KR20210039306A - Gene editing method using transgenic plants expressing CRISPR/Cas9 and gRNA, respectively - Google Patents

Abstract

The present invention relates to a method for editing a gene of a plant difficult to transform using a CRISPR/Cas9 expression plant and a gRNA expression plant, and the target gene editing method of the plant of the present invention can edit the target gene in the plant in which transformation is difficult or does not occur, thereby being able to be usefully sued for the development of novel plant materials.

Description

Gene editing method using transgenic plants expressing CRISPR/Cas9 and gRNA, respectively}

The present invention relates to a method of editing a gene of a plant through crossing between transgenic plants in which CRISPR/Cas9 and gRNA are individually expressed.

Genome Editing is a technology that freely edits the genetic information of living organisms.

Genome editing technology can change the genetic information of animals, plants, and microorganisms, including humans, to dramatically expand the scope of its use. Genetic scissors are molecular tools designed and made to accurately cut desired genetic information and play a key role in genome editing technology. Like the next generation sequencing technology that took the field of gene sequencing to the next level, gene scissors are becoming a key technology that expands the speed and range of using genetic information and creates new industrial fields.

The genetic scissors developed so far can be divided into three generations according to their order. The first generation of gene scissors is ZFN (Zinc Finger Nuclease), the second generation of scissors is TALEN (Transcription Activator-Like Effector Nuclease), the most recently studied CRISPR (Clustered regularly interspaced short palindromic repeat)-Cas (CRISPR associated protein). ) 9 is the third generation gene scissors.

CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) are loci containing several short direct repeats found in the genome of approximately 40% of gene sequenced bacteria and 90% of gene sequenced archaea.

CRISPR-Cas9 is an RNA and protein complex, and it is an artificial restriction enzyme based on Reebok Nucleic Acid (RNA) that enables genome editing by cutting specific regions of a gene, and has recently been in the spotlight as a material for genetic engineering. The technology for editing genes using the Cas9 protein has been developed in two directions.

The first is a technology that edits the genome by directly injecting ribonucleoprotein (RNP), a complex of RNA and protein, into a protoplast. After injecting RNP into a protoplast isolated from a plant tissue, the protoplast is cultured in a callus form. And, through the re-differentiation process, a large amount of gene-edited plants are secured from callus of an appropriate size.

However, in the existing technology of editing a target genome by injecting Cas9-ribonucleic acid protein (RNP) into a protoplast, it is necessary to re-differentiate the whole body from the protoplast, and there are many technical difficulties in this part. In crops such as corn and soybeans, it is difficult to form protoplast-derived redifferentiated bodies, and if this problem is not solved, the Cas9 genome editing technology in crops is not scalable.

In addition, mutations in the somatic nutrient system occurring in callus culture may cause mutations in off targets other than the gene to be edited, causing unwanted problems in the genome.

Second, a recombinant carrier (plasmid DNA) containing the gene encoding Cas9 protein and guide RNA (gRNA) at the same time is produced, and then transferred to a plant using Agrobacterium or introduced into a protoplast to produce a re-differentiated body. It is a technology that edits the genome.

However, in the case of a recombinant carrier (plasmid DNA) in which both the Cas9 protein and the gene encoding the guide RNA (gRNA) are inserted, the insertion of several types of Cas9 protein genes with different functions is restricted due to the size of the carrier. Limited to the number of genes encoding the insertable guide RNA (gRNA) (up to 8 gDNA structures can be inserted so far), and if the target genes to be edited are diverse, especially when constructing a gene editing library, traits for each target gene You have to do the conversion.

In addition, Agrobacterium-based transformation is not applicable to all plant species or within the same species. For example, in the case of corn transformation, it is known that only Hi-II family varieties can be transformed based on Agrobacterium.

Therefore, there is a need for a technology capable of editing target genes in plants that are difficult to transform based on Agrobacterium.

Republic of Korea Patent Publication No. 10-2018-0117785

The problem to be solved of the present invention is a method for editing a target gene of a plant comprising the step of crossing a Cas9-expressing plant and a gRNA-expressing plant to produce a progeny so that a target gene can be edited in a plant that is difficult to transform based on Agrobacterium. To provide.

Another object of the present invention is to provide a plant in which a target gene has been edited by the above editing method.

In order to solve the above problems, as an aspect of the present invention, a method for editing a target gene of a plant is provided, comprising the step of crossing a Cas9-expressing plant and a gRNA-expressing plant to produce a progeny.

The "gene editing method" of the present invention includes the step of crossing a Cas9-expressing plant and a gRNA-expressing plant to produce a progeny.

Conventionally, in order to edit a target gene in a plant, a transformation vector including Cas9 and gRNA was created and transformed with Agrabacterium. However, when the target gene to be edited is diverse, transformation is performed for each target gene. There was a problem that had to be done. In addition, there is a problem that gene editing in plant varieties to which Agrobacterium-based transformation technology is not applicable is difficult.

In the present invention, the Cas9-expressing plant is a plant in which the Cas9 gene or protein is expressed. Specifically, it is produced by transforming a Cas9 expression vector into a plant of a cultivar belonging to the same family that can be crossed with a plant variety that is difficult to transform.

Plants of varieties belonging to the same family capable of crossing with the plant varieties that are difficult to transform can obtain one or more transformed individuals, specifically, the transformation efficiency exceeds 3%, more specifically 10% May be excess.

The Cas9 expression vector is a vector including a nucleotide sequence encoding a Cas9 protein.

The "Cas9 protein" of the present invention is a major protein component of the CRISPR/Cas9 system, and is a protein capable of forming an activated endonuclease or nickase. The Cas9 protein can cause double strand break (DSB) by recognizing a specific nucleotide sequence in the genome of prokaryotic cells and/or animal and plant cells (eg, eukaryotic cells) including human cells. The double helix cleavage may cut a double helix of DNA to create a blunt end or a cohesive end. DSB can be efficiently repaired in cells by homologous recombination or non-homologous end-joining (NHEJ) mechanisms, and a desired mutation can be introduced into the target site during this process.

In the present invention, the Cas9 protein recognizes a specific sequence (protospacer associated motif, PAM) of the target gene and has a nucleotide cleavage activity, and is selected from among all Cas9s capable of causing insertion and/or deletion (Indel) in the target gene. It can be more than a species.

Specifically, the Cas9 protein is a Cas9 protein derived from the genus Streptococcus , specifically, Streptococcus thermophiles , Streptocuccus aureus , or Streptococcus pyogenes. ; Campylobacter genus, specifically, Campylobacter jejuni Cas9 protein derived from; Ney ceria (Neisseria), A specifically Ney ceria mening gidi tooth (Neisseria meningitidis) derived Cas9 protein; Paz Chateau Pasteurella (Pasteurella), A specifically, fasteners Chateau Pasteurella water Toshio the (Pasteurella multocida) derived Cas9 protein; Fran when cellar (Francisella) in, in particular, when Francisco Cellar Novi Let (Francisella novicida), but may be one or more selected from the group consisting of Cas9 protein derived from, without being limited thereto.

The Cas9 protein or gene information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI).

In an embodiment of the present invention, a Cas9 expression vector was prepared using the Cas9 gene having the nucleotide sequence of SEQ ID NO: 1, and the protein expressed by the Cas9 gene has the amino acid sequence of SEQ ID NO: 2.

Therefore, the Cas9 expression vector of the present invention may include a nucleotide sequence encoding the nucleotide sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2.

The Cas9 protein is used together with a target gene-specific guide RNA for guiding to a target site of genomic DNA. The Cas9 protein may form a complex with a guide RNA to act in the form of ribonucleic acid protein (RNP).

In the present invention, the term "expression vector" refers to a gene construct comprising essential regulatory elements operably linked so that the gene insert is expressed, and includes a plasmid vector, a cosmid vector, a bacteriophage vector, and a viral vector. Specific examples include E. coli-derived plasmids (pBR322, pBR325, pUC118, pUC119, pET30a, pET30c and pGEX-GST), Bacillus subtilis-derived plasmids (pUB110 and pTP5), yeast-derived plasmids (YEp13, YEp24 and YCp50) or Ti plasmid ( pGA3383, pCAMBIA3301, pCAMBIA3300, pGA3426, pGA3780, pGWB12, pGWB14), and the like, animal viruses such as retrovirus, adenovirus or vaccinia virus, insect viruses such as baculovirus, or plant viruses, and pPZP , pGA and pCAMBIA family of binary vectors can be used.

As the vector of the present invention is applied to a plant cell, the promoter of the present invention may include a promoter used for gene introduction into a plant. For example, SP6 promoter, T7 promoter, T3 promoter, PM promoter, corn ubiquitin promoter (Ubi), cauliflower mosaic virus (CaMV) 35S promoter, nopaline scintase (nos) promoter, pigwort mosaic virus 35S promoter, Sugacrane basiliform virus promoter, commelina yellow mottle virus promoter, ribulose-1,5-bis-phosphate carboxylase small subunit (ssRUBISCO) photoinducible promoter, rice cytosol triosphosphate isomerase (TPI) promoter, adenine phosphoribosyltransferase (APRT) promoter of Arabidopsis, and the octopine synthase promoter.

The promoter of the present invention is specifically a normally expressed promoter, and more specifically, it may be characterized in that it is a 35S promoter.

The "vector" of the present invention may include a selectable marker.

The selectable marker is typically a nucleic acid sequence having properties that can be selected by a chemical method, and all genes capable of distinguishing a transformed cell from a non-transformed cell correspond to this. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, bleomycin, hygromycin. ), and antibiotic resistance genes such as chloramphenicol, but are not limited thereto.

The "Cas9 expression vector" of the present invention is functionally linked to an expression control sequence so that the Cas9 gene can be expressed. For example, the vector includes a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, and an enhancer, and can be prepared in various ways according to the purpose. . In addition, the vector may contain a selectable marker, and the vector may be self-replicating or integrated into the host DNA. The vector of the present invention can be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and ligation use enzymes generally known in the art.

In the present invention, "transformation" is a phenomenon in which DNA enters the cell and changes the genotypic trait when DNA, which is a genetic material, is injected into a living cell of another lineage. Transformation, transformation, or Also called cast.

Transformation of a plant with the vector in the present invention can be performed by a transformation technique known to those skilled in the art. Specifically, a transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome mediated method ( liposome-mediated method), In planta transformation, Vacuum infiltration method, floral meristem dipping method, and Agrobacterium spraying method. In particular, a transformation method using Agrobacterium or an Agrobacterium spraying method may be used.

In the present invention, the term "plant" is meant to include not only mature plants, but also plant cells, plant tissues, and seeds of plants that can develop into mature plants.

In the present invention, the plant is not particularly limited, and as an example, rice, wheat, barley, corn, beans, potatoes, wheat, red beans, oats or food crops including sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion or carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut or rapeseed; Fruit trees including apple tree, pear tree, jujube tree, peach, poplar, grape, tangerine, persimmon, plum, apricot or banana; Flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies or tulips; And any one selected from the group consisting of feed crops including ryegrass, red clover, orchardgrass, alpha alpha, tall fescue or perennial ryegrass, specifically rice, wheat, barley, corn, soybeans, potatoes, wheat, Food crops including, but not limited to, red beans, oats or sorghum.

Introducing Cas9 expression vector in tobacco plant transformants well in an embodiment of the present invention into Agrobacterium (Agrobacterium), and infected them to callus (callus) or tissue were prepared transgenic tobacco (A) and cultured in a greenhouse . Thereafter, the Cas9-F (SEQ ID NO: 4) and Cas9-R (SEQ ID NO: 5) primers specific for the Cas9 gene, and the hygromycin-specific hptII-2 F primer (SEQ ID NO: 6) and the nos-R primer ( A transgenic tobacco expressing the Cas9 protein was selected by PCR using SEQ ID NO: 7).

Accordingly, the Cas9-expressing plant of the present invention may be selected from the plant transformed with the Cas9 expression vector using a primer set specific for the Cas9 gene, and the primer set specific for the Cas9 gene is Cas9-F of SEQ ID NO: 4 and It may be Cas9-R of SEQ ID NO: 5.

In addition, the Cas9-expressing plant of the present invention can be selected using a selectable marker-specific primer and a terminator-specific primer inserted into the vector, specifically, the selectable marker hygromycin gene-specific hygromycin of SEQ ID NO: 6 It may be selected using a specific primer (hptII-2 F) and a nos terminator specific primer of SEQ ID NO: 7.

The gRNA-expressing plant of the present invention is characterized by expressing a target gene-specific gRNA.

The gRNA-expressing plant may be a plant transformed with a gRNA expression vector.

The transformation and description of the plant are as described above.

In the present invention, "guide RNA (gRNA)" refers to RNA including a targeting sequence capable of hybridizing with a target sequence in a target gene.

The guide RNA serves to bind the Cas9 protein in vitro or in vivo (or cells) to guide it to a target gene or a target site in the target gene.

The specific sequence of the guide RNA can be appropriately selected according to the type of Cas9 (ie, the derived microorganism), which can be easily recognized by those of ordinary skill in the art.

In the present invention, "target gene" refers to a gene that is subject to gene editing, and "target site or target region" refers to a site in which gene editing by Cas9 in the target gene occurs.

One or several genes may be selected as the target gene.

The target gene may be a gene that is expressed or suppressed to regulate a plant trait.

In the present invention, “trait” refers to a physiological, morphological, biochemical, or physical characteristic of a plant or a specific plant material or cell. These features can be seen with the naked eye, such as the size of a seed or plant, or by biochemical techniques such as detection of the protein, starch or oil content of seeds or leaves, or by observation of metabolic or physiological processes, for example , Water depletion or by measuring tolerance to a specific salt or sugar concentration, or by observing the expression level of a gene or genes, or by agricultural observations such as osmotic stress tolerance or yield.

In addition, traits also include plant resistance to herbicides.

Also, the trait may be an agronomic trait.

In the present invention, "agricultural trait" is, for non-limiting examples, leaf greenness, production, growth rate, biomass, fresh weight at maturity, dry weight at maturity, fruit harvest rate, seed yield rate, whole plant Nitrogen content, nutrient nitrogen content, seed nitrogen content, nutrient tissue nitrogen content, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, nutrient tissue free amino acid content, total plant protein content, fruit protein content, Seed protein content, nutrient tissue protein content, dry resistance, nitrogen absorption, root lodging, harvest index, leaf stalk lodging, plant height, ear height, ear length, disease resistance, cold resistance, salt resistance, It is a measurable parameter, including the tiller number.

Accordingly, the target gene of the present invention includes genes known to be regulated by physiological, morphological, biochemical or physical characteristics of plants or specific plant substances or cells through gene expression inhibition or activation.

Specifically, disease resistance genes; Genes involved in agricultural traits; Genes involved in environmental stress, including immersion, drought, cold or salt resistance; Genes related to nitrogen metabolism; Genes involved in functional metabolism; Genes involved in the regulation of spicy taste, bitter taste, sour taste, or sweet taste; may include, but are not limited thereto.

In the examples of the present invention, a gene encoding Nicotiana benthamiana phytoene desaturase (NbPDS) was used as a target gene. Therefore, the target gene of the present invention may specifically be a gene encoding NbPDS, and the NbPDS gene may be composed of the nucleotide sequence of SEQ ID NO: 3.

In the present invention, the "target sequence" is a specific nucleotide sequence within the target site of the target gene, and has a nucleotide sequence complementary to the targeting sequence of the guide RNA.

The target sequence is a contiguous about 15 nt to about 30 nt, about 15 nt to about 25 nt, about 17 nt to about 23 nt located adjacent to the 5'end and/or 3'end of the PAM sequence recognized by the RNA-guide nuclease, or It may mean a nucleotide sequence of about 18 nt to about 22 nt, for example, about 20 nt in length.

In the present invention, "targeting sequence" refers to about 15 to about 30 consecutive, about 15 to about 35, about 17 to about 23, or about 18 to about 22 consecutive target sites in the target gene, For example, it includes a base sequence complementary to a base sequence of a site containing about 20 nucleotides (nt).

The guide RNA includes CRISPR RNA (crRNA) including a site capable of hybridizing with a target sequence (targeting sequence); Trans-activating crRNA (tracrRNA) containing a site that interacts with the Cas9 protein; And a single guide RNA (sgRNA) in which the main regions of the crRNA and tracrRNA (e.g., a crRNA site including a targeting sequence and a site of a tracrRNA interacting with a nuclease) are fused. It may be one or more, and specifically, it may be a dual RNA (dual RNA) including CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA), or a single guide RNA (sgRNA) including a major site of crRNA and tracrRNA. . The sgRNA is a portion having a sequence (targeting sequence) complementary to the target sequence in the target gene (target site) (also referred to as a spacer region, target DNA recognition sequence, base pairing region, etc.) and a hairpin structure for binding Cas protein It may include. More specifically, a portion including a sequence (targeting sequence) complementary to a target sequence in the target gene, a hairpin structure for binding to a Cas protein, and a Terminator sequence may be included. The structure described above may be sequentially present in the order of 5'to 3', but is not limited thereto. Any type of guide RNA can be used in the present invention as long as the guide RNA includes a major portion of crRNA and tracrRNA and a complementary portion of a target gene.

The "gRNA expression vector" of the present invention includes a gene sequence encoding a guide RNA (gRNA) that specifically recognizes the target gene, and functionally with an expression control sequence so that guide RNA (gRNA) can be expressed. connected. For example, the gRNA expression vector includes a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, and an enhancer, and can be prepared in various ways according to the purpose. I can.

The gRNA expression vector may include a promoter that enables transcription of RNA, specifically includes a promoter of RNA polymerase, and more specifically includes U3 and U6 promoters.

In addition, the gRNA expression vector may contain a selectable marker, and the vector may be self-replicating or integrated into the host DNA. The vector of the present invention can be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and ligation use enzymes generally known in the art.

In an embodiment of the present invention, a pU6-sgRNAs expression vector expressing gRNA(s) specific for a phytoene desaturase (NbPDS) gene (SEQ ID NO: 3) derived from Nicotiana benthamiana was prepared. . Specifically, a vector was prepared so that the gRNA gene of NbPDS was located in the downstream stream of the Arabidopsis U6P promoter. The prepared gRNA(s) vector was transformed into Agrobacterium and then infected with callus or tissue to prepare gRNA-expressing transgenic tobacco (B) and cultured in a greenhouse. Thereafter, in the transformant, a line was selected for the transducer of gRNA using nosT-F (SEQ ID NO: 8) and CRISPR-uni-R (SEQ ID NO: 9), and NbPDS-gRNA-F (SEQ ID NO: 10) Using primers and gRNA Scaffold-R (SEQ ID NO: 11), plants with high gRNA(s) expression were selected and seeds thereof were obtained.

Therefore, the gRNA(s) expressing plant of the present invention includes nosT-F (SEQ ID NO: 8) and CRISPR-uni-R (SEQ ID NO: 9) primers or NbPDS-gRNA-F (SEQ ID NO: 10) primers and gRNA Scaffold-R (SEQ ID NO: 8). Number 11) may be selected using a primer.

In the present invention, the gene editing method is characterized in that a progeny is produced by crossing the Cas9-expressing plant (A) and the gRNA-expressing plant (B).

Gene editing of the present invention refers to an action of causing mutation of nucleotides by generating double-stranded DNA cleavage at a target site in a target gene.

The mutation includes deletion, inversion, conversion or insertion of all or part of the nucleotide in the target gene, and as a result, the function of the target gene is lost. The loss of the function means that all or part of a biological function or role normally performed when the target gene is not modified, for example, the protein expressed by the target gene is terminated early, or the protein It has lost its normal function.

Specifically, the gene editing is a non-coding DNA sequence that knocks out a target gene or does not produce a protein by generating a stop codon at the target site or by generating a codon encoding an amino acid different from the wild type. It may be in various forms, such as introducing a mutation or activating the function of a target gene, but is not limited thereto.

Gene editing of the present invention is characterized in that Cas9 and gRNA are simultaneously expressed in one plant individual by plant crossing to edit the gene, and is characterized in that it is performed in vivo.

In the present invention, the plant in which the target gene is edited is a plant in which the nucleotide in the target site of the target gene is mutated (deleted, inverted, substituted, or inserted) among individuals crossing the Cas9-expressing plant and the gRNA-expressing plant. Specifically, the Cas9 gene and the gRNA gene may not be included, and the nucleotide of the target site of the target gene may be a mutated plant, and more specifically, the target gene may be a knock-out (KO) or activated plant.

In the embodiment of the present invention, the phenotype of the plant was analyzed to confirm whether or not the target gene was edited. As a result of the analysis, it was confirmed that the gene editing effect of the hybrid generation by crossing the plants expressing CRISPR/Cas9 and NbPDS-gRNA was continuously maintained (constant editing) or recovered while growing (temporary editing).

Therefore, the target gene editing of the present invention may be characterized as being permanently edited or temporary edited.

The editing method of the present invention may further include the step of selecting a constitutively edited entity.

In the present invention, "constant editing" means that the target gene is edited in the cotyledons of the mating juniors of the Cas9-expressing plant and the gRNA-expressing plant to show a gene-editing phenotype and continue to show gene-editing symptoms in new leaves according to growth.

In the present invention, "temporary editing" means that the plant is edited in cotyledons to show a phenotype, but the gene editing phenotype does not appear in the leaves emerging according to plant growth.

In order to edit the gene of a plant, the Cas protein and gRNA are directly introduced into the plant protoplast, or a method of transducing the Cas protein and gRNA into the plant using the Agrobacterium transformation method is mainly used. Isolation and cultivation of protoplasts is possible only in limited plants, and the transformation method using Agrobacterium can be applied to more types of plants compared to the method of direct introduction into protoplasts, but transformation is difficult or impossible with current technology. There is a limitation that gene editing is not possible for plant varieties.

The gene editing method of the present invention further includes the step of crossing the progeny with a plant variety that is difficult to transform.

The gene editing method of the present invention is efficient because a separate guide RNA (gRNA) is not cloned into a vector containing the Cas9 gene.

In addition, different types of Cas and gRNA can be aggregated into one crop by crossing different Cas gene-expressing plants and different gRNA-expressing plants. It has the advantage of being able to specifically edit a target gene in a plant variety (or lineage) that is difficult to transform by crossing a plant into which Cas9 and gRNA has been introduced, respectively, with a plant variety that is difficult to transform or does not work well.

In the present invention, the "plant variety that is difficult to transform" is a plant variety that is difficult to introduce a recombinant vector by a conventional transformation method, and may be a plant variety having a transformation efficiency of 3% or less.

The transformation efficiency represents the number of transformants grown by forming a plant and inducing roots when transduced by inoculating 100 seeds of a plant with Agrobacterium transformed with a recombinant vector.

Plants that are difficult to transform include rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, food crops including oats or sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion or carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut or rapeseed; Fruit trees including apple tree, pear tree, jujube tree, peach, poplar, grape, tangerine, persimmon, plum, apricot or banana; Flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies or tulips; And it may be any one crop selected from the group consisting of feed crops including ryegrass, red clover, orchardgrass, alpha alpha, tall fescue, or perennial ryegrass, but is not limited thereto.

In the case of Capsicum annum , the transformation efficiency is known to be 0.001% to less than 1.0% in two cultivars of the spicy pepper, and it is reported that the transformation efficiency is 0.001% in some cultivars of the same species. have.

Therefore, in the present invention, the pepper is a pepper ( Capsicum annum ) variety having a transformation efficiency of 1.0% or less, and may be specifically spicy pepper (Clili pepper) or bell pepper.

In the case of corn, the Hi-II variety has a transformation efficiency of about 20%, but it is known that few cultivated varieties in Korea.

The above Korean cultivated corn is Danok No. 2, Geumdanok, Chodang-ok No. 1, Gammi-ok, Guang-ok, Godang-ok, Platinum-ok, Gwangpyeong-ok, Cheong-an-ok, Jang Da-ok, Kang Da-ok, Da-pyeong-ok, Cheong-da-ok, Godang-ok No. 1 , Chalkok No. 1, Dumechal, Yeonnong No. 1, Gwanganok, Heukjeomchal, Ilmichal, Goldchal, Arichal, Amichal, Damichal, Hwangchalok, White Chalk, and Heukjinjuchal.

In the case of wheat, it is known that the transformation efficiency is as low as 0.01 to 0.1%.

The wheat of the present invention includes the varieties of Golden, Ariheuk, Opry, Geumgang, Baekgang, Landscaping and All Trees.

In the case of rice, the transformation efficiency varies according to the genotype, and the transformation efficiency of Dongjin rice of the Japonica line has been developed up to 75%. There is a problem that the efficiency is significantly lowered to 2% or less.

The rice may be an Indica strain having a transformation efficiency of 2% or less.

Plants have different susceptibility and regeneration rate of Agrobacterium upon transduction of Agrobacterium depending on the variety, and accordingly, the transformation efficiency may be remarkably low, and even if infected and re-differentiated by Agrobacterium, it is advantageous in the growth process of shoots. As a result, there may be a problem in that the transgenic plant is not formed.

Specifically, it is known that Agrobacterium susceptibility or regeneration rate in the transformation of chrysanthemum affects the transformation efficiency. In a report by Han et al. (J. Plant Biotechnol . 36:275-280, 2009), which investigated the regeneration rate among 33 varieties of spray and standard chrysanthemum, 7 out of 33 varieties were indole acetic acid (IAA) and benzyl amino. It was confirmed that it was difficult to re-differentiate because it did not respond to the purine (BAP) hormone at all, and Eun-Jung Seo et al (Journal of Horticultural Science and Technology 33(6), 2015.12, 947-954) on spray chrysanthemum transformation for 40 varieties of Agrobacterium. As a result of analyzing susceptibility and rediation tests, Black Marble(BMB), Moon Light(ML), Yes Star(YST), Golden Festival(GF), Ilweol(IW), Yes Day(YDY), Yes Happy(YH), Pink Velvet (PV), Yes Together (YTG), Seolak (SL), Orange Memory (OM), Borami (BRM), Gama (GM), and Yellow Pangpang (YPP) confirmed that Agrobacterium infection was relatively low. , Black Marble(BMB), Forest Aroma(FA), Graden Party(GP), Hwiparam(HPR), Moon Festiva(MF), Moon Light(ML), Pink Velvet(PV), Seolak(SL), Yes Now( YNW), 399 varieties of leaf tissues of 10 cultivars reported difficulty in transformation because they did not react to the re-differentiation medium using BAP and IAA at all. In addition, among the spray varieties showing a relatively high regeneration rate, Peak (PK) and Orange Memory (OM) varieties induced a large number of shoots, but after 3 weeks, shoots were vitrified, making it difficult to use for actual transformation. I'm doing it.

Refer to the above, Peak(PK), Orange Memory(OM), Black Marble(BMB), Forest Aroma(FA), Graden Party(GP), Hwiparam(HPR), Moon Festiva(MF), Moon Light(ML) , Pink Velvet(PV), Seolak(SL), Yes Now(YNW), Yes Star(YST), Golden Festival(GF), Ilweol(IW), Yes Day(YDY), Yes Happy(YH), Yes Together( YTG), Borami (BRM), Gama (GM), and Yellow Pangpang (YPP) are difficult to transform using Agrobacterium in some chrysanthemum varieties.

The plant varieties that are difficult to transform in the present invention include Peak (PK), Orange Memory (OM), Black Marble (BMB), Forest Aroma (FA), Graden Party (GP), Hwiparam (HPR), Moon Festiva (MF), Moon Light(ML), Pink Velvet(PV), Seolak(SL), Yes Now(YNW), Yes Star(YST), Golden Festival(GF), Ilweol(IW), Yes Day(YDY), Yes Happy(YH) ), Yes Together (YTG), Borami (BRM), Gama (GM) and Yellow Pangpang (YPP) may be one or more varieties of chrysanthemum selected from the group consisting of, but is not limited thereto.

In an embodiment of the present invention, a plant having good transfection efficiency is selected from among plants of the same kind, cognate or related species capable of crossing with the plant having difficulty in transformation, and the plant is transformed with a Cas9 expression vector or a gRNA expression vector, and Cas9 Expression plants and gRNA expression plants were prepared. The prepared Cas9-expressing plant and the gRNA-expressing plant were crossed to obtain a plant whose target gene was temporarily or permanently edited, and the target gene can be edited in a plant that is difficult to transform by crossing it with a plant variety that is difficult to transform. .

Specifically, for gene editing of a plant variety that is difficult to transform, an individual whose gene has been edited is constantly self-pollinated, and an individual whose genetic constitutive editing trait is fixed can be used for crossing.

Therefore, the method of the present invention does not use transformation in a plant variety that is difficult to transform, and through crossing with a plant in which the target gene has been edited, the target gene can be edited in a plant variety that is difficult to transform.

Another aspect of the present invention provides a plant in which a target gene has been edited by the above editing method.

In the present invention, the plant in which the target gene is edited is a plant produced by crossing the Cas9-expressing plant and the gRNA-expressing plant, and the target gene is edited by being expressed in one plant through crossing of Cas9 and gRNA.

In the present invention, the Cas9-expressing plant preferably selects a plant in which the Cas9 gene is stably expressed through genotyping or expression analysis, and uses a plant in which Cas9 expression is stably fixed in the posterior generation through self-pollination.

Specifically, the Cas9-expressing plant may be a homo-type in which the Cas9-expressing gene is included in both strands of DNA.

In the present invention, it is preferable to select a plant in which gRNA gene is stably expressed through genotyping or expression analysis, and to use a plant in which gRNA expression is stably fixed in the posterior generation through self-pollination.

Specifically, the gRNA-expressing plant may be a heterotype in which a gRNA-expressing gene is contained in one strand of DNA.

In the present invention, a plant whose target gene has been edited is characterized in that a temporary or constitutive gene has been edited.

For the development of plant varieties, it is desirable to use a constitutive gene-edited individual. Therefore, in the present invention, it may be characterized in that an individual whose target gene has been stably edited is selected and the gene-editing trait is fixed at a later generation through self-pollination.

In the present invention, a description of temporary or constitutive gene editing is as described above.

The plant of the present invention may be a cross-breeding of a plant produced by cross-breeding with a plant variety that is difficult to transform.

In the present invention, the description of the plant, which is difficult to transform, is as described above.

The description of the target gene in the present invention is as described above.

In the present invention, a plant whose target gene is edited is a plant whose target gene is edited in a plant that is difficult to transform, and all or part of the target gene is mutated (deleted, inversion, conversion) or inserted It is characterized by loss or activation of function, but is not limited thereto.

Specifically, the nucleotide at the target site of the target gene may be all or part of the deletion, inversion, conversion, or insertion through crossing of a plant variety that is difficult to transform with a plant whose target gene has been edited.

The method for editing a target gene of a plant of the present invention can edit a target gene in a plant that is difficult to transform, and thus can be usefully utilized in the development of a new plant material. In addition, since gRNA is not separately cloned into the obtained Cas9 expression vector, it is easy to use.

1 is a schematic diagram of a CRISPR/Cas9 vector and a gRNA vector.
2 is a Cas9 (A) and PDS-gRNA (B) vector introduction process and overexpression tobacco ( N. benthamiana ) transformants (1: stem induction after Agrobactria inoculation, 2: plant formation, 3: root induction, 4: Transformant)
3A and 3B show the expression of each gene in the Cas9(A) and PDS-gRNA(B) transformants using PCR and qRT-PCR.
Figure 4 shows the shape of _{F 1} obtained by crossing the NbPDS gene using the individually expressed plant selected in Figure 3.
Figure 5 shows the Cas9 and PDS-gRNA individual expression transgenic tobacco ( N. benthamiana ) hybrid generation (F ₁ ) phenotype (5 days after seeding). In dashed circle 1: keep editing, 2: recover editing, 3: no editing
Fig. 6 is an observation of a representative phenotype of Cas9 and PDS-gRNA individual expression transgenic tobacco ( N. benthamiana ) hybrid generation (F ₁ ) (1 month after seeding). 1: keep editing, 2: recover editing (slow), 3: recover editing (fast), 4: unedited, total population 223
7 is a result of observing a phenotype in which gene editing is not possible due to continuous gene editing of new leaves (left) according to plant growth, and normal leaves appearing (right) after a certain period of time. Observation period: 18 Aug 2020; Sowing, 8. 23. Cotyledon edit confirmation; 8. 28. Editing the first lobe and confirming it is normal; 9. 5. Editing the second lobe and confirming normality; 9. 17. Editing the fifth leaf and confirming normality; (9. 21. Taking pictures)

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

<Example 1> Preparation of transgenic plant

CRISPR/Cas9-expressing or gRNA-expressing transgenic plants were prepared by selecting representative resources that are well transformed among plants in the same species or genus as the plants selected in Example 1 that are not transformed.

First, CRISPR/Cas9-overexpressing transgenic tobacco and gRNA-expressing transgenic tobacco were prepared using easy-to-transform tobacco ( Nicotiana benthamiana ), and progeny (hybrid generation) were prepared by crossing each of the prepared transformants.

<Example 1-1> Preparation of CRISPR/Cas9-expressing transgenic tobacco (A)

Tobacco ( Nicotiana benthamiana ) was transduced with a CRISPR/Cas9 expression vector to prepare a Cas9-expressing transgenic tobacco.

Cas9 expression vector was prepared as shown in Figure 1 (above). The pHAtC vector was used. When an inducible promoter or a tissue-specific promoter is used as the promoter, it is relatively difficult to analyze the phenotype of the target gene when the plant is crossed, so a permanently expressed promoter, 35S, was used.

The Cas9 expression vector was transformed with Agrobacterium and then infected with callus or tissue of tobacco to prepare CRISPR/Cas9-expressing transgenic tobacco (A) (Fig. 2-A) and cultured in a greenhouse. Genomic DNA was isolated from the CRISPR/Cas9-expressing transgenic plant (A) prepared above, and PCR analysis was performed to confirm the introduction of the Cas9 gene. The Cas9 gene consists of the nucleotide sequence of SEQ ID NO: 1, and consists of the amino acid sequence of SEQ ID NO: 2 (Tables 1 and 2).

<Example 1-2> Preparation of transgenic plant (B) expressing target gene-specific gRNA

To knock-out (KO) a target gene in tobacco, a target gene-specific gRNA (s) was selected, and vectors (pU6-sgRNAs) expressing the gRNA were prepared as shown in FIG. 1 (below). The tU6p promoter -sgRNA_PDS(CR-V1) recombinant vector was prepared using the pICH86966 vector.

Specifically, a gRNA (s) expression vector was prepared using gRNA (s) specific for a phytoene desaturase (PDS) gene (SEQ ID NO: 3) derived from Nicotiana benthamiana. The prepared gRNA(s)-vector was transformed into Agrobacterium and then infected with callus or tissue to prepare a gRNA-expressing transgenic plant (B) (Fig. 2-B) and cultured in a greenhouse.

Gene name Base sequence NbPDS gene
(SEQ ID NO:3) ATGCCCCAAA TTGGACTTGT TTCTGCCGTT AATTTGAGAG TCCAAGGTAA TTCAGCTTAT
CTTTGGAGCT CGAGGTCTTC GTTGGGAACT GAAAGTCAAG ATGTTTGCTT GCAAAGGAAT
TTGTTATGTT TTGGTAGTAG CGACTCCATG GGGCATAAGT TAAGGATTCG TACTCCAAGT
GCCACGACCC GAAGATTGAC AAAGGACTTT AATCCTTTAA AGGTAGTCTG CATTGATTAT
CCAAGACCAG AGCTAGACAA TACAGTTAAC TATTTGGAGG CGGCGTTATT ATCATCATCG
TTTCGTACTT CCTCACGCCC AACTAAACCA TTGGAGATTG TTATTGCTGG TGCAGGTTTG
GGTGGTTTGT CTACAGCAAA ATATCTGGCA GATGCTGGTC ACAAACCGAT ATTGCTGGAG
GCAAGAGATG TCCTAGGTGG GAAGGTAGCT GCATGGAAAG ATGATGATGG AGATTGGTAC
GAGACTGGGT TGCACATATT CTTTGGGGCT TACCCAAATA TGCAGAACCT GTTTGGAGAA
CTAGGGATTG ATGATCGGTT GCAGTGGAAG GAACATTCAA TGATATTTGC GATGCCTAAC
AAGCCAGGGG AGTTCAGCCG CTTTGATTTT CCTGAAGCTC TTCCTGCGCC ATTAAATGGA
ATTTTGGCCA TACTAAAGAA CAACGAAATG CTTACGTGGC CCGAGAAAGT CAAATTTGCT
ATTGGACTCT TGCCAGCAAT GCTTGGAGGG CAATCTTATG TTGAAGCTCA AGACGGTTTA
AGTGTTAAGG ACTGGATGAG AAAGCAAGGT GTGCCTGATA GGGTGACAGA TGAGGTGTTC
ATTGCCATGT CAAAGGCACT TAACTTCATA AACCCTGACG AGCTTTCGAT GCAGTGCATT
TTGATTGCTT TGAACAGATT TCTTCAGGAG AAACATGGTT CAAAAATGGC CTTTTTAGAT
GGTAACCCTC CTGAGAGACT TTGCATGCCG ATTGTGGAAC ATATTGAGTC AAAAGGTGGC
CAAGTCAGAC TAAACTCACG AATAAAAAAG ATCGAGCTGA ATGAGGATGG AAGTGTCAAA
TGTTTTATAC TGAATAATGG CAGTACAATT AAAGGAGATG CTTTTGTGTT TGCCACTCCA
GTGGATATCT TGAAGCTTCT TTTGCCTGAA GACTGGAAAG AGATCCCATA TTTCCAAAAG
TTGGAGAAGC TAGTGGGAGT TCCTGTGATA AATGTCCATA TATGGTTTGA CAGAAAACTG
AAGAACACAT CTGATAATCT GCTCTTCAGC AGAAGCCCGT TGCTCAGTGT GTACGCTGAC
ATGTCTGTTA CATGTAAGGA ATATTACAAC CCCAATCAGT CTATGTTGGA ATTGGTATTT
GCACCCGCAG AAGAGTGGAT AAATCGTAGT GACTCAGAAA TTATTGATGC TACAATGAAG
GAACTAGCGA AGCTTTTCCC TGATGAAATT TCGGCAGATC AGAGCAAAGC AAAAATATTG
AAGTATCATG TTGTCAAAAC CCCAAGGTCT GTTTATAAAA CTGTGCCAGG TTGTGAACCC
TGTCGGCCCT TGCAAAGATC CCCTATAGAG GGTTTTTATT TAGCTGGTGA CTACACGAAA
CAGAAGTACT TGGCTTCAAT GGAAGGTGCT GTCTTATCAG GAAAGCTTTG TGCCGAAGCT
ATTGTACAGG ATTACGAGTT ACTTCTTGGC CGGAGCCAGA AGATGTTGGC AGAAGCAAGC
GTAGTTAGCA TAGTGAACTA A

<Example 2> Molecular biological analysis of A, B transgenic tobacco

After separating the Cas9 transformant of Example 1-1 or the gDNA or RNA of the gRNA-expressing transformant of Example 1-2, the transformants were selected through molecular biological analysis.

<Example 2-1> A transgenic tobacco

In the transformant of Example 1-1, the Cas9-F (SEQ ID NO: 4) and Cas9-R (SEQ ID NO: 5) primers specific to the Cas9 gene and the selection marker hygromycin primer (hptII-2 F, SEQ ID NO: 6) ) And nos terminator primer (nos-R; SEQ ID NO: 7) was used to perform PCR

Through the PCR analysis result, 26 lines of Cas9-expressing transformants were selected, and a large amount of seeds of the Cas9-expressing plant was obtained (FIG. 3A).

<Example 2-2> B Transgenic Tobacco

Similarly, the transformant of Example 1-2 was PCR with nosT-F (SEQ ID NO: 8) and CRISPR-uni-R (SEQ ID NO: 9) primers to select 19 transformants. In addition, the expression of gRNA was analyzed by real time qRT-PCR using NbPDS-gRNA-F (SEQ ID NO: 10) primer and gRNA Scaffold-R primer (SEQ ID NO: 11) to identify line 1 showing high expression and cross breeding. It was used for (Fig. 3b).

Primer name Sequence information (5'→3') Cas9-2F (SEQ ID NO: 4) AAGCTGCCTAAGTACTCCCT Cas9-2R (SEQ ID NO: 5) AGGTAGTGCTTGTGCTGTTC hptII-2F (SEQ ID NO: 6) CATAACAGCGGTCATTGACTG nos-R (SEQ ID NO: 7) TTGCGCGCTATATTTTGTTT nosT-F (SEQ ID NO: 8) TGAATCCTGTTGCCGGTCTT CRISPR-uni-R (SEQ ID NO: 9) AGCGTAATGCCAACTTTGTAC NbPDS-gRNA-F (SEQ ID NO: 10) GCCGTTAATTTGAGAGTCCA gRNA Scaffold-R (SEQ ID NO: 11) AAAAGCACCGACTCGGTG

In Table 4, F denotes the forward direction and R denotes the reverse direction.

<Example 3> CRISPR/Cas9-expressing plant and gRNA-expressing plant genotyping analysis

Genotypes of Cas9 and gRNA DNA carriers were analyzed in the CRISPR/Cas9-expressing plant line No. 23 and line No. 1 with increased gRNA expression selected in Example 2.

Each plant was self-pollinated, and the obtained seeds were sown in an antibiotic medium to observe the separation ratio. In the case of Cas9/23-1 individuals, as a result of sowing in selective medium containing hygromycin (50 mg/ℓ), all 24 plants survived in the selective medium, and it was determined that the pHAtC carrier DNA was homozygous inserted into both strands of the tobacco genome DNA. On the other hand, the gRNA carrier AtU6P-NbPDS-gRNA (CRV1-1) was seeded in a selective medium containing kanamycin (50 ㎎/ℓ). As a result, 20 out of 24 plants survived in the selective medium. It was determined that it was inserted into one of the strands (Fig. 4).

<Example 4> Gene editing analysis after crossing of Cas9 and gRNA individually expressing plants

Cas9/23-1 of Example 3 and gRNA-1 individuals were crossed _{to harvest 223 hybrid seeds (F 1} ), sown them in MS0 medium, and the phenotype of the plant was continuously observed.

In view of the results obtained in Example 3, the Cas9/23-1 and gRNA-1 hybrid seeds will exist as a heterotype inserted into one of the tobacco genomic DNA strands in all of the hybrid seeds as described in the individual. On the other hand, AtU6P-NbPDS-gRNA was predicted to exist as a heterotype in only 50% of the hybrids and not in the rest. In view of these results, 50% of the 223 individuals did not have AtU6P-NbPDS-gRNA, so gRNA was not expressed, so it was expected that gene editing would not be possible.

As a result of the analysis, it was confirmed that the target gene was edited 5 days after sowing (leaf chlorophyll deficiency) 81 individuals, and the edited symptoms (leaf chlorophyll normal) did not show 142 individuals (Fig. 5).

Among the 142 specimens that did not show symptoms that were edited, around 111.5 (50%) were not edited due to the lack of AtU6P-NbPDS-gRNA. The remaining about 31 individuals were judged to have not been edited, even though both pHAtC and AtU6P-NbPDS-gRNA were in a hetero state.

In addition, as a result of observation 1 month after sowing, it was confirmed that out of 81 individuals that were identified as edited individuals, 54 of them recovered gene editing in newly appearing leaves, and among these, 27 of them maintained the gene editing effect of new leaves ( Fig. 6).

In addition, among the 27 individuals whose editing was maintained for the first month of sowing as the tobacco plant was grown, the leaves of which the genes of the new leaves were continuously edited (chlorophyll deficiency, Fig. 7A) and the normal leaves whose genes were not edited after a certain period were newly It was confirmed that it grows (Fig. 7B).

From the above results, it was shown that the plant was edited on the cotyledon to show a phenotype, and that the effect of gene editing was maintained in the new leaves according to growth, and the phenotype was shown by editing the plant in the cotyledon. It was confirmed that the temporary editing of the things that did not happen (recovery) appeared.

On the other hand, it is judged that the cause of the gene editing effect of the hybrid generation by crossing the CRISPR/Cas9 and NbPDS-gRNA individually expressing plants is continuously maintained or recovered while growing, because the expression appears different for each type and part of the plant after transformation. I did.

By selecting individuals with gene editing maintained through genotyping or phenotypic analysis and self-crossing to advance several generations and fixing the generations, it is believed that individuals with genetic edits can be obtained at all times.

In addition, when these genetically modified individuals are crossed with a plant variety that is difficult to transform, the target gene can be constantly edited in a plant variety that is difficult to transform.

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Gene editing method using transgenic plants expressing CRISPR/Cas9 and gRNA, respectively <130> DP20200277 <150> KR 10-2019-0121603 <151> 2019-10-01 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 4143 <212> DNA <213> Artificial Sequence <220> <223> Cas9 gene <400> 1 atggacaaga agtacagcat cggcctggac atcggtacca acagcgtggg ctgggccgtg 60 atcaccgacg agtacaaggt gcccagcaag aagttcaagg tgctgggcaa caccgaccgc 120 cacagcatca agaagaacct gatcggcgcc ctgctgttcg acagcggcga gaccgccgag 180 gccacccgcc tgaagcgcac cgcccgccgc cgctacaccc gccgcaagaa ccgcatctgc 240 tacctgcagg agatcttcag caacgagatg gccaaggtgg acgacagctt cttccaccgc 300 ctggaggaga gcttcctggt ggaggaggac aagaagcacg agcgccaccc catcttcggc 360 aacatcgtgg acgaggtggc ctaccacgag aagtacccca ccatctacca tctgcgcaag 420 aagctggtgg acagcaccga caaggccgac ctgcgcctga tctacctggc cctggcccac 480 atgatcaagt tccgcggcca cttcctgatc gagggcgacc tgaaccccga caacagcgac 540 gtggacaagc tgttcatcca gctggtgcag acctacaacc agctgttcga ggagaacccc 600 atcaacgcca gcggcgtgga cgccaaggcc atcctgagcg cccgcctgag caagagccgc 660 cgcctggaga acctgatcgc ccagctgccc ggcgagaaga agaacggcct gttcggcaac 720 ctgatcgccc tgagcctggg cctgaccccc aacttcaaga gcaacttcga cctggccgag 780 gacgccaagc tgcagctgag caaggacacc tacgacgacg acctggacaa cctgctggcc 840 cagatcggcg accagtacgc cgacctgttc ctggccgcca agaacctgag cgacgccatc 900 ctgctgagcg acatcctgcg cgtgaacacc gagatcacca aggcccccct gagcgccagc 960 atgatcaagc gctacgacga gcaccaccag gacctgaccc tgctgaaggc cctggtgcgc 1020 cagcagctgc ccgagaagta caaggagatc ttcttcgacc agagcaagaa cggctacgcc 1080 ggctacatcg acggcggcgc cagccaggag gagttctaca agttcatcaa gcccatcctg 1140 gagaagatgg acggcaccga ggagctgctg gtgaagctga accgcgagga cctgctgcgc 1200 aagcagcgca ccttcgacaa cggcagcatc ccccaccaga tccacctggg cgagctgcac 1260 gccatcctgc gccgccagga ggacttctac cccttcctga aggacaaccg cgagaagatc 1320 gagaagatcc tgaccttccg catcccctac tacgtgggcc ccctggcccg cggcaacagc 1380 cgcttcgcct ggatgacccg caagagcgag gagaccatca ccccctggaa cttcgaggag 1440 gtggtggaca agggcgccag cgcccagagc ttcatcgagc gcatgaccaa cttcgacaag 1500 aacctgccca acgagaaggt gctgcccaag cacagcctgc tgtacgagta cttcaccgtg 1560 tacaacgagc tgaccaaggt gaagtacgtg accgagggca tgcgcaagcc cgccttcctg 1620 agcggcgagc agaagaaggc catcgtggac ctgctgttca agaccaaccg caaggtgacc 1680 gtgaagcagc tgaaggagga ctacttcaag aagatcgagt gcttcgacag cgtggagatc 1740 agcggcgtgg aggaccgctt caacgccagc ctgggcacct accacgacct gctgaagatc 1800 atcaaggaca aggacttcct ggacaacgag gagaacgagg acatcctgga ggacatcgtg 1860 ctgaccctga ccctgttcga ggaccgcgag atgatcgagg agcgcctgaa gacctacgcc 1920 cacctgttcg acgacaaggt gatgaagcag ctgaagcgcc gccgctacac cggctggggc 1980 cgcctgagcc gcaagcttat caacggcatc cgcgacaagc agagcggcaa gaccatcctg 2040 gacttcctga agagcgacgg cttcgccaac cgcaacttca tgcagctgat ccacgacgac 2100 agcctgacct tcaaggagga catccagaag gcccaggtga gcggccaggg cgacagcctg 2160 cacgagcaca tcgccaacct ggccggcagc cccgccatca agaagggcat cctgcagacc 2220 gtgaaggtgg tggacgagct ggtgaaggtg atgggccgcc acaagcccga gaacatcgtg 2280 atcgagatgg cccgcgagaa ccagaccacc cagaagggcc agaagaacag ccgcgagcgc 2340 atgaagcgca tcgaggaggg catcaaggag ctgggcagcc agatcctgaa ggagcacccc 2400 gtggagaaca cccagctgca gaacgagaag ctgtacctgt actacctgca gaacggccgc 2460 gacatgtacg tggaccagga gctggacatc aaccgcctga gcgactacga cgtggaccac 2520 atcgtgcccc agagcttcct gaaggacgac agcatcgaca acaaggtgct gacccgcagc 2580 gacaagaacc gcggcaagag cgacaacgtg cccagcgagg aggtggtgaa gaagatgaag 2640 aactactggc gccagctgct gaacgccaag ctgatcaccc agcgcaagtt cgacaacctg 2700 accaaggccg agcgcggcgg cctgagcgag ctggacaagg ccggcttcat caagcgccag 2760 ctggtggaga cccgccagat caccaagcac gtggcccaga tcctggacag ccgcatgaac 2820 accaagtacg acgagaacga caagctgatc cgcgaggtga aggtgatcac cctgaagagc 2880 aagctggtga gcgacttccg caaggacttc cagttctaca aggtgcgcga gatcaacaac 2940 taccaccacg cccacgacgc ctacctgaac gccgtggtgg gcaccgccct gatcaagaag 3000 taccccaagc tggagagcga gttcgtgtac ggcgactaca aggtgtacga cgtgcgcaag 3060 atgatcgcca agagcgagca ggagatcggc aaggccaccg ccaagtactt cttctacagc 3120 aacatcatga acttcttcaa gaccgagatc accctggcca acggcgagat ccgcaagcgc 3180 cccctgatcg agaccaacgg cgagaccggc gagatcgtgt gggacaaggg ccgcgacttc 3240 gccaccgtgc gcaaggtgct gagcatgccc caggtgaaca tcgtgaagaa gaccgaggtg 3300 cagaccggcg gcttcagcaa ggagagcatc ctgcccaagc gcaacagcga caagctgatc 3360 gcccgcaaga aggactggga ccccaagaag tacggcggct tcgacagccc caccgtggcc 3420 tacagcgtgc tggtggtggc caaggtggag aagggcaaga gcaagaagct gaagagcgtg 3480 aaggagctgc tgggcatcac catcatggag cgcagcagct tcgagaagaa ccccatcgac 3540 ttcctggagg ccaagggcta caaggaggtg aagaaggacc tgatcatcaa gctgcccaag 3600 tacagcctgt tcgagctgga gaacggccgc aagcgcatgc tggccagcgc cggcgagctg 3660 cagaagggca acgagctggc cctgcccagc aagtacgtga acttcctgta cctggccagc 3720 cactacgaga agctgaaggg cagccccgag gacaacgagc agaagcagct gttcgtggag 3780 cagcacaagc actacctgga cgagatcatc gagcagatca gcgagttcag caagcgcgtg 3840 atcctggccg acgccaacct ggacaaggtg ctgagcgcct acaacaagca ccgcgacaag 3900 cccatccgcg agcaggccga gaacatcatc cacctgttca ccctgaccaa cctgggcgcc 3960 cccgccgcct tcaagtactt cgacaccacc atcgaccgca agcgctacac cagcaccaag 4020 gaggtgctgg acgccaccct gatccaccag agcatcaccg gtctgtacga gacccgcatc 4080 gacctgagcc agctgggcgg cgacggcggc tccggacctc caaagaaaaa gagaaaagta 4140 taa 4143 <210> 2 <211> 1379 <212> PRT <213> Artificial Sequence <220> <223> Cas9 protein <400> 2 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 1 5 10 15 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 20 25 30 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 35 40 45 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 50 55 60 Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr 65 70 75 80 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe 85 90 95 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 100 105 110 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 115 120 125 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 130 135 140 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 145 150 155 160 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 165 170 175 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 180 185 190 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 195 200 205 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 210 215 220 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 225 230 235 240 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 245 250 255 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 260 265 270 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 275 280 285 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 290 295 300 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 305 310 315 320 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 325 330 335 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 340 345 350 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 355 360 365 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 370 375 380 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 385 390 395 400 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 405 410 415 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 420 425 430 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 435 440 445 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 450 455 460 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 465 470 475 480 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 485 490 495 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 500 505 510 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 515 520 525 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 530 535 540 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 545 550 555 560 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 565 570 575 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 580 585 590 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 595 600 605 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 610 615 620 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 625 630 635 640 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 645 650 655 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 660 665 670 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 675 680 685 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 690 695 700 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 705 710 715 720 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 725 730 735 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 740 745 750 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 755 760 765 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 770 775 780 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 785 790 795 800 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 805 810 815 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 820 825 830 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 835 840 845 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 850 855 860 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 865 870 875 880 Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 885 890 895 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 900 905 910 Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys 915 920 925 His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu 930 935 940 Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys 945 950 955 960 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 965 970 975 Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val 980 985 990 Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 995 1000 1005 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1010 1015 1020 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1025 1030 1035 1040 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1045 1050 1055 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1060 1065 1070 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1075 1080 1085 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1090 1095 1100 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1105 1110 1115 1120 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1125 1130 1135 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1140 1145 1150 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1155 1160 1165 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1170 1175 1180 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1185 1190 1195 1200 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1205 1210 1215 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1235 1240 1245 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1250 1255 1260 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1265 1270 1275 1280 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1285 1290 1295 Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1300 1305 1310 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1315 1320 1325 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1330 1335 1340 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1345 1350 1355 1360 Leu Ser Gln Leu Gly Gly Asp Gly Gly Ser Gly Pro Pro Lys Lys Lys 1365 1370 1375 Arg Lys Val <210> 3 <211> 1761 <212> DNA <213> Artificial Sequence <220> <223> NbPDS gene <400> 3 atgccccaaa ttggacttgt ttctgccgtt aatttgagag tccaaggtaa ttcagcttat 60 ctttggagct cgaggtcttc gttgggaact gaaagtcaag atgtttgctt gcaaaggaat 120 ttgttatgtt ttggtagtag cgactccatg gggcataagt taaggattcg tactccaagt 180 gccacgaccc gaagattgac aaaggacttt aatcctttaa aggtagtctg cattgattat 240 ccaagaccag agctagacaa tacagttaac tatttggagg cggcgttatt atcatcatcg 300 tttcgtactt cctcacgccc aactaaacca ttggagattg ttattgctgg tgcaggtttg 360 ggtggtttgt ctacagcaaa atatctggca gatgctggtc acaaaccgat attgctggag 420 gcaagagatg tcctaggtgg gaaggtagct gcatggaaag atgatgatgg agattggtac 480 gagactgggt tgcacatatt ctttggggct tacccaaata tgcagaacct gtttggagaa 540 ctagggattg atgatcggtt gcagtggaag gaacattcaa tgatatttgc gatgcctaac 600 aagccagggg agttcagccg ctttgatttt cctgaagctc ttcctgcgcc attaaatgga 660 attttggcca tactaaagaa caacgaaatg cttacgtggc ccgagaaagt caaatttgct 720 attggactct tgccagcaat gcttggaggg caatcttatg ttgaagctca agacggttta 780 agtgttaagg actggatgag aaagcaaggt gtgcctgata gggtgacaga tgaggtgttc 840 attgccatgt caaaggcact taacttcata aaccctgacg agctttcgat gcagtgcatt 900 ttgattgctt tgaacagatt tcttcaggag aaacatggtt caaaaatggc ctttttagat 960 ggtaaccctc ctgagagact ttgcatgccg attgtggaac atattgagtc aaaaggtggc 1020 caagtcagac taaactcacg aataaaaaag atcgagctga atgaggatgg aagtgtcaaa 1080 tgttttatac tgaataatgg cagtacaatt aaaggagatg cttttgtgtt tgccactcca 1140 gtggatatct tgaagcttct tttgcctgaa gactggaaag agatcccata tttccaaaag 1200 ttggagaagc tagtgggagt tcctgtgata aatgtccata tatggtttga cagaaaactg 1260 aagaacacat ctgataatct gctcttcagc agaagcccgt tgctcagtgt gtacgctgac 1320 atgtctgtta catgtaagga atattacaac cccaatcagt ctatgttgga attggtattt 1380 gcacccgcag aagagtggat aaatcgtagt gactcagaaa ttattgatgc tacaatgaag 1440 gaactagcga agcttttccc tgatgaaatt tcggcagatc agagcaaagc aaaaatattg 1500 aagtatcatg ttgtcaaaac cccaaggtct gtttataaaa ctgtgccagg ttgtgaaccc 1560 tgtcggccct tgcaaagatc ccctatagag ggtttttatt tagctggtga ctacacgaaa 1620 cagaagtact tggcttcaat ggaaggtgct gtcttatcag gaaagctttg tgccgaagct 1680 attgtacagg attacgagtt acttcttggc cggagccaga agatgttggc agaagcaagc 1740 gtagttagca tagtgaacta a 1761 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cas9-2F <400> 4 aagctgccta agtactccct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cas9-2R <400> 5 aggtagtgct tgtgctgttc 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> hptII-2F <400> 6 cataacagcg gtcattgact g 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> nos-R <400> 7 ttgcgcgcta tattttgttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> nosT-F <400> 8 tgaatcctgt tgccggtctt 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CRISPR-uni-R <400> 9 agcgtaatgc caactttgta c 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NbPDS-gRNA-F <400> 10 gccgttaatt tgagagtcca 20 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> gRNA Scaffold-R <400> 11 aaaagcaccg actcggtg 18

Claims (9)

A method for editing a target gene of a plant comprising the step of crossing a Cas9-expressing plant and a gRNA-expressing plant to produce a progeny. The method of claim 1,
The progeny is a temporary or constitutive gene editing individual, the target gene editing method of the plant. The method of claim 1,
The method further comprising the step of crossing the progeny with a plant variety that is difficult to transform. The method of claim 3,
The plant variety that is difficult to transform is that the transformation efficiency using Agrobacterium is 3% or less, the target gene editing method of the plant. The method of claim 4,
The plants include rice, wheat, barley, corn, beans, potatoes, wheat, red beans, food crops including oats or sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion or carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut or rapeseed; Fruit trees including apple tree, pear tree, jujube tree, peach, poplar, grape, tangerine, persimmon, plum, apricot or banana; Flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies or tulips; And any one crop selected from the group consisting of feed crops including ryegrass, red clover, orchardgrass, alpha alpha, tall fescue, or perennial ryegrass. The method of claim 5,
The rice includes Indica-based rice varieties, and the pepper includes hot pepper and green pepper varieties, and the corn varieties include Danok No.2, Geumdanok, Chodangok No.1, Gammiok, Kobeok, Godangok, Platinumok, Gwangpyeong Jade, Cheonganok, Jangdaok, Gangdaok, Dapyeongok, Cheongdaok, Godangok No.1, Chalkok No.1, Dumechal, Yeonnong No.1, Gwanganok, Heukspot, Ilmichal, Goldchal, Arichal, Amichal, Damichal, Hwangchalok, White Chalk and Heukjinjuchal varieties, and the wheat includes gold, Ariheuk, Opry, Geumgang, Baekgang, Landscaping and all-tree varieties
A method of editing target genes in plants. The method of claim 1,
In the gene editing, the nucleotide of the target gene is deleted, inverted, substituted or inserted. In claim 1,
The target gene is a disease resistance gene; Genes involved in agricultural traits; Genes involved in environmental stress, including immersion, drought, cold or salt resistance; Genes related to nitrogen metabolism; Genes involved in functional metabolism; Genes involved in the regulation of spicy, bitter, sour, or sweet taste; that is selected from the group consisting of, the target gene editing method of the plant. A plant in which the target gene has been edited by the editing method of any one of claims 1 to 8.

Images