CN110331161A - The method for improving rice genetic engineering line with genic sterile seed precision of color separation using dominant black glume character - Google Patents
The method for improving rice genetic engineering line with genic sterile seed precision of color separation using dominant black glume character Download PDFInfo
- Publication number
- CN110331161A CN110331161A CN201910699895.5A CN201910699895A CN110331161A CN 110331161 A CN110331161 A CN 110331161A CN 201910699895 A CN201910699895 A CN 201910699895A CN 110331161 A CN110331161 A CN 110331161A
- Authority
- CN
- China
- Prior art keywords
- genetic engineering
- gene
- seed
- black
- double
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of method for improving rice genetic engineering line with genic sterile seed precision of color separation using dominant black glume character, specifically: cultivate that yellow grain husk is double-colored to select genetic engineering line with genic sterile；Channel genes to yellow grain husk double-colored select of four dominant black glume gene, restoring gene, pollen inactivated gene and fluorescent marker gene chain expression is cultivated that black grain husk is double-colored to select genetic engineering line of breeding in genetic engineering line with genic sterile genome；Black grain husk is double-colored to select genetic engineering line of breeding and Huang Ying is double-colored selects genetic engineering line with genic sterile mixed planting, mixed to receive portion's seed；First time screening is carried out according to seed of the glume color to mixed receipts, separates yellow clever male-sterile seed and black clever seed；Whether fluoresced according to endosperm and carry out programmed screening, purifies yellow clever male-sterile seed.The present invention improves purity of the genetic engineering line with genic sterile seed in assorting room using the dominant black glume of rice as new color sorting label, realizes that genetic engineering line with genic sterile purity reaches the target of production application standard.
Description
Technical field
The present invention relates to technical field of rice gene engineering more particularly to a kind of dominant black glume character of utilization to improve water
The method of rice genetic engineering line with genic sterile seed precision of color separation.
Background technique
The breeding and sorting of genetic engineering line with genic sterile are the core technologies of third generation hybrid rice, have realized heredity
The batch breeding of engineering male-sterile seed and endosperm fluorescence sorting technology (referring to patent ZL201210426678.7), for hereditary work
The industrialization of journey line with genic sterile is laid a good foundation.However, in the process using existing fluorescence sorting technology separation male-sterile seed
In, since paddy endosperm is wrapped up by glume, reduce fluorescin from endosperm toward glume outside distribute the intensity of fluorescence, disturb color
The precision of color separation for selecting machine, the genetic engineering sterile line sub-elected often contain the line of breeding that several grains have transgene component
Seed.Since the current public is very sensitive to transgenosis, country does not decontrol the limitation to transgenic product yet, if in production of hybrid seeds ring
The line of breeding seed of several carry genetic modification ingredients is mixed into section male-sterile seed, it will cause in the hybrid seed produced
Seed containing a small number of carry genetic modification ingredients, to seriously hinder the promotion and application of third generation hybrid rice.
The normal glume color of rice is yellow, and the glume that black, brown or red etc. are different from yellow is then referred to as different
Color glume.In order to improve precision of color separation, realize that genetic engineering sterile line purity reaches the standard of production application, the present invention intends
Have on the basis of endosperm fluorescin color selection method of genetic engineering line with genic sterile seed, it is dominant using more intuitive rice
Black glume character is marked as the second color sorting, and building the double-colored of genetic engineering line with genic sterile selects separation system, passes through husk
Different colours and endosperm both color sorting characters that whether fluoresce establish two sets of color sorting programs, thoroughly solve existing genetic engineering core
Male-sterile seed is in the technical problem inadequate using precision of color separation in fluorescence assorting room.
Summary of the invention
The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art, provide a kind of utilization dominant black glume
The method that shape improves rice genetic engineering line with genic sterile seed precision of color separation, using the dominant black glume of rice as new color sorting
Label improves purity of the genetic engineering line with genic sterile seed in assorting room, realizes that genetic engineering line with genic sterile purity reaches raw
Produce the target for the standard of applying.The glume color of the genetic engineering male-sterile seed obtained using this method is different from normal rice
Yellow can be used in the mechanization production of hybrid seeds.
In order to solve the above technical problems, technical solution proposed by the present invention are as follows:
A method of rice genetic engineering line with genic sterile seed precision of color separation, packet are improved using dominant black glume character
Include following steps:
S1, cultivate that yellow grain husk is double-colored to select genetic engineering line with genic sterile；
S2, by four comprising dominant black glume gene, restoring gene, pollen inactivated gene and fluorescent marker gene
First chain vector is directed into the yellow double-colored genome for selecting genetic engineering line with genic sterile of grain husk and cultivates the hereditary work of the double-colored choosing of black grain husk
Journey line of breeding；
S3, select in genetic engineering line of breeding and the S1 that yellow grain husk is double-colored to select genetic engineering core not for grain husk black in the S2 is double-colored
Educating is mixed planting, and the black double-colored pollen for selecting genetic engineering line of breeding of grain husk is rushed to the yellow clever genetic engineering Genetic Sterility by florescence
It is to mix on plant and receive portion's seed；
S4, first time screening, separating yellow glume kind are carried out to the whole seeds received are mixed in the S3 according to glume color
Son and black glume seed；The yellow glume seed is the yellow double-colored offspring for selecting genetic engineering line with genic sterile plant of grain husk；
The black glume seed is the black double-colored offspring for selecting genetic engineering line of breeding plant of grain husk；
S5, programmed screening is carried out to the yellow glume seed separated in the S4 according to whether endosperm fluoresces,
The mixed line of breeding seed to fluoresce on a small quantity is screened, the yellow grain husk of purification is double-colored to select genetic engineering line with genic sterile seed.
In above-mentioned S4, the yellow glume seed is the offspring of former yellow clever sterile line plant, all not fluorescent Huangs
Clever male-sterile seed；Black glume seed is the offspring of former black clever line of breeding plant, and half is not fluorescent male-sterile seed,
Half is the line of breeding seed to fluoresce.
The above method, further, the grain husk of Huang described in the S1 is double-colored to select genetic engineering line with genic sterile using editor's rice
Wild type Recessive male sterility gene obtains.
The above method, further, the grain husk of Huang described in the S1 is double-colored to select genetic engineering line with genic sterile to pass through Backcrossing methods
The Recessive Male sterility for importing mutation obtains.
The above method, further, the double-colored breeding method for selecting genetic engineering line with genic sterile of the grain husk of Huang described in the S1 are as follows:
S1-A1, target site adapter-primer 1 is designed according to the cDNA sequence of PTC1 gene；
S1-A2, the target site adapter-primer 1 is made to the double-stranded adapters PTC1-T1 with cohesive end；
S1-A3, it connect the double-stranded adapters PTC1-T1 to obtain pU3-PTC1-T1-gRNA recombinant vector with carrier；
S1-A4, it the pU3-PTC1-T1-gRNA recombinant vector is connected to pCRISPR/Cas9 carrier obtains pCas9-
PTC1-T1 knockout carrier；
S1-A5, by the pCas9-PTC1-T1 knockout carrier import yellow glume rice callus in, transformation at
Huang Ying is double-colored to select genetic engineering line with genic sterile.
The above method, further, in the S1-A1, the target site adapter-primer 1 includes Seq2 and Seq 3, described
The DNA sequence dna of Seq2 is as shown in SEQ ID NO.2；The DNA sequence dna of the Seq 3 is as shown in SEQ ID NO.3.
The above method, further, the S2 specifically: lose dominant black glume gene, restoring gene, pollen
Gene and fluorescent marker gene living are building up in same plant expression vector and obtain quaternary chain vector, by the chain load of the quaternary
Body imported into the double-colored genome for selecting genetic engineering line with genic sterile of Huang Ying and obtains transgenic plant, from the transgenic plant
Select glume color for the strain that in black and progeny seed 50% is fluorescent seeds, as black grain husk is double-colored to select genetic engineering to breed
System.
The above method, further, the S2 specifically:
S2-1, design expand dominant black glume gene, restoring gene, pollen inactivated gene and fluorescent marker gene
Primer, carry out PCR amplification obtain genetic fragment；
S2-2, it the genetic fragment of four genes is building up in same plant expression vector obtains the chain load of quaternary
Body；
S2-3, the quaternary chain vector is imported into the yellow double-colored genome for selecting genetic engineering line with genic sterile of grain husk
Obtain transgenic plant；
It S2-4, from glume color is selected in the transgenic plant in black and progeny seed 50% is fluorescent seeds
Strain, as black grain husk is double-colored to select genetic engineering line of breeding.
The above method, further, the dominant black glume gene are Bh4；
The restoring gene is PTC1, EAT1, TDR or CYP704B2；
The pollen inactivated gene is ZMAA；
The fluorescent marker gene is DsRed.
The genomic dna sequence and cDNA sequence of described Bh4, PTC1, EAT1, TDR and CYP704B2 can be from " national rice
Data center " downloading obtain, corresponding accession number be respectively Os04g0460000, Os09g0449000, Os04g0599300,
Os02g0120500 and Os03g0168600.
The above method, further, the dominant black glume gene are Bh4, and the primer for expanding the Bh4 gene is
The DNA sequence dna of Bh4-F and Bh4-R, the Bh4-F are as shown in SEQ ID NO.7；The DNA sequence dna of the Bh4-R such as SEQ ID
Shown in NO.8；
The restoring gene is PTC1 gene, and the primer for expanding the PTC1 gene is PTC1-F and PTC1-R, institute
The DNA sequence dna of PTC1-F is stated as shown in SEQ ID NO.10；The DNA sequence dna of the PTC1-R is as shown in SEQ ID NO.11；
The primer for expanding the ZMAA gene is ZMAA-F and ZMAA-R, the DNA sequence dna of the ZMAA-F such as SEQ ID
Shown in NO.15；The DNA sequence dna of the ZMAA-R is as shown in SEQ ID NO.16；
The primer for expanding the DsRed gene is DsRed-F and DsRed-R, the DNA sequence dna of the DsRed-F such as SEQ
Shown in ID NO.20；The DNA sequence dna of the DsRed-R is as shown in SEQ ID NO.21.
The above method, further, the black clever genetic engineering line of breeding seed obtained in the S4 are sieved through second of fluorescence
Choosing, the black clever seed development to fluoresce are selected genetic engineering line of breeding at being that the black grain husk is double-colored after plant, can be continued on for next
The double-colored breeding for selecting genetic engineering line with genic sterile seed of Dai Huangying；Not fluorescent black clever seed development is at glume color after plant
It is changed into yellow, can continues on for breeding that next-generation Huang Ying is double-colored to select genetic engineering line with genic sterile kind with black clever line of breeding mixed planting
Son.
The above method, further, the clever genetic engineering line with genic sterile of Huang through second of fluorescent screening purification in the S5
Seed and restorer carry out hybrid seeding.
Compared with prior art, the method have the benefit that:
(1) rice genetic engineering line with genic sterile seed color is improved using dominant black glume character the present invention provides a kind of
The method for selecting precision utilizes on the basis of the endosperm fluorescin color selection method of existing genetic engineering line with genic sterile seed
More intuitive dominant black glume character is the second color sorting label, and building the double-colored of genetic engineering line with genic sterile selects chorista
System establishes two sets of color sorting programs by endosperm both the color sorting characters with the different colours of husk that whether fluoresce, thoroughly solves
Existing genetic engineering line with genic sterile seed is in the technical problem inadequate using precision of color separation in fluorescence assorting room.Using simply may be used
The dominant black glume character sorting genetic engineering line with genic sterile seed of control is more intuitive and thorough, can significantly improve male-sterile seed
Purity makes bred male-sterile seed be free of the genetic engineering line of breeding seed of carry genetic modification ingredient.
(2) rice genetic engineering line with genic sterile seed color is improved using dominant black glume character the present invention provides a kind of
The method for selecting precision, glume color of the black glume genetic engineering line of breeding plant at heading stage just show black, Ke Yizuo
The purity of genetic engineering line with genic sterile and the purity of made hybrid seed are further ensured that for sterile line impurity elimination index.
Detailed description of the invention
In order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below in conjunction with the embodiment of the present invention
In attached drawing, the technical scheme in the embodiment of the invention is clearly and completely described.
Fig. 1 is to improve genetic engineering line with genic sterile seed purity using dominant black glume character in the embodiment of the present invention 1
Techniqueflow chart.
Fig. 2 is the structure chart of pCas9-PTC1-T1 knockout carrier in the embodiment of the present invention 1.
Fig. 3 is the structure chart of four genophores of pBDPZ in the embodiment of the present invention 1.
Fig. 4 is the double-colored outside drawing a for selecting genetic engineering line of breeding seed in the embodiment of the present invention 1: black grain husk genetic engineering is numerous
Growing is seed；B: black grain husk genetic engineering line of breeding seed endosperm sends out red fluorescence.
Specific embodiment
Below in conjunction with Figure of description and specific preferred embodiment, the invention will be further described, but not therefore and
It limits the scope of the invention.
Material employed in following embodiment and instrument are commercially available.
Embodiment 1:
A method of rice genetic engineering line with genic sterile seed precision of color separation being improved using dominant black glume character,
Process referring to Fig. 1, specifically includes the following steps:
(1) the double-colored cultivation for selecting genetic engineering line with genic sterile of Huang grain husk of PTC1 gene mutation:
1.1, rice PTC1 gene encodes PHD zinc finger protein, is the key gene for regulating and controlling tapetal development and pollen formation.
PTC1 gene mutates, and will lead to paddy pollen abortion, generates a kind of genetic engineering line with genic sterile.According to PTC1 gene
CDNA sequence (Seq1) designs double target sites and synthesizes target site adapter-primer Seq2 and Seq3.
Seq1 (SEQ ID NO.1):
cgttgattggcagcaactagctagctcgccgtccggccggccggccatggcgcctaagatggtgatca
gcctggggagctcgcggcggcggaagcgcggcgagatgctgttccggttcgaggccttctgccagcccggctaccc
ggcgaacttcgccggcgccggcggcttcagggacaacgtgaggacgctgctcggcttcgcgcacctggaggccggc
gtccacggcgagaccaagtgctggtcgttccagctcgagctgcaccgccacccccccaccgtcgtgaggctcttcg
tcgtcgaggaggaggtcgccgcctcgccgcaccgccagtgccacctctgccgccatattgggtgggggaggcatct
gatatgcagcaagaggtatcacttcttgctgccgaggagggaatcggcggcggaagccgacggcctgtgcttcgcg
atcaaccacggcggcggcggtggcgcggagaaagcgtcgtcgaaagggacgacgacgacggcctccagcagaggcc
acctgctacacggcgtcgtgcacctcaacggctacggccacctcgtcgccctccacggcctcgagggcggctccga
cttcgtctccggccaccagatcatggacctctgggaccgcatttgctcagccttgcacgtaaggacggtgagcctg
gtggacacggcgaggaagggccacatggagctgaggctgctgcacggcgtcgcgtacggcgagacgtggttcgggc
ggtgggggtacaggtacggccggccgagctacggcgtcgcgctgccgtcgtaccggcagtcgctgcacgtgctcgg
ctccatgccgctctgcgtgctggtgccgcacctgtcgtgcttcagccaggagctccccatggtggtcaccaagtac
caggccatcagcggccacaagctgctcagcctcggcgacctcctccgcttcatgctcgagctgcgcgcccgcctgc
cggccacctccgtcacggccatggactaccggggcatcatgtcggaggcctcgtgccggtggtcggcgaagcgcgt
cgacatggcggcgcgcgccgtcgtggacgcgctccgccgcgccgagccggcggcgcggtgggtcacgcggcaggag
gtgcgcgacgcggcgcgcgcctacatcggcgacacgggcctcctcgacttcgtgctcaagtccctcggcaaccaca
tcgtcggcaactacgtcgtgcgccgcaccatgaacccggtgaccaaggtgctcgagtactgcctcgaggacgtctc
cagcgtgctcccggcggtcgccgccggcggcggcgtgccggcgcagggcaagatgagggtgaggttccagctcacg
cgtgcgcagctcatgagggacctggtgcacctgtaccggcacgtgctcaaggagcccagccaggcgctcaccggcg
gcgcgttcggcgcgatcccggtggcggtgcggatggtcctggacatcaagcacttcgtcaaagattaccacgaagg
acaagccgcggcgagcagcaatggcggtggcggattcgggcatccccacatcaacctgtgctgcacgctgctcgtg
agcaacgggagcccggagctagctccaccgtacgagacggtgaccctgccggcgcacgcgacggtgggcgagctga
agtgggaggcgcagagggtgttcagcgagatgtacctcggcctgaggagcttcgcggcggactccgtcgtcggggt
cggcgccgaccaggagggcctcccggtgctcgggctggtcgacgtcggaagcgccgtcgtggtgcaagggagcgtg
ggcgagcagataaacggggaggaccacgagaggaaggaggaggcggcggcggcggccgtgtgcgaggggagcggcg
gcggcgagcgcgtcgtggactgcgcgtgcggcgcggtggacgacgacggcgagcgcatggcgtgctgcgacatctg
cgaggcgtggcagcacacgcggtgcgccgggatcgcggacaccgaggacgcgccgcacgtcttcctctgcagccgg
tgcgacaacgacgtcgtgtcgttcccgtccttcaactgttagatgtgatgctgctgctgctactgctactactact
gcctctgctgctatatatgatgctacctagtacaagtgatcgagaattcaatttgttttctcggcaaaaccaaaat
gaaaacgaaggtaaaaccaagtgaacttcagatcaa。
Seq2(SEQ ID NO.2):ggcacatggtggtcaccaagtacc。
Seq3(SEQ ID NO.3):aaacggtacttggtgaccaccatg。
1.2, CRISPR/Cas9-PTC1 knockout carrier is constructed:
After two 3 mixed in equal amounts of nucleotide single-chain Seq2 and Seq of complementary pairing in step 1.1, it is denaturalized by 90 DEG C
The double-stranded adapters PTC1-T1 with cohesive end is formed after 3min and 20 DEG C of annealing 5min.With BsaI digestion ring-type pU6a-gRNA
Then carrier is connect with double-stranded adapters PTC1-T1, expression cassette among the guide-RNA recombinated: pU3-PTC1-T1-gRNA
Recombinant vector.By pU3-PTC1-T1-gRNA recombinant vector after BsaI digestion, it is connected on pCRISPR/Cas9 carrier and constructs
At pCas9-PTC1-T1 knockout carrier.The structure chart of pCas9-PTC1-T1 knockout carrier is as shown in Figure 2.
1.3, pCas9-PTC1-T1 knockout carrier is converted to the callus of the yellow fertile rice of grain husk using the method for mediated by agriculture bacillus
Tissue, and 37 plants of T0 are obtained for transgenic plant (agrobcterium-mediated transformation reference Hiei by the differentiation of callus
Deng the method for (1997)).37 plants of T0 are extracted for the DNA of transgenic plant, hygromycin gene is detected through PCR, obtains 17 plants and turn base
Because of positive plant.
1.4, according to Position Design mutational site the detection primer Seq4 and Seq5 of PTC1 gene target site), with 17 plants of sun
Property strain DNA be template, using Seq4 and Seq5 be primer progress PCR amplification.
Seq4(SEQ ID NO.4):cctccgacatgatgccccggtagtccat。
Seq5(SEQ ID NO.5):gagctccccatggtggtcaccaagtaccag。
Amplification system includes: 10 μ l PCR Mix, each 0.2 μ l of forward and reverse primer, 1 μ l of DNA profiling, supplements 8.6 μ l
ddH2O to 20 μ l of total volume.
Amplification program:
1. 98 DEG C of initial denaturation 3min；
2. 30 circulations (98 DEG C of 10s, 65 DEG C of 30s, 72 DEG C of 30s)；
3. finally extending 72 DEG C of 1min；
4. 4 DEG C of preservations.
Sequencing company is sent to be sequenced pcr amplification product again.Sequencing result shows in 17 positive plants have 12 strains to be
Homozygous mutation and cannot be normal solid, selects genetic engineering line with genic sterile for required yellow grain husk is double-colored.
(2) the double-colored initiative for selecting genetic engineering line of breeding of black grain husk:
2.1, rice Bh4 is dominant gene, encodes an amino acid transporter, mainly expresses in glume, recessive
Allele bh4 is due to, there are the forfeiture that the missing of a 22bp leads to function, causing the husk of paddy rice color on the 3rd exon
Yellow is become from black, transgenic experiments show that Bh4 can make the yellow husk color transition black of rice.Design primer point
Not Kuo Zeng Bh4 gene expression frame, restoring gene PTC1 expression cassette, pollen inactivated gene ZMAA expression cassette (Pg47 promoter,
ZMAA gene cDNA sequence, IN2-1 terminator) and fluorescent marker gene DsRed expression cassette (ltp promoter, DsRed gene
CDNA sequence, PINII terminator).
Bh4 gene expression frame (SEQ ID NO.6), source rice.
Expand the primer pair of Bh4 gene:
Bh4-F (SEQ ID NO.7): gcgaaacttgacaaatgatagtgtgatcgctttctgttct；
Bh4-R (SEQ ID NO.8): caccgccattgcaggaagcatatcactagcatct.
PTC1 gene expression frame (SEQ ID NO.9), source rice.
Expand the primer pair of PTC1 gene:
PTC1-F (SEQ ID NO.10): gtcatgcattcagccgtcagaaaggctcaga；
PTC1-R (SEQ ID NO.11): gcatgtggactgtggaggtggccagtaatt.
Pg47 promoter (SEQ ID NO.12), source corn.
ZMAA gene cDNA sequence (SEQ ID NO.13), source corn.
IN2-1 terminator (SEQ ID NO.14), source corn.
Expand the primer pair of ZMAA gene:
ZM AA-F (SEQ ID NO.15): ggcataccagacagtccggtgtgccagatca；
ZMAA-R (SEQ ID NO.16): ggagatataggggaaagagaacgctgatgtgacaagtgagt.
Ltp promoter sequence (SEQ ID NO.17), source barley.
DsRed gene cDNA sequence (SEQ ID NO.18).
PINII terminator (SEQ ID NO.19), source potato.
Expand the primer pair of DsRed gene:
DsRed-F (SEQ ID NO.20): aaaccgtctcttcgtgagaataaccgtggcct；
DsRed-R (SEQ ID NO.21): ggccgcattcgcaaaacacacctagactagat.
Increasing system includes: 10 μ l PCR Mix, each 0.2 μ l of forward and reverse primer, 1 μ l of DNA profiling, supplements 8.6 μ l
ddH2O to 20 μ l of total volume.
Amplification program:
1. 98 DEG C of initial denaturation 3min；
2. 30 circulations (98 DEG C of 10s, 65 DEG C of 30s, 72 DEG C of 3~5min)；
3. finally extending 72 DEG C of 1min；
4. 4 DEG C of preservations.
2.2, Bh4 gene, PTC1 gene, ZMAA gene and DsRed gene are gradually connected to plant expression vector
On pCAMBIA1300, quaternary chain vector: pBDPZ carrier is formed.Fig. 3 is the structure chart of pBDPZ carrier.
2.3, using agrobcterium-mediated transformation, pBDPZ carrier converts to yellow grain husk is double-colored to select genetic engineering core
The callus of sterile line simultaneously obtains 15 plants of T0 for transgenic plant by the differentiation of callus, has 12 plants of T0 generation sun through PCR detection
Property transgenic plant.By 12 plants of T0 for positive transgenic plantlet of transplant to crop field, pollen fertility, harvest time tune are observed in florescence
Look into setting percentage and observation glume color, have in 12 plants of positive plants 5 plants of fertile rates of pollen be 50%, setting percentage restore it is normal and
Glume color is the strain of black, and such strain, that is, double-colored selects genetic engineering line of breeding.
(3) breeding and sorting of genetic engineering line with genic sterile seed
By the double-colored double-colored choosing heredity of Huang grain husk for selecting genetic engineering line of breeding seed and step (1) to cultivate of step (2) breeding
Engineering line with genic sterile seed according to 200 plants of ratio mixed planting of 2:8, caught up with line of breeding pollen using small-sized quadrotor aircraft by florescence
To sterile line plant, is mixed after seed is mature and receive all seed about 4.58kg.
Color selector is adjusted to glume color color sorting mode, first time screening is carried out to the 4.58kg seed of mixed receipts, separates black
Glume seed 1.63kg and Huang Ying seed 2.95kg.Wherein for black glume seed source in former line of breeding plant, half is to send out glimmering
The line of breeding seed of light, half are not fluorescent male-sterile seed, and whether two kinds of seeds can fluoresce substantially area according to endosperm
It can continue on for sterile line propagation after point.The seed source of yellow glume is in former sterile line plant, and all genetic engineering core is not
Educating is seed.
Fig. 4 is the double-colored outside drawing a for selecting genetic engineering line of breeding seed: black grain husk genetic engineering line of breeding seed；B: black grain husk
Genetic engineering line of breeding seed endosperm sends out red fluorescence.
Programmed screening is carried out to yellow clever male-sterile seed according to whether endosperm fluoresces, mixed a small amount of black grain husk is bred
It is that seed screens, only the genetic engineering line with genic sterile seed of remainder 2.93kg yellow glume, 2.93kg male-sterile seed are complete
After planting, all plant are all sterile line in portion, illustrate that precision of color separation is 100%.
The above described is only a preferred embodiment of the present invention, being not intended to limit the present invention in any form.Though
So the present invention is disclosed as above with preferred embodiment, and however, it is not intended to limit the invention.It is any to be familiar with those skilled in the art
Member, in the case where not departing from Spirit Essence of the invention and technical solution, all using in the methods and techniques of the disclosure above
Appearance makes many possible changes and modifications or equivalent example modified to equivalent change to technical solution of the present invention.Therefore,
Anything that does not depart from the technical scheme of the invention are made to the above embodiment any simple according to the technical essence of the invention
Modification, equivalent replacement, equivalence changes and modification, all of which are still within the scope of protection of the technical scheme of the invention.
Sequence table
<110>Hunan Research Centre for Hybrid Rice
<120>method for improving rice genetic engineering line with genic sterile seed precision of color separation using dominant black glume character
<160> 21
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2232
<212> DNA
<213>rice (rice)
<400> 1
cgttgattgg cagcaactag ctagctcgcc gtccggccgg ccggccatgg cgcctaagat 60
ggtgatcagc ctggggagct cgcggcggcg gaagcgcggc gagatgctgt tccggttcga 120
ggccttctgc cagcccggct acccggcgaa cttcgccggc gccggcggct tcagggacaa 180
cgtgaggacg ctgctcggct tcgcgcacct ggaggccggc gtccacggcg agaccaagtg 240
ctggtcgttc cagctcgagc tgcaccgcca cccccccacc gtcgtgaggc tcttcgtcgt 300
cgaggaggag gtcgccgcct cgccgcaccg ccagtgccac ctctgccgcc atattgggtg 360
ggggaggcat ctgatatgca gcaagaggta tcacttcttg ctgccgagga gggaatcggc 420
ggcggaagcc gacggcctgt gcttcgcgat caaccacggc ggcggcggtg gcgcggagaa 480
agcgtcgtcg aaagggacga cgacgacggc ctccagcaga ggccacctgc tacacggcgt 540
cgtgcacctc aacggctacg gccacctcgt cgccctccac ggcctcgagg gcggctccga 600
cttcgtctcc ggccaccaga tcatggacct ctgggaccgc atttgctcag ccttgcacgt 660
aaggacggtg agcctggtgg acacggcgag gaagggccac atggagctga ggctgctgca 720
cggcgtcgcg tacggcgaga cgtggttcgg gcggtggggg tacaggtacg gccggccgag 780
ctacggcgtc gcgctgccgt cgtaccggca gtcgctgcac gtgctcggct ccatgccgct 840
ctgcgtgctg gtgccgcacc tgtcgtgctt cagccaggag ctccccatgg tggtcaccaa 900
gtaccaggcc atcagcggcc acaagctgct cagcctcggc gacctcctcc gcttcatgct 960
cgagctgcgc gcccgcctgc cggccacctc cgtcacggcc atggactacc ggggcatcat 1020
gtcggaggcc tcgtgccggt ggtcggcgaa gcgcgtcgac atggcggcgc gcgccgtcgt 1080
ggacgcgctc cgccgcgccg agccggcggc gcggtgggtc acgcggcagg aggtgcgcga 1140
cgcggcgcgc gcctacatcg gcgacacggg cctcctcgac ttcgtgctca agtccctcgg 1200
caaccacatc gtcggcaact acgtcgtgcg ccgcaccatg aacccggtga ccaaggtgct 1260
cgagtactgc ctcgaggacg tctccagcgt gctcccggcg gtcgccgccg gcggcggcgt 1320
gccggcgcag ggcaagatga gggtgaggtt ccagctcacg cgtgcgcagc tcatgaggga 1380
cctggtgcac ctgtaccggc acgtgctcaa ggagcccagc caggcgctca ccggcggcgc 1440
gttcggcgcg atcccggtgg cggtgcggat ggtcctggac atcaagcact tcgtcaaaga 1500
ttaccacgaa ggacaagccg cggcgagcag caatggcggt ggcggattcg ggcatcccca 1560
catcaacctg tgctgcacgc tgctcgtgag caacgggagc ccggagctag ctccaccgta 1620
cgagacggtg accctgccgg cgcacgcgac ggtgggcgag ctgaagtggg aggcgcagag 1680
ggtgttcagc gagatgtacc tcggcctgag gagcttcgcg gcggactccg tcgtcggggt 1740
cggcgccgac caggagggcc tcccggtgct cgggctggtc gacgtcggaa gcgccgtcgt 1800
ggtgcaaggg agcgtgggcg agcagataaa cggggaggac cacgagagga aggaggaggc 1860
ggcggcggcg gccgtgtgcg aggggagcgg cggcggcgag cgcgtcgtgg actgcgcgtg 1920
cggcgcggtg gacgacgacg gcgagcgcat ggcgtgctgc gacatctgcg aggcgtggca 1980
gcacacgcgg tgcgccggga tcgcggacac cgaggacgcg ccgcacgtct tcctctgcag 2040
ccggtgcgac aacgacgtcg tgtcgttccc gtccttcaac tgttagatgt gatgctgctg 2100
ctgctactgc tactactact gcctctgctg ctatatatga tgctacctag tacaagtgat 2160
cgagaattca atttgttttc tcggcaaaac caaaatgaaa acgaaggtaa aaccaagtga 2220
acttcagatc aa 2232
<210> 2
<211> 24
<212> DNA
<213>artificial sequence (seArtificial Sequence)
<220>
<221> misc_feature
<222> (1)..(24)
<223>it is designed according to requirement of experiment, as the adapter-primer of PTC1 gene target site
<400> 2
ggcacatggt ggtcaccaag tacc 24
<210> 3
<211> 24
<212> DNA
<213>artificial sequence (seArtificial Sequence)
<220>
<221> misc_feature
<222> (1)..(24)
<223>it is designed according to requirement of experiment, as the adapter-primer of PTC1 gene target site
<400> 3
aaacggtact tggtgaccac catg 24
<210> 4
<211> 28
<212> DNA
<213>artificial sequence (seArtificial Sequence)
<220>
<221> misc_feature
<222> (1)..(28)
<223>it is designed according to requirement of experiment, as the detection primer of PTC1 gene target site
<400> 4
cctccgacat gatgccccgg tagtccat 28
<210> 5
<211> 30
<212> DNA
<213>artificial sequence (seArtificial Sequence)
<220>
<221> misc_feature
<222> (1)..(30)
<223>it is designed according to requirement of experiment, as the detection primer of PTC1 gene target site
<400> 5
gagctcccca tggtggtcac caagtaccag 30
<210> 6
<211> 3901
<212> DNA
<213>rice (rice)
<400> 6
gcgaaacttg acaaatgata gtgtgatcgc tttctgttct ttctcttgac atcatgacat 60
tgtcaaacct ttgtctctta tccgtgtgtg tgtatatata aatatattca catacaaaat 120
atgcttacct taactaactt aagttgtaac cagcctattc aggtttaagt tctaaacttg 180
acatggtcac atggatgctc atatttacgg ctaattattc tttcaaggcg atatatctgt 240
cgacatcaag gcgtccgtga tgacttttgc attagtctca aaatatgtca acctagtctt 300
tcggaggttc aatcgtagag gtggtgtgtt ccacgtgtgt ttgtgcgttt ataggataaa 360
tgcgtgcacg atatgagcaa ctggatttat aatgcgtttc ttaaaaaaac atgtttattc 420
acactcatca ctacagggga ctttagtgct ctttttgaac ataggagttc cacaggatat 480
tctccatgat caattaataa aattccctta gaaaatacgg cgattttttt ttctaagaag 540
tccttaacag tttttttggg acaggaatta aaagattaat ggacgtgatg ttgaatcatc 600
catatattaa attacaaagg agaactctca actatgtgac aaatgaaaat ggtgatagaa 660
attcccaact gatcgagcac tgtttttgta agagtggatg gtagggatga aatcgttgga 720
gaattctcta tattttccaa ttcaactatt ttagtaatac catcaatatg atactaatag 780
gaattagaca atttaaattt atgtctagaa tcagaaacgt cacaacttct acgagaacaa 840
taatggatcg gttgggaata tccatcaccg ttcccatccc taactttcgg tggagctcat 900
cggagcatgt acaatggtat agattcttag atagatagta catgggtgcc gcgctgaggg 960
gtgctaatgc atgggtggtc acacgggggc aagcctgcgc ggtgagttcg ccccctctag 1020
tctctcatct ctcctcttta tatgtatata tgtatgtata tacttttata tacatacgta 1080
taaactttgt atcactttgt cttgacgcac accgatatca agggccccac tagcgcacgg 1140
ggagccagcc cccccccccc ctccgattcc tcctcattgc tcatggcaac cgtgcccctg 1200
accctgttaa tgaaaacaag tagtaccgtt cgctccacca cgaggacctg cttgaggctt 1260
gagagaggag ggaaaggagg attgtcacaa ggctgtgaaa cgggtggcta ggaaatttaa 1320
agcaaaacca atatttcgtt atccattagg tgtgcaattg gtagagcatt ctcgagattg 1380
tattgtatgc aagggttttt ttcatgaaca cgtagaaact ttacacatca atatattaga 1440
agaagtgtag tatacaactg tgacacgccg ggcagtcact ggaggatcag tgggagggca 1500
tatctcgtta cataagaagc agtctggacc aagcaagtgt taggtggttc aggacaacac 1560
aaattaaatt atacaatcta cagttaggat aacatgattt acttatcaat aaccatgttt 1620
tttttaaagt taaacgtaac ataggagttc tctcacagtg accaactagc tttagctact 1680
gtatctttca tagtgaccaa ctagctagca tagctgcgca taggtaggta taggtgatgc 1740
acccaacaac gtatgctgta tgcagcaaaa gcgagacgct gaagtgcaga aatgcttcca 1800
agttccagcc tgttttgggg cttggctatt gcctatatat actgctccaa gatgaccctg 1860
cattaatcca tgctgagcct cttatactaa tattgccaga tttatttact aactataaac 1920
gggaacacaa tgccggtcgg caccgcgcga acttgcatga atggcctcaa tgccctgtcc 1980
ggtgcgtaca tgttgctcga gatcttctag ctaccttgca gtcttgctta attgcttgcg 2040
ttgatttacc gtgcgcactc atgccgctat atattctctg atcgaccagg ggttggcttg 2100
ctcaccgtgc cctacgccct ctccgagggg ggctgggtga gcctcgcgct gctcgccgcc 2160
gtggccgccg cctgctggta caccgggatc ctcctctgcc gctgcatgga cgccgacgac 2220
gccatccgga cgtacccgga catcggcgag cgcgcgttcg gccgcacggg ccgcctcctc 2280
gtgtccgcct tcacgtacgt cgagctctac ctcgtcgcca ccggcttcct catcctcgag 2340
ggcgacaacc tcgacaagct cttcccagga gccagagtca ccctggggac ggtgtccctc 2400
gccgggaagc ggctgttcgt cgtgctcgtc gcgctcgtgg tggcgcccac gacgtggctg 2460
cgcagcctcg gcgtgctcgc gtacgtctcc gccacgggcg tgttcgcgtc cgtcgtcatc 2520
gtgctcagcg tgctgtgggc cgcggccgtc gacggcgtcg gattctccgg acgagggacg 2580
acgacgccgc tacggatcgc ggggctcccg acggctctcg ggctgtacat cttctgctac 2640
gggggacacc ccatgttccc gacgctctac acatctatga agaggaagtc tcagtttcca 2700
aaggtatacc cgtatacgca tgcgcataac actatgctat ttatcagtcg tgattttttc 2760
ttatccgtta gtcaaccaat ttgcaaaggt catttactaa acttgcacac tactatatat 2820
aaaaaaaaca ctgcaacttt tagctttgct tttttaaaaa aatattttct ggaccaattt 2880
agtgcattat tatgtttata tgaagagaaa tttccctatg tacccctaaa agttcgtcca 2940
atcccttcta tattcctgag atttgattat ttacttccat actcctaaat tttactttga 3000
atcccctcta tactcctttt gtcagttgac cgttaaattc atatcataaa ctccatttta 3060
ccctttggta taaaaaaata aatttgtgaa gtatattgat ggagtgtata aatttattgt 3120
atgcgactat tatatttatg agtttatttt gtaagatatt atttaacaaa aataattttt 3180
atctcatata acaagattta tcttataaaa atttgcgtac tactataaca aactatgcta 3240
tatatataca gttttcaatg ataaaaaata ttattttttg ttttatctaa aataaattgt 3300
catagataaa aattactttt gttttccctt cgcgaggcga aactaaaata ttacttttat 3360
taaataatat ctcacaaaat aaactcatac atataatagt cccatacaat aaatttatac 3420
actacatcaa tatatttcat aaatttatat tttctcgata ccaaagggca aaatgaactt 3480
tatgatagaa atttaacggc taactaatgg aagaggtata gaagggacat agaagatata 3540
ccaaaaaata ttttttaaac ttttaggtta gaatattatt ttcttcacca caaggagaaa 3600
gaacataagg atgagtttgt tgatatatat tgatctagct agtgttaaaa atgcgattga 3660
tagataagaa aaaaaatctc ttgacaaata gataatcctg agaaataatg tagtagaaga 3720
aatcacgttt ttgagaaaac atatattttt aaagcaagtt ataaacaatc tggtgcataa 3780
tcagaatgga ttaattgatg gtcgatcaat atactgacca actcttcaat tgattattga 3840
tcaattaatt attatcaaat atcaaccaga tgctagtgat atgcttcctg caatggcggt 3900
g 3901
<210> 7
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(40)
<223>it is designed according to requirement of experiment, as the primer of amplification Bh4 gene
<400> 7
gcgaaacttg acaaatgata gtgtgatcgc tttctgttct 40
<210> 8
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(34)
<223>it is designed according to requirement of experiment, as the primer of amplification Bh4 gene
<400> 8
caccgccatt gcaggaagca tatcactagc atct 34
<210> 9
<211> 7093
<212> DNA
<213>rice (rice)
<400> 9
gtcatgcatt cagccgtcag aaaggctcag atttatttcc gtggaataaa cagaaatctc 60
caaaagacaa ctctagcctt ggagttaaca agtggatggt gcttactgat tctgcttgga 120
agattggagc aaaaggacta gaaagtgcat tcttgaaggt tctttgtgat cctctttatt 180
attattttcc tttgtatccc tccagttttt ctttttcttt tgactaattc agtttttttt 240
ccttgaaggg tggtagtgca ttgactctga aaatgatcta tgaatcggta ggtatactgt 300
tttatgaagt tagattgatt ttactttttc ttacagcatc attagacatt aatggactta 360
tcatcatggt agttagccaa gagactatct ggaaagctgc tcatggaggc tggtaaatat 420
gagataaaga aagaacttct aaagcaggta tatgtatttt agttgatatc tgtaagcaat 480
ttttcctgat tttattattt gctcatctca taattctttt aacagaataa tagatatact 540
catgttctgg ccccacctga aaaatgcagt agcatagctt gatacacaga tcatatacac 600
aagctgtaac tattttttta attgttataa taaatatcct ttgggagtac tgaggtttgc 660
catctgcagg gtggacgatt agctgctgtt aatctggagt ctcgagctgg tttgcttgca 720
gctaggcagg taacattctc atctgtcagc agctacttcc atgcataatt ggtatattat 780
gctcccagta ttatctgaaa aactgcacat tttagatggt cgtttgaata atcctcttga 840
atgtatgcat gcagggtttg gcacgtgcag catctagata tgttggtctt aggagtgtca 900
tgacgtttct tggaccaatg tatgtttctg ctaatatatc tggaatctgt ttgttgctgt 960
atttttttaa atcaataata cactatcagg tttccgcatg tttctataaa aaatttgacc 1020
tcttttcctt tttggtcaat agtaggttct tatggttaat ttatttttgg gtgcatgatg 1080
tattcatgtt ttgctacttc aacttgctgt tctgagttta ctgtttgtca gatctacttt 1140
ttaagtaatg attcattcac aataagcttc ttcaaatgct ttgttgtgtt gaattttgag 1200
cagactataa atcagttact gactcttctg ttctacaact tcttgctgca tagaatgtgg 1260
gggacactct tggctgacat tgtgatccaa atgcttggga cagactatgc tagaattgtg 1320
caggcaatct atgcttttgc tcaggtgagc ttctgattgt tcagtttttc gtccagtaac 1380
tcactgtcca tccattgagt tcacatctta gcctttctaa cagattcggc tgactaggac 1440
atcttacata gaatctcatg aagaataatc aacagtggga catttctggt ctggactaac 1500
agggcattct gggcccatag tgtacattct gatcatgcag aacatttttg gttgagtgct 1560
ggcgcaattc tcccaagagg actcgaggac agtaagttca tactttcaca gaagttgtgc 1620
agctgatgta aatgcataga agttagatga cagaacaatt gatagatgct aggtaggata 1680
gatggtacag atgacacaca aatcatctat gcttttgaat tctccaaggt ttaaggctgc 1740
tgcttaagtg agagcttgtt atacattcca ggaaaaatta atttactgcc actatagaat 1800
ggtgtaattg tatttaagaa atagctcaca atgaccatta gggccaccta ctctctaaac 1860
gcggtagttg tgaatgaata tacatccact tcacacttcc acgagggccc gaagttgtag 1920
accatgcatt ccattctgct ccagttaatt atgcaacaaa acggttcccc tgatcttaaa 1980
ctattgcccc cctaacattc agttaggcaa ggcatacttc attgacatta gtccatgctt 2040
atcccagcca tatgttacag atatgcttac gtgtaaacac cagggcataa tttgcatgtt 2100
gcaccctgct tattcccctt atcaaaacac tagcaactaa tttatcagta caggctagat 2160
atcattattc aaaatcgcaa caagtatggt atactcacat taccaaaact tgccatactt 2220
catttagcta acatgtctaa catgtggcca acaaaattaa agccacactt tagccatagg 2280
agagtaaact tgccacactt ttatgtgcca atgacatgta ggacccacat catggtgaag 2340
gaatcttgtt aaaagtgtgg caccaaccaa acgaatgcct aactaagtca aacctggcta 2400
acttgagttg tggcatgatg aggcaaattg tggtagtgaa ccaaacaacc ccttaatatc 2460
tacttcctcc gtttcaggtt ataagacttc attgcctaca ttcatataga tgttaacgaa 2520
tctagacaca tttatataaa tgtgtctaga ttcgttaaca tctatatgaa tgtatataaa 2580
tgtgtctaga ttcgttaaac atctatatga atgtgggcaa tactagaaat tcttataacc 2640
tgaaatggat gtagtactag attgtgtaac aattcagata gctagtgcaa ttggtgattg 2700
attaatttta cagtccttat gtatttggag gtatcataat cttaagtgtt aatttgtgat 2760
acctcctggt cctcaacact agagagatac taagtggtaa cactgcaaaa tgtggcatct 2820
cctggtacct tttaagtacc aaatgcacta ggtgcctttg cgcaaaattc ccagatgaga 2880
ggacccaatt tgtgatcgtg tgcgacatgt ctagaagggt ggcccattgt ttacattcct 2940
tcaccagatc gccgaagctt tctaaatcgc gggcacttaa cgcgtgagaa gcccaatgag 3000
acctccaaat gctaacctta aaatcgcagc gctgcacggc gacatggtct cctagctagc 3060
tgcctagctt ctcggcgacg ttgattggca gcaactagct agctcgccgt ccggccggcc 3120
ggccatggcg cctaagatgg tgatcagcct ggggagctcg cggcggcgga agcgcggcga 3180
gatgctgttc cggttcgagg ccttctgcca gcccggctac ccggcgaact tcgccggcgc 3240
cggcggcttc agggacaacg tgaggacgct gctcggcttc gcgcacctgg aggccggcgt 3300
ccacggcgag accaagtgct ggtcgttcca gctcgagctg caccgccacc cccccaccgt 3360
cgtgaggctc ttcgtcgtcg aggaggaggt cgccgcctcg ccgcaccgcc agtgccacct 3420
ctgccgccat attggtccgt cgaacaaact acaattaatc aatcaacctt tacataggat 3480
tgatccgatc gatgccatgg tgttgtaggg tgggggaggc atctgatatg cagcaagagg 3540
tatcacttct tgctgccgag gagggaatcg gcggcggaag ccgacggcct gtgcttcgcg 3600
atcaaccacg gcggcggcgg tggcgcggag aaagcgtcgt cgaaagggac gacgacgacg 3660
gcctccagca gaggccacct gctacacggc gtcgtgcacc tcaacggcta cggccacctc 3720
gtcgccctcc acggcctcga gggcggctcc gacttcgtct ccggccacca gatcatggac 3780
ctctgggacc gcatttgctc agccttgcac gtaaggtagt agtagtatac atgtgcgtgt 3840
gcatgcatgc aagcaatgca acgatgtcgg gctgcgtgtg agaacatttg cttgggcatg 3900
gtgtggtgta tgcaaggacg gtgagcctgg tggacacggc gaggaagggc cacatggagc 3960
tgaggctgct gcacggcgtc gcgtacggcg agacgtggtt cgggcggtgg gggtacaggt 4020
acggccggcc gagctacggc gtcgcgctgc cgtcgtaccg gcagtcgctg cacgtgctcg 4080
gctccatgcc gctctgcgtg ctggtgccgc acctgtcgtg cttcagccag gagctcccca 4140
tggtggtcac caagtaccag gccatcagcg gccacaagct gctcagcctc ggcgacctcc 4200
tccgcttcat gctcgagctg cgcgcccgcc tgccggccac ctccgtcacg gccatggact 4260
accggggcat catgtcggag gcctcgtgcc ggtggtcggc gaagcgcgtc gacatggcgg 4320
cgcgcgccgt cgtggacgcg ctccgccgcg ccgagccggc ggcgcggtgg gtcacgcggc 4380
aggaggtgcg cgacgcggcg cgcgcctaca tcggcgacac gggcctcctc gacttcgtgc 4440
tcaagtccct cggcaaccac atcgtcggca actacgtcgt gcgccgcacc atgaacccgg 4500
tgaccaaggt gctcgagtac tgcctcgagg acgtctccag cgtgctcccg gcggtcgccg 4560
ccggcggcgg cgtgccggcg cagggcaaga tgagggtgag gttccagctc acgcgtgcgc 4620
agctcatgag ggacctggtg cacctgtacc ggcacgtgct caaggagccc agccaggcgc 4680
tcaccggcgg cgcgttcggc gcgatcccgg tggcggtgcg gatggtcctg gacatcaagc 4740
acttcgtcaa agattaccac gaaggacaag ccgcggcgag cagcaatggc ggtggcggat 4800
tcgggcatcc ccacatcaac ctgtgctgca cgctgctcgt gagcaacggg agcccggagc 4860
tagctccacc gtacgagacg gtgaccctgc cggcgcacgc gacggtgggc gagctgaagt 4920
gggaggcgca gagggtgttc agcgagatgt acctcggcct gaggagcttc gcggcggact 4980
ccgtcgtcgg ggtcggcgcc gaccaggagg gcctcccggt gctcgggctg gtcgacgtcg 5040
gaagcgccgt cgtggtgcaa gggagcgtgg gcgagcagat aaacggggag gaccacgaga 5100
ggaaggagga ggcggcggcg gcggccgtgt gcgaggggag cggcggcggc gagcgcgtcg 5160
tggactgcgc gtgcggcgcg gtggacgacg acggcgagcg catggcgtgc tgcgacatct 5220
gcgaggcgtg gcagcacacg cggtgcgccg ggatcgcgga caccgaggac gcgccgcacg 5280
tcttcctctg cagccggtgc gacaacgacg tcgtgtcgtt cccgtccttc aactgttaga 5340
tgtgatgctg ctgctgctac tgctactact actgcctctg ctgctatata tgatgctacc 5400
tagtacaagt gatcgagaat tcaatttgtt ttctcggcaa aaccaaaatg aaaacgaagg 5460
taaaaccaag tgaacttcag atcaattcag acttctcaac tttcctccca agagaaaaaa 5520
aagaatatga aaaaccatcg agcccactta atgtgggccg gtgtttgttt attccagccc 5580
aggaggatcc atggttagaa tcacccaatc aggccaggag cccaggacaa catcttctaa 5640
caaatgggtc tcctagaggt gaattacggc tataccatga tgggctgggc cgtgaccatg 5700
taacctacct gaaatgaggt gcccatgaat tttattgctt ccaagttcaa ctcatcttca 5760
taagatagtt ttcttcaact gtgtgattat tatgtcagtg gcttagagca ggagaggctt 5820
gatgaccagc ttaagggttg cacctaatgt ctaatgacta agttaagtac ctatcaggta 5880
acagtgctac taaactggca agtgaccacc aaaagatgag ctattcacat ggcctgcttg 5940
gaggggccca cttggtggtg tcatgaaagg ccttttagga aaggggcttc cctacactgt 6000
ggacactgct gctgctacta ctatcctatt cctactccac gtttgcatgc atccatggga 6060
gaagggagaa gctagccatg gtttctggtt ggaagcatcc aactaacatc ctgaatgatt 6120
catgtctagc tttgatggca agaaacatgc tttagcccac caacgcaaaa gctaaactga 6180
acctgcaaca atgtgctccc catcgtgctt gcacgcttaa ttacctttca gatgcttgag 6240
atttgagatc ctcactttct ttccttactg ttagaacagt gaacagatca ttctccattt 6300
tatctcttcc aaaagccaag tggctgctga gtagtgatta gcaagaaggt agaaatttca 6360
gtagaaaaag ggactagtac atagtgacat actgcacact ttgaccattg caacagcaaa 6420
gaagtgggaa ttgttctgaa gaagaacaaa gcaagaagaa acaaatgact tatcattgaa 6480
gcaatgaaaa gagagggagg aaagttgttt tgcttttatc tctctcactg tcactctctc 6540
tgccagtaga gggactccat ttgtcctgtg tccctagtga gacaacctag ctagcctttt 6600
cttttcccct ctctctttct gttcttttgc agttttgcat tgcaaggact gaaggccccc 6660
tttgttaggg ctctttcact caccctgatg agatgcctgt ttctctctcc atctttttcc 6720
cgtctctttt tgtttcatta atctgtctct gacatgttga ggtgatccac cactatggtg 6780
tgagggcgat aggggcacat ggtctggtgg ctcggctaaa aagggactca tcaactaaaa 6840
ggaagggagc aagtagctta agctagcaac agagtgaaga taggaagatc gatgtggaag 6900
tgactagaga acggcatctt ggaagcaagc cagcaagagg agctactaac tgcttttgct 6960
ccgttttctg actaataatg tgctcatttg ccactctcat tttgcctagt tcaggacact 7020
ctctgaagct cttactaact aattcaaaag caacattaat tttaattact ggccacctcc 7080
acagtccaca tgc 7093
<210> 10
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223>it is designed according to requirement of experiment, as the primer of amplification PTC1 gene
<400> 10
gtcatgcatt cagccgtcag aaaggctcag a 31
<210> 11
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(30)
<223>it is designed according to requirement of experiment, as the primer of amplification PTC1 gene
<400> 11
gcatgtggac tgtggaggtg gccagtaatt 30
<210> 12
<211> 2717
<212> DNA
<213>corn (corn)
<400> 12
ggcataccag acagtccggt gtgccagatc agggcaccct tcggttcctt tgctcctttg 60
cttttgaacc ctaactttga tcgtttattg gtttgtgttg aacctttatg cacctgtgga 120
atatataatc tagaacaaac tagttagtcc aatcatttgt gttgggcatt caaccaccaa 180
aattatttat aggaaaaggt taaaccttat ttccctttca atctccccct ttttggtgat 240
tgatgccaac acaaaccaaa gaaaatatat aagtgcagaa ttgaactagt ttgcataagg 300
taagtgcata ggttacttag aattaaatca atttatactt ttacttgata tgcatggttg 360
ctttctttta ttttaacatt ttggaccaca tttgcaccac ttgttttgtt ttttgcaaat 420
ctttttggaa attctttttc aaagtctttt gcaaatagtc aaaggtatat gaataagatt 480
gtaagaagca ttttcaagat ttgaaatttc tccccctgtt tcaaatgctt ttcctttgac 540
taaacaaaac tccccctgaa taaaattctc ctcttagctt tcaagagggt tttaaataga 600
tatcaattgg aaatatattt agatgctaat tttgaaaata taccaattga aaatcaacat 660
accaatttga aattaaacat accaatttaa aaaatttcaa aaagtggtgg tgcggtcctt 720
ttgctttggg cttaatattt ctcccccttt ggcattaatc gccaaaaacg gagactttgt 780
gagccattta tactttctcc ccattggtaa atgaaatatg agtgaaagat tataccaaat 840
ttggacagtg atgcggagtg acggcgaagg ataaacgata ccgttagagt ggagtggaag 900
ccttgtcttc gccgaagact ccatttccct ttcaatctac gacttagcat agaaatacac 960
ttgaaaacac attagtcgta gccacgaaag agatatgatc aaaggtatac aaatgagcta 1020
tgtgtgtaat gtttcaatca aagtttcgag aatcaagaat atttagctca ttcctaagtt 1080
tgctaaaggt tttatcatat aatggtttgg taaagatatc gactaattgt tctttggtgc 1140
taacataagc aatctcgata tcaccccttt gttggtgatc cctcaaaaag tgataccgaa 1200
tgtctatgtg cttagtgcgg ctgtgttcaa cgggattatc cgccatgcag atagcactct 1260
cattgtcaca taggagaggg actttgctca atttgtagcc atagtcccta aggttttgcc 1320
tcatccaaag taattgcaca caacaatgtc ctgcggcaat atacttggct tcggcggtag 1380
aaagagctat tgagttttgt ttctttgaag tccaagacac cagggatctc cctagaaact 1440
gacaagtccc tgatgtgctc ttcctatcaa ttttacaccc tgcccaatcg gcatctgaat 1500
atcctattaa atcaaaggtg gatcccttgg ggtaccaaag accaaattta ggagtgtaaa 1560
ctaaatatct catgattctt ttcacggccc taaggtgaac ttccttagga tcggcttgga 1620
atcttgcaca catgcatata gaaagcatac tatctggtcg agatgcacat aaatagagta 1680
aagatcctat catcgaccgg tatacctttt ggtctacgga tttacctccc gtgtcgaggt 1740
cgagatgccc attagttccc atgggtgtcc tgatgggctt ggcatccttc attccaaact 1800
tgttgagtat gtcttgaatg tactttgttt ggctgatgaa ggtgccatct tggagttgct 1860
tgacttgaaa tcctagaaaa tatttcaact tccccatcat agacatctcg aatttcggaa 1920
tcatgatcct actaaactct tcacaagtag atttgttagt agacccaaat ataatatcat 1980
caacataaat ttggcataca aacaaaactt ttgaaatggt tttagtaaag agagtaggat 2040
cggctttact gactctgaag ccattagtga taagaaaatc tcttaggcat tcataccatg 2100
ctgttggggc ttgcttgagc ccataaagcg cctttgagag tttataaaca tggttagggt 2160
actcactatc ttcaaagccg agaggttgct caacatagac ctattcaccc catttgatca 2220
cttttttggt ccttcaggat ctaatagtta tgtataattt agagtctctt gtttaatggc 2280
cagatatttc taattaatct aagaatttat gatatttttt aattttttat catgtctgat 2340
gagaattaac ataaaggctc aattgggtcc tgaattaata atagagtgaa aattaatcca 2400
gaggctctat tagaaccttc aattagtaat accaagatat atataagata gtagagtata 2460
gtttaaatgt tggcattgtt cattctttct tttgttattt aatttatgct ttccacggtg 2520
gttagtggtt acttctgaag ggtccaaata atgcatgaag agtttgagga caagaagtct 2580
gccctaaaaa tagcgatgca aaggcatggt gtccaagcca tacatatagc gcactaattt 2640
tatcagcaga acaatggtat ttataggtcc tagtgcccag gcaacaagag acacgaataa 2700
agcatcgatc acgacac 2717
<210> 13
<211> 1616
<212> DNA
<213>corn (corn)
<400> 13
atggcggcga caatggcagt gacgacgatg gtgacgagga gcaaggagag ctggtcgtca 60
ttgcaggtcc cggcggtggc attcccttgg aagccacgag gtggcaagac cggcggcctc 120
gagttccctc gccgggcgat gttcgccagc gtcggcctca acgtgtgccc gggcgtcccg 180
gcggggcgcg acccgcggga gcccgatccc aaggtcgtcc gggcggcctg cggcctggtc 240
caggcacaag tcctcttcca ggggtttaac tgggagtcgt gcaagcagca gggaggctgg 300
tacaacaggc tcaaggccca ggtcgacgac atcgccaagg ccggcgtcac gcacgtctgg 360
ctgcctccac cctcgcactc cgtctcgcca caaggctaca tgccaggccg cctatacgac 420
ctggacgcgt ccaagtacgg cacggcggcg gagctcaagt ccctgatagc ggcgttccac 480
ggcaggggcg tgcagtgcgt ggcggacatc gtcatcaacc accggtgcgc ggaaaagaag 540
gacgcgcgcg gcgtgtactg catcttcgag ggcgggactc ccgacgaccg cttggactgg 600
ggccccggga tgatctgcag cgacgacacg cagtactcgg acgggacggg gcaccgcgac 660
acgggcgagg ggttcgcggc ggcgcccgac atcgaccacc tcaacccgcg cgtgcagcgg 720
gagctctccg cctggctcaa ctggctcagg tccgacgccg tggggttcga cggctggcgc 780
ctcgacttcg ccaagggcta ctcgccggcc gtcgccagaa tgtacgtgga gagcacgggg 840
ccgccgagct tcgtcgtcgc ggagatatgg aactcgctga gctacagcgg ggacggcaag 900
ccggcgccca accaggacca gtgccggcag gagctgctgg actggacgcg ggccgtcggc 960
gggcccgcca tggcgttcga cttccccacc aagggcctgc tgcaggcggg cgtgcagggg 1020
gagctgtggc ggctgcgcga cagctccggc aacgcggccg gcctgatcgg gtgggcgccc 1080
gagaaggccg tcaccttcgt cgacaaccat gacaccgggt cgacgcagaa gctctggccg 1140
ttcccatccg acaaggtcat gcagggctac gcctacatcc tcacccatcc aggagtcccc 1200
tgcattttct acgaccacat gttcgactgg aacctgaagc aggagatatc cacgctgtct 1260
gccatcaggg cgcggaacgg catccgcgcc gggagcaagc tgcggatcct cgtggcggac 1320
gcggacgcgt acgtggccgt cgtcgacgag aaggtcatgg tgaagatcgg gacaaggtac 1380
ggcgtgagca gcgtggtccc gtcggatttc cacccggcgg cgcacggcaa ggactactgc 1440
gtctgggaga aagcgagcct ccgcgtcccg gcggggcgcc acctctagca gctcagattg 1500
ctcagtcttg tgctgcattg caaacacagc agcacgacac tgcataacgt cttttccttg 1560
agatctgaca aagcagcatt agtccgttga tcggtggaag accactcgtc agtgtt 1616
<210> 14
<211> 293
<212> DNA
<213>corn (corn)
<400> 14
gagttgaatg tttgatcaat aaaatacggc aatgctgtaa gggttgtttt ttatgccatt 60
gataatacac tgtactgttc agttgttgaa ctctatttct tagccatgcc aagtgctttt 120
cttattttga ataacattac agcaaaaagt tgaaagacaa aaaaaaaaac ccccgaacag 180
agtgctttgg gtcccaagct actttagact gtgttcggcg ttccccctaa atttctcccc 240
ctatatctca ctcacttgtc acatcagcgt tctctttccc ctatatctcc acg 293
<210> 15
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223>it is designed according to requirement of experiment, as the primer of amplification ZMAA gene
<400> 15
ggcataccag acagtccggt gtgccagatc a 31
<210> 16
<211> 41
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(41)
<223>it is designed according to requirement of experiment, as the primer of amplification ZMAA gene
<400> 16
ggagatatag gggaaagaga acgctgatgt gacaagtgag t 41
<210> 17
<211> 831
<212> DNA
<213>barley (barley)
<400> 17
aaaccgtctc ttcgtgagaa taaccgtggc ctaaaaataa gccgatgagg ataaataaaa 60
tgtggtggta cagtacttca agaggtttac tcatcaagag gatgcttttc cgatgagctc 120
tagtagtaca tcggacctca catacctcca ttgtggtgaa atattttgtg ctcatttagt 180
gatgggtaaa ttttgtttat gtcactctag gttttgacat ttcagttttg ccactcttag 240
gttttgacaa ataatttcca ttccgcggca aaagcaaaac aattttattt tacttttacc 300
actcttagct ttcacaatgt atcacaaatg ccactctaga aattctgttt atgccacaga 360
atgtgaaaaa aaacactcac ttatttgaag ccaaggtgtt catggcatgg aaatgtgaca 420
taaagtaacg ttcgtgtata agaaaaaatt gtactcctcg taacaagaga cggaaacatc 480
atgagacaat cgcgtttgga aggctttgca tcacctttgg atgatgcgca tgaatggagt 540
cgtctgcttg ctagccttcg cctaccgccc actgagtccg ggcggcaact accatcggcg 600
aacgacccag ctgacctcta ccgaccggac ttgaatgcgc taccttcgtc agcgacgatg 660
gccgcgtacg ctggcgacgt gcccccgcat gcatggcggc acatggcgag ctcagaccgt 720
gcgtggctgg ctacaaatac gtaccccgtg agtgccctag ctagaaactt acacctgcaa 780
ctgcgagagc gagcgtgtga gtgtagccga gtagatccac cggtcgccac c 831
<210> 18
<211> 678
<212> DNA
<213>coral polyp (coralline)
<400> 18
atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60
accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120
cacaacaccg tgaagctgaa ggtgacgaag ggcggccccc tgcccttcgc ctgggacatc 180
ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240
gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300
gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360
aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420
atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480
acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540
tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600
atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660
caccacctgt tcctgtag 678
<210> 19
<211> 342
<212> DNA
<213>potato (potato)
<400> 19
cggcccatgg atattcgaac gcgtagactt gtccatcttc tggattggcc aacttaatta 60
atgtatgaaa taaaaggatg cacacatagt gacatgctaa tcactataat gtgggcatca 120
aagttgtgtg ttatgtgtaa ttactagtta tctgaataaa agagaaagag atcatccata 180
tttcttatcc taaatgaatg tcacgtgtct ttataattct ttgatgaacc agatgcattt 240
cattaaccaa atccatatac atataaatat taatcatata taattaatat caattgggtt 300
agcaaaacaa atctagtcta ggtgtgtttt gcgaatgcgg cc 342
<210> 20
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(32)
<223>it is designed according to requirement of experiment, as the primer of amplification DsRed gene
<400> 20
aaaccgtctc ttcgtgagaa taaccgtggc ct 32
<210> 21
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(32)
<223>it is designed according to requirement of experiment, as the primer of amplification DsRed gene
<400> 21
ggccgcattc gcaaaacaca cctagactag at 32
Claims (9)
1. a kind of method for improving rice genetic engineering line with genic sterile seed precision of color separation using dominant black glume character, special
Sign is, comprising the following steps:
S1, cultivate that yellow grain husk is double-colored to select genetic engineering line with genic sterile；
S2, will connect comprising the quaternary of dominant black glume gene, restoring gene, pollen inactivated gene and fluorescent marker gene
Lock vector introduction cultivates that black grain husk is double-colored to select genetic engineering numerous into the yellow double-colored genome for selecting genetic engineering line with genic sterile of grain husk
It grows and is；
S3, select in genetic engineering line of breeding and the S1 that yellow grain husk is double-colored to select genetic engineering line with genic sterile for grain husk black in the S2 is double-colored
The black double-colored pollen for selecting genetic engineering line of breeding of grain husk is rushed to the yellow clever genetic engineering line with genic sterile and planted by mixed planting, florescence
It is mixed to receive portion's seed in strain；
S4, according to glume color in the S3 mix receive whole seeds carry out first time screening, separating yellow glume seed and
Black glume seed；The yellow glume seed is the yellow double-colored offspring for selecting genetic engineering line with genic sterile plant of grain husk；It is described
Black glume seed is the black double-colored offspring for selecting genetic engineering line of breeding plant of grain husk；
S5, programmed screening is carried out to the yellow glume seed separated in the S4 according to whether endosperm fluoresces, will mixed
The line of breeding seed to fluoresce on a small quantity entered screens, and the yellow grain husk of purification is double-colored to select genetic engineering line with genic sterile seed.
2. method according to claim 1, which is characterized in that the grain husk of Huang described in the S1 is double-colored to select genetic engineering line with genic sterile
It is obtained using editor's rice wild type Recessive male sterility gene；Or, importing the recessive cytoblast sterile of mutation by Backcrossing methods
Gene obtains.
3. the method according to claim 1, wherein the grain husk of Huang described in the S1 is double-colored to select genetic engineering Genetic Sterility
The breeding method of system are as follows:
S1-A1, target site adapter-primer 1 is designed according to the cDNA sequence of PTC1 gene；
S1-A2, the target site adapter-primer 1 is made to the double-stranded adapters PTC1-T1 with cohesive end；
S1-A3, it connect the double-stranded adapters PTC1-T1 to obtain pU3-PTC1-T1-gRNA recombinant vector with carrier；
S1-A4, it the pU3-PTC1-T1-gRNA recombinant vector is connected to pCRISPR/Cas9 carrier obtains pCas9-PTC1-
T1 knockout carrier；
S1-A5, the pCas9-PTC1-T1 knockout carrier is imported in the callus of yellow glume rice, transformation Cheng Huangying
It is double-colored to select genetic engineering line with genic sterile.
4. according to the method described in claim 3, it is characterized in that, in the S1-A1, the target site adapter-primer 1 includes
The DNA sequence dna of Seq2 and Seq3, the Seq2 are as shown in SEQ ID NO.2；The DNA sequence dna of the Seq3 such as SEQ ID NO.3
It is shown.
5. method according to claim 1, which is characterized in that the S2 specifically:
S2-1, design expand drawing for dominant black glume gene, restoring gene, pollen inactivated gene and fluorescent marker gene
Object carries out PCR amplification and obtains genetic fragment；
S2-2, it the genetic fragment of four genes is building up in same plant expression vector obtains quaternary chain vector；
S2-3, it the quaternary chain vector is imported into the yellow double-colored genome for selecting genetic engineering line with genic sterile of grain husk obtains
Transgenic plant；
S2-4, from selected in the transgenic plant glume color for strain that in black and progeny seed 50% is fluorescent seeds
System, as black grain husk is double-colored to select genetic engineering line of breeding.
6. according to the method described in claim 5, it is characterized in that, the dominant black glume gene is Bh4；
The restoring gene is PTC1, EAT1, TDR or CYP704B2；
The pollen inactivated gene is ZMAA；
The fluorescent marker gene is DsRed.
7. according to the method described in claim 6, it is characterized in that, the dominant black glume gene is Bh4, described in amplification
The primer of Bh4 gene is Bh4-F and Bh4-R, and the DNA sequence dna of the Bh4-F is as shown in SEQ ID NO.7；The Bh4-R's
DNA sequence dna is as shown in SEQ ID NO.8；
The restoring gene is PTC1 gene, and the primer for expanding the PTC1 gene is PTC1-F and PTC1-R, described
The DNA sequence dna of PTC1-F is as shown in SEQ ID NO.10；The DNA sequence dna of the PTC1-R is as shown in SEQ ID NO.11；
The primer for expanding the ZMAA gene is ZMAA-F and ZMAA-R, the DNA sequence dna of the ZMAA-F such as SEQ ID NO.15
It is shown；The DNA sequence dna of the ZMAA-R is as shown in SEQ ID NO.16；
The primer for expanding the DsRed gene is DsRed-F and DsRed-R, the DNA sequence dna of the DsRed-F such as SEQ ID
Shown in NO.20；The DNA sequence dna of the DsRed-R is as shown in SEQ ID NO.21.
8. method according to claim 1, which is characterized in that the black clever seed obtained in the S4 is sieved through second of fluorescence
Choosing, the black clever seed development to fluoresce are selected genetic engineering line of breeding at being that the black grain husk is double-colored after plant, can be continued on for next
The breeding of Dai Huangying male-sterile seed；Not fluorescent black clever seed development is yellow at glume color transition after plant, can be with
Black grain husk line of breeding mixed planting, continues on for breeding that next-generation Huang Ying is double-colored to select genetic engineering line with genic sterile seed.
9. method according to claim 1, which is characterized in that through the Huang grain husk heredity of second of fluorescent screening purification in the S5
Engineering line with genic sterile seed and restorer carry out hybrid seeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910699895.5A CN110331161B (en) | 2019-07-31 | 2019-07-31 | Method for improving color selection precision of rice genetic engineering genic male sterile line seeds by utilizing dominant black glume characters |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910699895.5A CN110331161B (en) | 2019-07-31 | 2019-07-31 | Method for improving color selection precision of rice genetic engineering genic male sterile line seeds by utilizing dominant black glume characters |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110331161A true CN110331161A (en) | 2019-10-15 |
| CN110331161B CN110331161B (en) | 2021-04-02 |
Family
ID=68148228
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910699895.5A Active CN110331161B (en) | 2019-07-31 | 2019-07-31 | Method for improving color selection precision of rice genetic engineering genic male sterile line seeds by utilizing dominant black glume characters |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110331161B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111218457A (en) * | 2020-04-17 | 2020-06-02 | 中国农业科学院作物科学研究所 | Rice MIT2 gene and encoding protein and application thereof |
| CN111850035A (en) * | 2020-07-01 | 2020-10-30 | 湖南杂交水稻研究中心 | Method for removing transgenic seeds subjected to color selection and omission detection by inhibiting expression of herbicide resistance genes of plants |
| CN112410458A (en) * | 2020-12-09 | 2021-02-26 | 中国热带农业科学院热带生物技术研究所 | PCR primer for quickly and early identifying weedy rice and application thereof |
| CN113322342A (en) * | 2021-06-18 | 2021-08-31 | 湖南农业大学 | Molecular marker for assisting in selecting ptc1 common genic male sterile line and breeding line and application |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070130635A1 (en) * | 2005-12-02 | 2007-06-07 | Sarreal Eugenio S | Inbred rice line 053002 |
| CN102876711A (en) * | 2012-10-31 | 2013-01-16 | 湖南杂交水稻研究中心 | Cultivation method of rice engineering maintainer line and application thereof to breeding of rice genic male sterile line |
| CN104278051A (en) * | 2013-07-09 | 2015-01-14 | 中国科学院上海生命科学研究院 | Regulation and control gene of awn, grain length and number of grain per ear and application thereof |
| CN106544358A (en) * | 2016-11-25 | 2017-03-29 | 湖南杂交水稻研究中心 | A kind of propagation method of the common line with genic sterile of Oryza sativa L. |
| CN109112158A (en) * | 2018-08-17 | 2019-01-01 | 湖南杂交水稻研究中心 | A method of intelligent sterile line is formulated based on toxicity detoxification genes |
| CN109486853A (en) * | 2018-11-21 | 2019-03-19 | 湖南杂交水稻研究中心 | A method of quickly formulating the engineering Female sterile clone for being suitble to the mechanization production of hybrid seeds using genome editing technique |
-
2019
- 2019-07-31 CN CN201910699895.5A patent/CN110331161B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070130635A1 (en) * | 2005-12-02 | 2007-06-07 | Sarreal Eugenio S | Inbred rice line 053002 |
| CN102876711A (en) * | 2012-10-31 | 2013-01-16 | 湖南杂交水稻研究中心 | Cultivation method of rice engineering maintainer line and application thereof to breeding of rice genic male sterile line |
| CN104278051A (en) * | 2013-07-09 | 2015-01-14 | 中国科学院上海生命科学研究院 | Regulation and control gene of awn, grain length and number of grain per ear and application thereof |
| CN106544358A (en) * | 2016-11-25 | 2017-03-29 | 湖南杂交水稻研究中心 | A kind of propagation method of the common line with genic sterile of Oryza sativa L. |
| CN109112158A (en) * | 2018-08-17 | 2019-01-01 | 湖南杂交水稻研究中心 | A method of intelligent sterile line is formulated based on toxicity detoxification genes |
| CN109486853A (en) * | 2018-11-21 | 2019-03-19 | 湖南杂交水稻研究中心 | A method of quickly formulating the engineering Female sterile clone for being suitble to the mechanization production of hybrid seeds using genome editing technique |
Non-Patent Citations (3)
| Title |
|---|
| GORAFI YSA: "A population of wheat multiple synthetic derivatives:an effective platform to explore,harness and utilize genetic diversity of Aegilops tauschii for wheat improvement", 《THEORETICAL AND APPLIED GENETICS》 * |
| 施建达: "利用组合亲本的杂交水稻机械化制种技术优势分析", 《农业科技通讯》 * |
| 黄大辉: "普通野生稻黑颖壳遗传分析及育种利用初探", 《西南农业学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111218457A (en) * | 2020-04-17 | 2020-06-02 | 中国农业科学院作物科学研究所 | Rice MIT2 gene and encoding protein and application thereof |
| CN111218457B (en) * | 2020-04-17 | 2020-07-24 | 中国农业科学院作物科学研究所 | Rice MIT2 gene and encoding protein and application thereof |
| CN111850035A (en) * | 2020-07-01 | 2020-10-30 | 湖南杂交水稻研究中心 | Method for removing transgenic seeds subjected to color selection and omission detection by inhibiting expression of herbicide resistance genes of plants |
| CN111850035B (en) * | 2020-07-01 | 2023-11-14 | 湖南杂交水稻研究中心 | Method for removing color selection omission transgenic seeds by inhibiting expression of herbicide resistance genes of plants |
| CN112410458A (en) * | 2020-12-09 | 2021-02-26 | 中国热带农业科学院热带生物技术研究所 | PCR primer for quickly and early identifying weedy rice and application thereof |
| CN113322342A (en) * | 2021-06-18 | 2021-08-31 | 湖南农业大学 | Molecular marker for assisting in selecting ptc1 common genic male sterile line and breeding line and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110331161B (en) | 2021-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110331161A (en) | The method for improving rice genetic engineering line with genic sterile seed precision of color separation using dominant black glume character | |
| CN105602952B (en) | A kind of fertile gene and its application | |
| CN110250000B (en) | Method for improving color selection precision of rice genetic engineering genic male sterile line seeds by utilizing recessive glume color characters | |
| CN110213961A (en) | Crop based on genome editor is engineered and produces plant of short stem | |
| CN107164401A (en) | A kind of method and application that rice Os PIL15 mutant is prepared based on CRISPR/Cas9 technologies | |
| CN111996209B (en) | Parthenogenesis haploid inducing gene DMP and application thereof | |
| CN110684796B (en) | Method for specifically knocking out soybean lipoxygenase gene by CRISPR-Cas9 and application thereof | |
| CN108291234A (en) | Multiple sporinite forms gene | |
| CN111741969B (en) | Corn gene KRN2 and application thereof | |
| CN110511945A (en) | A kind of rice fertility controlling gene and its mutant and application | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN107245495A (en) | The method for creating of the common line with genic sterile of paddy rice and application | |
| CN109234310A (en) | It is quickly obtained the recombinant vector and application method of no transgene gene editor plant | |
| CN111206047B (en) | OsSWEET13 gene mutant and application thereof in increasing rice yield | |
| JP2011120597A (en) | Method for selecting genomic dna fragment | |
| CN102154337B (en) | Gossypium hirsutum mitogen-activated protein kinas 6 (GhMAPK6) gene and application thereof | |
| CN111304219B (en) | GL1 gene separated from rice WZ1 and application thereof in increasing rice grain length | |
| CN109837295A (en) | A kind of the rice haploid inducing line and its method for creating of gene editing initiative and application | |
| CN109161551B (en) | Cabbage BoMS1 gene and application thereof in creating sterile materials | |
| CN114774568B (en) | Molecular marker of maize half-dwarf gene ZmD13 and application thereof | |
| CN111979233A (en) | Method for increasing rice grain type and application thereof | |
| CN110305895B (en) | Method for preventing transgene pollen drift by using rice RAMy1A gene | |
| CN108660139A (en) | Plant fertility controlling gene NP2 and its coding albumen and application | |
| CN112522259A (en) | Method for cultivating plant type improved rice material with Oslg1 mutant phenotype through haploid mediation | |
| CN108135145A (en) | There are the Brassica plants of the property changed in seed production |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |