CN109112158A - A method of intelligent sterile line is formulated based on toxicity detoxification genes - Google Patents
A method of intelligent sterile line is formulated based on toxicity detoxification genes Download PDFInfo
- Publication number
- CN109112158A CN109112158A CN201810939510.3A CN201810939510A CN109112158A CN 109112158 A CN109112158 A CN 109112158A CN 201810939510 A CN201810939510 A CN 201810939510A CN 109112158 A CN109112158 A CN 109112158A
- Authority
- CN
- China
- Prior art keywords
- male
- sterile
- gene
- crop
- female
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/829—Female sterility
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Virology (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of methods based on toxicity detoxification genes initiative crop intelligence sterile line.The present invention is using sterile material as research object, including male sterile material and female sterile material operate wild type detoxification genes using gene silent technology, make detoxification genes silencing.By detoxification genes silencing, restoring gene and riddled basins 3 chain expression cassette carrier constructions, recessive karyon male/Female sterile clone is transferred to by transgenic technology.Obtain intelligent male/Female sterile clone, the mechanization production of hybrid seeds applied to male/Female sterile clone breeding and cenospecies.
Description
Technical field
The invention belongs to molecular biology of plants and agricultural technology field, more particularly to a kind of intelligent sterile line of initiative
Method more specifically relates to the application based on toxicity detoxification genes in intelligent sterile line.
Background technique
Heterosis utilization is a major technological breakthrough and achievement in modern agricultural production.Hybrid caused by hybridizing
Advantage refers to the filial generation for the parent that two have hereditary basis difference the phenomenon that being better than two parents on various shapes.Development and
It is the key that heterosis utilization develops using the pollination system that can control.Heterosis utilization skill based on sterile line
Art is widely applied in the crops such as rice, corn, wheat.Male sterile line with the mode of inheritance of sterile gene and
Positioning in cell can be divided into genie male sterile line and cytoplasmic male sterile line and nucleo-cytoplasmic interreaction sterile line.And it is female
Sterile phenotype is varied, and sterile mechanism is complex, seed hair more shrivelled than more typical plant female infertility feature such as ovary
Bud rate is low and without style and column+head etc..Scientists find and identify numerous sterile genes, as PAIR2, UDT1,
OsGAMYB, OsFMS2 and PTB1 etc., this, which allows, directly becomes possibility using sterile gene on molecular level.
With the continuous development of modern biotechnology science and technology, the sterile gene of inheritance stability is used, is kept and numerous
Sterile line is grown, and sterile line and cenospecies of the final production without transgene component become the new important side of hybrid rice development
To.Compared with conventional hybridization breeding and conventional transgenic breeding, intelligent sterile line technology has following advantage: 1. utilize infertility
Gene is that crops are generally existing, the crops of all genetic backgrounds can all be formulated into intelligent sterile line, resource utilization
More than 95%, this solves the traditional conventional cross-breeding of conventional breeding there is resource utilizations the bottles such as low, breeding cycle is long
Neck problem.2. the gene being transferred into is limited, other crops cannot be traveled to, also turn base without external source in filial generation plant
Because of element, GMO bio-safety problem is not present.
In recent years, intelligent sterile line technology is just at the early-stage and rapidly develops, and existing corn controls insect sterile technique, U.S. Du more
The SRT technology of nation pioneer, rice intelligence insect sterile technique etc..Corn controls insect sterile technique based on corn stealth line with genic sterile more,
Establish effective reproduction technique system of the corn stealth Genetic Sterility material of the temperature sensitive influence of not light.Corn SRT technological synthesis benefit
With transgenic technology, pollen abortion technology and fluorescin color sorting technology, restores the fertility of sterile line and can effectively breed.And
Rice intelligence insect sterile technique has used for reference corn SRT technology, realizes and produces non-transgenic male-sterile seed with transgenic approach
And hybrid rice seed.So the new fertility restorer that can be used for intelligent sterile line initiative, 3 kinds of pollen abortion, selection markers heredity
The discovery and update of tool become the important directions of intelligent sterile line research.
The infertility of rice distant hybrid in recent years molecule mechanism and application have biggish breakthrough, it was found that such as the site qHMS7
Virulent gene ORF2/ detoxification genes ORF3 etc. lead to the gene loci of crop Fertility change by toxicity-detoxication mechanisms.These
The development and function effect plant fertility that gene passes through control female and male gametophyte.This kind of key gene for influencing distant hybridization fertility exists
While having great theoretical significance on distant hybridization infertility molecular mechanism research, also have in the application of intelligent sterile line
Wide space and huge potentiality.
Summary of the invention
It is a kind of based on toxicity detoxification genes initiative crop intelligence infertility the present invention is directed to overcome the deficiencies of the prior art and provide
The method of system.
In order to achieve the above object, technical solution provided by the invention are as follows:
The method based on toxicity detoxification genes initiative crop intelligence sterile line, which is characterized in that the method includes
Following steps: make detoxification genes silencing using genetic engineering means；Detoxification genes silencing expression cassette, restoring gene are expressed
Box and riddled basins expression cassette 3 chain expression cassette carrier constructions, are transferred to crop recessive cell by transgenic technology
Core male or Female sterile clone obtain intelligence male or Female sterile clone, the breeding applied to crop male or female infertility
With the mechanization production of hybrid seeds of crop hybrid kind.
Preferably, the detoxification genes include but is not limited to the ORF3 gene in the site qHMS7, and the detoxification genes sequence is such as
Shown in SEQ ID NO.1.The restoring gene includes but is not limited to wild type male infertility or female sterile gene.It is described
Riddled basins include but is not limited to fluorescent marker gene, glume color gene etc..
5. the method as described in claim 1, which is characterized in that gene silencing methods include but is not limited to antisense technology,
RNA interference etc..
Preferably, it is described applied to crop male or female infertility breeding be for crop recessive karyon male or
The breeding of Female sterile clone.The mechanization production of hybrid seeds applied to crop hybrid kind is for the crop hybrid using female sterile
The mechanization production of hybrid seeds of kind.The crop is monocot crops or dicotyledonous crops, the monocot crops or dicotyledonous crops packet
Include but be not limited to rice, corn, rape, millet, wheat, capsicum etc..
The invention will be further described below:
The present invention provides a kind of methods for formulating intelligent sterile line based on toxicity detoxification genes:
(1) detoxification genes silencing expression cassette, restoring gene expression cassette, riddled basins expression cassette are inserted into rice
Expression vector；
(2) construct prepared by step 1 is transferred to male sterility/female sterile material, generates the first plant；
(3) first plant self-pollinations, in the offspring of generation, half be the homozygous recessive male without external source construct/
Plants with female sterility, the other half is the first plant containing external source construct.
External source construct described in step 1 includes:
A) the first nucleotide sequence, when its expression when, can inhibit the male gamete containing the nucleotide sequence formation or
Function；
B) the second nucleotide sequence, it includes the nucleotides sequences that will lead to plant pollen infertility or female sterile after mutation
Column, when expressing in sterile plant, it develops the normal pollen for restoring the plant or female organ；
Whether c) third nucleotide sequence can be distinguished in plant when its expression containing the construct introduced.
In the present invention, the first nucleotides sequence being previously mentioned in the method for above-mentioned initiative intelligence sterile line is classified as detoxification genes
Silencing, sequence is as shown in SEQ ID NO.1, and wherein detoxification genes include but is not limited to the ORF3 gene in the site qHMS7.Described
First nucleotide sequence with tetranucleotide sequence is operable is connected, the tetranucleotide sequence preference is in plant pollen
Middle expression.
In the present invention, the second nucleotides sequence being previously mentioned in the method for above-mentioned initiative intelligence sterile line is classified as fertility restorer
Gene, including but not limited to male or the wild type of female sterile gene.Second nucleotide sequence and pentanucleotide
Sequence is operable to be connected, and the pentanucleotide sequence preference is expressed in male plant or female organ.
In the present invention, the third nucleotides sequence being previously mentioned in the method for above-mentioned initiative intelligence sterile line is classified as fluorescin
One of the group that the genes such as gene, glume color are constituted.Wherein the third nucleotide sequence can be grasped with Hexanucleotide sequence
That makees is connected, and the Hexanucleotide sequence, which is that END2 or LTP2 etc. is specifically expressed in callus/seed or endosperm, to be opened
Mover.
In the present invention, the second nucleotide sequence to the 6th nucleosides being previously mentioned in the method for above-mentioned initiative intelligence sterile line
Acid sequence discloses (patent No.: ZL 2,014 1 0116096.8) in patent of invention.
The present invention also provides a kind of methods of new substitution pollen abortion gene, and the method includes to such as qHMS7 etc.
The gene for regulating and controlling pollen function by toxicity detoxication mechanisms, makes pollen abortion by the technological means of mutation." mutation "
Including but not limited to following methods, such as generated with antisense RNA, RNAi gene silencing means.In the present invention, the removing toxic substances base
Because silencing includes but is not limited to the detoxification genes ORF3 silencing in the site qHMS7.For example, it has now been found that certain rice product
Kind while the ORF3 for carrying toxic ORF2 and removing toxic substances, pollen are survived because there is the protection of ORF3, lack the protection of ORF3, pollen
Will be dead, to show male sterility.
First nucleotides sequence of the present invention is classified as the nucleotide sequence for making pollen abortion using the above method, the sequence
Column are as shown in SEQ ID NO.1.First nucleotide sequence can be built into expression cassette and be inserted into any carrier being transformed into cell
In.The primer pair of the overall length or any segment that expand above-mentioned nucleotide fragments is also the scope of protection of the invention.Contain the first core
Recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of acid fragments are also protection scope of the present invention.Preferred cell
It is crop cell, preferably rice cell.The first nucleotide of the present invention for including in the crop cell can be by turning base
Because of technological sourcing plant cell, including importeding into core, chloroplaset, mitochondria and/or the plastid of plant cell, so that this hair
Bright first nucleotide is present in plant cell.
The present invention also provides a kind of breeding homozygous recessive core male/Female sterile clone methods, which comprises
(1) detoxification genes silencing expression cassette, restoring gene expression cassette, riddled basins expression cassette are inserted into rice
Expression vector；
(2) construct prepared by step 1 is transferred to male sterility/female sterile material, generates the first plant；
(3) first plant self-pollinations, in the offspring of generation, half be the homozygous recessive male without external source construct/
Plants with female sterility, the other half is the first plant containing external source construct.
External source construct described in step 1 includes:
A) the first nucleotide sequence, when its expression when, can inhibit the male gamete containing the nucleotide sequence formation or
Function；
B) the second nucleotide sequence, it includes the nucleotides sequences that will lead to plant pollen infertility or female sterile after mutation
Column, when expressing in sterile plant, it develops the normal pollen for restoring the plant or female organ；
Whether c) third nucleotide sequence can be distinguished in plant when its expression containing the construct introduced.
In the present invention, the first nucleosides being previously mentioned in the method for above-mentioned breeding homozygous recessive core male/Female sterile clone
Acid sequence is detoxification genes silencing, and sequence is as shown in SEQ ID NO.2, and wherein detoxification genes include but is not limited to the site qHMS7
ORF3 gene.First nucleotide sequence with tetranucleotide sequence is operable is connected, the tetranucleotide sequence
Column prefer to express in plant pollen.
In the present invention, the second nucleosides being previously mentioned in the method for above-mentioned breeding homozygous recessive core male/Female sterile clone
Acid sequence is restoring gene, including but not limited to male or the wild type of female sterile gene.Second nucleotide
Sequence with pentanucleotide sequence is operable is connected, the pentanucleotide sequence preference is in male plant or female organ
Middle expression.
In the present invention, the third nucleosides being previously mentioned in the method for above-mentioned breeding homozygous recessive core male/Female sterile clone
Acid sequence is one of the group that the genes such as fluorescence protein gene, glume color are constituted.The wherein third nucleotide sequence and the
Hexanucleotide sequence is operable to be connected, and the Hexanucleotide sequence is END2 or LTP2 etc. in callus/seed or embryo
Specifically expressed promoter in cream.
In the present invention, the second nucleosides being previously mentioned in the method for above-mentioned breeding homozygous recessive core male/Female sterile clone
Acid sequence discloses (patent No.: ZL 2,014 1 0116096.8) in patent of invention to Hexanucleotide sequence.
The present invention also provides a kind of constructs, it is characterised in that the construct includes:
A) the first nucleotide sequence, when its expression when, can inhibit the male gamete containing the nucleotide sequence formation or
Function；
B) the second nucleotide sequence, it includes will lead to plant pollen infertility/female sterile nucleotide sequence after mutation,
When expressing in the first plant, it develops the normal pollen/female organ for restoring the plant；
Whether c) third nucleotide sequence can be distinguished in plant when its expression containing the construct introduced.
In the present invention, the first nucleotides sequence being previously mentioned in above-mentioned construct is classified as detoxification genes silencing, sequence such as SEQ
Shown in ID NO.2, wherein detoxification genes include but is not limited to the ORF3 gene in the site qHMS7.First nucleotide sequence
With tetranucleotide sequence is operable is connected, the tetranucleotide sequence preference in plant pollen in expressing.
In the present invention, the second nucleotides sequence being previously mentioned in above-mentioned construct is classified as restoring gene, including but not
It is limited to the wild type of male or female sterile gene.Second nucleotide sequence and the operable phase of pentanucleotide sequence
Even, the pentanucleotide sequence preference is expressed in male plant or female organ.
In the present invention, the third nucleotides sequence being previously mentioned in above-mentioned construct is classified as fluorescence protein gene, glume color
One of the group that equal genes are constituted.Wherein the third nucleotide sequence with Hexanucleotide sequence is operable is connected, it is described
Hexanucleotide sequence is the specifically expressed promoter in callus/seed or endosperm such as END2 or LTP2.
In the present invention, the second nucleotide sequence being previously mentioned in above-mentioned construct is to Hexanucleotide sequence in invention
Patent disclosure (patent No.: ZL 2,014 1 0116096.8).
The present invention also provides a kind of mechanization producing method for seed using intelligent sterile line, the method includes by recessive core
Plants with female sterility and male sterile plants mixed seeding, to prepare cenospecies.
Compared with prior art, beneficial effects of the present invention is provide new hereditary work for the initiative of intelligent sterile line
Tool.
Detailed description of the invention
The carrier figure of Fig. 1 external source construct pOF3 (intelligent male sterility)/pFS5 (intelligent female sterile)；
Fig. 2 carries the fluorescent seeds of external source construct in Fig. 1 and does not carry the non-fluorescence seed of external source construct and shows as
1:1 separation；
Fig. 3 male sterile line/Female sterile clone propagation method flow chart.
Specific embodiment
Embodiment 1:
Below by specific embodiment, the invention will be further described, but is not so limited the scope of the present invention.It is following
Experimental method used in embodiment is conventional method unless otherwise specified.Material as used in the following examples, reagent
Deng being commercially available unless otherwise specified.
Embodiment 1: designated rna i segment obtains ORF3 gene silencing expression cassette using RNAi technology.
The acquisition of 1.1RNAi segment
The cDNA sequence of ORF3 gene is analyzed using RNAi on-line analysis tool siDirect version 2.0, chooses one
The non-conservative coded sequence of section 20-50bp is as target sequence (CCGTGGAAAAGGGAGTTTCATAT (SEQ ID NO.2)).Root
According to target site sequence, a both ends add KpnI and XhoI restriction enzyme site respectively, and another both ends add PstI and BamHI digestion
Site synthesizes the RNAi segment.Selected target sequence is connected to intermediate vector pB-3Dlinker with forward and reverse
3Dlinker segment both ends.ORF3 gene is obtained with restriction enzyme KpnI and PstI digestion pB3D-RNAi carrier again
RNAi interference carrier segment.
The ORF3 gene RNAi interference fragment of acquisition is connected with pollen specific expression promoter PG47, obtains ORF3
Gene interferes expression cassette.
1.2 building intermediate vectors
(1) PCR system: template: 1 μ l, Buffer:5 μ l, dNTP:4 μ l, H20:40 μ l, forward primer: 5 μ l reversely draw
Object: 5 μ l.PCR program: 95 DEG C of 10min, 55 DEG C of 10min, 14 DEG C of 5min.
(2) digestion connects: endonuclease reaction substrate: 1 μ l, enzyme 1:1 μ l, enzyme 2:1 μ l, buffer:1 μ l add ddH2O to 10 μ
l.Configured system is placed in 37 DEG C of incubator 30min.
(3) linked system: Insert Fragment: 3 μ l, carrier segments: 1 μ l, T4-ligase:0.5 μ l, T4-buffer:1 μ l,
Add ddH2O to 10 μ l.Configured system is placed in 37 DEG C of incubators about 2h or so.
(4) recombinant plasmid transformed
(5) bacterial examination and plasmid extraction verifying
According to this laboratory experience, the intermediate vector of building needs not move through bacterial examination, can directly choose spot and shake bacterium, accuracy rate
Up to 99%, plasmid then is extracted with plasmid extraction kit, respectively send 2 monoclonals the plasmid of extracting, is sequenced.
Embodiment 2: application of the detoxification genes ORF3 silencing in the initiative of intelligent sterile line.
The building of the sterile expression vector of 2.1 intelligence
On expression vector pCAMBIA1300, it is inserted into 3 expression cassettes；ORF3 silencing expression cassette, restoring gene expression
Box, fluorescent screening marker gene expression cassette.ORF3 silencing expression box element include: pollen specific promoter PG47,
ORF3RNAi segment；Wild type fertile gene expression cassette carries the promoter and terminator of itself；Red fluorescent protein gene
Expression box element includes: the end of RP coded sequence on the seed specific promoters END2 of corn, carrier pLj02, potato
Only sub- PIN II (attached drawing 1).The carrier is respectively designated as intelligent male sterility carrier pOF3 and intelligent female sterile carrier
pFS5.Constructed carrier utilizes electrization to import agrobacterium strains EHA105 for rice transformation.
The acquisition of 2.2 transgenic paddy rices
Intelligent male sterility construct pOF3 is transferred to male sterile plants, and intelligent female sterile construct pFS5 is transferred to female
Sterile plant.After callus and Agrobacterium co-culture 2 days, therefrom selects being transferred on Selective agar medium for color cadmium yellow and cultivate one
Week the transformed calli of red fluorescence is had with the screening of body formula fluorescence microscope, observes transformation efficiency, screen the 15th day to hair
The callus of fluorescence carries out first time cutting, and the cell mass to fluoresce is cut into 0.1-0.2mm size, is transferred to new screening
Culture medium screens the 30th day, and second of cutting is divided into the cell mass of independent transformation as far as possible.It screens the 45th day, third time is cut.
Callus after cutting three times is transferred to differential medium in long extremely > 0.2mm on screening and culturing medium, and differentiation seedling grows to 4cm or so
When go to root media root induction, when plantlet it is long to 7-10cm or so when carry out indoor hardening, transplanted after 3~4d
It is grown into soil.
The Molecular Detection of 2.3 transgenic plants
(1) T0 is carried out for transgenic paddy rice and wild type control using plant total RNA extraction reagent box (Tiangeng DP432)
RNA extracting, method refer to kit specification.
(2) detection of expression of the T0 for transgenic paddy rice ORF3 gene
Corresponding cDNA is synthesized by template reverse transcription of total serum IgE.Using Actin as reference gene, WT lines are control,
Semiquantitive PCR detection is carried out to ORF3 with the method for RT-PCR.
ActinF:GAAGATCACTGCCTTGCTCC (SEQ ID NO.3)
ActinR:CGATAACAGCTCCTCTTGGC (SEQ ID NO.4)
ORF3-F:TCGAGTAAAAGGCGACGAGT (SEQ ID NO.5)
ORF3-R:GAAAACCTCATTGCCTCCAA (SEQ ID NO.6)
Using FastKing one-step method except the first chain of genome cDNA synthesis premix reagent (Tiangeng KR118), method reference
Kit specification.
(3) Southern engram analysis
Rice total dna is taken to carry out I digestion of EcoR, electrophoresis, be transferred to nitrocellulose filter Hybond-N.Utilize random primer
Labelling kit (Promega company) and [α -32P] dATP (Beijing Ya Hui company), random priming prepare α -32P label
RFP genetic fragment hybridizes as molecular probe according to the Southern that the molecular cloning methods such as Sambrook carry out transformed plant
Analysis.
The fertility of 2.4 transgenic rice plants is investigated
(1) pollen fertility and solid situation are investigated to the transgenic plant Jing Guo Molecular Identification.Anther when taking away colored, warp
After conventional I2-KI dyeing, its pollen grain situation is observed.
(2) fluorescent seeds of transgenic rice plant separates analysis with non-fluorescence seed
Single copy transgenic rice plant tied T1 obtained to above-described embodiment carries out fluorescence segregation ratio for seed
Investigation, the results showed that these seeds show 1:1 segregation ratio (attached drawing 2), i.e., the fluorescent seeds of foreign gene-carrying and do not carry
The non-fluorescence seed of foreign gene shows as 1:1 separation, shows that each element overall performance of carrier provided by the present invention is good, reaches
To expected purpose.The fluorescent seeds of foreign gene-carrying continues on for male/Female sterile clone breeding (attached drawing 3).
Embodiment 3: the breeding of recessive cell line with genic sterile and cross-breeding technology
The core concept of the technology is: using core recessiveness male/female-sterile mutant as transformation receptor material, by will be tight
Close 3 chain target genes are converted into sterile mutant.Wherein, detoxification genes silencing can make the pollen containing foreign gene
Inactivation, that is, lose fertilizing ability；Restoring gene can make the fertility restorer of transformation receptor；Marker gene can be used for transgenosis
The sorting of seed and non-transgenic seed.The non-transgenic seed sorted out is male/Female sterile clone, and transgenic seed
It is as holding.By keeping being self-fertility, thus breed male/Female sterile clone.During hybrid seeding, female is not
Educating is that pollination male sterile line generates hybrid seed, and Female sterile clone itself cannot be solid, will not generate selfed seed and shadow
Hybrid seed purity is rung, so without removing after pollination.Therefore female and male sterile line mixed seeding can be mentioned in production
Powder is caught up in cross-pollination efficiency (i.e. cross breeding seed efficiency) under high natural conditions, reduction；Without removing paternal plant after pollination,
Labour's investment during the production of hybrid seeds is reduced, the mechanization production of hybrid seeds is conducive to.The propagation method of the male/Female sterile clone is as schemed
Shown in 3.
SEQUENCE LISTING
<110>Hunan Research Centre for Hybrid Rice
<120>a kind of method for formulating intelligent sterile line based on toxicity detoxification genes
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 6546
<212> DNA
<213>artificial synthesized
<400> 1
ctagtgacct cccattgctc caagatccag caccaaaacg agatcgagca agcaagggag 60
attcaaagga acggaatgtg cgcggcacag acctgctgct tcttagcctt cggcggcgcc 120
gtggcggcgg cggcggcggc caccggggcg cccttcctct tccccgcggc ggtggcggcg 180
ccgtcagcct gcgtgttcag agcacgcaca tttcaccccc cacacaaaac atcacatcaa 240
cacacgaggc gcgagacggc gcggggtcta atcttgcgaa gcagcagcaa ctgattgtgc 300
atagatatag cttgtgtgtt aattgcagct cgctaatttc ttccctagtt tcttcgttct 360
ctcccatcaa ttagttgcgt aatgtgattt ctttcttctt cgttctgact tctgaggagc 420
acgcttggta gtttatcaat gaaaacagta gattcctctg tcagttttct caatgcattt 480
gtttgggaag attaacaatt ttttgctgat tatggcatgg aagagattag ctctgcagtt 540
ctgcctggtg ctgaggtcgc acgtctgcgg gattagatat ggccttcgtt cccgatgtgg 600
cccgggttcg cgaaggtggc cgctcgccgg ctacgtcgag gtggaagacg ctggaaattt 660
cttctccgag ttgcccaacg attctgcggt gtggagggcg gccgcgacgt ctgcggctgg 720
ccccgcctcg tgcgtctcgg ctcgcccgtt tcgatcggct gctgctttgc gagattacaa 780
gacgactggt tcctgacatc cacaccggaa tctgagctcg agcccctcta gagcgcagcc 840
cacgccggcg ccggtgacga gcgtgacgag gtggagaaga cgacggaaaa gctggcgttg 900
gggacggacg gacggatcgg cgacggagtg gcacggaata aaggaattcg ctatcgcagt 960
gacaaaatct gaaaggaatg tgtattgagt ggcttgccct gaaaggcctg cgaattggat 1020
gtcaaataat gaaatttctc caattatgtc catccacatg atgcccgttt ctgatgatga 1080
cagaaatccc ccacgcagcc acagcacggc tattccccct aacccccgcc gccgcccaga 1140
tgcgaattct ccgccgcttt ccgcgtctgc tccgacgctc taacgccgcc gcccgatctc 1200
ctgccccgat gcaccgcctc atctcttctc cctctctcat ggcatctgca gcggctagct 1260
ggtgctggtg gtcaccattg cttgctcgag gaggacctgt cgtccgtcgt gtttcccggt 1320
gtgttttctt gtgctgatcg atgctaaagt ctgcgccttt acttggttat tactacagtt 1380
ttggcatgat tttcatagac agattttttg ggcatgtgtt ttttttcctt gttctgatgc 1440
taaagtttgc gtcttttgcc acagtttttg gatctgcgat caactttggg ttttgttttc 1500
ctcgcaaaaa aaaaaaaact ttgggttttg ttttcatttg tttgaaggta gttgtggaaa 1560
ataagtttct ttaaactaat tcgaaacaaa gacaaaggag atcgagaaaa aaaatttaga 1620
aatcgattat cgatttcagg gttagatgat ctcaatcctg actgatggta ccgtcttatt 1680
tattttagtt gttgatattg gtttttcatt ctcttaatta atgatagatt tccttgggaa 1740
cctcggaaca tgaccaccat cagtcgagta aaaggcgacg agtcatacag gcgacttcca 1800
tcccaggaaa agaagcatac tgcgatcact caaggtatga aaaccattga caccaggggc 1860
acaatcttgg aggctagagc tggagatgag aaaagtaata gagatgcggc gtcctcagag 1920
gtttcataca tcaaatacga tgtactgggg caaagtgcga agcaggatgg ctgtgatgag 1980
gatgatcgaa ggagtgaaac ggaggaacat gttgaggagg acgaagttct tgatcctgaa 2040
gaatatactg tgaacaacat acttccaaaa agtagacacc gtgatggctc tatatatagg 2100
gacatcatgg acacaccgtg gaaaagggag tttcatattg cagaccgtaa tgagagtaag 2160
ctatcttttc tctatcttta tttgctatat tattttttat tagagataat ttgtttcctt 2220
gaacataacg aatctctttc catatctata aatattttat tgcgatccta gagatcattg 2280
tatatgtggt gctatgcagc actgccataa ttttacccgc cttacactct tttcagctat 2340
gagataattg tactggaggt ccttaaacgt ggatgagagt aacacttcca ccccaagcct 2400
tgtactttac ttttactggc ccttcagctt agcaccattt gcatacatag caatctgcgc 2460
cacagcctga tgggagggac tgaggttgca tgcagagttc tgatgacatg gactaggacc 2520
ttattccatg ccatttaatt acataaatgt ccaaagtact ttatccctga actttgcaac 2580
acggtgatca cacagccttt gagcatgtat ttcaatagca gaatacacaa gaaaatgaca 2640
actataagtg caaataataa tctaaatatc gcatccacac tgttgtaatt gccattaggt 2700
ttaaattctc catacatgca gccacaaact gtcagtaata gtacaagttt tccaagcatg 2760
cagggagcaa caacaagcaa taatagaaag tactcaggca gttcacatac tatatataac 2820
ctaaaggact actaggtgtt caaggggcca accaaacatt caaatgcccc tgtttaatat 2880
gaggagcggg ttgccagttt ccaaaatata gaccacttcc caaaacacgt ggttttctgt 2940
agaggtaaaa ggctggtaca ggaaagaata tacctggctt tctgaagagg tagtctgccc 3000
ttgagttttt tttttcttgt agttgatact aggatagatg ttgctctcct agtaaaaaga 3060
acataggttg tttctacttt gtagatgaaa aggaaaaaaa aatccaataa ggccatataa 3120
tcatcaaata tcacatgtac ttttcaaatg tcaagtgttt gttcactgta ttaatttccg 3180
gtcacaaact tacattatga ctttactttt tttgaagctc ggttggaggc aatgaggttt 3240
tcgaatccca caaattgtgt cattcgcagt aatggaactt gcatgtcaca tgttcattgc 3300
aacatgctgc aaattttatc attggagttg gctaaaatta cactggatgg tggttcagta 3360
gagttgtatg gatacatagc tgtgcgggat gatctagatc cgttgcttaa ttatattgtc 3420
aactgtagca gggatgatcc catcattgtg gagcaggtac acatccgact tatctagaaa 3480
tatcattgtg tattttgatt tggaaaattc atacttcatg agttttggca aaaatcgtca 3540
aattattggt actcgaatta cttttaagat gttaatttta ttgcaattgg tgatatattg 3600
atagagaaat taaaggtcaa aattctactt ttcaagaatt tctccttcca aaacgcacct 3660
tacataggga gtgtactcta tattatgaaa tgatgattta ctatgagaac aggtttaaat 3720
tatgaaacta aggaacacat gtattccaaa gaaaaatcat gttaaatagt tttggacact 3780
ttgttgttgc ttagtaccct acataatttt tttttctttt gtttgataca tgatgaagat 3840
cttggtagtt gtaaaaagag taaaatacac caccggtcct taaagttgga gcgtggtgtc 3900
acttaggtcc atgatcttgt aaaatcgata ttaaggtcca tgaacttgtt taagtgaatc 3960
atagcagtac aaaacacgtc tgactgggtt gaccgtccta cgtggcagtc cagcgtggct 4020
ccatatttgc aattaggccc tccacgcccg atccacggcc ttcacggtgt cggagatgtg 4080
gttcttgccg atgaccgacg taacggcctc ccgcacctta gcgagcacct atgcgagtgc 4140
ctcccggatc ttcatcatcg tttcgcccgg caccgctgcc gccaccgccg gcacgcgctg 4200
tgccacgacc tccttccgcc actgcactat gccgaagatc gcctcgctga gcacgcggtc 4260
ctcatcgccc cgacggagca tgtcggcgat ttagccggtg accgtcgccc ccttgtcctg 4320
ttgctgcccg gtcgctggct cgccggaggc aagggtggtg gaggcgtccg agtcctgcgc 4380
ggtaccctgt gactatgagg tgccgctgat gcctgagatc acggtgccag cggactgcgt 4440
cacttgctgc accttgccag ccacgagtcc acgacggtcc cgactccggc gaccttctcg 4500
tacattgtgg tggctagctt cttgctgtac tctccgtggt gcatgtcgct gccaacttga 4560
tcttgtcggt gtacgtcacg ccggacacga caggcggcag cgctgccttc aggcattgtg 4620
tacgtggccg catccttcca ctcgaaagag tcgacgacag gcgtcgtgcc gatgtcctcg 4680
ccttcccgca gcacacgcat cgtggagtgt ggtgccgccg agacgtccaa gacggggccg 4740
ccgaggtcac cgagccgaca ccttgacacg ttgcgccgtc gccctccact gctccatctc 4800
ctgcaccgct agggtccttg ccatgtcaaa cctgacaccg tcagcggcgg cacacgcaaa 4860
caaccaaaaa agtttcaaat ctaacaccgt cagcggcggc acatgcaaag ctagagatca 4920
acggagcaag agcttactcg gcgcgatatg aacctcagga tcggaatcca tggcgatggt 4980
tttgtcctcg atgtcctctt ggtacctgcg ctagtccaca tcacccatcc tctgcgccgc 5040
cacatcgcgt tcatcctcct cgctgctgtt gctgttgttg ctcacgccag cgcggtcgcc 5100
gctgtttctc cctgccacct ccgccgtcat tgttcccgct gtggtcgccg ccggcgatgg 5160
tgttcttgag caccggcttg tgttgcttct ccttccccag tgcatctgcc cctgtccccc 5220
ctccgccgct gctgctgcaa caaacaccca ccgaaggcgg caacggcgcc gggcaacatg 5280
atggcgaagg tcgggaggcg ctcacgcagg tgctcaccaa ggcgcgggag gccgtcatgt 5340
cgctcatcgg caagaaccgc gtctccaaca ccatgaaggc tgtggatcgg gcgtggaggg 5400
gcctaattgc aaacatgtag ccacgctaga ctgccacgta ggacggtcaa cccggtcaga 5460
cgtgtttttg gactgcaatg attcacttaa acaagttcat ggatcttaat gttgatttta 5520
caagatcgtg gacctaagtg acaccacgct ccaactttaa ggacctttca agtaaatgct 5580
gttacaagtg aaacaacata aggaagcatc cacctttaga tatttcttac ttttataaga 5640
agagcaacta aatataataa ttttgtaggg ttcgctcatc aacatggaag gccctaaccg 5700
aggaatagac atgatggact atgctctaat tgaatatgac atgaggatca agacaggtga 5760
acaagaaaaa gatgacctac agctgattga tggtgcatca atgataggct ctggaggcct 5820
atggaatcgg ccagaaacaa tttgcattcc tggcgattac ggtgcagttg acataacttt 5880
atcacgtttt aattgttcag ctgaggccac cgtagagatt cttatatcag aagtgcaaag 5940
cagtttcaat ttgttgctcg gttgtttaac cagtgacttg gataaggaaa tccgtctctt 6000
tgatggtgtc atcagtgagt cacgtgattt aaagaggtcg gtggttgctg taacgaggga 6060
ttctttcata gatttgaagt tcgaagtggg cgcgtttcca tccagtttcg accagcatta 6120
tgtttccttc aaggagaaaa tccatggcta tgatactcaa gaaataaaga ctgattttgc 6180
gttaatctca gtaaaggtga cttggtcagc tttgctttct ggacgagtga tacctctgtt 6240
tctgtaacag agtgggccat gcaacatcac atttacacac ccatgaatat ggccctaaca 6300
cacgctcaaa gagataaaaa tcaacggcac atctttgatc tcactagatc tataatgtta 6360
actttattat acttattatt tagaatgtat atttcgcata tgaaattatg tatccaagtt 6420
tattacagca aatgcttgaa taacggcatt gcacttacct aacctatttt cagacttatg 6480
agggagaatc tagcgttcaa atttgtgtct tgtggacttt gaatagtcaa aatcgatctt 6540
ctttta 6546
<210> 2
<211> 23
<212> DNA
<213>artificial synthesized
<400> 2
ccgtggaaaa gggagtttca tat 23
<210> 3
<211> 20
<212> DNA
<213>artificial synthesized
<400> 3
gaagatcact gccttgctcc 20
<210> 4
<211> 20
<212> DNA
<213>artificial synthesized
<400> 4
cgataacagc tcctcttggc 20
<210> 5
<211> 20
<212> DNA
<213>artificial synthesized
<400> 5
tcgagtaaaa ggcgacgagt 20
<210> 6
<211> 20
<212> DNA
<213>artificial synthesized
<400> 6
gaaaacctca ttgcctccaa 20
Claims (9)
1. a kind of method based on toxicity detoxification genes initiative crop intelligence sterile line, which is characterized in that the method includes such as
Lower step: make detoxification genes silencing using genetic engineering means；By detoxification genes silencing expression cassette, restoring gene expression cassette
With riddled basins expression cassette 3 chain expression cassette carrier constructions, crop recessive karyon is transferred to by transgenic technology
Male or Female sterile clone, obtain intelligence male or Female sterile clone, applied to crop male or female infertility breeding and
The mechanization production of hybrid seeds of crop hybrid kind.
2. the method as described in claim 1, which is characterized in that the detoxification genes include but is not limited to the site qHMS7
ORF3 gene, the detoxification genes sequence is as shown in SEQ ID NO.1.
3. the method as described in claim 1, which is characterized in that the restoring gene includes but is not limited to wild type male
Infertility or female sterile gene.
4. the method as described in claim 1, which is characterized in that the riddled basins include but is not limited to fluorescent marker base
Cause or glume color gene.
5. the method as described in claim 1, which is characterized in that gene silencing methods include but is not limited to antisense technology, RNA dry
It disturbs.
6. the method as described in claim 1, which is characterized in that described to be applied to crop male or the breeding of female infertility
Breeding for crop recessive karyon male or Female sterile clone.
7. the method as described in claim 1, which is characterized in that the mechanization production of hybrid seeds applied to crop hybrid kind is to be used for
Utilize the mechanization production of hybrid seeds of the crop hybrid kind of female sterile.
8. the method as described in claim 1, which is characterized in that the crop is monocot crops or dicotyledonous crops.
9. method according to claim 8, which is characterized in that the monocot crops or dicotyledonous crops be rice, corn,
Rape, millet, wheat, capsicum.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810939510.3A CN109112158B (en) | 2018-08-17 | 2018-08-17 | Method for creating intelligent sterile line based on toxic detoxification genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810939510.3A CN109112158B (en) | 2018-08-17 | 2018-08-17 | Method for creating intelligent sterile line based on toxic detoxification genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109112158A true CN109112158A (en) | 2019-01-01 |
| CN109112158B CN109112158B (en) | 2022-08-09 |
Family
ID=64852347
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810939510.3A Active CN109112158B (en) | 2018-08-17 | 2018-08-17 | Method for creating intelligent sterile line based on toxic detoxification genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109112158B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110331161A (en) * | 2019-07-31 | 2019-10-15 | 湖南杂交水稻研究中心 | The method for improving rice genetic engineering line with genic sterile seed precision of color separation using dominant black glume character |
| CN113615567A (en) * | 2020-05-07 | 2021-11-09 | 海南波莲水稻基因科技有限公司 | Seed production carrier for crop genetic intelligent breeding |
| CN113621642A (en) * | 2020-05-07 | 2021-11-09 | 海南波莲水稻基因科技有限公司 | Genetic intelligent breeding system for crop cross breeding seed production and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834684A (en) * | 2013-03-29 | 2014-06-04 | 湖南杂交水稻研究中心 | Method for mechanically producing seed by using female sterile hybrid rice |
| CN104082128A (en) * | 2014-07-25 | 2014-10-08 | 湖南杂交水稻研究中心 | Reproductive method of intelligent rice sterile line |
| CN104206268A (en) * | 2014-09-09 | 2014-12-17 | 扬州大学 | Novel method for sensitively cultivating efficient rice intelligent sterile line by using herbicides |
| CN105039316A (en) * | 2015-06-04 | 2015-11-11 | 北京首佳利华科技有限公司 | Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene |
| WO2016048909A1 (en) * | 2014-09-22 | 2016-03-31 | Pioneer Hi-Bred International, Inc. | Methods for reproducing plants asexually and compositions thereof |
| CN107667853A (en) * | 2017-06-07 | 2018-02-09 | 湖南杂交水稻研究中心 | The method for creating of the common line with genic sterile of rice and application |
-
2018
- 2018-08-17 CN CN201810939510.3A patent/CN109112158B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834684A (en) * | 2013-03-29 | 2014-06-04 | 湖南杂交水稻研究中心 | Method for mechanically producing seed by using female sterile hybrid rice |
| CN104082128A (en) * | 2014-07-25 | 2014-10-08 | 湖南杂交水稻研究中心 | Reproductive method of intelligent rice sterile line |
| CN104206268A (en) * | 2014-09-09 | 2014-12-17 | 扬州大学 | Novel method for sensitively cultivating efficient rice intelligent sterile line by using herbicides |
| WO2016048909A1 (en) * | 2014-09-22 | 2016-03-31 | Pioneer Hi-Bred International, Inc. | Methods for reproducing plants asexually and compositions thereof |
| CN105039316A (en) * | 2015-06-04 | 2015-11-11 | 北京首佳利华科技有限公司 | Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene |
| CN107667853A (en) * | 2017-06-07 | 2018-02-09 | 湖南杂交水稻研究中心 | The method for creating of the common line with genic sterile of rice and application |
Non-Patent Citations (2)
| Title |
|---|
| XIAOWEN YU 等: "A selfish genetic element confers non-Mendelian inheritance in rice", 《SCIENCE》 * |
| 胡骏 等: "红莲型细胞质雄性不育的发现利用研究及展望 ", 《科学通报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110331161A (en) * | 2019-07-31 | 2019-10-15 | 湖南杂交水稻研究中心 | The method for improving rice genetic engineering line with genic sterile seed precision of color separation using dominant black glume character |
| CN110331161B (en) * | 2019-07-31 | 2021-04-02 | 湖南杂交水稻研究中心 | Method for improving color selection precision of rice genetic engineering genic male sterile line seeds by utilizing dominant black glume characters |
| CN113615567A (en) * | 2020-05-07 | 2021-11-09 | 海南波莲水稻基因科技有限公司 | Seed production carrier for crop genetic intelligent breeding |
| CN113621642A (en) * | 2020-05-07 | 2021-11-09 | 海南波莲水稻基因科技有限公司 | Genetic intelligent breeding system for crop cross breeding seed production and application thereof |
| WO2021223725A1 (en) * | 2020-05-07 | 2021-11-11 | 海南波莲水稻基因科技有限公司 | Vector for intelligent genetic breeding and seed production of crop |
| WO2021223727A1 (en) * | 2020-05-07 | 2021-11-11 | 海南波莲水稻基因科技有限公司 | Intelligent genetic breeding and seed production system for crop cross breeding and hybrid seed production, and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109112158B (en) | 2022-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105602952B (en) | A kind of fertile gene and its application | |
| KR20170098953A (en) | How to perform site-specific mutations in whole plants through transient gene expression | |
| CN102634522B (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| AU2019460919B2 (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method therefor | |
| CN105518141A (en) | Use of genic male sterility gene and mutation thereof in hybridization | |
| CN109112158A (en) | A method of intelligent sterile line is formulated based on toxicity detoxification genes | |
| CN113913454B (en) | Artificial gene editing system for rice | |
| CN109234310A (en) | It is quickly obtained the recombinant vector and application method of no transgene gene editor plant | |
| Bao et al. | CRISPR/Cas9-based gene editing in soybean | |
| CN101037695B (en) | Control gene of paddy pollen fertility and application | |
| CN114854768A (en) | Duck grass vernalization gene DgPAPS4 and application thereof | |
| CN101892246B (en) | Clone and application of pleiotropic gene Ghd8 for controlling yield, florescence and plant height of rice grain | |
| CN112126707B (en) | Nucleic acid molecules from corn event CA09328 and methods for detecting same | |
| CN104004775B (en) | One sterility changing gene and its application | |
| CN109837295A (en) | A kind of the rice haploid inducing line and its method for creating of gene editing initiative and application | |
| CN107227303A (en) | A kind of application of OsGA3ox1 genes in rice male-sterile plants system formulates | |
| CN115851823B (en) | Cymbidium CgARF18 gene and application thereof | |
| Tang et al. | A fast technique for visual screening of wheat haploids generated from TaMTL-edited mutants carrying anthocyanin markers | |
| CN110402814A (en) | A kind of tomato recessive nucleus male sterility keeps the selection of system | |
| CN112680460B (en) | Male sterile gene ZmTGA9 and application thereof in creating male sterile line of corn | |
| CN112239762B (en) | Plant pollen tube growth gene and application | |
| CN115927363B (en) | Cymbidium CgARF8 gene and application thereof | |
| CN116875580B (en) | Artificial mutation for creating maize msp1 male sterile line | |
| CN117247967B (en) | Male sterile gene ZmPKSA and application thereof in creating maize male sterile line | |
| CN113322266B (en) | Application of rice OsRHD1-1 gene in rice male sterile line cultivation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |