CN104278051A - Regulation and control gene of awn, grain length and number of grain per ear and application thereof - Google Patents

Abstract

The invention relates to a regulation and control gene of awn, grain length and the number of grain per ear and application thereof. The technical scheme firstly discloses that by directionally regulating and controlling the expression level of An-1 gene in cereal crops, the output, the awn properties, the seed form, the seed quantity property, the ear type structure and other important properties of the crops can be substantially regulated, thereby reaching the purposes of improving cereal crops, increasing output and the like.

Description

The regulatory gene of a kind of awns, grain length and number of grain per ear and application thereof

Technical field

The invention belongs to biotechnology and phytology field; More specifically, the present invention relates to a kind of awns, the regulatory gene of grain length and number of grain per ear and application thereof.

Background technology

Along with the minimizing year by year of global cultivated area, the output of farm crop is difficult to the development maintaining the mankind.Although the per mu yield of food crop is in increase, ultimate production is difficult to maintain growth trend.According to the report that Food and Argriculture OrganizationFAO issues, the whole world faces larger crisis in food.The breed improvement of some staple food crops seems very urgent.

Paddy rice is the staple food crop of whole world population over half.Asian Cultivated Rice (Oryza sativa L.) is mainly divided into long-grained nonglutinous rice (Oryza sativa L.ssp.Indica) and japonica rice (Oryza sativa L.ssp.Japonica) two subspecies.With regard to its origin, research display Asian Cultivated Rice may by common wild-rice (Oryza rufipogon Griff.) through domestication.Under the effect of artificial selection, compared with wild-rice, the proterties of cultivated rice there occurs obvious change, and these changes make cultivated rice more be applicable to early stage agricultural planting, for the mankind provide reliable food source.As the reduction of seed holding, vertical growth, the increase of branch stalk number and spikelet number, the degeneration of seed appurtenant awns disappears, and even seed hulls look and fruit colour all there occurs change.Therefore the clone of domestication's gene, not only allows the present inventor progressively understand the mechanism of artificial selection and the origin of cultivated rice proterties, also for molecular breeding of new generation provides the molecular regulation information of character improvement.

Domestication's gene is generally completed by map-based cloning, namely by wild ancestor kind and cultivar hybridization, utilize filial generation to quantitative character ( quantitative trait locus, QTL) carry out genetic mapping analysis, prepare the single-factor that QTL site is separated into Mendelian inheritance by Advanced backcross material simultaneously, then carry out Fine Mapping and gene clone.In current paddy rice, existing multiple gene relevant to domestication is cloned, such as control gene qSH1, SH4 of shattering, control the gene PROG1 of tillering angle, control the gene Rc of red rice skin, control the gene Bh4 of black grain husk shell, control the wide gene qSW5 of grain and control the gene Wx of glutinous matter.Very complicated to the molecular mechanism of the research display Character change of domestication gene.The spontaneous mutation of some gene directly destroys gene function thus phenotype is changed, as PROG1, Bh4, Rc.Some gene is then change phenotype by protein modification or regulation and control change, and as qSH1 changes at a SNP of 5 ' control region the disappearance causing absciss layer, SH4 causes monamino acid replacement that seed holding is reduced in a SNP change of coding region.Cultivated rice is divided into japonica rice and long-grained nonglutinous rice to increase the complicacy of paddy rice domestication, and nearest research shows that the allelic variation of SH4, PROG1, qSW5, Bh4 is fixed up in japonica rice and long-grained nonglutinous rice, Rc and Wx is only fixing in japonica rice colony.

The seed of wild-rice generally has long awns, and awns is in seed dispersal and prevent that birds and beasts is edible to play an important role; But the seed of tool awns is not easily gathered in the crops and stored, awns degenerates gradually forfeiture in artificial selection, causes most of cultivated rice without awns.A lot of cereal crop seed has awns, and as barley, wheat, oat, rye and paddy rice etc., awns is an important component part in these plant fringe portions.In wheat, awns is one of important photosynthetic organs, its assimilation product directly transport to raw small ear, particularly in the grouting later stage, Grain Filling is played an important role, from agriculture production, the awns strain that has of wheat generally has higher output, and the production-increasing function of awns in wheat makes it be retained in very long Crop Domestication process.Compared with wheat, the awns of paddy rice slowly degenerates in the process of taming cultivated rice from wild-rice, and thus present most of cultivated rice is without awns or short awns kind.

The awns of long-term QTL research display wild-rice by controlled by multiple genes, and is vulnerable to such environmental effects, and the QTL controlling awns is distributed on many karyomit(e)s, but has not yet to see the play-by-play of Cloning of Genes Related and functional study.

Summary of the invention

The object of the present invention is to provide a kind of awns, the regulatory gene of grain length and number of grain per ear and application thereof.

In a first aspect of the present invention, provide a kind of regulate and control the method for cereal crop economical character and/or yield traits, described method comprises: the expression regulating An-1 gene in cereal crop.

In a preference, described cereal crop is grass; Preferably, described grass is paddy rice, barley, wheat, oat, rye; And/or

Described economical character comprises: awns proterties, seed morphology, seed amount proterties, fringe type structure (as branch stalk number).

In another preference, described An-1 genes encoding:

A () is as the polypeptide (An-1 polypeptide) of SEQ ID NO:2 or SEQ ID NO:4 aminoacid sequence;

(b) by SEQ ID NO:2 or SEQ ID NO:4 aminoacid sequence through one or more (as 1-20; Preferably 1-10; More preferably 1-5) replacement of amino-acid residue, disappearance or interpolation form, and have the polypeptide derivative by (a) of (a) polypeptide function; Or

C peptide sequence that () and (a) limit has 80% (preferably 90%; More preferably 95%; More preferably 98%) above homology and there is the polypeptide derivative by (a) of (a) polypeptide function.

In another preference, described An-1 gene has the sequence of SEQ ID NO:1 or the nucleotide sequence shown in SEQ ID NO:3 or its degeneracy.

In another preference, the method for described regulation and control cereal crop economical character and/or yield traits comprises: the expression reducing An-1 in cereal crop; Thus: increase yield; Reduce grain length; Increase every fringe seed grain number; Increase every cladus stalk number; Shorten the awn length of seed; And/or subtract and oligospermously have awns rate.

In another preference, in described reduction cereal crop, the expression of An-1 gene comprises:

By lowering An-1 genetic transcription, the lower adjustment of protein expression or protein-active proceeds in cereal crop; Preferably, described lower adjustment is the disturbing molecule of specificity interference An-1 genetic transcription.

In another preference, described disturbing molecule be with An-1 gene or its transcript for suppressing or dsRNA, antisense nucleic acid, siRNA, the Microrna of reticent target, maybe can express or be formed the construction of described dsRNA, antisense nucleic acid, siRNA, Microrna; Preferably, described disturbing molecule is as the dsRNA of reticent target or construction with SEQ ID NO:1 or SEQ ID NO:3 (preferably, for a part (SEQ ID NO:5) of 3 ' UTR of SEQ ID NO:1 or 3 sequences).

In another preference, described disturbing molecule is construction, the structure containing shown in formula (I):

Seq _forward-X-Seq _oppositelyformula (I),

In formula (I), Seq _forwardfor the polynucleotide shown in SEQ ID NO:5, Seq _oppositelyfor with Seq _forwardcomplementary polynucleotide;

X is for being positioned at Seq _forwardand Seq _oppositelybetween intervening sequence, and described intervening sequence and Seq _forwardand Seq _oppositelynot complementary.

In another preference, in described reduction cereal crop, the method for the expression of An-1 gene comprises:

I () provides the Agrobacterium of carrying the carrier that can disturb genetic expression, described carrier is selected from lower group:

(a) An-1 gene containing opposite direction startup or the carrier of gene fragment (antisense molecule);

B () disturbs the carrier of the disturbing molecule (such as formula (I) construction) of the composition of An-1 genetic expression (or transcribing) containing forming specificity in plant materials;

(ii) tissue of plant or organ are contacted with the Agrobacterium in step (i), thus make described carrier proceed to plant tissue or organ.

Preferably, in described reduction cereal crop, the method for the expression of An-1 gene also comprises:

(iii) plant tissue having proceeded to described carrier or organ is selected; With

(iv) plant tissue in step (iii) or neomorph are become plant.

In another preference, the method for described regulation and control cereal crop economical character and/or yield traits comprises: the expression improving An-1 gene in cereal crop, thus: the grain length increasing seed; Reduce every fringe seed grain number; Reduce every cladus stalk number; Increase the awn length of seed; And/or increase seed has awns rate.

In another preference, in described raising cereal crop, the expression of An-1 gene comprises: An-1 gene is proceeded to cereal crop, obtains the cereal crop transformed.

In another preference, in described raising cereal crop, the method for An-1 genetic expression comprises:

(S1) provide the Agrobacterium of carrying expression vector, described expression vector contains An-1 gene;

(S2) cell or tissue of plant or organ are contacted with the Agrobacterium in step (S1), thus make described polynucleotide proceed to plant tissue, organ or seed.

Preferably, in described raising cereal crop, the method for An-1 genetic expression also comprises:

(S3) plant tissue, organ or the seed that have proceeded to described An-1 gene is selected; With

(S4) by the plant tissue in step (S3), organ or seed regeneration plant.

In another aspect of this invention, provide a kind of purposes of An-1 gene, for regulating and controlling cereal crop economical character or yield traits; Described economical character comprises: awns proterties, seed morphology, seed amount proterties, fringe type structure (as branch stalk number).

In another aspect of this invention, provide a kind of purposes of An-1 gene, for the molecule marker as qualification cereal crop economical character or yield traits; Described economical character comprises: awns proterties, seed morphology or plumpness proterties, seed amount proterties, fringe type structure (as branch stalk number).

In another aspect of this invention, provide a kind of material reducing An-1 genetic expression, described material contains the structure shown in formula (I):

Seq _forward-X-Seq _oppositelyformula (I),

In formula (I), Seq _forwardfor the polynucleotide shown in SEQ ID NO:5, Seq _oppositelyfor with Seq _forwardcomplementary polynucleotide; With

X is for being positioned at Seq _forwardand Seq _oppositelybetween intervening sequence, and described intervening sequence and Seq _forwardand Seq _oppositelynot complementary.

In another aspect of this invention, a kind of purposes reducing the material of An-1 genetic expression is provided, for regulating plant economical character or yield traits; Comprise: increase yield; Reduce grain length; Increase every fringe seed grain number; Increase every cladus stalk number; Shorten the awn length of seed; And/or subtract and oligospermously have awns rate.

Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.

Accompanying drawing explanation

The clone of Fig. 1, An-1 and functional verification.

(A) the fringe type of SL4/GLA4/CSSL-Z3 compares (Bar=10mm).

(B) awn length of SL4/GLA4/CSSL-Z3 compares (Bar=10mm).

(C) in SL4, rice chromosome awns QTL locates, and An-1 is between M6298 and M6285, and An-2 is between M1108 and M1160.

(D) An-1 Fine Mapping, finally fixes on the region of about 70Kb between FM3 and FM6, corresponding to the BAC of two Japan fine BAC and W1943.FM1-9 represents the molecule marker of Fine Mapping, arrow display gene direction.

(E) between FM3 and FM6, the fine gene comparision of W1943 and Japan and gene annotation compare.Black represents genomic fragment, and grey represents collinearity region, and redness represents transposon or tumor-necrosis factor glycoproteins, and green represents forward prediction gene, and blueness represents backward prediction gene.

(F) An-1 gene structure and the plasmid for functional analysis.PCPL represents the complementary plasmid of An-1, and pOX represents An-1 process LAN plasmid, and pRNAi represents An-1-RNAi plasmid.

Fig. 2, An-1 transcriptional activation activity and nuclear location.

(A) An-1 protein transcription Activation Activity in yeast activation system.

(B) An-1-GFP is positioned in core.

(C) contrast 35S-GFP to be positioned in core with on cytolemma.

Three kinds of typical haplotypes in Fig. 3, cultivated rice and wild-rice

(A) main haplotype an-1 (Tn+) in japonica rice.

(B) main haplotype an-1 (G-) in long-grained nonglutinous rice.

(C) main haplotype An-1 in wild-rice.

Fig. 4, awn length compare.

(A) the Primary branch top grain photo of GLA4 and NIL-An-1.

(B) the Primary branch top grain photo of Japan fine, complementary CPL and process LAN OX.

(C) the Primary branch top grain photo of Kasalath and RNAi-6.

(D) the Primary branch top grain awn length of GLA4 and NIL-An-1 compares.

(E) the Primary branch top grain awn length of Japan fine, complementary CPL and process LAN OX compares.

(F) the Primary branch top grain awn length of Kasalath and RNAi compares (Bar=10mm).

Fig. 5, grain length compare.

(A) 10 seed photos of GLA4 and NIL-An-1.

(B) 10 seed photos of Japan fine, complementary CPL and process LAN OX.

(C) Kasalath, RNAi-2 and RNAi-610 grain seed photo.

(D) GLA4 and NIL-An-1 grain length compares.

(E) fine, the complementary CPL of Japan and process LAN OX grain length compare.

(F) Kasalath and RNAi grain length compares (Bar=10mm).

Fig. 6, number of grain per ear compare and compare with single plant yield.

(A) the whole fringe photo of GLA4 and NIL-An-1.

(B) the whole fringe photo of Kasalath, RNAi-2 and RNAi-6.

(C) number of grain per ear of GLA4 and NIL-An-1 compares.

(D) number of grain per ear of Kasalath and RNAi compares.

(E) the whole fringe photo of Japan fine, complementary CPL and process LAN OX.

(F) number of grain per ear of Japan fine, complementary CPL and process LAN OX compares.

(G) fine, complementary CPL-1 and the CPL-2 single plant yield of Japan compares.

Fig. 7, An-1 expression level compares.

(A) comparison of An-1 expression level between GLA4 and NIL-An-1.

(B) comparison between fine in Japan, complementary CPL-1 and CPL-2 of An-1 expression level.

(C) comparison of An-1 expression level between Kasalath4 and RNAi strain.

(D) comparison between fine in Japan, complementary CPL-1 and CPL-2 of LOG expression level.

The growth of Fig. 8, awns and the expression pattern of An-1 and Histone H4.

(A1-A5) at the electron microscope photo scanning of different development stage GLA4 small ear, the outer thin membrane inside rush stalk top of arrow indication.

(B1-B5) at the electron microscope photo scanning of different development stage NIL-An-1 small ear, the former base of arrow indication awns.

(C1-C5) An-1 is in the spatial and temporal expression pattern of GLA4 small ear different development stage, the outer thin membrane inside rush stalk top of arrow indication.

(D1-D5) An-1 is in the spatial and temporal expression pattern of NIL-An-1 small ear different development stage, the former base of arrow indication awns.

(E1) in the Sp8l phase, the photo of GL4 small ear tissue section strain, the outer thin membrane inside rush stalk top of arrow indication.

(E2-E5) the spatial and temporal expression pattern of Histone H4 in GLA4 Spikelet development, the outer thin membrane inside rush stalk top of arrow indication.

(F1) in the Sp8l phase, the photo of NIL-An-1 small ear tissue section strain, the former base of arrow indication awns.

(F2-F5) the spatial and temporal expression pattern of Histone H4 in NIL-An-1 Spikelet development, the former base of arrow indication awns (Bars=100 μm) Sp8l:Sp8 late period.

The expression analysis of Fig. 9, the cell comparative analysis of seed-coat silicidize and Histone Hs.

(A) stereoscan photograph of whole seed, the region that arrow 1 representative species sub-surface is amplified, arrow 2 represents along horizontal long axis interval to the cell counting of seed-coat silicidize.Bars=1mm。

(B) region of Kasalath seed-coat amplification.

(C) the region Bars=100 μm of RNAi-6 seed-coat amplification.

(D) cell counting of Kasalath and RNAi seed-coat silicidize is compared.

(E) Kasalath and RNAi is less than Histone H1 expression in 4cm children fringe.

(F) region of Japanese fine seed-coat amplification.

(G) the region Bars=100 μm of CPL-1 seed-coat amplification.

(H) cell counting of Japanese warm and fine CPL-1 seed-coat silicidize is compared.

(I) Japanese warm and fine CPL-1 is less than Histone H1 expression in 4cm children fringe.

The growth of Figure 10, awns and the expression pattern (Bars=100 μm) of An-1 and Histone H4.

(A-D) An-1 is in the spatial and temporal expression pattern of NIL-An-1 inflorescence development different times.

(E-H) An-1 is in the spatial and temporal expression pattern of GLA4 inflorescence development different times.

(I-L) An-1 is in the spatial and temporal expression pattern of CPL-1 inflorescence development different times.

(M-P) OSH1 is in the spatial and temporal expression pattern of NIL-An-1 inflorescence development different times.

An-1 1978bp full length cDNA sequence in Figure 11, W1943, its 262 amino acid of encoding, underscore part is conservative bHLH structural domain.

In Figure 12, GLA4, the 1979bp full-length cDNA of an-1 gene is encoded 263 amino acid, and underscore part is conservative bHLH structural domain.First represent the L-Ala inserted in GLA4, second representative because of a base replace cause L-Ala replacement glycine.

Embodiment

The present inventor is through extensive and deep research, disclose by regulation and control An-1 gene expression dose directed in cereal plants (crop) first, can the important proterties of the output, awns proterties, seed morphology, seed amount proterties, fringe type structure etc. of remarkable regulating plant, and then reach object such as improvement cereal crop, increase yield etc.

As used herein, described " cereal crop " can be grass or have awns plant (crop).Preferably, described grass is paddy rice, barley, wheat, oat, rye.There is awns plant to refer to and seed hulls exists spicule plant.

As used herein, the polypeptide called after " An-1 " of An-1 genes encoding.In the present invention, term " An-1 " refers to have the SEQ ID NO:2 of An-1 activity or the polypeptide of 4 sequences.This term also comprise have with An-1 identical function, the variant form of SEQ ID NO:2 or 4 sequences.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8,1-5) amino acid whose disappearance, insertion and/or replacement, and add or disappearance one or several (being generally within 20, is preferably within 10, within being more preferably 5) amino acid at C-terminal and/or N-terminal.Such as, in the art, when replacing with similar nature or similar amino acid, the function of protein can not usually be changed.Again such as, add at C-terminal and/or N-terminal the function that or several amino acid also can not change protein usually.This term also comprises active fragments and the reactive derivative of An-1.

The bioactive fragment of any one An-1 can be applied in the present invention.Here, the implication of the bioactive fragment of An-1 refers to as a peptide species, and it still can keep all or part of function of the An-1 of total length.Under normal circumstances, described bioactive fragment at least keeps the activity of the total length An-1 of 50%.Under still more preferential conditions, described active fragments can keep the activity of 60%, 70%, 80%, 90%, 95%, 99% or 100% of total length An-1.

The variant form of polypeptide comprises: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutants.

Any with described An-1 homology is high (is such as 70% or higher with the homology of the sequence shown in SEQ ID NO:2 or 4; Preferably, homology is 80% or higher; Preferred, homology is 90% or higher, as homology 95%, 98% or 99%) and the polypeptide with An-1 identical function be also included within the present invention.

The invention still further relates to code book invention An-1 or its conservative variation's polypeptide, derivative polynucleotide sequence.Described polynucleotide can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can the varient of or degeneracy identical with the coding region sequence shown in SEQ ID NO:1 or SEQID NO:3.As used herein, " varient of degeneracy " refers to that coding has the protein of SEQ ID NO:2 or 4 in the present invention, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NO:1 or SEQ ID NO:3." polynucleotide of coded polypeptide " can be the polynucleotide comprising coding said polypeptide, also can be the polynucleotide also comprising additional code and/or non-coding sequence.

The invention still further relates to and above-mentioned sequence hybridization and have at least 50% between two sequences, preferably at least 70%, the more preferably polynucleotide of at least 80% homogeny.The present invention be more particularly directed to polynucleotide interfertile with polynucleotide of the present invention under strict conditions.In the present invention, " stringent condition " refers to: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 60 DEG C; Or be added with denaturing agent during (2) hybridization, and as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc.; Or (3) homogeny only between two sequences, at least more than 90%, is just hybridized when being more preferably more than 95%.Further, the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in SEQ ID NO:2 or 4.

Should understand, although An-1 gene of the present invention is preferably available from paddy rice, but within the scope also considered in the present invention with other gene of paddy rice An-1 gene very high homology (as have more than 70%, as 80%, 85%, 90%, 95%, even 98% sequence thereto) available from other plant.The Method and kit for of aligned sequences homogeny is also that this area is known, such as BLAST.

An-1 Nucleotide full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.

The present invention also relates to the carrier comprising described polynucleotide, and with the host cell that described carrier or An-1 encoding sequence produce through genetically engineered.

When described polynucleotide are expressed in higher eucaryotic cells, if will make to transcribe to be enhanced when inserting enhancer sequence in the carrier.Enhanser is the cis-acting factors of DNA, and nearly 10 to 300 base pairs, act on promotor transcribing with enhancing gene usually.

Persons skilled in the art all know how to select suitable carrier, promotor, enhanser and host cell.

Transform host with recombinant DNA to carry out with routine techniques well known to those skilled in the art.Conversion of plant can use the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as spraying, leaf disk method, Rice Young Embryo conversion method etc.Can ordinary method regeneration plant be used for the plant tissue transformed or organ, thus the plant that acquired character changes.

The invention provides the purposes of described An-1 gene, for regulating plant economical character or yield traits; Or for screening for regulating plant economical character or the useful material of yield traits (that is: described material comes regulating plant economical character or yield traits by regulating the expression of An-1 gene).As a kind of optimal way, described An-1 gene can be used for: the grain length increasing seed; Reduce every fringe seed grain number; Reduce every cladus stalk number; Increase the awn length of seed; And/or increase seed has awns rate.

The invention still further relates to adjustment or lower adjustment and uses thereof on An-1.Due to the upper adjustment of An-1 or the expression of the adjustable An-1 of lower adjustment and/or activity etc., therefore, described upper adjustment or lower adjustment also by coming regulating plant economical character or yield traits to the impact of An-1, thus reach the object of improvement plant.

The activity of any An-1 of raising, improve its stability, promote that it is expressed, extends its effective acting time or promote that the material of its genetic transcription and translation all can be used for the present invention, as the material that can be used for regulating plant economical character or yield traits.

The activity of any An-1 of reduction, reduce its stability, suppress it to express, reduce its effective acting time or reduce its material transcribed and translate and all can be used for the present invention, as the lower adjustment of An-1, antagonist or inhibitor, as the disturbing molecule (as formed the disturbing molecule of microRNA) of An-1 genetic expression as described in disturbing.Described lower adjustment, antagonist or inhibitor can be used for regulating plant economical character or yield traits.After obtaining cicada target sequence, the method for the disturbing molecule that preparation interference specific gene is expressed is well known in the art.

The invention still further relates to a kind of method of regulating plant economical character or yield traits, the method comprises the expression regulating An-1 gene in described plant.

On the one hand, the invention provides the method for another kind of regulating plant (as crop) economical character or yield traits, described method comprises: the expression (comprise and An-1 gene is not expressed or low expression) reducing An-1 gene in described plant; Thus increase yield; Reduce grain length; Increase every fringe seed grain number; Increase every cladus stalk number; Shorten the awn length of seed; And/or subtract and oligospermously have awns rate.

On the other hand, the invention provides the method for a kind of regulating plant (as crop) economical character or yield traits, described method comprises: make described plant overexpression An-1 gene, thus: the grain length increasing seed; Reduce every fringe seed grain number; Reduce every cladus stalk number; Increase the awn length of seed; And/or increase seed has awns rate.

After the purposes obtaining the An-1 gene described in cicada, multiple method well known in the art can be adopted to regulate the expression of described An-1 gene.Such as by the approach that those skilled in the art are known, the ceneme (such as expression vector or virus etc.) carrying An-1 gene is delivered on target spot, and makes it the An-1 of expression activity.

In addition, multiple method well known in the art can be adopted to reduce the expression of An-1 gene or to make it loss of expression, such as the ceneme (such as expression vector or virus etc.) of carrying antisense An-1 gene is delivered on target spot, cell or plant tissue is not expressed or reduces to express An-1.

As one embodiment of the present invention, An-1 gene is cloned in suitable carrier by conventional method, the described recombinant vectors with foreign gene is imported in plant tissue or organ, makes described expression of plants An-1 gene.By described plant tissue or neomorph are become plant, obtain the plant of overexpression An-1 gene.

Preferably, provide a kind of method preparing transgenic plant, comprising:

(1) by the An-1 gene transferred plant organ or tissue of external source, the plant tissue, organ or the seed that are transformed into described gene is obtained; With

(2) plant tissue having proceeded to external source An-1 gene step (1) obtained, organ or seed regeneration plant.

As the preferred example of one, described method comprises step:

(s1) provide the Agrobacterium of carrying expression vector, described expression vector contains An-1 gene;

(s2) plant tissue, organ or seed are contacted with the Agrobacterium in step (s1), make An-1 gene transferred plant, and be incorporated on the karyomit(e) of vegetable cell;

(s3) plant tissue, organ or the seed that proceed to An-1 gene is selected; And

(s4) by the plant tissue in step (s3), organ or seed regeneration plant.

Other method increasing An-1 gene or the expression of its homologous gene is that this area is known.Such as, by driving with strong promoter thus strengthening An-1 gene or its homogenic expression.Or the expression of this An-1 gene is strengthened by enhanser (as paddy rice waxy gene First Intron, Actin gene First Intron etc.).The strong promoter being applicable to the inventive method includes but not limited to: 35S promoter, the Ubi promotor etc. of paddy rice, corn.

Preferably, provide a kind of method reducing An-1 genetic expression in plant, described method comprises:

(1) disturbing molecule of interference An-1 genetic expression is proceeded to plant tissue, organ or seed, obtain the plant tissue, organ or the seed that are transformed into described disturbing molecule; With

(2) plant tissue having proceeded to described disturbing molecule step (1) obtained, organ or seed regeneration plant.

As the preferred example of one, described method comprises step:

I () provides the Agrobacterium of carrying the carrier that can disturb genetic expression, described carrier is selected from lower group:

(a) An-1 gene containing opposite direction startup or the carrier of gene fragment (antisense molecule);

B () disturbs the carrier of the disturbing molecule of the composition of An-1 genetic expression (or transcribing) containing forming specificity in plant materials;

(ii) tissue of plant or organ or seed are contacted with the Agrobacterium in step (i), thus make described carrier proceed to plant tissue or organ or seed.

Preferably, described method also comprises:

(iii) plant tissue having proceeded to described carrier or organ or seed is selected; With

(iv) by the plant tissue in step (iii) or organ or seed regeneration plant.

Other method suppressing An-1 gene or its homologous gene to be expressed is that this area is known.

The present invention also comprises the plant utilizing any one method aforementioned to obtain, and described plant comprises: proceeded to An-1 gene or its homogenic transgenic plant; Or the plant etc. that An-1 expression amount (comprise low expression or do not express) reduces.

Any suitable conventional means can be adopted, comprise reagent, temperature, pressure condition etc. and implement described method.

In addition, the invention still further relates to and utilize An-1 gene to mark as a kind of tracking of gene transformation progeny of plants.The invention still further relates to and utilize An-1 gene as a kind of molecule marker, by detecting An-1 expression conditions in plant, the awns proterties of plant identification, seed morphology, seed amount proterties, fringe type structure.Also can utilize the cue mark of plant correlated character characteristic as hybrid true in hybrid seeding process of An-1 gene-correlation.

In a particular embodiment of the present invention, utilized the method for map based cloning to clone to control the An-1 gene that paddy rice awns grows, utilized genetic transformation to verify this gene.To the near isogene type system (NIL-An-1) of An-1 gene, the transgenic line phenotype of An-1 complementation (CPL) and process LAN (OX) is investigated, find that An-1 causes long awns phenotype and makes particle elongated, reduce number of grain per ear simultaneously.The transfer-gen plant of RNAi then causes contrary phenotype.Further experiment display, the up-regulated of An-1 reduces single plant yield; The down-regulated expression of An-1 then adds single plant yield.In the near isogene type system with wild-rice An-1 gene, scanning electron microscope display is when the SP6 phase of Spikelet development, and outer thin membrane inside rush stalk top is because cell continues division and extends to form Mang Yuanji, and in the former base of awns, cell divides further and causes awns former base continuation extension.The in situ hybridization display of An-1 gene, An-1 is in the SP6 phase of Spikelet development, and the former base top of thin membrane inside rush stalk starts strong expression outside, and its expression is continued until SP8 late period phase, and this species specific expression causes the initial sum of the former base of awns to extend.The up-regulated expression of An-1 gene causes cell to continue division, and the up-regulated of regulation and control histone h1 and H4, also causes the elongated of particle.An-1 gene is also expressed in young fringe, and its rise expressed can cause the downward of an important phytokinin regulatory gene LOG to express, thus causes the minimizing of number of grain per ear.Relatively wild-rice An-1 and cultivated rice an-1 sequence find, Main Differences is present in promoter region.The present inventor also finds that An-1 drops on paddy rice and is subject to strongly taming selected zone (domestication sweeps), show this gene in domestication, become a main alternative, reason of searching to the bottom may be the output reducing paddy rice while An-1 causes awns to grow.Therefore the genotype an-1 be fixed in cultivated rice causes baldness shape and improves output simultaneously, meets the needs of agriculture production.

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, conveniently condition such as J. Pehanorm Brooker etc. is write usually, Molecular Cloning: A Laboratory guide, the third edition, Science Press, the condition described in 2002, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number calculate by weight.

I, materials and methods

1, experiment material

Have for the rice material of An-1 location and functional study in experiment: without the long-grained nonglutinous rice Guanglu ai 4 (Guangluai4 of awns, GLA4), having the monosome of awns to replace is SL4, the single slice having awns is replaced is CSSL-Z3 and the near isogenic line NIL-An-1 having awns.

SL4 is provided by Japanese plant's genome center, is with GLA4 genetic background, rice chromosome the monosome that substitutes by common wild-rice (Oryza rufipogon) W1943 replace system, to backcross BC at wild-rice W1943 and long-grained nonglutinous rice GLA4 ₄f ₂obtained by molecular marker screening in colony.

CSSL-Z3 is that SL4 and long-grained nonglutinous rice GLA4 backcross BC ₅f ₃the single slice obtained by molecular marker screening replaces system, is W1943 fragment between molecule marker IN6298-IN6265, covers main effect awn length site An-1.

NIL-An-1 is by CSSL-Z3 × GLA4BC ₁f ₃in colony, screening obtains GLA4 background, comprises the near isogenic line in An-1 site.

Wild-rice W1943 is available from state-run genetic research institute of Japan.

Kasalath is available from state-run genetic research institute of Japan.

Japan is fine available from Japanese agriculture the Study on Resources institute.

2, the structure of An-1 Fine Mapping colony

The present inventor utilizes GLA and CSSL-Z3 to hybridize and constructs 1 Fine Mapping colony, hybridization F ₁represent type identical with CSSL-Z3, selfing obtains F ₂comprise the large group of 10500 individualities, phenotype has been separated into awns and without awns, has carried out identified gene type to it, and the recon obtained is transplanted to field, investigates phenotype.

3, the screening of wild-rice BAC and preparation

The BAC library of application common wild-rice W1943, is kept in 80 piece of 384 orifice plate.By pcr amplification, can all there is the single BAC of amplification by Stepwise Screening in two differing moleculars mark.Utilize the BAC of QIAGEN company to extract test kit and carry out BAC DNA preparation.

4, wild-rice BAC checks order and gene annotation

Adopt shotgun method to check order to selected wild-rice BAC, carry out gene annotation with the software of GENESCAN.

5, An-1 transgene carrier builds

(1) the complementary plasmid (pCPL) of An-1 builds

Screen and extract the wild-rice W1943BAC comprising An-1 gene, the genome sequence utilizing BamHI enzyme to cut back to close 10kb long fragment to comprise An-1 upstream region of gene 6kb to downstream 0.5kb, be connected on carrier pCAMBIA1301 carrier, build An-1-CPL plasmid, i.e. pCPL.

(2) the process LAN plasmid (pOX) of An-1 builds

Over-express vector used take pCAMBIA1300 as skeleton, utilize corn Ubquitin promotor as promotor, be terminator with NOS terminator, and before terminator, with the addition of the HAtag sequence of one section of about 90bp, cDNA inserts can form fusion rotein with it.This fragment sequence, as SEQ ID NO:20 (wherein 1-1980 position is corn UBI promotor, and 2105-2360 position is NOS terminator, and 2000-2104 is HAtag sequence), inserts pCAMBIA1300 multiple clone site HindIII/EcoRI site.

After wild-rice W1943An-1ORF being connected to the UBI promotor of PNCGR, build An-1-pOX carrier respectively, i.e. pOX.

Wherein, with wild-rice W1943cDNA for template, amplification W1943An-1ORF, its upstream primer is AGGCGCGCCTGGCAGGCTGTCCCGTGTCT (SEQ ID NO:6); Downstream primer GGGGTACCGCT GGCTCGGCCTTCATGTG (SEQ ID NO:7).

(3) the RNA interference plasmid (pRNAi) of An-1 builds

The rna interference vector used is pTCK303 (available from Plants of Beijing institute).The 282bp cDNA sequence (part of 3 ' UTR) of An-1 gene is bidirectionally coupled on pTCK303 carrier, builds An-1-RNAi carrier, i.e. pRNAi.

282bp cDNA sequence following (SEQ ID NO:5):

GGTTTTCCAAGGCTTAACTTTTTCCAGATGCAGTGTCATATTGTTTAGGCAAAGAACTTGTTTTGATGTTGTG?ATGCTTGTAGGACAGAGGAGTATATGTGTAGTATGTCTGGAAATGGCAAGGCAGGGGAGCTGTGTGACCTT?TGTGTGTGCTGGTTGCATGCCCTAACTGTAGAAAAAAAAAAGAGGAGGATTGTGCTAGTGATGTTAGTAGT?GGTAGTGGCTTTGTAGGATTTGGCATGCATGGGGATGTATGTACTATGTATGTAGAGATTGGAGAGG

This 282bp cDNA sequence forward connects into the BamHI/KpnI site of carrier, and Opposite direction connection enters the SpeI/SacI site of carrier.

(4) the promoter GUS vector construction of An-1

Promoter GUS carrier used is pCAMBIA1300GN:GUS.Choose An-1ATG upstream 2kb or 6kb fragment, before SmaI and XbaI directed cloning to the gus gene in pCAMBIA1300GN carrier (available from Shanghai plant physiological ecology institute woods letter a surname laboratory), build An-1::GUS carrier.

Wherein, with wild-rice W1943 genome for template, amplification An-1ATG upstream 2kb or 6kb fragment primer are respectively:

The upstream primer of amplification An-1ATG upstream 6KB fragment: TTTTGCTTACGCGTTTGTTG TGTTG (SEQ ID NO:8); Downstream primer TCCCCCGGGGTGGTTGACCGTTATATAAG A AA (SEQ ID NO:9).

The upstream primer of amplification An-1ATG upstream 6KB fragment: ACGCGTCGACCAGTTGAAG AAAAAGGATCCAG (SEQ ID NO:10); Downstream primer TCCCCCGGGGTGGTTG ACCGTTA TATAAGAAA (SEQ ID NO:11).

6, agriculture bacillus mediated rice transformation

The method that Transgenic Rice adopts is Agrobacterium-mediated genetic transformation method, and the agrobacterium strains adopted is EHA105.PCPL and pOX is fine for transforming Japan, and pRNAi is for transforming Kasalath.

7, panicled characters is investigated and the scanning of grain type

(1) ponder the Grain in Ear of parent and transfer-gen plant and examine

The investigation of awn length proterties: after single-strain seed maturation, get its main fringe and measure all Primary branch tops grain awn length and get the awn length that its mean value represents whole fringe, each strain gets 20 individualities, the awn length scope of record parent.

There is the investigation of awns rate: after seed maturity, get the main fringe of individual plant, add up total grain number and the grain number having awns, have awns grain number divided by total grain number, be awns rate.Each strain gets 20 individualities, calculating mean value.

(2) panicled characters is investigated

Get different three tassels of tillering on an individual plant when Grain Filling of Rice later stage, tassel also do not turn yellow and carry out panicled characters investigation.The proterties of paper examines comprises: spike length, Primary branch length, Primary branch number, Secondary branch number, total grain number, the flat grain number that is not in the milk, have awns grain number and top grain awn length.Differing materials gets 20 individual plants, every strain 3 masters tiller on tassel, calculate the mean value of each proterties.

(3) grain type scanning

Seed plumpness can affect grain length, grain is wide, after seed fully matured, individual plant sowing be used for grain type investigate.Each individual plant gets the seed of about 100 at random, uses MICROTEK ScanMaker i800 scanner to carry out a type scanning after going awns.The scan image obtained uses " seed Rice Outer-quality inspection software " to calculate length and the width of each seed, calculating mean value.

8, scanning electron microscopic observation

(1) scanning electron microscopic observation children fringe.

(2) scanning electron microscopic observation seed coat.

9, real-time quantitative PCR

Fresh plant tissue or-80 DEG C of frozen tissue Trizol Reagent extract.DNA in total serum IgE sample after dnase digestion, with the SuperScript of Invitrogen ^tMit is cDNA first chain that II Reverse Transcriptase carries out reverse transcription, is the masterplate of real-time quantitative PCR further.Quantitative PCR adopts Takara company premix Ex TaqTM test kit, Applied Biosystems7500real time PCR instrument is carried out.According to gene order design specific gene primer, select paddy gene eEF-1 α (GenBank accession no.AK061464) as internal reference.

10, the Subcellular Localization of An-1

(1) the GFP fusion protein construction of An-1

The GFP fusion rotein carrier used is PA7-GFP carrier (available from the full laboratory of Shanghai Communications University Yang Hong).Use the forward and reverse primer of PCR (the forward CCGCTCGAGATGAACCCCACCACCG (SEQ ID NO:12) of enzyme-added cut-grafting head; Reverse GGACTAGTACTGGCTCGGCCT TCATGTGGTT (SEQ ID NO:13)) amplification An-1cDNA fragment, double digestion is connected to before the GFP albumen coded sequence of PA7 carrier, builds GFP fusion rotein carrier.

(2) the electroporated onion epidermis cell of particle gun and GFP signal are observed.

11, An-1 yeast one-hybrid checking transcriptional activation activity

(1) structure of An-1 yeast one-hybrid bait carrier

Use the transcriptional activation activity of the yeast-one-hybrid system checking An-1 of Clontech company, build yeast one-hybrid bait carrier with pGBKT7 carrier (Clontech).

According to the cDNA sequence design primer of An-1, increase An-1 total length ORF sequence, N-end protein (N the holds 1-82 position) encoding sequence of An-1 and C-end protein (C holds 82-263 position) encoding sequence respectively, when ensure not frameshit be connected on carrier pGBKT7, receive after GAL4binding domain, be built into yeast one-hybrid bait carrier.

Amplification An-1 total length ORF sequence forward primer CCGGAATTCATGAACCCCACCACCG (SEQ ID NO:14); Reverse primer CGGGATCCTTATGGC TCGGCCTTCATGTGGT (SEQ ID NO:15).

N-end protein (N holds 1-82 position) the encoding sequence forward primer CCGGAATTCATGAACCCCACCACCG (SEQ ID NO:16) of amplification An-1; Reverse primer CGGGATCCTCACGCCCTC ACATGGATGTAGTCTTT (SEQ ID NO:17).

C-end protein (C holds 82-263 position) the encoding sequence forward primer CCGGAATTCAGGCGGGGGCAAGCCA (SEQ ID NO:18) of amplification An-1; Reverse primer CGGGATCCTCACATGGCT CGGCCTTCATGTGGTT (SEQ ID NO:19).

12, paraffin section and in situ hybridization

Material for histological observation and in situ hybridization is fixed with 4% paraformaldehyde, and series of ethanol dewaters, and dimethylbenzene is transparent and be embedded in paraffin.The probe of in situ hybridization marks with the digoxigenin labeled test kit of Roche Holding Ag.The original position justice antisense probe marked is hybridized on the paraffin section of 8-um.

II, embodiment

The Fine Mapping of embodiment 1, wild-rice rice chromosome awn length QTL location and awn length Gene A n-1 and checking

GLA4 is cultivated rice rice variety, and all particles is without awns.SL4 has long awns, and almost all particles has awns.CSSL-Z3 has stable longer awns, and most of seed has awns, has awns rate more than 80%.NIL-An-1 has stable longer awns, and most of seed has awns, has awns rate more than 60% (Figure 1A and 1B).

The present inventor utilizes SL4 × GLA4F ₂colony, totally 255 individualities, wild-rice rice chromosome located two awn length QTL site, respectively called after An-1 and An-2 (Fig. 1 C).An-1 and An-2 is wild-rice W1943 genotype is positive-effect to awns, promotes the growth of awns.Be positioned between molecule marker M6298 and M6285 at the beginning of An-1, the contribution rate for awn length is 52.5%; Be positioned between molecule marker M1108 and M1160 at the beginning of An-2, the contribution rate for awn length is 12%.

CSSL-Z3 is the BC that SL4 and GLA4 backcrosses ₅f ₃in colony, the karyomit(e) single slice obtained through Markers for Detection replaces system.CSSL-Z3 is W1943 genotype between molecule marker M6298-M6265, and all the other backgrounds are that the single slice of GLA4 replaces system.The target group that the present inventor utilizes CSSL-Z3 and GLA4 comprising An-1 site to build, carries out Fine Mapping to awn length Gene A n-1.CSSL-Z3 and GLA4 hybridizes F ₁the phenotype in generation is identical with CSSL-Z3, the long awns of tool, illustrates that An-1 is dominant gene, selfing F ₂the phenotype in generation occurs that long awns is separated with without awns, and segregation ratio meets 3:1, illustrates that An-1 is Dominant gene.The present inventor utilizes CSSL-Z3 × GLA4F ₂fine Mapping colony (comprising 10500 individualities), use molecule marker FM1-9 identified gene type, An-1 navigates between molecule marker FM3 and FM6 the most at last, is 70kb (Fig. 1 D) according to the fine genome sequence of Japan (IRGSP V4.0) Computational Physics distance.The present inventor utilizes FM3 and FM6 to screen wild-rice W9143BAC storehouse, obtains the ORW1943Ba0047B01 corresponding to this region, and has carried out order-checking and gene annotation.In this region, there is very high homology with GLA4 because Japan is fine, do not have other gene to insert.Therefore the present inventor directly to compare in FM3 and FM6 region sequence between Japanese warm and fine W1943, find to there is a lot of insertion and deletion fragment (Fig. 1 E) in this region, this mutual insertion and disappearance cause GLA4 and W1943 to recombinate further in this region comparatively difficulty, therefore cannot reduce orientation range further.

Compare the prediction case of the fine gene of W1943 and Japan in FM3 and FM6 interval, screening obtains 2 candidate genes, one be to cell fission, break up relevant bHLH gene (Os04g0350700), another one is the RF1 gene (Os04g0350133) relevant to mitochondrial function.It is fine that the present inventor constructs complementary Plastid transformation Japan respectively to these two candidate genes.Comprise the not long awns of the complementary Plastid transformation fine transfer-gen plant obtained of Japan of 10kb in RF1 gene regions and upstream promoter district thereof, can not have complementary functions, therefore eliminate the possibility of RF1 alternatively gene.

The 6kb promoter region, upstream choosing candidate's wild-rice W1943 gene bHLH adds whole gene regions, and the complementary fragment of about 10kb is connected to pCAMBIA1301 and builds pCPL plasmid (Fig. 1 F).Construct process LAN plasmid simultaneously, with the cDNA of wild-rice W1943 for template, after the corn UBI promotor ORF of 0.8kb being connected to PNCGR carrier, build pOX plasmid (Fig. 1 F).PCPL and pOX plasmid is transformed respectively Japan fine, T ₀show obvious long awns phenotype for 80%CPL transfer-gen plant and 90%OX transfer-gen plant, have awns rate more than 50%.

Build the RNA interference plasmid of An-1 simultaneously, for template amplification 282bp fragment it is forward and reversely connected to (Fig. 1 F) on pTCK303 carrier with the cDNA of wild-rice W1943.PRNAi Plastid transformation has the rice variety Kasalath of awns, T ₀occur that awns shortens for 50%RNAi plant to tail off.

The above results proves, the gene of An-1 really of Os04g0350700, has the function controlling awns and grow.

Embodiment 2, wild-rice compare with cultivated rice An-1 allelic sequences and the screening of covariation

Domain analyses result shows, and An-1 is a gene containing basic helix-loop-helix (bHLH) conserved domain.The present inventor utilizes 5 ' RACE and 3 ' RACE technology to have increased the full length cDNA sequence of An-1.In W1943, this full length gene cDNA sequence is 1978bp (FO681395) (SEQ ID NO:1), coding 262 amino acid whose albumen (SEQ ID NO:2).In GLA4, this full length gene cDNA is 1979bp (FO681475) (SEQ ID NO:3), coding 263 amino acid whose albumen (SEQ ID NO:4).Both are, 1 in GLA4 difference ^stexon has the insertion of a CCG how to cause a L-Ala, 2 ^ndthere is a SNP in exon and glycine is become L-Ala, two place's differences are all outside bHLH conserved domain.Last disappearance and 1 base replacement (Figure 11 and Figure 12) that there are 2 bases in 3 ' UTR district.

The present inventor utilizes yeast-one-hybrid system to demonstrate An-1 albumen to have transcriptional activation activity (Fig. 2 A).By the laser confocal microscope observation nuclear location of An-1-GFP fusion rotein in onion epidermis cell (Fig. 2 B and 2C).Therefore demonstrating An-1 genes encoding is a bHLH albumen with transcriptional activation activity.

The present inventor is to the fine An-1 Gene sequence comparison of W1943, GLA4 and Japan.Between the Japanese warm and fine GLA4 of sequencing result display, except there are two SNP promoter region, all the other sequences are completely the same.And W1943 and GLA4 compares display, consistent with above-mentioned cDNA difference in the difference of gene regions; Then differ greatly in promoter region, comprise some insertion and deletions and multiple SNP, comprise in Japanese warm and fine GLA4 and have the transposon of a 4.4kb to insert at An-1 transcription initiation site upstream about 40bp.

The present inventor determines the An-1 gene (comprising 4.5kb promoter region and 3.5kb gene regions) of 43 cultivated rice kinds (22 long-grained nonglutinous rices, 21 japonica rice) and 27 wild-rice strains to compare its sequence difference.By gene comparision, find to there is covariation between cultivated rice and wild-rice, comprise 12 SNP, the disappearance of 4 1bp is inserted, and the transposon disappearance of 1 4.4kb is inserted.According to these covariations, the present inventor is divided into the an-1 type of two haplotypes and cultivated rice and the An-1 type (Fig. 3) of wild-rice cultivated rice and wild-rice.Further according to the presence or absence and 2 of transposon ^ndexons 1 bp lacks the presence or absence inserted, and the haplotype of cultivated rice can be further divided into two hypotypes, an-1 (Tn+) and an-1 (G-) (Fig. 3 A and 3B).Most an-1 (Tn+) haplotype (Fig. 3 A) without awns japonica rice with Japanese warm and fine GLA4, and mostly without awns long-grained nonglutinous rice, there is an-1 (G-) haplotype (Fig. 3 B).

Most without in awns long-grained nonglutinous rice, such as HP228,2 ^ndthe disappearance of exons 1 bp causes this genes encoding to frame shift position (framshift), produces a new termination site, causes this genes encoding 97 amino acid whose truncated proteins, and cause this gene afunction in long-grained nonglutinous rice.

But in wild-rice, there is larger variation in An-1 gene.Wherein the strain of about 30% has long-grained nonglutinous rice an-1 (G-) haplotype, other strain genotype includes the covariation in above-mentioned W1943 haplotype, and these covariations possible directly affects the awns phenotypic difference (table 4) of wild-rice and cultivated rice.

Embodiment 3, An-1 promote the growth of awns

In order to study the function of An-1, the present inventor has screened a near isogenic line, NIL-An-1.NIL-An-1 is from CSSL-Z3 × GLA4BC ₁f ₃in colony, screening obtains, and take GLA4 as background, comprises wild-rice 120K fragment (comprising An-1 site).The An-1 near isogenic line that selfing obtains, its awn length is 14.68 ± 2.45mm, and has awns rate to be 52.81 ± 12.8% (Fig. 4 A and 4D).

Consider the impact of the copy number in transfer-gen plant on phenotype, the present inventor utilizes hygromycin resistance sieve method to identify single copy and inserts T ₂for homozygous plants carry out phenotype analytical and other analyze, comprising complementation CPL-1,2, RNAi-1,2,5,6 strains.Process LAN OX then selects T ₀represent OX-1 and OX-5 plant type to analyze.

In transgenosis complement strain, the awn length of CPL-1 and CPL-2 is 31.84 ± 6.36mm and 31.90 ± 6.98mm respectively, and has awns rate to be respectively 54.48 ± 14.41% and 53.21 ± 15.14%.In process LAN strain, OX-1 and OX-5 awn length is 33.82 ± 5.81mm and 34.04 ± 6.99mm respectively, and has awns rate to be respectively 63.41 ± 14.19% and 65.74 ± 16.82%.Its contrast Japan fine (Nipponbare) is substantially without awns (Fig. 4 B and 4E).

For RNAi strain, with Kasalath (awn length 23.30 ± 3.05mm, have awns rate 56.32 ± 4.11%) compare, awn length declines, its length to from 0.82 ± 1.29mm to 9.14 ± 1.87mm, and has awns rate also to decline to be respectively from 4.25 ± 3.44% to 23.84 ± 9.49% (Fig. 4 C and 4F) simultaneously.

Therefore An-1 not only controls awn length but also has controlled awns rate.

Embodiment 4, An-1 promote that paddy rice particle is elongated

In the process that the present inventor investigates at panicled characters, find compared with GLA4, NIL-An-1, except awn length changes, have also appeared a change for the proterties such as type, grain number per spike.Number of grain per ear, grain type size are all closely-related Main Agronomic Characters with rice yield, therefore present inventor has performed detailed examination.

The plumpness of seed can affect a type, after seed fully matured, each material individual plant sowing, after removing the not full seed of grouting, be put into after the seed getting about 100 at random goes awns on scanner and carry out a type scanning, the scan image obtained uses special software to calculate length and the width of every seed.

First statistical is carried out to the grain length of GLA4 and NIL-An-1, find NIL-An-1 particle longer than GLA4 particle by 3.19% (Fig. 5 A and 5D).The particle length 13.90% and 11.97% finer than Japan respectively of CPL1 and CPL2; And the particle of OX-1 and OX-5 length 19.99% and 16.74% (Fig. 5 B and 5E) finer than Japan respectively.The particle of RNAi is but shorter than Kasalath, the different strain particles of RNAi 3.30%-9.60% (Fig. 5 C and 5F) shorter in Kasalath particle respectively.

Embodiment 5, An-1 regulate and control number of grain per ear and single plant yield

Except affecting awn length and grain length, An-1 gene also affects number of grain per ear.Number of grain per ear about 10.58% (Fig. 6 A and 6C) fewer than GLA4 in NIL-An-1.

The present inventor investigates the number of grain per ear of An-1-RNAi, finds compared with Kasalath, and the number of grain per ear of RNAi plant increases 13.60%-38.4% (Fig. 6 B and 6D).

Complementary similar to NIL-An-1 with the situation of process LAN transfer-gen plant.Japan fine usual generation 9.67 ± 1.57 Primary branch, 19.76 ± 3.95 Secondary branch and 111.56 ± 19.29 every fringe particles.In CPL and OX transfer-gen plant, Primary branch and Secondary branch number all reduce, and in CPL and OX transfer-gen plant, Primary branch number is generally 7-8, and Secondary branch number mean value is also at about 7-8.CPL-1 and CPL-2 number of grain per ear is respectively 63.61 ± 9.17 and 68.47 ± 12.19, declines 42.08% and 38.62% respectively compared with fine with Japan.And OX-1 and OX-5 number of grain per ear is respectively 51.79 ± 9.57 and 55.82 ± 14.34, decline compared with fine with Japan 54.58% and 49.96% (Fig. 6 E and 6F) respectively.The present inventor find simultaneously fine with Japan compared with, the transfer-gen plant of CPL and the OX flat grain that is not in the milk increases.

The present inventor compares analysis to the fine single plant yield of CPL and Japan further.Result shows, and compared with fine with Japan, CPL-1 and CPL-2 single plant yield declines 34.83% and 30.80% (Fig. 6 G) respectively.

These phenotypic datas all prove, An-1, except controlling the growth of paddy rice awns, also affects grain number per spike and the grain length of paddy rice.The An-1 gene of wild-rice W1943 makes Primary branch number and Secondary branch number obviously reduce, thus reduces grain number per spike and single plant yield.

An-1 expression level change in embodiment 6, NIL-An-1 and transfer-gen plant

The present inventor gets the young fringe extraction total serum IgE that spike length is less than 4cm, and reverse transcription is cDNA first chain, carries out quantitative PCR analysis as template.Analytical results shows, and An-1 gene is about two times (Fig. 7 A) of GLA4 at the expression level of NIL-An-1.Compared with fine with Japan, in complementary CPL-1 and the CPL-2 plant of transgenosis, the expression level of An-1 gene has raised 40-45 doubly (Fig. 7 B).Consider that CPL-1 and CPL-2 only comprises the foreign transgenes of a copy, therefore expression amount raises the mainly cause of foreign gene in this genetic background.And in RNAi plant, compared with contrast kasalath, An-1 down regulation of gene expression, lowers degree consistent with phenotype degree (Fig. 7 C).Expression level change combines display with phenotype, and An-1 gene expression dose and awn length and grain length positive correlation, then present negative correlation with number of grain per ear.

Research display in the past, these two genes of LOG and Gn1a directly affect the concentration of phytokinin and control the grain number per spike of paddy rice.LOG genes encoding enzyme, the phytokinin of catalysis non-activity becomes activated phytokinin; And Gn1a encoding cytokinin oxidases 2 (OsCKX2), degradation of cell mitogen.Because number of grain per ear in CPL plant declines serious, the present inventor have detected CPL and Japan fine in the expression level of LOG and OsCKX2.Find in the young fringe being less than 1cm, in CPL-1 and CPL-2, the expression level of LOG gene drops to the half (Fig. 7 D) in only having Japan fine; OsCKX2 express CPL and Japan fine between then there is no considerable change.

Embodiment 7, An-1 gene guide the growth of cell fission and awns

The flower of paddy rice is made up of four-wheel: outermost one is taken turns and comprised lemma and glumelle, and second takes turns and be made up of two lodicules, and third round is made up of six stamens, and interior wheel is gynoecium.According to the division to paddy rice Spikelet development period such as Ikeda, Spikelet development is divided into 8 periods: the former base of Sp1 phase sterile lemma is formed; The former base of Sp2 phase sterile lemma is formed; The former base of Sp3 phase lemma is formed; The former base of Sp4 phase glumelle is formed; The former base of Sp5 phase lodicule is formed; Sp6 phase stamen retrogressive is formed; Sp7 phase carpellary primordia is formed; Sp8 phase ovule and pollen formation.The floral organ ripening stage is entered, i.e. the In8 phase after spike length 4cm.

Scanning electron microscopic observation shows, and the former base of Sp4 phase glumelle forms (Fig. 8 A1 and 8B1), until Sp6 phase stamen retrogressive is formed, the spikelet sprimordium of GLA4 and NIL-An-1 does not morphologically have difference (Fig. 8 A2 and 8B2) substantially.Occur change when the Sp7 phase that carpellary primordia is initial, the lemma top yearning of NIL-An-1 extends to form Mang Yuanji (Fig. 8 B3), and (Fig. 8 A3) is not obviously extended in the lemma top in GLA4.Early stage to Sp8, time flower glume starts to close, the former base of ovule is formed, can see that the lemma top of GLA4 is not still extended, form a circular structure (Fig. 8 A4) and the former base of the awns of NIL-An-1 continues elongation (Fig. 8 B4).In the fringe being greater than 4cm, start to enter the little floral organ ripening stage, i.e. Sp8 late period, now the awns of NIL-An-1 very long (Fig. 8 B5), and the lemma tip of GLA4 terminates as bran point (Fig. 8 A5).

In order to probe into An-1 in the developmental function of awns, the present inventor adopts RNA hybridization in situ technique to detect the expression of An-1 at small ear different development stage.In Spikelet development, An-1 has expression at sterile lemma and the former base of sterile glume, the former base of flower glume (Fig. 8 C1 and 8D1), stamen retrogressive (Fig. 8 C2 and 8D2) and carpellary primordia subsequently (Fig. 8 C3 and 8D3).An-1 is early stage at Spikelet development, and the expression in GLA4 and NIL-An-1 does not have too big-difference.Difference is from the Sp6 phase, the expression of An-1 starts on the lemma top of NIL-An-1 to strengthen (Fig. 8 D2), subsequently at the former base strong expression of awns (Fig. 8 D3), this strong expression lasts till SP8 early stage (Fig. 8 D4), then weakens gradually (Fig. 8 D5) in the Sp8 later stage.In GLA4, the expression of An-1 is always more weak and relatively evenly (Fig. 8 C2-C3), but but do not express (Fig. 8 C4) on lemma top, in the Sp8 later stage, the expression of An-1 almost disappears in flower glume, mainly has obvious signal (Fig. 8 C5) at flower pesticide and carpel place.

Tissue slice observation and comparison shows, and in the small ear in Sp8 late period, NIL-An-1 awns primordial cell number is (Fig. 8 E1 and 8F1) more than three times of GLA4 small ear bran tip Cells number, therefore can think that the growth of awns is directly related with cell fission.

Histone H1 and H4 expressed in the cell cycle G1 phase-S phase, and their expression is often used as fissional marker.The situ Analysis of Histone H4 shows, before the Sp6 phase, Histone H4 all has expression in the former base of all floral organs of GLA4 and NIL-An-1, does not have notable difference (Fig. 8 E2 and 8F2).In the Sp7 phase, the former base top of NIL-An-1 lemma starts outwardly, and Histone H4 has very high expression on the former base of flower glume, stamen retrogressive and awns; And in GLA4 low in the expression amount of the former base of small ear lemma is than NIL-An-1 (Fig. 8 E3 and 8F3).Early stage at Sp8, Histone H4 expresses comparatively strong in the stamen retrogressive of GLA4 small ear, and the expression of the former base of flower glume starts to weaken; And very strong expression (Fig. 8 E4 and 8F4) is still had on the stamen of NIL-An-1 little Hua, flower glume and the former base of awns.In the Sp8 later stage, Histone H4 is very low at expression amount in GLA4 and NIL-An-1 flower glume, substantially only also has in stamen and carpel and expresses (Fig. 8 E5 and 8F5).

These results suggest that, in NIL-An-1, An-1 is at the most advanced and sophisticated specifically expressing of lemma, and cause the most advanced and sophisticated cell of lemma to continue division, cell number increases, and guides the initial sum of the former base of awns to extend further.Therefore the high expression level of An-1 is that in the former base of awns, cell continues the basis divided.And in cultivated rice GLA4, the expression of An-1 is got rid of from lemma tip by the genotype of an-1, thus cause the most advanced and sophisticated cell of lemma to lose splitting ability, produce without awns phenotype.

Embodiment 8, An-1 regulating cell divide thus affect particle length

Rice paddy seed is wrapped up by clever shell, is divided into glumelle and lemma, and the size of clever shell is the important factor affecting grain type.Silicidize cell forms the epidermis of clever shell, has sharp projection in grid-like, has hard epidermal hair, shows regular array at seed, plays protection supporting function.

The gene relevant to grain type can affect the size of seed usually by the cell quantity or cell size regulating and controlling clever shell; the such as disappearance of qSW5 gene function makes the quantity of surface silicon keratinocyte cells increase; PGL2 gene overexpression makes clever hülle cell length increase, and causes a type elongated.Whether the present inventor studies An-1 further affects grain length by the number change controlling clever hülle cell.The present inventor gets An-1 transfer-gen plant and it transforms the mature seed of parent, comprises CPL-1 and Japan is fine, RNAi-6 and Kasalath, uses the method for scanning electron microscope to observe seed-coat, investigates the change of statistics silicidize cell number.Statistics seed lemma is near the capable silicidize cell number of flower glume line of delimitation 10-11, because locating near bran point at it, a vascular bundle on lemma forms a projection easily identified at its terminal, and unified this projection of choosing is as statistics boundary (Fig. 9 A).

First, compare RNAi-6 and Kasalath seed coat silicidize cell, find that the size of cell does not have considerable change (Fig. 9 B and 9C).And Cytometric result is presented at RNAi-6 seed coat cell number than Kasalath minimizing 9.68% (Fig. 9 D).Quantitative PCR shows, and compared with Ksalath, RNAi-6 is less than expression level decline about 50% (Fig. 9 E) of Histone H1 in 4cm children fringe.

Then, compare CPL-1 and Japan fine seed coat silicidize cell, find that their cell size does not have considerable change (Fig. 9 F and 9G) equally.Cytometric result display CPL-1 seed coat cell number is than Japanese fine increase by 14.16% (Fig. 9 H).Quantitative PCR shows, and compared with fine with Japan, the expression amount that CPL-1 is less than Histone H1 in 4cm children fringe raises (Fig. 9 I) more than 2 times.In situ hybridization is presented in the small ear in Sp8 late period, and Histone H4 does not still almost express (Fig. 9 J) at CPL-l continuous expression (Fig. 9 K) in Japan is fine.

So when An-1 up-regulated expression, (in CPL-1 plant) continues to carry out causing seed lemma silicidize cell number significantly to become many due to cell fission, causes particle elongated.And (in RNAi plant) cell fission minimizing causes seed lemma silicidize cell number obviously to reduce when An-1 lowers expression, seed is caused to shorten.

Embodiment 9, the An-1 expression in inflorescence and the relation of number of grain per ear

Paddy rice inflorescence development is divided into 9 periods by the people such as Ikeda.Early stage at inflorescence development, the expression pattern of An-1 in GLA4, NIL-An-1 and CPL-1 is not obviously distinguished.Formed at the former base of In-1 phase sepal, apical meristem changes rachis meristematic tissue into.An-1 is in the faint expression in rachis meristematic tissue top layer (Figure 10 A and 10E) of GLA4 and NIL-An-1; And in CPL-1, not only expression amount rises An-1 but also its expression expands to (Figure 10 I) in marrow and provascular strand tissue by top layer.In the In2-In3 phase, An-1 starts to express in the former base of the Primary branch of GLA4 and NIL-An-1, expression amount medium (Figure 10 B and 10F) then strong expression (Figure 10 J) in CPL-1.In the In5 phase when Secondary branch is initial, An-1 expresses (Figure 10 C, 10G and 10H) in the former base of the Secondary branch of GLA4, NIL-An-1 and CPL-1.Initial from In-6 phase spikelet sprimordium, the expression of An-1 is transferred in the spikelet sprimordium of GLA4, NIL-An-1 and CPL-1 and is expressed (Figure 10 D, 10H and 10L).At all developmental stages, the expression of An-1 is slightly higher than GLA4 in NIL-An-1, and expresses the strongest at CPL-1, expressed in situ result and real-time quantitative PCR result very identical.

The present inventor compares the expression pattern of OSH1 and An-1 gene at NIL-An-1 further.In the In1-In5 phase, OSH1 gene is expressed consumingly in rachis meristematic tissue, the former base of Primary branch and the former base of Secondary branch (Figure 10 M-10O), and the also faint expression in these tissues of An-1 gene.Their differential expression appears at the In6 phase, and OSH1 only expresses An-1 in small ear meristematic tissue and then starts to express (Figure 10 D and 10P) in the former base of floral organ.Although two genes have common expression pattern in early days at inflorescence development, the fringe portion phenotype of NIL-An-1 and transfer-gen plant phenotype illustrate, the effect of An-1 in maintenance meristematic tissue attribute is contrary with OSH1.

In sum, while the expression pattern of An-1 and expression amount, change causes the change of fringe portion phenotype in NIL-An-1 and transfer-gen plant.

Sum up

The present inventor has cloned wild-rice An-1, and this gene has pleiotropy, controls the growth of paddy rice awns, grain length and number of grain per ear simultaneously.Introduce when this gene and can cause long awns phenotype without awns cultivated rice and increase grain length, but cause number of grain per ear to reduce and single plant yield decline simultaneously.The expression amount of An-1 and the appearance of expression pattern to these phenotypes extremely important.The expression of An-1 gene upregulation can maintain cell fission, increases cell number, thus the growth of induction awns and grain length increase, and therefore An-1 is a Cell cycle regulatory proteins.An-1 gene is up-regulated expression in the former base of rachis meristematic tissue, Primary branch and Secondary branch, together with time lower the expression of phytokinin regulatory factor LOG, thus cause the minimizing of number of grain per ear and the decline of single plant yield.Therefore An-1 is an important artificial selection gene, is subject to strong selective pressure.And in cultivated rice two kinds of haplotypes, japonica rice an-1 (Tn+) reduces its expression level and changes expression pattern, long-grained nonglutinous rice an-1 (G-) loses gene function, such change causes the forfeiture of awns and the increase of number of grain per ear, thus cause the increase of output, reach the object of domestication.

The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (12)

1. regulate and control a method for cereal crop economical character and/or yield traits, it is characterized in that, described method comprises: the expression regulating An-1 gene in cereal crop.

2. the method for claim 1, is characterized in that, described cereal crop is grass; Preferably, described grass is paddy rice, barley, wheat, oat, rye; And/or

Described economical character comprises: awns proterties, seed morphology, seed amount proterties, fringe type structure.

3. the method for claim 1, is characterized in that, described An-1 genes encoding:

A () is as the polypeptide of SEQ ID NO:2 or SEQ ID NO:4 aminoacid sequence;

B SEQ ID NO:2 or SEQ ID NO:4 aminoacid sequence are formed through the replacement of one or more amino-acid residue, disappearance or interpolation by (), and have the polypeptide derivative by (a) of (a) polypeptide function; Or

C peptide sequence that () and (a) limit has more than 80% homology and has the polypeptide derivative by (a) of (a) polypeptide function.

4. the method for claim 1, is characterized in that, described method comprises: the expression reducing An-1 in cereal crop; Thus:

Increase yield;

Reduce grain length;

Increase every fringe seed grain number;

Increase every cladus stalk number;

Shorten the awn length of seed; And/or

Subtracting oligospermously has awns rate.

5. method as claimed in claim 4, is characterized in that, in described reduction cereal crop, the expression of An-1 gene comprises:

By lowering An-1 genetic transcription, the lower adjustment of protein expression or protein-active proceeds in cereal crop; Preferably, described lower adjustment is the disturbing molecule of specificity interference An-1 genetic transcription.

6. method as claimed in claim 5, it is characterized in that, described disturbing molecule be with An-1 gene or its transcript for suppressing or dsRNA, antisense nucleic acid, siRNA, the Microrna of reticent target, maybe can express or be formed the construction of described dsRNA, antisense nucleic acid, siRNA, Microrna; Preferably, described disturbing molecule is using SEQ ID NO:1 or SEQ ID NO:3 as the dsRNA of reticent target or construction.

7. the method for claim 1, is characterized in that, described method comprises: the expression improving An-1 gene in cereal crop, thus:

Increase the grain length of seed;

Reduce every fringe seed grain number;

Reduce every cladus stalk number;

Increase the awn length of seed; And/or

What increase seed has awns rate.

8. method as claimed in claim 7, is characterized in that, comprising: An-1 gene is proceeded to cereal crop, obtains the cereal crop transformed.

9. a purposes for An-1 gene, for regulating and controlling cereal crop economical character or yield traits; Described economical character comprises: awns proterties, seed morphology, seed amount proterties, fringe type structure.

10. a purposes for An-1 gene, for the molecule marker as qualification cereal crop economical character or yield traits; Described economical character comprises: awns proterties, seed morphology or plumpness proterties, seed amount proterties, fringe type structure.

11. 1 kinds of materials reducing An-1 genetic expression, it is characterized in that, described material contains the structure shown in formula (I):

Seq _forward-X-Seq _oppositelyformula (I),

In formula (I), Seq _forwardfor the polynucleotide shown in SEQ ID NO:5, Seq _oppositelyfor with Seq _forwardcomplementary polynucleotide; With

X is for being positioned at Seq _forwardand Seq _oppositelybetween intervening sequence, and described intervening sequence and Seq _forwardand Seq _oppositelynot complementary.

12. 1 kinds of purposes reducing the material of An-1 genetic expression, for regulating plant economical character or yield traits; Comprise:

Increase yield;

Reduce grain length;

Increase every fringe seed grain number;

Increase every cladus stalk number;

Shorten the awn length of seed; And/or

Subtracting oligospermously has awns rate.