. The guide RNA expression cassette preferably comprises a first grape U6 promoter; a first polynucleotide sequence encoding a first guide RNA; a second grape U6 promoter; a second polynucleotide sequence encoding a second guide RNA; Terminator; and a linear double-strand in which the donor DNA is sequentially linked. The first U6 promoter and the second U6 promoter may be selected from grape U6 promoters having the same nucleotide sequence, or may be selected from grape U6 promoters having different nucleotide sequences. The first guide RNA and the second guide RNA preferably recognize a target gene of a grape genus, and for this purpose contain nucleotides of a sequence complementary to the target gene or a part thereof. Target genes of the grape genus include MADS5 gene or ZAT10 gene, but are not necessarily limited thereto. The Cas endonuclease expression cassette comprises a promoter and a polynucleotide sequence operably linked thereto and encoding a Cas endonuclease. The promoter constituting the Cas endonuclease expression cassette can be selected from various known promoters, for example, the CaMV 35S promoter (preferably the Doubled CaMV 35S promoter, D35S). Specific examples of the recombinant vector according to another embodiment of the present invention include a pGK1064 plasmid vector or a pGK1066 plasmid vector having the map of FIG. 2 . There is a GK1064-crZAT10-221.273D plasmid vector or pGK1064-crMADS5-1493.1599D plasmid vector having the structure of FIG. 7 .

In the recombinant vector according to the present invention, the grape U6 promoter may be provided in a form inserted into a cloning vector or an expression vector. The term "cloning vector" used in the present invention is defined as a material capable of transporting a DNA fragment into a host cell and reproducing it. In the present invention, the cloning vector may further include a polyadenylation signal, a transcription termination sequence, and multiple cloning sites. In this case, the multiple cloning site includes at least one endonuclease restriction enzyme restriction site. In addition, the term "expression vector" used in the present invention is defined as a DNA sequence necessary for transcription and translation of the cloned DNA in an appropriate host. In addition, the term "expression vector" as used herein refers to a genetic construct comprising essential regulatory elements operably linked to an insert such that the insert is expressed when present in cells of an individual. The expression vectors can be prepared and purified using standard recombinant DNA techniques. The type of the expression vector is not particularly limited as long as it expresses a desired gene in various host cells such as prokaryotic and eukaryotic cells and produces a desired protein, but retains a promoter showing strong activity and strong expression power in a natural state. A vector capable of producing a large amount of a foreign protein having a similar form is preferred. The expression vector preferably contains at least a promoter, a start codon, a gene encoding a desired protein, and a stop codon terminator. In addition, DNA encoding a signal peptide, additional expression control sequences, untranslated regions on the 5' and 3' sides of a desired gene, a selectable marker region, or a replicable unit may be appropriately included.

One aspect of the present invention relates to a method for editing the genome of a grape genus plant using a CRISPR/Cas gene editing system as a use of the novel U6 promoter.

A method for editing the genome of a plant of the genus Vine according to an embodiment of the present invention includes the steps of co-cultivating an explant of a plant of the genus Agrobacterium into which a recombinant vector has been introduced and infecting the transformed Agrobacterium genus bacteria; and forming callus by culturing the explant infected with the genus Agrobacterium in a callus-forming medium. A method for editing the genome of a grape genus plant according to another embodiment of the present invention includes introducing a recombinant vector into protoplasts of a grape genus plant to transform the protoplasts; and culturing the transformed protoplasts. In addition, the genome editing method of a grape genus plant according to the present invention preferably includes regenerating transformed plant cells or tissues (eg, callus, protoplast, etc.) into a complete plant.

The recombinant vector used in the method for editing the genome of a vine plant according to the present invention includes a grape U6 promoter as a promoter for transcription of guide RNA and can be introduced into a vine plant to implement the CRISPR/Cas system. GK1064-crZAT10-221.273D plasmid vector or pGK1064-crMADS5-1493.1599D plasmid vector having the structure of 7; and pBGW-crMADS5-1493.1599D recombinant binary plasmid or pBGW-crZAT10-221.273D recombinant binary plasmid having the map of FIG. 8 .

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are only for clearly illustrating the technical features of the present invention, but do not limit the protection scope of the present invention.

1. Identification of grape U6 snRNA gene

The U6 snRNA sequence from the grape reference genome Pinot Noir 12X genome sequence (Genbank accession GCA_000003745.2) was searched by the Blastn method (percent identity > 90%, e-value < 1E-10). The proximal sequence element (PSE), which is a key promoter sequence of the U6 snRNA gene, and the TATA motif were identified in the upper 1 kb sequence from the transcription start point, which was defined as the grape U6 snRNA gene. During the initial Blastn search, nine U6 snRNA sequences were identified on three chromosomes. Of these, the one located on chromosome 4 was classified as a pseudogene because it did not have PSE and TATA sequences. A total of eight U6 snRNAs were defined, from VviU6-1 to VviU6-8 on chromosomes 3 and 6. Table 1 summarizes the U6 snRNA gene information present in the grape reference genome.

chromosome number sequence name starting position end position direction U6 snRNA gene name 3 NC_012009 5,173,560 5,173,657 reverse VviU6-1 3 NC_012009 5,160,681 5,160,778 reverse VviU6-2 3 NC_012009 5,179,508 5,179,605 reverse VviU6-3 3 NC_012009 5,197,520 5,197,617 forward VviU6-4 6 NC_012012 16,492,523 16,492,619 forward VviU6-5 6 NC_012012 15,577,690 15,577,787 forward VviU6-6 6 NC_012012 15,580,293 15,580,390 forward VviU6-7 6 NC_012012 15,582,423 15,582,520 forward VviU6-8 4 NC_012010 16,410,180 16,410,277 forward VviU6-9
(pseudogene)

2. Promoter Sequence Identification of Grape U6 snRNA Gene

Promoter elements present in the upper 1 kb sequence of the grape U6 snRNA gene were identified. Proximal Sequence Element (PSE) and TATA motifs were present in all genes, and some sequences were identified in the OCT-1 motif, which was characterized in vertebrates, and in the model plants Arabidopsis thaliana and Medicago truncatula. It contains sequence element 5 (Distal Sequence Element 5, DSE5). Specifically, VviU6-2 and VviU6-3 contain completely conserved DSE5 (AATCTGAA), and VviU6-7 has a slightly different form of dse5-2 (AAcCTGAA). OCT-1 (ATTTGCAT) identified in Medicago was present in slightly different forms in VviU6-1, VviU6-3, and VviU6-7. Figure 1 schematically shows the U6 snRNA gene identified in the grape reference genome and the promoter motif present in the upper region. In addition, Table 2 below shows DNA motif information of the U6 snRNA gene promoter region present in the grape reference genome.

Species U6 gene Promoter Element Name motif sequence direction Location (relative to the starting point of transcription, bp) Homo sapiens HsU6-1 SPH ATTtCCCATgATtCcTTcat forward -241 OCT-1 ATTTGCAT forward -221 Arabidopsis AtU6-26 DSE5 AATCTGAA forward -158 Medicago
truncatula MtU6-6 OCT-1 ATTTGCAT forward -96 DSE5 AATCTGAA forward -160 DSE5 AATCTGAA forward -186 OCT-1 ATTTGCAT forward -212 Vitis vinifera VviU6-1 oct-2 tcTTGCAT reverse -235 VviU6-2 DSE5 AATCTGAA forward -320 VviU6-3 DSE5 AATCTGAA forward -256 oct-3 AaTTGCAT reverse -294 VviU6-7 dse5-2 AAcCTGAA reverse -154 oct-4 ggTTGCAT forward -345

3. Construction of Plasmid Vector Inserted with Grape U6 Promoter for CRISPR sgRNA Cloning and Expression

The VviU6-1 promoter, VviU6-3 promoter, VviU6-5 promoter, VviU6-6 promoter, and VviU6-7 promoter were selected as U6 promoter candidates through identification of the promoter sequence of the grape U6 snRNA gene. Thereafter, plasmid vectors pGK1064, pGK1066, pGK1067, pGK1068 and pGK1069 were constructed for the expression of sgRNA by the Cas9 gene and the U6 promoter. A total of 5 grape U6 promoters (VviU6-1, VviU6-3, VviU6-5, VviU6-6, VviU6-7) and Arabidopsis U6 promoter AtU6-26 were cloned as a comparison group. After connecting each U6 promoter and sgRNA cloning cassette by overlap PCR, they were cloned into the top of the CaMV 35S- Cas9-2A-GFP gene using restriction enzymes Xba I and Sac I and T4 DNA ligase. The sgRNA cloning cassette consists of a CRISPR RNA cloning cassette using the restriction enzyme Aar I and a guide RNA (gRNA) scaffold sequence. Table 3 below shows the length of the U6 promoter candidate group and the nucleotide sequence of the primers used for cloning the U6 promoter (allele type A). The Cas9 gene and sgRNA cloning cassette were prepared using the pBAtC vector (Kim, et al. (2016) A simple, flexible and high-throughput cloning system for plant genome editing via CRISPR-Cas system. J Integr Plant Biol 58:705-712.) Amplified as a template. In addition, as a grape variety for amplification of the U6 promoter , Vitis vinifera cv. Hongju, which was bred by crossing an Italia variety and a Perlon variety, was used. VviU6-1, a U6 promoter isolated from the grape variety Hongju, consists of the nucleotide sequence of SEQ ID NO: 1, VviU6-3 consists of the nucleotide sequence of SEQ ID NO: 2, and VviU6-5 consists of the nucleotide sequence of SEQ ID NO: 3 , VviU6-6 consists of the nucleotide sequence of SEQ ID NO: 4, and VviU6-7 consists of the nucleotide sequence of SEQ ID NO: 5.

U6 gene Length of U6 promoter isolated from Hongju (Pinonoir U6 promoter length) Primer nucleotide sequence (5'→3') VviU6-1 363(352) forward: CATGTCTAGATGAAACCTAGCTGTTGGATGG reverse: CTCTCGAGACACCTGCCTCCAAGcTCCAATCATTTGGAGTTG VviU6-3 523(519) forward: CATGTCTAGACATGGTTTTGCTTCAAGTTGGT reverse : ACTCTCGAGACACCTGCCTCTAAGCTCTAAGCGTTTGCTCCTG VviU6-5 363(365) forward : CATGTCTAGATCCTGAGACACCCAAGAAAGC reverse: CTCTCGAGACACCTGCCTCCAAGCTTTGGTGGGGAGAGCTGAT VviU6-6 360(361) forward : CATGTCTAGATCCTGAGACACCCAAGAAAGC reverse: CTCTCGAGACACCTGCCTCCAAGCTTTGGTGGGGAGAGCTGAT VviU6-7 560(560) forward: CATGTCTAGATCCTGTAGAGAAATCTGTACCA reverse: ACTCTCGAGACACCTGCCTCTAAGCTTTAATAGTGGAGTTTCA AtU6-26 449 taggtctagaTTCGTTGAACAACGGAAACT

SpCas9 gene (Cas9hc:NLS:HA) and GFP (S67T) contained in the pBAtC vector were ligated with the T2A sequence to construct a single recombinant gene Cas9-2A-GFP, which was converted into an entry plasmid containing the CaMV 35S promoter and terminator sequences cloned into. Xba I and Sac I restriction enzyme recognition sequences were included at the top of the CaMV 35S promoter, and the previously prepared U6 promoter and sgRNA cloning cassette were inserted using them. 2 is a map of plasmid vectors pGK1064, pGK1066, pGK1067, pGK1068 and pGK1069 constructed for sgRNA cloning and Cas9 expression in Examples of the present invention. In FIG. 2 , the plasmid vector pGK2201 has the U6 promoter AtU6-26 of Arabidopsis thaliana inserted instead of the grape U6 promoter, and the plasmid vector pGK1025 does not have the U6 promoter inserted. Figure 3 shows the connection structure of the grape U6 promoter and sgRNA cloning cassette prepared in Example of the present invention.

4. Comparison of the transcriptional activity of the grape U6 promoter in grape protoplasts

Plasmid vectors pGK1064, pGK1066, pGK1067, pGK1068 and pGK1069 into which the grape U6 promoter was introduced, and the plasmid vector pGK2201 into which the Arabidopsis U6 promoter was introduced, and The plasmid vector pGK1025 in which the U6 promoter was not introduced was introduced by a PEG-mediated plasmid transfection method. Then, after culturing the transfected protoplasts for 16 hr, the expression level of the sgRNA linked to the U6 promoter was measured using Realtime PCR, and the transcriptional activities of the promoters were compared.

First, E. coli cultured in LB medium in a volume of 200 ml was purified using Qiagen's Plasmid Maxi prep kit, and then diluted to a concentration of 1 μg/μl to prepare a plasmid.

Isolation of protoplasts from grape callus cultures is a conventional method known in the art [Yoo, et al. (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocols 2: 1565-1572; Kim and Nam (2013) Isolation and characterization of Medicago truncatula U6 promoters for the construction of small hairpin RNA-mediated gene silencing vectors. Plant Molecular Biology Reporter 31: 581-593] was applied. Callus culture was induced in a medium containing auxin 2,4-D from tendrils of Italian grapes ( Vitis vinifera cv. Italia), and a cell line isolated from one callus colony was used. Callus in a volume of about 5 cm 3 was placed in a 50 ml centrifuge tube, and a 20 ml volume of enzyme reaction solution (1% Celluclast L, 1% Pectinase, 2% Viscozyme, 0.4 M mannitol, 20 mM KCl, 20 mM MES, 10 mM CaCl ₂ , 0.1% BSA, 0.2 mM DTT, pH 5.7) was added and reacted at room temperature for 3 hr to degrade the cell wall. Thereafter, the protoplasts were recovered in a conventional manner and finally diluted to a concentration of 2×10 ⁵ cells/ml.

PEG-mediated plasmid transfection was performed by a conventional method known in the art. Specifically, 10 μl of DNA (plasmid) was mixed with 100 μl of protoplasts, and a PEG solution (40% PEG4000, 0.2M mannitol, 0.1M CaCl ₂ ) was mixed thereto and reacted for about 10 minutes. Thereafter, the reaction was stopped by adding a 4-fold volume of W5 solution (150 mM NaCl, 125 mM CaCl ₂ , 5 mM KCl, 2 mM MES, pH 5.7). Thereafter, protoplasts were recovered by centrifugation, suspended in WI solution (4mM MES, 0.5M mannitol, 20mM KCl), and then placed in a 6-well plate and cultured in dark conditions for about 16 hr. This experiment was repeated six times for each plasmid, and four of the experiments were randomly selected to extract total RNA, and then used for real-time PCR experiments.

Thereafter, total RNA is extracted and purified from the cultured protoplasts, and first-strand cDNA is synthesized, and the amount of sgRNA transcript is quantified by real-time PCR using this as a template did Total RNA (total RNA) was extracted by collecting protoplasts cultured in 6 wells. The protoplasts recovered by centrifugation were placed in 300 μl of TRIzol™ (Thermo Fisher Scientific), disrupted by vibration, and then digested at room temperature for 5 minutes. Then, total RNA was extracted according to the provided experimental method. In order to eliminate the possibility that a large amount of the transfected plasmid remains in total RNA, DNase-I was treated. TURBO DNA-free kit™ (Ambion) was treated according to the provided experimental method. Oligo gRNA-3R having a complementary sequence to the 3' end of the gRNA scaffold for first-strand cDNA synthesis and Cas9-2A-GFP synthetic gene as a reference gene for correction between experimental groups at the same time A mixture of oligo GFP-R was used. According to the experimental method of the TOPscript cDNA kit™ (Enzynomics), 50 ng of total RNA, 50 pM gRNA-3R, and 50 pM GFP-R were mixed in the mixed reaction composition and reacted at 42 ° C for 2 hr to obtain the first First-strand cDNA was synthesized. Then, the first-strand cDNA was diluted 2-fold using the same amount of TE buffer and used as a template for real-time PCR. Real-time PCR analysis was performed using the CFX96 Touch Real-Time PCR system™ (Biorad). The reaction composition was prepared according to the experimental method of TOP Real qPCR premix™ (Enzynomics), prepared according to sgRNA cloning cassette and scaffold (hereinafter, gRNA fragment) g5-F and gRNA-3R that amplify 118 bp transcript, and reference Cas9-CF2 and GFP-NR, which amplify 155 bp of Cas9-2A-GFP as a gene, were used as primers, respectively. Primer information used for first-strand cDNA synthesis and real-time PCR analysis is shown in Table 4 below.

Target DNA name target DNA length Primer name Primer nucleotide sequence (5'→3') First-strand cDNA gRNA-3R AAAAAAGCACCGACTCGGTG GFP-R GATCGCGCTTCTCGTTGGGGT gRNA fragment
(sgRNA cloning cassette+scaffold) 118 bp g5-F GCTTGGAGGCAGGTGTCTCGAGAG gRNA-3R AAAAAAGCACCGACTCGGTG Cas9-2A-GFP 155 bp Cas9-CF2 ATACCCCTACGACGTGCCCGA GFP-NRs CGTCGCCGTCCAGCTCGACCAG

Target DNA (gRNA fragment) purified after amplification by PCR was diluted to 10 ² to 10 ⁷ copy/μl, and then used as a standard material for quantification of transcripts. The expression level of the gRNA transcript was calculated by relative quantification (ddCt), that is, as a relative value for the case where the Arabidopsis AtU6-26 promoter was used. Figure 4 shows the expression level of gRNA transcripts after culturing protoplasts of grapes of Italian variety, into which plasmid vectors pGK1064, pGK1066, pGK1067, pGK1068, pGK1069, pGK2201 and pGK1025 were introduced by transfection in an embodiment of the present invention. This is a graph comparing the transcriptional activity of the U6 promoter. In FIG. 4, 'NULL' indicates a case in which the plasmid vector pGK1025 in which the U6 promoter is not introduced is introduced. As shown in Figure 4, all of the grape U6 promoters VviU6-1, VviU6-3, VviU6-5, VviU6-6, and VviU6-7 expressed their lower gRNA fragments, and the transcriptional activity of the Arabidopsis promoter AtU6- Compared to 26, it was at least 5.9 times and up to 55 times higher. In particular, among the grape U6 promoters, VviU6-7 exhibited 55-fold higher transcriptional activity than AtU6-26, and VviU6-3 showed 32-fold higher transcriptional activity than AtU6-26.

5. Construction of a template plasmid for cloning two or more sgRNAs and establishment of a double cloning vector system

Since the success of genome editing using the CRISPR/Cas system depends on the targeting efficiency of guide RNAs (gRNAs), the efficiency can be increased by using a plurality of guide RNAs (gRNAs) or by testing and selecting them in advance. Expression of multiple gRNAs is achieved by linking U6-sgRNA or U3-sgRNA units that bind sgRNAs under the U6 or U3 promoter [Ma, et al. (2015) A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274-1284; Xing, et al. (2014) A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology 14: 327-327], method for linking tRNA-bound units [Xie, et al. (2015) Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proceedings of the National Academy of Sciences 112: 3570-3575].

Two grape U6 promoters, VviU6-3 and VviU6-7, were used, and a single GoldenGate assembly was performed using Aar I, a Type IIS restriction enzyme [Engler, et al. (2008) A one pot, one step, precision cloning method with high throughput capability. Plos One 3: e3647] to establish a system for cloning two sgRNAs. Specifically, PCR and GoldenGate assembly reactions were performed using a pair of primers having an Aar I recognition sequence and a CRISPR target sequence (crRNA) at the 5' end and a sequence complementary to the vector at the 3' end. A plasmid in which two U6-sgRNA units are combined can be easily constructed. The pVgR6-3 plasmid and the pVgR6-7 plasmid provided as templates in the present invention have a VviU6-3 promoter and a VviU6-7 promoter, respectively, and a gRNA scaffold is located on top of them.

After amplifying the gRNA scaffold and promoter from pGK1064 (VviU6-3), the VviU6 promoter vector presented above, by PCR, the VviU6-3 promoter was synthesized by connecting the gRNA and overlap PCR, and the pLPS-TOPO Blunt vector (Elpis biotech) to construct plasmid pVgR6-3. In addition, after amplifying the VviU6-7 promoter from the pGK1066 (VviU6-7) plasmid, which is a VviU6 promoter vector, by PCR, it was cut using Xba I and Sac I restriction enzymes, and it was cut into VviU6-3 by Spe I and Sac I. The pVgR6-7 plasmid was completed by cloning into the pVgR6-3 plasmid from which the promoter was removed. The pVgR6-3 plasmid used as a PCR template in the present invention consists of the nucleotide sequence of SEQ ID NO: 6. In addition, the pVgR6-7 plasmid used as a PCR template in the present invention consists of the nucleotide sequence of SEQ ID NO: 7. Table 5 below shows primer information used to construct the pVgR6-3 plasmid and the pVgR6-7 plasmid.

Target DNA name PCT product length Primer name Primer nucleotide sequence (5'→3') gRNA scaffold 111 bp gR-F GAGTTTTAGAGCTAGAAATAGC gRNA_MUT AGAGACTAGTAAGAAAAAAAAATGTCAAAAAAAAGCACCGACTCGGTGCCACT VviU6-3 500 bp VviU6-3pro-olF ACATTTTTTTTCTTACTAGTCTCTAAGCTACCACCCTCGGTATCC VviU6-3R2 AAGCCTAAGCGTTTGCTC VviU6-7 585 bp VviU6-7-Xbf CTAGATCCTGTAGAGAAATCTGTACCA VviU6-7Sc-R TACCGAGCTCGAATTCCCTTAAGCTTTAATAGTGGAGTTT

Figure 5 is a map (A) of the pVgR6-3 plasmid and pVgR6-7 plasmid prepared in Examples of the present invention and a schematic diagram (B) of PCR primer design for using them as templates. Table 6 shows a primer design method for using the pVgR6-3 plasmid and the pVgR6-7 plasmid as a PCR template.

primer Aar I adapter sequence gRNA sequences template binding sequence template plasmid p1 AAACACCTGCGAGGGCTT GNNNNNNNNNNNNNNNNNNN GTTTTAGAGCTAGAAATAGC common gRNA 1 gRNA scaffold p2 TTCACCTGCCTCAAAAC NNNNNNNNNNNNNNNNNNNC AAGCTCTAAGCGTTTGCTCC pVgR6-3 (VviU6-3) gRNA 2 AAGCTTTAATAGTGGAGTTT pVgR6-7 (VviU6-7) reverse complementary U6 promoter

6. Grapes MADS5 and ZAT10 Construction of gene-targeting CRISPR sgRNA cloning plasmids

Using the pVgR6-3 plasmid and the pGK1064 plasmid presented in Examples of the present invention, plasmids in which a pair of sgRNAs targeting the grape MADS5 gene (LOC100232870) and the ZAT10 gene (LOC100250659) were cloned were constructed. CRISPR target sequences were selected at positions 106 bp and 52 bp away from the exon region of each gene. According to the primer design method presented in the examples of the present invention, primers p1-crMADS5-1493, p2-crMADS5-1599, p1-crZAT10-221 and p2-crZAT10-273 containing the target sequence were designed, and pVgR6-3 The insert was prepared by PCR using the plasmid as a template, and cloned into pGK1064 by GoldenGate assembly method.

In a total volume of 50 μl, 5 μl of 10×Pfu buffer, 4 μl of 10 mM dNTP mixture, 1 μl of 10 μM p1 primer, 1 μl of 10 μM p2 primer, 1 μl of pVgR6-3 at a concentration of 10 ng/μl, and 1 unit of Pfu DNA polymerase A PCR reaction composition was prepared by mixing. The PCR temperature program was 98° C. for 3 min; (98°C for 10 seconds, 55°C for 20 seconds, 72°C for 20 seconds) x 25 cycles; 5 minutes was set at 72°C, and Biometra's T-Gradient equipment was used. DNA amplified by PCR was purified using a silica column.

In addition, 1 μl of 10X T4 DNA ligase buffer, 1 μl of BSA (100X, NEB), 1 μl of 100 ng/μl pGK1064 plasmid, 1 μl of 20 ng/μl PCR DNA, and 0.5 μl of T4 DNA ligase (NEB) were added to a total volume of 10 μl. , 0.5 μl of Aar I (2 U/ul, Thermo Fisher Scientific) and 0.2 μl of Aar I oligo were mixed to prepare a GoldenGate assembly reaction composition. The GoldenGate assembly temperature program was 30 minutes at 37°C in Biorad's C1000 Touch Thermal Cycler; (5 minutes at 37°C, 10 minutes at 23°C) x 40 cycles; It was set to 1 hr at 50°C, 20 minutes at 80°C, and cooling at 8°C.

After the GoldenGate assembly reaction was completed, 1 μl of the reaction solution was taken and put into 40 μl of E. coli TOP10 electro competent cells, followed by electroporation, and then plated on LB medium supplemented with 50 mg/L kanamycin and cultured. Target E. coli colonies were selected by colony PCR using the p1 and p2 primers, and the base sequences of the plasmids were 1064-F (5'-GCTCCACCATGTTGACCTGCA-3') and 1064-R (5'-AGGCTTCAAGCTTCGAATTGG-3'). It was determined using primers.

Figure 6 shows the positions (A) of gR1 (gRNA1) and gR2 (gRNA2) targeting MADS5 and the positions (B) of gR1 (gRNA1) and gR2 (gRNA2) targeting ZAT10 in an embodiment of the present invention. will be. Table 7 below shows primer information for cloning two sgRNAs. Figure 7 shows the U6-sgRNA structure (C) of the recombinant plasmid pGK1064-crZAT10-221.273D in which two sgRNAs for targeting ZAT10 were cloned in pGK1064 in an example of the present invention, and two sgRNAs for targeting MADS5 in pGK1064 shows the U6-sgRNA structure of the cloned recombinant plasmid pGK1064-crMADS5-1493.1599D (D).

Gene/LOCUS Target name and sequence Primer name Primer nucleotide sequence (5'→3') ZAT10
LOC100250659 gR1: GCTTCCAGAGCCATGAAAGA p1-crZAT10-221 AAACACCTGCGAGGGCTTGCTTCCAGAGCCATGAAAGAGTTTTAGAGCTAGAAATAGC gR2: GCTGGGTTGTTCGTAGTGAA p2-crZAT10-273 TTTCACCTGCCTCAAAACTTCACTACGAACAACCCAGCAAGCTCTAAGCGTTTTGCTCC MADS5
LOC100232870 gR1: GCAGAATGTGACCTGACGGT p1-crMADS5-1493 AAACACCTGCGAGGGCTTGCAGAATGTGACCTGACGGTGTTTTAGAGCTAGAAATAGC gR2: GAGTACTCATAGACTCGACCG p2-crMADS5-1599 TTTCACCTGCCTCAAAACCGGTCGAGTCTATGAGTACTCAAGCTCTAAGCGTTTGCTCC

7. Grape Genome Editing Using Agrobacterium Transformation

(1) sgRNA cloning and construction of recombinant binary vectors

The recombinant plasmids pGK1064-crZAT10-221.273D and pGK1064-crMADS5-1493.1599D prepared above were recombined into the T-DNA vector pBGW containing the Basta selection marker, respectively, by Gateway LR™ (Invitrogen) reaction to create two binary plasmid vectors, pBGW- crMADS5-1493.1599D and pBGW-crZAT10-221.273D were prepared. Specifically, 500 ng entry plasmid and 500 ng pBGW were mixed, and Gateway LR recombination reaction was performed according to the test method of Invitrogen's Gateway LR clonase II kit. Thereafter, the recombinant binary plasmid vector was introduced into E. coli TOP10 and cultured by plating on LB medium containing 100 mg/L Spectinomycin. Thereafter, the E. coli clone into which the plasmid was introduced was selected by colony PCR using the p1 primer and the 1064-R primer, and the plasmid sequence of the clone was determined using the 1064-R primer. 8 is a map of pBGW-crMADS5-1493.1599D and pBGW-crZAT10-221.273D, which are recombinant binary plasmids prepared in Examples of the present invention.

(2) Transformation of grape plants using Agrobacterium

The recombinant binary plasmids pBGW-crMADS5-1493.1599D and pBGW-crZAT10-221.273D were respectively introduced into the Agrobacterium tumefaciens EHA105 strain, which were plated on TY/Ca medium containing 100 mg/L Specitinomycin and cultured. Agrobacterium clones into which the plasmid was introduced were selected by colony PCR using the p1 primer and the 1064-R primer. Agrobacterium clones selected for grape plant transformation were cultured in MTY medium (Mannitol 5 g/L, Tryptone 5 g/L, Yeast 3 g/L, 5 mM MES, MgSO ₄ 7H ₂ O 0.2 g/L, 6 mM CaCl ₂ , pH 5.8) and diluted to an OD600 (Optical density at 600 nm) value of 0.7 to prepare an Agrobacterium culture medium.

Grapes for Agrobacterium transformation were Italian varieties ( Vitis vinifera cv. Italia), and tendrils were used as explants. The tendril of the Italian variety was sterilized by soaking in 70% ethanol for 1 minute and 20% diluted chlorx (Yuhan lac) for 10 minutes. Hg) for 10 minutes, and then coculture medium (SH salt and vitamins, Sigma S6765; 30 g/L sucrose, 0.5 g/L casein hydrolysates, 2 μM AVG, 10 μM 2,4-D, 1 μM BAP) , 100 μM acetosyringone) and co-cultured for 3 days in the dark at 25 ° C. Thereafter, the explants infected with Agrobacterium were washed with an aqueous solution of antibiotics (600 mg/L Cefotaxime), followed by callus induction medium (SH salt and vitamins; 30 g/L sucrose, 0.5 g/L casein hydrolysates, 2 μM AVG, 10 μM 2,4-D, 1 μM BAP, 200 mg/L Timentin, 5 mg/L Basta) and cultured in the dark at 25°C to induce callus formation. After about 4 months, 5 callus masses formed on leaf segments were collected using tweezers and used as samples for genome editing analysis.

(3) Genotype analysis and results of callus transformed by Agrobacterium

Genomic DNA was extracted from callus collected from explants infected with Agrobacterium by the CTAB method. Based on the wild-type genotype, primers were designed to amplify regions of 342 bp and 367 bp in front of and behind the CRISPR target site. In addition, one of the primers was labeled with a 6FAM fluorescent substance and IDAA assay [Yang, et al. (2015) Fast and sensitive detection of indels induced by precise gene targeting. Nucleic Acids Res 43: e59-e59]. Specifically, the target site was amplified by a triple-primer PCR method using an oligo (FAM-oligo) labeled with a 6FAM fluorescent substance at the 5' end, and the capillary electrophoresis equipment (ABI 3730xl) was used to amplify the target site. analyzed using GeneScan™ 500 LIZ™ dye Size Standard (Thermo Fisher Scientific) with a range of 35-500 bp was used as a DNA size standard. Concentrations were adjusted to 400 nM, 20 nM and 400 nM (20:1:20), respectively. Table 8 below shows information on forward primers, reverse primers, and FAM-oligo primers for IDAA Tri-primer PCR.

* PCR composition for IDAA analysis

- PCR composition: 2.5 μl of 10×Pfu buffer, 1 μl of genomic DNA (100ng/μl), 2 μl of dNTPs (2.5mM, ea.), 0.1 μl of forward primer (10 μM), 0.1 μl of reverse primer (10 μM) based on a total of 25 μl ) 1 μl, FAM-oligo primer (10 μM) 1 μl, Pfu DNA polymerase 1 unit, the remaining amount is distilled water

target Primer (5'→3') Wild type target length crMADS5-1493.1599D MADS5-1439-F: AGCTGACCGGCAGCAAAATTGGTGTAGTGAACATGGGGAGAGG 342 bp MADS5-1764-R: AGGGTTCTGCAACTTCTGATGA crZAT10-221.273D ZAT10-141-F: AGCTGACCGGCAGCAAAATTGTCAAATCTCACCAGTCCTTCA 367 bp ZAT10-483-R: AGTTTAGGAGCTTCCACCTGC IDAA PCR FAM-oligo: 6FAM-AGCTGACCGGCAGCAAAATTG

Figure 9 is the peak of IDAA analysis of MADS5 gene edited callus (sample number: crM5-4-1 to crM5-4-4) obtained by culturing after infection with Agrobacterium in an example of the present invention. This is the result of quantifying the peak area and insertion/deletion (InDel) genotype frequency for each deletion genotype shown in Fig. 9. 11 is the IDAA analysis peak of ZAT10 gene-edited callus (sample number: crZ10-4-1 to crZ10-4-4) obtained by culturing after infection with Agrobacterium in an example of the present invention, and FIG. is the result of quantifying the peak area and insertion/deletion (InDel) genotype frequency for each deletion genotype shown in FIG. In FIG. 9, the wild-type amplified DNA size is 348 bp, the blue chromatogram is PCR amplified DNA labeled with 6FAM, and the orange chromatogram is GeneScan™ 500 LIZ™ dye Size Standard marker (ThermoFisher Scientific). 11, the wild-type amplified DNA size is 367 bp, the blue chromatogram is PCR amplified DNA labeled with 6FAM, and the orange chromatogram is GeneScan™ 500 LIZ™ dye Size Standard marker (ThermoFisher Scientific).

As a result of IDAA analysis, the callus community formed from leaf sections transformed with crMADS5-1493.1599D recombinant Ti-plasmid and crZAT10-221.273D recombinant Ti-plasmid was a mixed state of several genotypes, of which 348 bp of MADS5 , the same size as the wild type, , the average frequency of the 367 bp genotype of ZAT10 was 13.2% and 31.09%, respectively, when estimated by the peak area, and the remaining area ratios, 86.8% and 68.91%, were estimated to have the InDel genotype by genome editing. Characteristically, the distribution of the main peaks in both genes is divided into two places, and the length of the DNA corresponding to the peaks in the two groups is between the wild type and the small deletion (Single deletion) group representing a deletion within 10 bp and the two target guide RNAs. It was divided into a large deletion (Dual deletion) group caused by two sgRNAs, in which the region was presumed to be deleted. In the case of crMADS5-1493.1599D, the average frequency of small deletion and dual deletion was 9.3% and 75.4%, and the ratio of dual deletion was about 6 times higher. In the case of crZAT10-221.273D, the average frequency of small deletion and dual deletion was 21.9% and 32.5%, and dual deletion was about 1.5 times more common.

8. Grape Genome Editing Using Protoplast Plasmid Transfection

(1) Preparation of sgRNA and Cas9 expression plasmids

The recombinant plasmids pGK1064-crZAT10-221.273D and pGK1064-crMADS5-1493.1599D prepared above were purified with high purity using Qiagen's Plasmid Maxi Prep Kit, and the purified plasmids were added to TE buffer and adjusted to a concentration of 1 μg/μl did

(2) Isolation of protoplasts

Protoplasts were isolated from callus induced using tendrils of Italian grapes ( Vitis vinifera cv. Italia) as explants. Specifically, the volume of 5 cm 3 of the callus cell mass was mixed with 20 ml of cell wall degrading enzyme solution (1% Celluclast L, 1% Pectinase, 2% Viscozyme, 0.4 M mannitol, 20 mM KCl, 20 mM MES, 10 mM CaCl ₂ , 0.1% BSA, 0.2 mM DTT, pH 5.7) and reacted at room temperature for 3 hr to degrade the cell wall. Then, 20 ml W5 solution (150 mM NaCl, 125 mM CaCl ₂ , 5 mM KCl, 2 mM MES, pH 5.7) was added thereto, mixed, and then centrifuged (200 × g, 2 minutes) to remove the supernatant. did Thereafter, the pellet of the lower layer was suspended in 20 ml W5 solution, put in an ice bath and left for 20 minutes to precipitate the protoplast cells, and the supernatant was removed. The isolated protoplasts were diluted in MMg solution (0.4M mannitol, 15mM MgCl ₂ , 4 mM MES) at a concentration of 2×10 ⁵ cell/ml.

(3) protoplast plasmid transfection

Two recombinant plasmids pGK1064-crMADS5-1493.1599D (hereinafter referred to as crM5) and pGK1064-crZAT10-221.273D (hereinafter referred to as crZ10) were each introduced into protoplasts by PEG-mediated transfection. Specifically, 100 μl protoplasts and 10 μl plasmid DNA were mixed in a 2 ml tube, and PEG solution (40% PEG4000, 0.2 M mannitol, 0.1 M CaCl ₂ ) was added thereto, mixed, and reacted for 10 minutes. Thereafter, after dilution by adding 440 μl W5 solution, protoplasts were recovered by centrifugation (200×g, 2 minutes). 1 ml of W5 solution was added to the recovered protoplasts to suspend them, and the protoplasts were recovered again by centrifugation under the same conditions. Finally, the recovered protoplasts were suspended in WI solution (4 mM MES, 0.5 M mannitol, 20 mM KCl), put into a 6-well plate, and cultured under dark conditions. Experiments were repeated three times for each plasmid. The success of transfection of the plasmid into the protoplast was determined by observing the expression of the Cas9-2A-GFP gene present in the plasmid by GFP fluorescence. 13 is a photograph of the Cas9-2A-GFP gene expression observed by GFP fluorescence of the plasmid transfected into protoplasts derived from callus of Italian grapes in an example of the present invention. 13A is a photograph before irradiation with fluorescence and B is a photograph after irradiation with fluorescence. As shown in FIG. 13, most of the protoplasts showed strong GFP fluorescence, indicating that the plasmid transfection was successful.

(4) Cultivation of protoplasts transfected with plasmids

After culturing the transfected protoplasts in the WI solution for 16 hr, the protoplast cells were recovered by centrifugation, and the protoplast culture medium (0.5 × Nitsch & Nitsch medium, 30 g / L sucrose, 1 g / L casein hydrolysates, 50 μM L-glutamine , 400 mg/L L-cysteine, 0.5 M mannitol, 10 μM NAA, 4 μM BAP, 2 μM AVG) and suspended in 1.5 ml, then placed in a 6-well plate and further incubated for 8 hr at 25 ° C and dark conditions. . Thereafter, the protoplast cells were recovered by centrifugation and stored frozen for use as samples for InDel analysis.

(5) InDel (Insertion/Deletion) analysis of the protoplast pool transfected with the plasmid

InDel genotypes of protoplast samples recovered by culturing after transfection with the pGK1064-crMADS5-1493.1599D and pGK1064-crZAT10-221.273D plasmids, respectively, were analyzed using the IDAA method. Specifically, after lysing the cells by adding 300 μl of CTAB DNA extraction buffer to the transfected protoplasts, genomic DNA was extracted using a conventional method and diluted to a concentration of 100 ng/μl. Since the subsequent process was performed according to the materials and methods used in (3) genotyping of callus transformed by Agrobacterium, detailed descriptions are omitted.

Figure 14 is the peak of the IDAA analysis of the protoplasts transfected with the pGK1064-crMADS5-1493.1599D plasmid in an example of the present invention, and Figure 15 is the insertion / deletion (InDel) related peak area and insertion / deletion (InDel) shown in FIG. ) is the result of quantifying the genotype frequency. In addition, FIG. 16 shows peaks as a result of IDAA analysis of protoplasts transfected with the pGK1064-crZAT10-221.273D plasmid in an example of the present invention, and FIG. 17 shows peak areas related to insertion/deletion (InDel) and insertion/deletion shown in FIG. (InDel) This is the result of quantifying the genotype frequency. In Figure 14, the wild-type amplified DNA size is 348 bp, the blue chromatogram is PCR amplified DNA labeled with 6FAM, and the orange chromatogram is GeneScan™ 500 LIZ™ dye Size Standard marker (ThermoFisher Scientific). 16, the wild-type amplified DNA size is 367 bp, the blue chromatogram is PCR amplified DNA labeled with 6FAM, and the orange chromatogram is GeneScan™ 500 LIZ™ dye Size Standard marker (ThermoFisher Scientific).

As a result of IDAA (INDEL Detection by Amplicon Analysis) analysis, InDel was generated by genome editing in both the protoplasts transfected with the plasmids pGK1064-crMADS5-1493.1599D and pGK1064-crZAT10-221.273D. The efficiency was estimated and calculated by subtracting the peak area of the wild type from the total area. The estimate was up to 37.2% for pGK1064-crMADS5-1493.1599D and up to 28.4% for pGK1064-crZAT10-221.273D. In addition, similar to the results of genotyping of callus transformed by Agrobacterium, the genotypes in all of the transfected protoplasts were separated into two peak groups, each peak group having a small deletion (Single deletion) of a similar size to the wild type and This corresponds to a large deletion (dual deletion) in which the distance between the two guide RNA target sequences is reduced.

As a result of estimating the InDel genotype frequency of protoplasts transfected with the pGK1064-crMADS5-1493.1599D plasmid by peak area, the proportion of the wild type was 62.8%, the small deletion was 27.6%, and the large deletion was 8.7%, which is the proportion of the total InDel genotype. was estimated at 37.2%. The dual deletion genotype, which is the peak around 242 bp, the length minus the distance between the two guide RNAs, was estimated to be 7.5%.

On the other hand, as a result of estimating the InDel genotype frequency of the protoplasts transfected with the pGK1064-crZAT10-221.273D plasmid by the peak area, the wild-type ratio was 71.6%, the large deletion was 28.3%, and the total InDel genotype ratio was estimated to be 28.4%. It became. The dual deletion genotype, which is peaks around 315 bp, the length minus the distance between the two guide RNAs, was estimated to be 18.2%, and the area of the 256 bp peak, which is a longer large deletion, was estimated to be 10.1%. Small deletions were present below the detection limit.

(6) Deletion genotype sequencing of the protoplast pool transfected with the plasmid

In order to confirm the nucleotide sequence structure of the large deletion that occurs when two plasmids, pGK1064-crMADS5-1493.1599D and pGK1064-crZAT10-221.273D, were transfected into grape protoplasts and genome edited, PCR-amplified DNA was inserted into a plasmid vector. Cloned and each clone was sequenced. The PCR-amplified DNA was purified using a silica column, and an A base was added to the 3' end using Taq DNA polymerse, and cloned into a T-vector having a T end. Twenty colonies formed in the ampicillin medium were randomly selected and sequenced using the M13R-40 primer.

18 is a result of confirming the nucleotide sequence structure of a large deletion that occurs when genome editing is performed by transfecting two plasmids, pGK1064-crMADS5-1493.1599D and pGK1064-crZAT10-221.273D, respectively, into grape protoplasts in an example of the present invention. . The uppermost sequence in A and B of FIG. 18 is the grape variety Pinot Noir genome reference sequence, a typical CRISPR cleavage site is indicated by a red arrow, and the uppermost sequence among the clone sequences aligned below is the unedited wild type clone sequence . As shown in FIG. 18, the large deletion in the protoplasts transfected with the plasmids pGK1064-crMADS5-1493.1599D and pGK1064-crZAT10-221.273D, respectively, had a base sequence deleted between the two target guide RNAs, and the cleavage site was It was confirmed to be a CRISPR cleavage site 3-4 bp away from the PAM (Protospacer adjacent motif) site or a site close to it. All of the large deletions (19 clones out of 19 deletion clones) of the protoplasts transfected with pGK1064-crMADS5-1493.1599D were of the type in which the CRISPR cleavage site 3-4 bp away from the PAM was truncated (Fig. 18A). On the other hand, the large deletion of the protoplasts transfected with pGK1064-crZAT10-221.273D showed a relatively irregular cutting position (Fig. 18B). However, all of the protoplasts had a base sequence deleted between the two target guide RNAs.

As described above, the present invention has been described through the above embodiments, but the present invention is not necessarily limited thereto, and various modifications are possible without departing from the scope and spirit of the present invention. Accordingly, the scope of protection of the present invention should be construed to include all embodiments falling within the scope of the claims appended hereto.

<110> Myongji University Industry and Academia Cooperation Foundation THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Novel U6 promoter separated form grapevine and use of the same <130> ZDP-20-0349-D1 <160> 63 <170 > KoPatentIn 3.0 <210> 1 <211> 363 <212> DNA <213> Unknown <220> <223> VviU6-1 promoter separated from Vitis vinifera cv. Hongju <400> 1 tgaaacctag ctgttggatg gaacaaggaa ctattgggtc cattttttgg aaaaaagaaa 60 agaaaagtta tattgaaatc ccttgccaac accaacaatc ttctttccct ggtttccatg 120 caagaccact cctccacaat cacctcacaa aagcttcaca aa atgagcaa agaaagaaca 180 gtggtctcac caaggacaaa catgccattt ctaaattcaa cccaaatgag ttgtggtgac 240 ggcgccgtgg gctcgatgtc cagaccaaag cgaaacgacg tcgttcccaa gcgactcctc 300 ccacatcgac tgcgcagaag ctaaattc gg gttttatata gcaactccaa atgattggag 360 ctt 363 < 210> 2 <211> 523 <212> DNA <213> Unknown <220> <223> VviU6-3 promoter separated from Vitis vinifera cv. Hongju <400> 2 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacatatgat aaacacttgc ccct ggaaaa tccacataca 180 attttttttc agtttctttt aattaccagc aaaattaggg ctgagaatgc aattcccaaa 240 ccctaagaac aaaaagaatg cccaaatctg aaagcattat atgacaacaa cagccataat 300 aaagatgaaa agcaacgaag aaaaagtaat ctca ccttct ggtggggaac accaaggacg 360 aacatgccaa ttctaaattc aacccaaatg agttgtggtg acgggccgtg ggctcgatgc 420 ccagaccaag cgaaacgacg tcgttcccaa acgactcttc ccacatcgac tgcgtataga 480 ctaaattcac cttttttata tcaggagcaa acgcttagag ctt 523 <210> 3 <211> 363 <212> DNA <213> Unknown <220> <223> VviU6-5 promoter separated from Vitis vinifera cv. Hongju <400> 3 tcccttgtgt ggaatatgcc acctcaatac cgaggaagta cttcagtttc cctaattcct 60 ttatctcaaa ctctgttact aatctctgct tcacttcatg cttttctctc tcatcatttc 120 cagtcactat gatgtcgtca acatagacta gaagaccagt tactcc cctt gtagccgagt 180 gcttaatgaa gagagtgtgg tcaccttggc tttgtttgta cccaaactct ttcatgagtt 240 ttgcaaatct cccaaaccaa gccctgggag attgttttag cccatacagg gccttcttca 300 gcttgcacac cttgttacct gtgttttcct caaatcctgg tgggatgttc atgtaaatcc 360 ctt 363 < 210> 4 <211> 360 <212> DNA <213> Unknown <220> <223> VviU6-6 promoter separated from Vitis vinifera cv. Hongju <400> 4 tcctgagaca cccaagaaag ctttgtcaac aaattccgtc tcatccacca taaggttagg 60 aacaccttgt gatttcacct cttttcaggc cttccactaa ggttccaatc aaaactcttt 120 cattgtttgg aagatgaaaa tacaacaatg aagtaaacca gtga aaataa tacatcagca 180 accaaaggaa acaacaaaag aggcaatgag aagtcagaac tgagaagcag acctcaccta 240 ctggttgtgg gcccatgttg ttctcctttt aagattggtt catccaaaat tccattccca 300 catcgaaaaa ttatgaagcc agcaatgtct tcatatgtat c agctctccc accaaagctt 360 360 <210 > 5 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6-7 promoter separated from Vitis vinifera cv. Hongju <400> 5 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacgatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg tgacagaaat aaaagtgatg gaaatttgaa cccaata aat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat ttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct ataagatgaa aatata agta taacaaacaa atgaagaagt aaagaagcag 360 aacatatcca caatcaaata aagaaacaag aaaagtaacc ctcactttca ggttgtggac 420 ccacataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttgggcagcc gggggtcttg 480 acatccccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactccact attaaagctt 560 <210> 6 <211> 632 <212> DNA <213> Artificial Sequence <220> <223> pVgR6-3 PCR template plasmid <400> 6 gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60 ggcaccgagt cggtgctttt ttttgacatt ttttttctta ctagtctctc atggttttgc 120 ttcaagttgg tttttgatca gcagtcaat g gattttaagc taccaccctc ggtatcctac 180 ataagaaatc caatacaaaa gtggattttt gcagtgctgg tagtttcttg aatttaagtt 240 aattaattag acatatgata aacacttgcc cctggaaaat ccacatacaa ttttttttca 300 gtttctttta attaccagca aaatt agggc tgagaatgca attcccaaac cctaagaaca 360 aaaagaatgc ccaaatctga aagcattata tgacaacaac ca catcgact gcgtatagac taaattcacc 600 ttttttatat caggagcaaa cgcttagagc tt 632 <210> 7 <211> 665 <212> DNA <213> Artificial Sequence <220> < 223> pVgR6-7 PCR template plasmid <400> 7 gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60 ggcaccgagt cggtgctttt ttttgacatt ttttttctta ctagatcctg tagagaaatc 120 tgtaccaata aa acaacaac aataggtcat aggttaacag tttactttaa ataattgtat 180 gcccaaaacg atgatcataa cattaattac aggttgtttg gttctctgga aact gtgaca 240 gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc agctctccca 300 acttttctca tca atttttt ggttgcataa attttcccca aattttgaca atatgttctt 360 ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat tgtctataag 420 atgaaaatat aagtataaca aacaaatgaa gaagtaaaga agcagaacat atccacaatc 480 aaataaagaa acaagaaaag taaccc < 210> 8 <211> 522 < 212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Thompson seedless <400> 8 catagttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cgtaagaaat ccaatacaaa agtggatt tt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtg gggaaca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttcccaaa cgactcttcc cacatcgact gcgcatagac 480 taaattcagc ttttatatat caggagcaaa cgcttggag c tt 522 <210> 9 <211> 519 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis vinifera Thompson seedless <400> 9 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa a gtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt tatttaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac cataataaag 300 atgaaaagca acgaagaaaa agta atctca ccttctggtg gggaacacca aggacgaaca 360 tgccaattct aaattcaacc caaatgagtt gtggtgacgg gccgtgggct cgatgcccag 420 accaagcgaa acgacgtcgt tcccaaacga ctcttcccac atcgactgcg tatagactaa 480 attcaccttt tttatat cag gagcaaacgc ttagagctt 519 <210> 10 <211 > 490 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis spp. Tamnara <400> 10 aaaaaaaaaa aaaaaagaaa tatgttggat gatcaaacac tataaaataa ttttctattt 60 ttaaaagtgg atttttgcag tgctagtagt ttcttgaatt taagttaatt aattagacat 120 atgataaaca cttgccctgg aaaatccacc tacaattt tt ttcagtttct ttcaatcagc 180 aaaattaggg ctgagaatgc aattcccaaa ccctaagaac aaaaagaagg cccaaatctg 240 aaaacattat atgacaacaa ccataataaa gatgaaaagc aacgaagaaa aagtaatctc 300 accatctggt ggggaacacc aaggacgaac atgcca attc taaattcaac ccaaatgagt 360 tgtggtgacg ggccgtgggc tcgatgccca gaccaagcga aacgacgtca ttctcaaacg 420 actcttccca catcgactgc ccatagacta aattcagctt ttatatatca ggagcaaacg 480 cttagagctc 490 <210> 11 <211> 522 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis Shiny Star <400 > 11 catagttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cgtaagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggg gaaca ccaaggacga 360 agatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 522 <210> 12 <211> 523 <212> DNA <213> Unknown <220> <223> Vvi U6-3(allele A) promoter separated from Vitis Shiny Star < 400 > 12 catagttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacatatgat aaacacttgc ccctg gaaaa tccacataca 180 attttttttc agtttctttt aattaccagc aaaattaggg ctgagaatgc aattcccaaa 240 ccctaagaac aaaaagaatg cccaaatctg aaagcattat atgacaacaa cagccataat 300 aaagatgaaa agcaacgaag aaaaagtaat ctcac catct ggtggggaac accaaggacg 360 aagatgccaa ttctaaattc aacccaaatg agttgtggtg acgggccgtg ggctcgatgc 420 ccagaccaag cgaaacgacg ccgttcccaa acgactcttc ccacatcgac tgcgcataga 480 ctaaattcag cttttatata tcaggagcaa acgcttggag ctt 523 <210> 13 <211> 519 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Ruby Seedless <400> 13 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc cc ctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac cataataaag 300 atgaaaagca acgaagaaaa agtaatctca ccttctggt g gggaacacca aggacgaaca 360 tgccaattct aaattcaacc caaatgagtt gtggtgacgg gccgtgggct cgatgcccag 420 accaagcgaa acgacgtcgt tcccaaacga ctcttcccac atcgactgcg tatagactaa 480 attcaccttt tttatatcag gagcaaacgc ttagagctt 519 <210> 14 <211> 522 <212> DNA <2 13> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis vinifera Ruby Seedless <400> 14 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tc accatctg gtggggaaca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttcccaaa cgactcttcc cacatcgact gggcatagac 480 taaattcagc ttttatatat caggagcaaa cgcttagagc gt 522 <210> 15 <211> 464 <21 2> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Rizamat <400> 15 catagttttg cttcaagttg gttttttatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagttctt 120 gaatttaagt taattaatta gacatatgat aaac acttgc ccctggaaaa tccacataca 180 attttttttc agtttctttt aattaccagc aaaattaggg ctgagaatgc aattcccaaa 240 ccctaagaac aaaaagaatg cccaaatctg aaagcattat atgacaacaa ccataataaa 300 gatgaaaagc aacgaagaaa aagta atctc accatctggt gaggggccgt gggctcgatg 360 cccagaccaa gcgaaacgac gtcgttccca aacgactctt cccacatcga ctgtgcatag 420 actaaattca gcttttatat atcaggagca aacgcttaga gttt 464 <210> 16 <211> 522 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter from separated Vitis vinifera Rizamat <400> 16 catagttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cgtaagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggggga aca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttcccaaa cgactcttcc cacatcgact gcgcatagac 480 taaattcagc ttttatatat caggagcaaa cgcttggagc tt 522 <210> 17 <211> 519 <212> DNA <213> Unknown <220> <223> VviU6-3 (allele B) promoter separated from Vitis vinifera Red Globe < 400 > 17 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt tatttaatta gacttatgat aaacactagc ccctgga gg gaacacca aggacgaaca 360 tgccaattct aaattcaacc caaatgagtt gtggtgacgg gccgtgggct cgatgcccag 420 accaagcgaa acgacgtcgt tcccaaacga ctcttcccac atcgactgcg tatagactaa 480 attcaccttt tttatatcag gagcaaacgc ttagagctt 519 <210> 18 <211> 522 <212> DNA <213> Unknown <220> <22 3> VviU6-3(allele A) promoter separated from Vitis vinifera Red Globe <400> 18 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt tatttaatta gacttatgat aaacactagc ccctgga aaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggggaaca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttcccaaa cgactcttcc cacatcgact gggcatagac 480 taaattcagc ttttatatat caggagcaaa cgcttagagc gt 522 <210> 19 <211> 464 <212> DNA <213> Unknown <2 20> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Princess <400> 19 catagttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacatatgat aaacacttgc ccct ggaaaa tccacataca 180 attttttttc agtttctttt aattaccagc aaaattaggg ctgagaatgc aattcccaaa 240 ccctaagaac aaaaagaatg cccaaatctg aaagcattat atgacaacaa ccataataaa 300 gatgaaaagc aacgaagaaa aagtaatctc accatctgg t gaggggccgt gggcccgatg 360 cccagaccaa gcgaaacgac gtcgttccca aacgactctt cccacatcga ctgcgcatag 420 actaaattca gcttttatat atcaggagca aacgctttga gttt 464 <210> 20 <211> 522 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis vinifera Princess <400> 2 0 catagtttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cgtaagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggggaaca ccaaggacga 36 0 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttcccaaa cgactcttcc cacatcgact gcgcatagac 480 taaattcagc ttttatatat caggagcaaa cgcttggagc tt 522 <210> 21 <211> 519 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) separated promoter from Vitis vinifer a Pinot Noir <400> 21 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt tatttaatta gacttatgat aaacactagc ccctggaaaa t a ggacgaaca 360 tgccaattct aaattcaacc caaatgagtt gtggtgacgg gccgtgggct cgatgcccag 420 accaagcgaa acgacgtcgt tcccaaacga ctcttcccac atcgactgcg tatagactaa 480 attcaccttt tttatatcag gagcaaacgc ttagagctt 519 <210> 22 <211> 464 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Perlon <400> t ccacataca 180 attttttttc agtttctttt aattaccagc aaaattaggg ctgagaatgc aattcccaaa 240 ccctaagaac aaaaagaatg cccaaatctg aaagcattat atgacaacaa ccataataaa 300 gatgaaaagc aacgaagaaa aagtaatctc accatctggt gaggggccgt gggccccgatg 360 cccagaccaa gcgaaacgac gtcgttccca aacgactctt cccacatcga ctgcgcatag 420 actaaattca gcttttatat atcaggagca aacgctttga gttt 464 <210> 23 <211> 522 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis vinifera Perlon <400> 23 catggttttg cttcaagttg gttttt gatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagc taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac agccataata 3 00 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggggaaca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttcccaaa cgactcttcc cacatcgact gcgcatag ac 480 taaattcaga ttttatatat caggagcaaa tgcttaaagc tt 522 <210 > 24 <211> 522 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Muscat of Alexandria <400> 24 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataaga aat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatct ga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggggaaca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttccca aa cgactcttcc cacatcgact gggcatagac 480 taaattcagc ttttatatat caggagcaaa cgcttagtgc tt 522 <210> 25 <211> 519 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis vinifera Muscat of Alexandria <400> 25 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 c ggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt tatttaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac cataataaag 300 atgaaaagca acgaagaaaa agtaatctca ccttctggtg gggaacacca aggacgaaca 360 tgccaattct aaattcaacc caaatgagtt gtggtgacgg gccgtgggct cgatgcccag 420 acc aagcgaa acgacgtcgt tcccaaacga ctcttcccac atcgactgcg tatagactaa 480 attcaccttt tttatatcag gagcaaacgc ttagagctt 519 <210> 26 <211> 464 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Kishmish Chernyi <400> 26 catagttttg cttcaagttg gttttttatc agcagtcaat ggattttaag ctaccaccct 60 aatt cccaaa 240 ccctaagaac aaaaagaatg cccaaatctg aaagcattat atgacaacaa ccataataaa 300 gatgaaaagc aacgaagaaa aagtaatctc accatctggt gaggggccgt gggctcgatg 360 cccagaccaa gcgaaacgac gtcgttccca aacgactctt cccacacatcga ctgt gcatag 420 actaaattca gcttttatat atcaggagca aacgcttaga gttt 464 <210 > 27 <211> 519 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis vinifera Kishmish Chernyi <400> 27 catggttttg cttcaagttg gttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagttctt 120 gaatttaagt tatttaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata t gacaacaac cataataaag 300 atgaaaagca acgaagaaaa agtaatctca ccttctggtg gggaacacca aggacgaaca 360 tgccaattct aaattcaacc caaatgagtt gtggtgacgg gccgtgggct cgatgcccag 420 accaagcgaa acgacgtcgt tcccaaacga ctcttcccac atcgactgcg tatagactaa 480 attcaccttt tttatatcag gagcaaacgc ttagagctt 519 < 210> 28 <211> 522 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Italia <400> 28 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cata agaaat ccaatacaaa agtggatttt tgcagtgctg gtagttctt 120 gaatttaagc taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata t gacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggggaaca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttcccaaa cgactcttcc cacatcgact gcgcatagac 480 taaattcaga ttttatatat caggagcaaa tgcttaaagc tt 522 <210> 29 <211> 522 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis vinifera Italia <400> 29 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta agaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc cccaggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggggaaca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaagc gaaacgacgt cgttcccaa a cgactcttcc cacatcgact gcgcatagac 480 taaattcagc ttttatatat caggagcaaa cgcctagggc tt 522 <210> 30 <211> 519 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis vinifera Hongju <400> 30 catggttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtat ccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gagttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaatttgggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaat gc ccaaatctga aagcattata tgacaacaac cataataaag 300 atgaaaagca acgaagaaaa agtaatctca ccttctggtg gggaacacca aggacgaaca 360 tgccaattct aaattcaacc caaatgagtt gtggtgacgg gccgtgggct cgatgcccag 420 accaagcgaa acgacgtc gt tcccaaacga ctcttcccac atcgactgcg tatagactaa 480 attcaccttt tttatatcag gagcaaacgc ttagagctt 519 <210> 31 <211> 522 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis labrusca Himrod <400> 31 catagttttg cttcaagttg gttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatcc ta cgtaagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatg c ccaaatctga aagcattata tgacaacaac agccataata 300 aagatgaaaa gcaacgaaga aaaagtaatc tcaccatctg gtggggaaca ccaaggacga 360 acatgccaat tctaaattca acccaaatga gttgtggtga cgggccgtgg gctcgatgcc 420 cagaccaaac gaaacgac gt cgttctcaaa cgactcttcc cacatcgact gcgcatagac 480 taaattcagc ttttatatat caggagcaaa cgcttagagt tc 522 <210> 32 <211> 515 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis labrusca Himrod <400> 32 catagttttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cgg tatccta cataagaaat ccaatacaaa agtggatttt tgcagtgcta gtagtttctt 120 gaatttaagt taattaatta gacatatgat aaacacttgc cctggaaaat ccacctacaa 180 tttttttcag tttctttcaa tcagcaaaat tagggctgag aatgcaattc ccaaacccta 240 aga acaaaaa gaaggcccaa atctgaaaac attatatgac aacaaccata ataaagatga 300 aaagcaacga agaaaaagta atctcaccat ctggtgggga acaccaagga cgaacatgcc 360 aattctaaat tcaacccaaa tgagttgtgg tgacgggccg tgggctcgat gcccagacca 4 20 agcgaaacga cgtcgttccc aaacgactct tcccacatcg actgcgcata gactaaattc 480 agcttttata tatcaggagc aaacgcttgg agctt 515 <210> 33 <211> 490 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitis labruscana Campbell Early <400> 33 aaaaaaaaa aaaaaagaaa tatgttggat gatcaaacac tataaaataa ttttctatt t 60 ttaaaagtgg attttgcag tgctagtagt ttcttgaatt taagttaatt aattagacat 120 atgataaaca cttgccctgg aaaatccacc tacaattttt ttcagtttct ttcaatcagc 180 aaaattaggg ctgagaatgc aattcccaaa ccctaagaac aaaaagaagg cccaaatctg 240 a aaacattat atgacaacaa ccataataaa gatgaaaagc aacgaagaaa aagtaatctc 300 accatctggt ggggaacacc aaggacgaac atgccaattc taaattcaac ccaaatgagt 360 tgtggtgacg ggccgtgggc tcgatgccca gaccaagcga aacgacgtca ttctcaaacg 420 act cttccca catcgactgc ccatagacta aattcagctt ttatatatca ggagcaaacg 480 cttagagctc 490 <210> 34 <211> 523 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis labruscana Campbell Early <400> 34 catagttttg cttcaagttg gttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacatatgat aaacacttgc ccctggaaaa tccacataca 180 attttttttc agtttctttt aattaccagc aaaattaggg ctgagaatgc aattcccaaa 240 ccctaagaac aaaa agaatg cccaaatctg aaagcattat atgacaacaa cagccataat 300 aaagatgaaa agcaacgaag aaaaagtaat ctcaccatct ggtggggaac accaaggacg 360 aagatgccaa ttctaaattc aacccaaatg agttgtggtg acgggccgtg ggctcgatgc 420 ccaga ccaag cgaaacgacg ccgttcccaa acgactcttc ccacatcgac tgcgcataga 480 ctaaattcag cttttatata tcaggagcaa acgcttagag ctt 523 <210> 35 <211> 493 <212> DNA <213> Unknown <220> <223> VviU6-3(allele B) promoter separated from Vitus amurensis <400> 35 catggtctgc ttcaagttgg tttttgatca gcagtcaatg gattttaagc taccaccctc 60 ggtat cctac ataagaaatc caatacaaaa gtggattttt gcagtgctgg tagttcttg 120 aatttaagtt aattaattag acatatgata aacacttgcc ctggaaaatt cacctacaat 180 ttttttcaat ttctttcaat taccagcaaa attaggactg agaatgcaat tcccaaaccc 240 taagaacaaa aagaaggtcc aaatctga aa acattatatg acaacaacca taataaagat 300 gaaaagcaac gaagaaaaag taatctcacc atctggtggg gaacaccaag gacgaacatg 360 ccaattgtga cgggccgtgg gctcgattcc cagaccaaag tgaaacgacg tcgttcccaa 420 acgactcttc ccacatcgac tgtgtgta aa ctaaattcag cctttataga tcaggagcaa 480 acgcctagag ttt 493 < 210> 36 <211> 519 <212> DNA <213> Unknown <220> <223> VviU6-3(allele A) promoter separated from Vitis amurensis <400> 36 catgattttg cttcaagttg gtttttgatc agcagtcaat ggattttaag ctaccaccct 60 cggtatccta cataagaaat ccaatacaaa agtggatttt tgcagtgctg gtagtttctt 120 gaatttaagt taattaatta gacttatgat aaacactagc ccctggaaaa ttcacctaca 180 atttttttca gtttctttca attaccagca aaattagggc tgagaatgca attcccaaac 240 cctaagaaca aaaagaatgc ccaaatctga aagcattata tgacaacaac cataata aag 300 atgaaaagca acgaagaaaa agtaatctca ccatctggtg gggaacacca aggacgaaca 360 tgccaattct aaattcaacc caaatgagtt gtggtgacgg gccgtgggtt cgatgcccag 420 accaagcgaa acgacgtcgt tcccaaacga ctcttcccac atcgactggg catag actaa 480 attcagcttt tatatatcag gagcaaacgc ttagagctt 519 <210 > 37 <211> 557 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis vinifera Thompson Seedless <400> 37 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataacag tttactttaa 60 ataattgtat gcccaaaacg at gatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatatgttc ttccaatttt gttgagtaaa aaaccaaata gagttggatg ttttcctttg 300 attgtctata agatgaaaat ataagtataa caaacaaatg aagaagtaaa gaagcagaac 360 atatccacaa ccaaataaag aaacaagaaa agtgaccctc actttcaggt tgtggaccca 420 cataaaggcg gtgcaggttg agtgaaacgg catcgttttg ggcagccggg ggtcttgaca 480 tccccattcc catcccacat cgaaacttta agaccagata tgtttcctca tatattgaaa 540 ctccactatt aaagctt 557 <210> 38 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6-7(allele B) promoter separated from Vitis Tano Red <400> 38 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 6 0 tttaaataat tgtatgccca aaacaatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg taacagaaat aaaagtgatg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatacg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct atgagatgaa aatataagta taacaaacaa atgaagaagt aaagaaacag 360 aacacatcca caaccaaata aagaaacaag aaaagtgacc ctcactt tca ggctgtgggc 420 ccccataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttgggcagcc aggggtcttg 480 acattcccat a aatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacgatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg tgacagaaat aaaagtgatg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct ataagatgaa aatataagta taacaaacaa atgaagaagt aaagaagcag 360 aacatatcca caatcaaata aagaaacaag aaaagtaacc ctcactttca ggttgtggac 420 ccacataaag gcggtgcagg ttgagtgaaa vviU6- 7(allele A) promoter separated from Vitis spp. Tamnara <400> 40 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacaatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg taacagaaat aaaagtgatg gaaatttgaa cccaataa at ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat ttttggttg cataaatttt ccccaaattt 240 tgacaatacg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct atgagatgaa aatataag ta taacaaacaa atgaagaagt aaagaaacag 360 aacacatcca caaccaaata aagaaacaag < 210> 41 <211> 555 <212> DNA <213> Unknown <220> <223> VviU6-7 (allele B) promoter separated from Vitis vinifera Suffolk Red <400> 41 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttga acccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaata t aagtataata aacaaatgaa gaagtaaaga aacagaacat 360 atccacaacc aaataaagaa acaagaaaag tgaccttcac tttcaggttg tggaccccca 420 taaaggcagt gcaggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaacttta ag accagatatg tttcctcata tattgaaact 540 ccactgttaa agctt 555 <210> 42 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6 -7(allele A) promoter separated from Vitis vinifera Suffolk Red <400> 42 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacgatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg tgacagaa at aaaagtgatg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgtttcct 300 ttgattgtct ataagatgaa aatataagta taacaaacaa atgaagaagt aaagaagcag 360 aacatatcca caatcaaata aagaaacaag aaaagtaacc ctcactttca ggttgtggac 420 ccacataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttggg cagcc gggggtcttg 480 acatcccccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactccact attaaagctt 560 <210> 43 <211> 557 <212> DNA <213> Unknown < 220> <223> VviU6-7(allele B) promoter separated from Vitis Shiny Star <400> 43 tcctgtagag aaatctgtac caataaaaca acaataatag gtcataacag tttactttaa 60 ataattgtat gcccaaaacg atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca ga aataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatatgttc ttccaatttt gttgagtaaa aaaccaaata gagttggatg ttttcctttg 300 attgtctata agatgaaaat ataagtataa caaacaaatg aagaagtaaa gaagcagaac 360 atatccacaa ccaaataaag aaacaagaaa agtgaccctc actttcaggt tgt ggaccca 420 cataaaggcg gtgcaggttg agtgaaacgg catcgttttg ggcagccggg ggtcttgaca 480 tccccattcc catcccacat cgaaacttta agaccagata tgtttcctca tatattgaaa 540 ctccactatt aaagctt 557 <210> 44 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis Shiny Star <400> 44 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacgatgat cataacatta attacaggtt gtttggttct 1 20 ctggaaactg tgacagaaat aaaagtgatg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct ataagatgaa aatataagta taacaaacaa atgaagaagt aaagaagcag 360 aacatatcc a caatcaaata aagaaacaag aaaagtaacc ctcactttca ggttgtggac 420 ccacataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttgggcagcc gggggtcttg 480 acatccccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactcc act attaaagctt 560 <210> 45 <211> 555 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis vinifera Ruby Seedless <400> 45 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgt gaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaatat aagtataata aacaaatgaa gaagtaaaga aacagaacat 360 atccacaacc aaataaagaa acaagaaaag tgaccttcac t ttcaggttg tggaccccca 420 taaaggcagt gcaggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaactttaag accagatatg tttcctcata tattgaaact 540 ccactgttaa agctt 555 <210> 46 <211> 555 <212 >DNA <213> Unknown <220> <223> VviU6-7(allele B) promoter separated from Vitis vinifera Rizamat <400> 46 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaatat aagtataata aacaaatgaa gaagtaaaga aac agaacat 360 atccacaacc aaataaagaa acaagaaaag tgaccttcac tttcaggttg tggaccccca 420 taaaggcagt gcaggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaactttaag accagatatg tt tcctcata tattgaaact 540 ccactgttaa agctt 555 <210> 47 < 211> 560 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis vinifera Rizamat <400> 47 tcctgtagag aaatctgtac caataaaaca ataacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacgatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg tgacagaaat aaaagtgatg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct ataagatgaa aatataagta taacaaacaa atgaagaagt aaagaagcag 360 aacatatcca caaccaata aagaaacaag aaaagtaacc ctcactttca ggttgtggac 420 ccacataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttgggcagcc gggggtct tg 480 acatccccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactccact attaaagctt 560 <210> 48 <211> 555 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis vinifera Red Globe <400> 48 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcata a cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattt tgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaatat aagtataata aacaaatgaa gaagtaaaga aacagaacat 360 atccacaacc aaataaagaa acaagaaaag tgaccttcac tttcaggttg tggaccccca 420 taaa ggcagt gcaggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaactttaag accagatatg tattcctcata tattgaaact 540 ccactgttaa agctt 555 <210> 49 <211> 555 <212> DNA <213> Unknown <220> <223> VviU6-7(allele B) promoter separated from Vitis vinifera Princess <400> 49 tcctgtagag aattctgtac caataaaaca acaacaata g gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca actttctca tcaatttttt ggttgcataa attt tcccca aattttgaca 240 atatgttctt ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaatat aagtataata aacaaatgaa gaagtaaaga aacagaacat 360 atccacaacc aaataaagaa acaagaaaag tgaccttc ac tttcaggttg tggaccccca 420 taaaggcagt gcaggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaactttaag accagatatg tttcctcata tattgaaact 540 ccactgttaa agctt 555 <210> 50 <211> 557 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis vinifera Princess <400 > 50 tcctgtagag aaatctgtac caataaaaca acaataatag gtcataacag tttactttaa 60 ataattgtat gcccaaaacg atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 18 0 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatatgttc ttccaatttt gttgagtaaa aaaccaaata gagttggatg ttttcctttg 300 attgtctata agatgaaaat ataagtataa caaacaaatg aagaagta aa gaagcagaac 360 atatccacaa ccaaataaag aaacaagaaa agtgaccctc actttcaggt tgtggaccca 420 cataaaggcg gtgcaggttg agtgaaacgg catcgttttg ggcagccggg ggtcttgaca 480 tccccattcc catcccacat cgaaacttta agaccagata tgtttcctca tatattgaaa 540 ctccactatt aaagctt 557 <210> 51 <211> 560 <212> DNA <213> Unknown < 220> <223> VviU6-7(allele A) promoter separated from Vitis vinifera Pinot Noir <400> 51 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacgatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg tgacagaaat aaaagtgatg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct ataagatgaa aatataagta taacaaacaa atgaagaagt aaagaagcag 360 aacatatcca caatcaaata aagaaacaag aaaagtaacc ctcactttca ggttgtggac 420 ccacataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttgggcagcc gggggtcttg 480 acatccccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactccact attaaagct t 560 <210> 52 <211> 555 <212> DNA <213> Unknown <220> <223> VviU6-7 (allele B ) promoter separated from Vitis vinifera Perlon <400> 52 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaac ccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaatat aagtataata aacaaatgaa gaagtaaaga aacagaacat 360 atccacaacc aaataaagaa acaagaaaag tgaccttcac tttcaggttg tggaccccca 420 taaaggcagt gcaggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaacttta ag accagatatg tttcctcata tattgaaact 540 ccactgttaa agctt 555 <210> 53 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6 -7(allele A) promoter separated from Vitis vinifera Perlon <400> 53 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacgatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg tgacagaaat aa aagtgatg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct ataagatgaa aatataagta taacaaacaa atgaagaagt aaagaagcag 360 aacatatcca caatcaaata aagaaacaag aaaagtaacc ctcactttca ggttgtggac 420 ccacataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttgggcagcc gggggt cttg 480 acatcccccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactccact attaaagctt 560 <210> 54 <211> 555 <212> DNA <213> Unknown <220 > <223> VviU6-7(allele A) promoter separated from Vitis Muscat of Alexandria <400> 54 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaa ag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaatat aagtataata aacaaatgaa gaagtaaaga aacagaacat 360 atccacaacc aaataaagaa acaagaaaag tgaccttcac tttcaggttg tg gaccccca 420 taaaggcagt gcaggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaactttaag accagatatg tttcctcata tattgaaact 540 ccactgttaa agctt 555 <210> 55 <211> 55 5 <212> DNA <213> Unknown <220> <223> VviU6-7(allele B) promoter separated from Vitis vinifera Kishmish Chernyi <400> 55 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcataa cattaattac aggttgtttg gttctct gga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaatat aagtataata aacaaatgaa gaagtaaaga aacagaacat 36 0 atccacaacc aaataaagaa acaagaaaag tgaccttcac tttcaggttg tggaccccca 420 taaaggcagt gcaggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaactttaag accagatatg tttcctcata t attgaaact 540 ccactgttaa agctt 555 <210> 56 <211 > 557 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis vinifera Kishmish Chernyi <400> 56 tcctgtagag aaatctgtac caataaaaca acaataatag gtcataacag tttactttaa 60 ataattgtat gcccaaaacg atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatatgttc ttccaatttt gttgagtaaa aaaccaaata gagttggatg ttttcctttg 300 attgtctata agatgaaaat ataagtataa caaacaaatg aagaagtaaa gaagcagaac 360 atatccacaa ccaaataaag aaacaagaaa agtgaccctc actttcaggt tgtggaccca 420 cataaaggcg gtgcaggttg agtgaaacgg catcgttttg ggcagccggg ggt cttgaca 480 tccccattcc catcccacat cgaaacttta agaccagata tgtttcctca tatattgaaa 540 ctccactatt aaagctt 557 <210> 57 <211> 555 <212> DNA <213> Unknown <220> <223> VviU6-7(allele B) promoter separated from Vitis vinifera Italia <400> 57 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcata a cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattttgt t gagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctatgag atgaaaatat aagtataata aacaaatgaa gaagtaaaga aacagaacat 360 atccacaacc aaataaagaa acaagaaaag tgaccttcac tttcaggttg tggaccccca 420 taaaggcagt g caggttgag tgaaacggca tcgttttcgg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaactttaag accagatatg tttcctcata tattgaaact 540 ccactgttaa agctt 555 <210> 58 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis vinifera Italia <400> 58 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcatagg tt aacagttac 60 tttaaataat tgtatgccca aaacgatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg tgacagaaat aaaagtgatg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct ataagatgaa aatataagta taacaaacaa atgaagaagt aaagaagcag 360 aacatatcca caatcaaata aagaaacaag aaaagta acc ctcactttca ggttgtggac 420 ccacataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttgggcagcc gggggtcttg 480 acatccccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactccact attaaagctt 560 <210> 59 <211> 555 <212> DNA <213> Unknown <220> <223> VviU6-7(allele B) promoter separated from Vitis vinifera Hongju <400> 59 tcctgtagag aattctgtac caataaaaca acaacaatag gtcataggtt aacagtttaa 60 ataattgtat gcccaaaaca atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc attccctctc 180 agctctccca actt ttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatgttctt ccaattttgt tgagtaaaaa accaaataga gttggatgtt ttcctttgat 300 tgtctataag atgaaaatat aagtataaca aacaaatgaa gaagtaaaga agcagaacat 360 atcc acaatc aaataaagaa acaagaaaag taaccctcac tttcaggttg tggacccaca 420 taaaggcggt gcaggttgag tgaaacggca tcgttttggg cagccggggg tcttgacatc 480 cccattccca tcccacatcg aaactttaag accagatatg tttcctcata tattgaaact 540 ccactattaa agctt 555 <210> 60 <211> 557 <212> DNA <213> Unknown <220> < 223> VviU6-7(allele B) promoter separated from Vitis labrusca Himrod <400> 60 tcctgtagag aaatctgtac caataaaaca acaataatag gtcataacag tttactttaa 60 ataattgtat gcccaaaacg atgatcataa cattaattac aggttgtttg gttctctgga 120 aactgtgaca gaaataaaag tgatggaaat ttgaacccaa taaatttttc at tccctctc 180 agctctccca acttttctca tcaatttttt ggttgcataa attttcccca aattttgaca 240 atatatgttc ttccaatttt gttgagtaaa aaaccaaata gagttggatg ttttcctttg 300 attgtctata agatgaaaat ataagtataa caa acaaatg aagaagtaaa gaagcagaac 360 atatccacaa ccaaataaag aaacaagaaa agtgaccctc 6 1 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis labrusca Himrod <400> 61 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacaatgat cataacatta attacaggtt gtttggtct 120 ctggaaactg taacagaaat aaaagtgatg gaaatttga a cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatacg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct atgagat gaa aatataagta taacaaacaa atgaagaagt aaagaaacag 480 acattcccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactccact gttaaagctt 560 <210> 62 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6-7 (allele A) promoter separated from Vitis labruscana Campbell Early <400> 62 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacaatgat cataacatta attacaggtt gtttggtct 120 ctggaaactg taacagaaat aaaagtga tg gaaatttgaa cccaataaat ttttcattcc 180 ctctcagctc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatacg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct atgagatgaa aatataagta taacaaacaa atgaagaagt aaagaaacag 360 aacacatcca caaccaata aagaaacaag aaaagtgacc ctcactttca ggctgtgggc 420 ccccataaag gcggtgcagg ttgagtgaaa cggcatcgtt ttgggcagcc aggggtcttg 4 80 acattcccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540 aaactccact gttaaagctt 560 <210> 63 <211> 560 <212> DNA <213> Unknown <220> <223> VviU6-7(allele A) promoter separated from Vitis amurensis <400> 63 tcctgtagag aaatctgtac caataaaaca acaacaatag gtcataggtt aacagtttac 60 tttaaataat tgtatgccca aaacaatgat cataacatta attacaggtt gtttggttct 120 ctggaaactg tg acagaaat aaaagtgatg gaaatctgaa cccaataaat ttttcattcc 180 ctctcagccc tcccaacttt tctcatcaat tttttggttg cataaatttt ccccaaattt 240 tgacaatatg ttcttccaat tttgttgagt aaaaaaccaa atagagttgg atgttttcct 300 ttgattgtct atgagatgaa aatatatgta taacaaacaa atgaagaagt aaagaaacag 360 aacatattca caaccaaata aagaaacaag aaaagcgacc ctcactttca agttgtggac 420 cctcataaag gcggtgcagg ttgagtgaa a cggcatcgtt ttgggcagcc gggggtcttg 480 acatccccat tcccatccca catcgaaact ttaagaccag atatgtttcc tcatatattg 540aaactccact attgaagctt 560

Claims (11)

U6 promoter consisting of the nucleotide sequence of SEQ ID NO: 5.
A recombinant vector comprising the U6 promoter of claim 1 and a polynucleotide sequence operably linked to the U6 promoter and encoding a guide RNA.
A guide RNA expression cassette comprising the U6 promoter of claim 1 and a polynucleotide sequence operably linked to the U6 promoter and encoding a guide RNA; and a recombinant vector comprising a Cas endonuclease expression cassette.
4. The recombinant vector according to claim 3, wherein the Cas endonuclease expression cassette comprises a promoter and a polynucleotide sequence operably linked thereto and encoding a Cas endonuclease.
The recombinant vector according to claim 3, wherein the recombinant vector is a pGK1066 plasmid vector having the map of FIG. 2.
The recombinant vector according to claim 3, wherein the guide RNA recognizes a target gene of a grape genus.
A first U6 promoter, a first polynucleotide sequence operably linked to the first U6 promoter and encoding a first guide RNA, a second U6 promoter and a second guide RNA operably linked to the second U6 promoter A dual guide RNA expression cassette comprising a second polynucleotide sequence encoding a; And a vector comprising a Cas endonuclease expression cassette,
The first U6 promoter and the second U6 promoter are recombinant vectors, characterized in that the U6 promoter of claim 1.
8. The recombinant vector according to claim 7, wherein the Cas endonuclease expression cassette comprises a promoter and a polynucleotide sequence operably linked thereto and encoding a Cas endonuclease.
8. The recombinant vector according to claim 7, wherein the first guide RNA and the second guide RNA recognize a target gene of a grape genus.
Infecting an explant of a grape genus plant with a transformed Agrobacterium genus bacteria by co-cultivating the recombinant vector according to claim 3 or with an Agrobacterium genus bacteria introduced with the recombinant vector according to claim 7; and
A method of editing a grape genus plant genome comprising the step of forming callus by culturing the explant infected with the Agrobacterium genus in a medium for forming callus.
Transforming the protoplasts by introducing the recombinant vector of claim 3 or the recombinant vector of claim 7 into the protoplasts of grape genus plants; and
A grape genus plant genome editing method comprising the step of culturing the transformed protoplasts.

Images