CN113493786A - Method for improving rice grain traits by blocking or weakening expression of OsMIR3979 in rice - Google Patents
Method for improving rice grain traits by blocking or weakening expression of OsMIR3979 in rice Download PDFInfo
- Publication number
- CN113493786A CN113493786A CN202010265162.3A CN202010265162A CN113493786A CN 113493786 A CN113493786 A CN 113493786A CN 202010265162 A CN202010265162 A CN 202010265162A CN 113493786 A CN113493786 A CN 113493786A
- Authority
- CN
- China
- Prior art keywords
- osmir3979
- rice
- crispr
- gene
- editing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Abstract
The invention belongs to the technical field of plant biology, and particularly relates to a method for improving rice grain characters. The technical problem to be solved by the invention is to improve the rice grain character and further improve the rice yield. The technical scheme for solving the technical problem is to provide a method for improving the rice grain character. The method improves the rice grain character by blocking or weakening the expression of OsMIR3979 in rice. The method has simple steps, is easy to operate, and has good prospects in the aspects of rice quality improvement and genome function research and application.
Description
Technical Field
The invention belongs to the technical field of plant biology, and particularly relates to a method for improving rice grain traits by blocking or weakening expression of OsMIR3979 in rice.
Background
Small RNA (microRNA, miRNA) is a kind of endogenous non-coding small RNA with a regulation function in organisms, and the size of the small RNA is mostly 19-24 nucleotides (nt). In eukaryotic plants, mirnas are mostly encoded by independent genes, and within the nucleus the miRNA gene is transcribed by RNA polymerase II into a longer primary transcript (primary miRNA), followed by processing into a miRNA precursor (pre-miRNA) containing only stem-loop structures, and subsequently the pre-miRNA is further processed to form a mature miRNA. The mature miRNA molecule is combined with the mRNA of a target gene under the mediation of a RISC complex (RISC), so that the degradation of the mRNA of the target gene or the inhibition of the translation of the mRNA of the target gene is caused, and the regulation and control of the gene expression of the target gene at the level after transcription are realized.
Researches show that plant miRNA is an important regulation factor in the growth and development process of the plant miRNA, and plays an important role in aspects of morphogenesis, signal transduction, metabolism, nutrient absorption, hormone regulation, biotic and abiotic stress response and the like. Theoretically, the miRNA coding gene has the potential of providing rich gene resources for plant genetic improvement, but based on the particularity of the molecular mechanism of the genome structure and function realization of the miRNA, the current miRNA (especially plant miRNA) research mainly focuses on the aspects of high-throughput sequencing identification of miRNA molecules, miRNA differential expression comparison, miRNA target gene identification, miRNA over-expression analysis and the like, the definite identification of the related biological functions of the miRNA molecules is very limited due to the lack of effective mutant materials, and the foundation and application research of the plant miRNA coding gene are limited to a great extent.
Recently, a target gene analog (TM) or short tandem target analog (STTM) strategy is used for miRNA molecular function research, and a miRNA derepression influence degree on a target gene is evaluated by obtaining a material interfering (or blocking) a target miRNA, so as to analyze miRNA molecular functions. In addition, RNA function interference research based on CRISPR-Cas13 is reported at present.
CRISPR-Cas9 is a gene editing system, and the creation of a mutant for knocking out plant miRNA encoding genes based on a CRISPR-Cas9 method is reported before. And the CRISPR-Cas12a (CRISPR-Cpf1) system is a new gene editing system discovered in recent years. Different from CRISPR-Cas9, due to the characteristics or advantages that the CRISPR-Cas9 has a PAM recognition site of a T/A enrichment region, guide RNA is a single crRNA molecule with a simple structure, a sticky end is generated, a deleted fragment is large (mostly 6bp-13bp), and the like, the method is expected to have specific advantages for directionally editing miRNA coding genes. However, at present, the work of specifically editing and creating mutant for plant miRNA coding genes based on CRISPR-Cas12a, effectively analyzing the biological functions corresponding to miRNA, and further excavating plant miRNA sites with breeding value is not reported.
The rice OsMIR3979 gene is a rice miRNA found based on high-throughput sequencing, and no report on the function is found at present.
Disclosure of Invention
The technical problem to be solved by the invention is to provide a method for improving the rice grain character, so as to improve the rice yield.
The technical scheme for solving the technical problem is to provide a method for improving the rice grain character. The method improves the rice grain character by blocking or weakening the expression of OsMIR3979 in rice.
Wherein, the blocking or attenuating of OsMIR3979 expression in rice can be performed by knocking out rice OsMIR3979 encoding gene or interfering with OsMIR3979 encoding gene expression product.
The method for interfering the action of the OsMIR3979 expression product comprises at least one of an RNA interference method, an antisense RNA method, a target gene analogue (TM) method short tandem target analogue (STTM) method or a CRSPR-Cas13 method.
The method for knocking out the gene coding for OsMIR3979 in the rice genome comprises at least one of a genome editing method, a homologous recombination method and a random insertion mutation method.
The genome editing method described in the above method includes at least one of Meganuclease (Meganuclease), ZFN, TALEN, and CRISPR-Cas.
Wherein, when the CRISPR-Cas method is used for knocking out the OsMIR3979 encoding gene in the rice genome in the method, the method comprises the following steps:
a. designing a guide RNA aiming at a rice OsMIR3979 encoding gene;
b. constructing a Cas gene editing expression vector capable of expressing the guide crRNA;
c. b, transforming rice by using the expression vector obtained in the step a, and obtaining a transformed plant by using a CRISPR-Cas gene editing system;
d. collecting the seeds of the transformed plants, and screening the seeds of the rice OsMIR3979 encoding gene directional editing mutant to obtain the rice mutant with improved grain properties.
Wherein, the CRISPR-Cas method for knocking out the OsMIR3979 encoding gene in the rice genome in the method comprises at least one of CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b and the like.
Furthermore, the nucleotide sequence of the guide RNA for the rice OsMIR3979 encoding gene in the above method is shown as Seq ID No.2 (sequence 5'-TTGGATCTCTCTCTCCCTTGAAG-3'). The guide RNA is used in the CRISPR-Cas12a gene editing system.
Wherein the method for improving the rice grain traits is at least one of thousand kernel weight, grain length and grain width.
On the basis, the invention provides application of a reagent for blocking or weakening the expression of OsMIR3979 in rice in improving the rice grain traits.
Wherein the agent for blocking or attenuating the expression of OsMIR3979 in rice comprises at least one of an agent for knocking out the gene encoding OsMIR3979 of rice or an agent for interfering with the expression product of the gene encoding OsMIR 3979.
The reagent for interfering the action of the OsMIR3979 expression product comprises a reagent for weakening the action of the OsMIR3979 expression product by at least one of an RNA interference method, an antisense RNA method, a CRISPR-Cas13 method, a target gene analogue (TM) method, a short tandem target analogue (STTM) method or a CRISPR-Cas13 method.
The agent used for reducing the effect of the OsMIR3979 expression product by the RNA interference method in the above-mentioned uses includes siRNA (small interfering RNA), antisense RNA, target gene analogs, short tandem target analogs, guide RNA for CRISPR-Cas13 method, against the OsMIR3979 expression product.
Wherein, the reagent for reducing the expression of the rice OsMIR3979 in the application comprises a reagent for knocking out an OsMIR3979 encoding gene in a rice genome.
Further, the agent for knocking out an OsMIR 3979-encoding gene in a rice genome described in the above-mentioned uses includes at least one of a Meganuclease for Meganuclease (Meganuclease) method, a ZFN protein for ZFN method, a TALEN protein for TALEN method, a guide RNA for CRISPR-Cas method, a recombinant DNA fragment for homologous recombination method, or a T-DNA (Transfer DNA ) or transposon for random insertion mutation method for the OsMIR 3979-encoding gene.
Further, the nucleotide sequence of the crRNA used in the CRISPR-Cas12a method in the application is shown as Seq ID No. 2.
Meanwhile, the invention also provides a guide RNA aiming at the rice OsMIR3979 encoding gene. Further, the coding nucleotide sequence of the guide RNA was 5'-TTGGATCTCTCTCTCCCTTGAAG-3' (Seq ID No. 2).
Meanwhile, the present invention provides a vector loaded with the above crRNA.
Further, the vector is a Cas editing expression vector for a CRISPR-Cas gene editing technology. Preferably, the CRISPR-Cas gene editing technology is CRISPR-Cas12a technology.
The invention has the beneficial effects that:
the invention provides a method for improving rice grain traits, which improves the rice grain traits by blocking or weakening the expression of OsMIR3979 in rice. Knocking out the encoding gene OsMIR3979 of rice or influencing the effect of the expression product of the encoding gene OsMIR3979 is two main modes for blocking or weakening the expression of OsMIR3979 in rice. In the embodiment of the invention, the rice mutant with obviously increased thousand kernel weight, length and width of the rice grains is obtained by knocking out the encoding gene OsMIR3979 of the rice, which shows that the grain properties of the rice mutant are greatly improved, and the feasibility of improving the grain properties of the rice by blocking or weakening the expression of OsMIR3979 in the rice is fully demonstrated. The method has simple steps, is easy to operate, and has good prospects in the aspects of rice quality improvement and genome function research and application.
Drawings
FIG. 1 shows a schematic diagram of the stem-loop structure of OsMIR3979 locus (MI0017251) in rice genome (mature OsMIR3979-5p (MIMAT0019673) in underlined capital region and mature OsMIR3979-3p (MIMAT0019674) in underlined lowercase region)
FIG. 2 shows the structure of the T-DNA region of the Cas12a backbone vector (pTX377) and OsMIR3979 editing vector (pTX377_ OsMIR3979) for rice genome editing
FIG. 3 shows molecular identification of OsMIR3979 editing vector (pTX377_ OsMIR3979) part of rice T0 generation transformed plants (A, positive PCR detection result of OsMIR3979 editing vector transformation; B, identification result of SSCP of OsMIR3979 editing site of rice genome (bold underlined plant is candidate editing mutant plant), C, sequencing result of PCR amplification product Sanger of OsMIR3979 site of rice candidate editing mutant (bold is LbCas12a editing recognition sequence PAM site, italics is crRNA sequence, underlined is rice OsMIR3979-5p mature body sequence (MIMAT0019673)
FIG. 4 shows the phenotype and genotype identification of rice OsMIR3979 editing mutant T3 generation plant kernel (A, rice OsMIR3979 site editing mutant plant OsMIR3979 site PCR amplification product Sanger sequencing result (bold is LbCas12a editing recognition sequence PAM site, italics is crRNA sequence, underlined is rice OsMIR3979-5p mature body sequence (MIMAT0019673), B, rice wild type plant (OsMIR3979_ WT) and rice OsMIR3979 site editing mutant plant (OsMIR 3979-M1, M2, M3) T3 generation plant kernel comparison result, Bar is 10mm)
FIG. 5 Rice OsMIR3979 editing mutant T3 generation plant kernel key agronomic trait identification (A, thousand kernel weight, n ═ 3; B, kernel length, n ═ 10; C, kernel width, n ═ 10; extreme significant difference, p < 0.001; extreme significant difference, p < 0.01;. significant difference, 0.01< p <0.05)
Detailed Description
At present, most of plant miRNA molecules recorded in plant miRNA public database miRBase (http:// www.mirbase.org/index. shtml) are obtained based on small RNA high-throughput sequencing, and no specific biological function experiment result exists. One piece of rice miRNA molecular information OsMIR3979 found based on high-throughput sequencing is annotated with the length of precursor sequence of 114bp, and the accession number of miRBase is MI 0017251.
By jointly searching the public database of NCBI nucleic acids and the rice genome database (https:// rapdb.dna. affrc. go. jp/; http:// rice. plant biology. msu. edu), it was found that OsMIR3979, which is an accession to miRBase, is located in the 19480150bp-19480263bp interval of rice chromosome 11, and the annotation information in this interval is non-coding RNA (NCBI accession number: XR-003239228). Further data retrieval shows that the biological function of the rice OsMIR3979 is not reported in a public way except for sequencing data.
On the basis of carrying out a large amount of work of directionally editing mutant creation aiming at unknown biological function miRNA coding genes of rice in the earlier stage of the invention, the invention knocks out the OsMIR3979 coding gene in the rice by a genome editing technology, and the result shows that plants with obviously improved grain agronomic characters are obtained, and the improved characters are embodied in the increase of thousand kernel weight, the increase of grain length and the increase of grain width of grains.
Based on the experiments, the close correlation between the OsMIR3979 encoding gene of the rice and the agronomic characters of rice grains is demonstrated, the expression of the OsMIR3979 in the rice is blocked or weakened, and the agronomic characters of the grains can be effectively improved.
Therefore, the invention establishes and discloses a novel method for improving the rice grain character. The method improves the agronomic characters of grains by blocking or weakening the expression of an OsMIR3979 encoding gene in rice.
It is known that the genes encoding mirnas will first give primary transcripts (pri-mirnas) during expression, and then be processed into miRNA precursors (pre-mirnas), which are then further processed into mature mirnas. The mature miRNA molecules can exert the biological functions thereof. Obviously, any step in the whole process of OsMIR3979 encoding gene expression is influenced, so that the effect of an OsMIR3979 expression product can be reduced, and the agronomic characters of rice grains can be improved. Knocking out the encoding gene OsMIR3979 of rice or interfering the effect of the expression product of the encoding gene OsMIR3979 is two main modes for blocking or weakening the expression of the encoding gene OsMIR3979 in rice in the field.
For those skilled in the art, there are several existing methods for interfering with the action of OsMIR3979 expression product, that is, with the biological function of OsMIR 3979.
For example, antisense RNA method can be used to design antisense RNA for OsMIR3979, thereby achieving the purpose of reducing the biological function of OsMIR3979 and improving the rice grain character.
In recent years, target gene analog (TM) and short tandem target analog (STTM) approaches have also been developed in the art to interfere with (or block) the effects of target mirnas. Obviously, after reading the invention, those skilled in the art can design a target gene analog or a tandem target analog to reduce the biological function of OsMIR3979 and improve the rice grain trait.
In recent years, the CRISPR-Cas13 method is applied as a newly developed editing tool for RNA, and a person skilled in the art can understand that the CRISPR-Cas13 method can be used for blocking or weakening the effect of an expression product of an OsMIR3979 encoding gene.
While the other direction starts with influencing the transcription of OsMIR 3979. At present, the most common method is to knock out the OsMIR3979 encoding gene from the genome, and the adopted technical means are a genome editing method, a homologous recombination method, a random insertion mutation method and the like.
When the homologous recombination method is used, a specific recombinant DNA fragment can be designed and replaced into a genome through homologous recombination, so that the rice does not express the OsMIR3979 encoding gene. In the random insertion mutation method, a T-DNA (Transfer DNA) insertion mutation method, a transposon insertion mutation method, or the like can be used, and similar effects can be achieved.
In recent years, genome editing techniques have been attracting much attention in the art. Meanwhile, currently, genome Meganuclease (Meganuclease) methods, ZFN (zinc finger nuclease) methods, TALEN (Transcription activator-like effectors) methods, and CRISPR-Cas methods are commonly used as genome editing techniques for gene knockout. The methods can be used for the creation of rice directional editing mutants with OsMIR3979 encoding genes knocked out, and mutant plants with improved grain properties are obtained.
Meanwhile, the method can be used for blocking or weakening the expression of the OsMIR3979 in the rice to improve the agronomic traits of the rice seeds of any rice variety.
Meanwhile, the invention also provides application of the reagent for blocking or weakening the expression of the OsMIR3979 in the rice to improving the rice grain traits.
These agents include, on the one hand, various types of molecules that interfere with and make difficult the OsMIR3979 expression product to function normally, including but not limited to RNAi molecules, antisense RNA molecules, target gene analog (TM) molecules, short tandem target analog (STTM) molecules designed against OsMIR3979 expression product, guide RNA for CRISPR-Cas13 method.
On the other hand, the gene coding for OsMIR3979 in the rice genome can be knocked out by the gene. These agents include, but are not limited to, Meganuclease for Meganuclease (Meganuclease) method, ZFN protein for ZFN method, TALEN protein for TALEN method, guide RNA molecule for CRISPR-Cas method, recombinant DNA fragment for homologous recombination method, or T-DNA (Transfer DNA) molecule or transposon molecule for random insertion mutation method against OsMIR3979 encoding gene.
The CRISPR-Cas method for knocking out the coding gene currently has a plurality of specific technical systems such as CRISPR-Cas9, CRISPR-Cas12a and CRISPR-Cas12b, and when the method is implemented by the technical personnel in the field, the targeted editing work of the OsMIR3979 coding gene can be easily carried out according to the requirements of each specific technology.
In one embodiment of the invention, a specially designed guide RNA for the gene encoding rice OsMIR3979 is used. The nucleotide sequence is 5'-TTGGATCTCTCTCTCCCTTGAAG-3' (Seq ID No.2), and the guide RNA is used for a CRISPR-Cas12a gene editing system to carry out gene editing on the OsMIR3979 encoding gene of rice. Of course, we know that the crRNA molecule specifically functions as a guide RNA in the CRISPR-Cas12a gene editing system.
On the basis, the Cas12a oriented editing expression vector (pTX377_ OsMIR3979) capable of expressing the guide crRNA is also obtained in the embodiment of the invention. Of course, there are many reported alternatives to such Cas12 a-directed editing of the backbone vector of the expression vector. For this crRNA, pTX377, pYPQ230 (TangX, Lowder LG, Zhang T, Malzahn A, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y2017. A CRISPR-Cpf1 system for effective gene editing and transcritical expression in Plants Nature Plants,3: 17018; TangX, Ren Q, Yang L, Bao Y, Zhong Z, He Y, Liu S, Qi C, Liu B, Wang Y, Sreenovic S, Zhang Y, Zhang X, Zhang T, Zhang Y, Zhang Y.2019. simple P2. copy Y, Sreen S, Zhang Y, Zhang X, Zhang T, Zhang Y.2019. simple T2. copy K2. copy system S, Crypton T19S, Cas T19-PAM 19, Cas 5-PAM 5-CP 19. A CRISK 3. A, Sk 3. A, Skyo 3. A, Sk. In one embodiment of the invention, the pTX377 vector is used as a framework vector, so that a good effect is achieved, and the rice OsMIR3979 encoding gene directional editing mutant material with obviously increased thousand kernel weight, grain length and grain width is obtained.
Specifically, the method for preparing the rice OsMIR3979 encoding gene targeted editing mutant material by using the Cas12a targeted editing guide crRNA (OsMIR3979_ crRNA1) to knock out the rice OsMIR3979 encoding gene targeted editing mutant material so as to improve the improved grain traits comprises the following main steps:
a. preparing a Cas12a gene editing expression vector of crRNA with a sequence of Seq ID No. 2;
b. b, transforming rice by using the expression vector obtained in the step a, and obtaining a transformed plant by using a CRISPR-Cas12a gene editing system;
c. and (3) collecting seeds of the transformed plants, and screening the seeds of the rice OsMIR3979 encoding gene directional editing mutant to obtain the rice OsMIR3979 encoding gene directional editing mutant with the rice grains with obviously increased thousand kernel weight, grain length and grain width.
Furthermore, the method of the invention can be carried out according to the following more specific steps:
(1) selection of crRNA target sites
The rice OsMIR3979 coding gene is located on chromosome 11, the 114bp length of the coding sequence of the precursor DNA is annotated as shown in Seq ID No.1, and the stem-loop structure (stem-loop) schematic diagram in the maturation process is shown in FIG. 1. The crRNA sequence is shown as Seq ID No.2, the length is 23bp, the target site is 8bp-30bp in OsMIR3979 precursor sequence shown as Seq ID No.1, and the PAM site is 4bp-7bp (5 '-TTTC-3') in OsMIR3979 precursor sequence. Two single-stranded nucleotide sequences OsMIR3979-crRNA1-F annealing to form cohesive ends were synthesized based on the crRNA sequence design, as shown in Seq ID No.3 and OsMIR3979-crRNA1-R, as shown in Seq ID No. 4.
(2) Cas12a directed editing expression vector construction
OsMIR3979-crRNA1-F and OsMIR3979-crRNA1-R are respectively diluted by 10 times, 10 mu L of each is mixed together and denatured at 98 ℃ for 5min, natural cooling is carried out, and the annealed product is diluted by 20 times. The annealed product was ligated with BsaI-digested backbone vector pTX377 (the structure of the T-DNA region of Cas12a backbone vector pTX377 for editing the rice genome is schematically shown in FIG. 2). Through transformation of Escherichia coli, single colony PCR and sequencing identification, the directionally edited expression vector pTX377_ OsMIR3979 for the rice OsMIR3979 coding gene is obtained, and the structural schematic diagram of the T-DNA region is shown in FIG. 2. Specific methods of construction are described in the literature references (Tang X, Lowder LG, Zhang T, Malzahn A, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y.2017.A CRISPR-Cpf1 system for effective gene evaluation and transcriptional expression in Plants. Nature Plants,3: 17018; Tang X, Ren Q, Yang L, Bao Y, Zhong Z, He Y, Liu S, Qi C, Liu B, Wang Y, Srenovic S, Zhang Y, Zheng X, Zhang T, Zhang Y, Zhang Y.2019.Single transform 2.0system for Robust Cas 19. Biotechnology 1445: 17. Biotechnology 3: 17).
(3) Genetic transformation and molecular identification of rice
The rice OsMIR3979 coding gene directional editing expression vector pTX377_ OsMIR3979 obtains a transformed plant through agrobacterium-mediated rice genetic transformation, screening and regeneration, and extracts single plant DNA for positive identification. PCR amplification is carried out by using designed specific primers OsMIR3979-SSCP-F (shown as Seq ID No.5) and OsMIR3979-SSCP-R (shown as Seq ID No.6), and an OsMIR3979 directional knockout mutant is obtained through SSCP and Sanger sequencing verification. The mutants have the characteristics of obviously increasing the thousand kernel weight, the grain length and the grain width of rice grains.
Rice genetic transformation and molecular characterization specific Process references (Tang X, Lowder LG, Zhang T, Malzahn A, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y.2017.A CRISPR-Cpf1 system for efficacy gene editing and transcription expression in Plants. Nature Plants,3: 17018).
The present invention will be described in further detail with reference to examples.
Example 1 construction of Rice OsMIR3979 encoding Gene CRISPR-Cas12a Directional editing expression vector
(1) crRNA design
The crRNA is designed according to the recognition and cleavage rules of the target site by CRISPR-Cas12 a. According to the rice OsMIR3979 encoding gene annotation precursor sequence (Seq ID No.1), single-stranded nucleotides OsMIR3979-crRNA1-F (Seq ID No.3) and OsMIR3979-crRNA1-R (Seq ID No.4) are designed, and the two single-stranded nucleotides are used for synthesizing a pTX377_ OsMIR3979 vector.
The nucleotide sequence of the precursor sequence of the coding gene of the rice OsMIR3979 is as follows (Seq ID No. 1):
5’-GGTTTTCTTGGATCTCTCTCTCCCTTGAAGGCTATCTCATGGAGGTTTGATGTACACCATTGTTGCCTAAGAAACTGAGAAAGCCTTCGGGGGAGGAGAGAAGCCAAGCAAGCC-3’；
wherein 13bp-32bp is mature OsMIR3979-5p sequence, 85bp-104bp is mature OsMIR3979-3p sequence, and 8bp-30bp is the combination sequence of the crRNA (OsMIR3979_ crRNA1, Seq ID No.2) designed by the invention.
OsMIR3979-crRNA1-F nucleotide sequence (Seq ID No. 3):
5’-agatTTGGATCTCTCTCTCCCTTGAAG-3’。
OsMIR3979-crRNA1-R nucleotide sequence (Seq ID No. 4):
5’-ggccCTTCAAGGGAGAGAGAGATCCAA-3’。
(2) annealing of single-stranded nucleotide sequences
Respectively diluting 10 times of single-stranded nucleotide sequences of OsMIR3979-crRNA1-F and OsMIR3979-crRNA1-R at the upstream and downstream of the target site, respectively taking 10 mu L of each single-stranded nucleotide sequence, denaturing at 98 ℃ for 5min, naturally cooling, and diluting 20 times of annealed products for later use.
(3) Enzyme digestion, glue recovery, connection
The backbone vector used in the experiment was pTX377, constructed by the laboratory from the literature (Tang X, Lowder LG, Zhang T, Malzahn A, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y.2017.A CRISPR-Cpf1 system for effective genetic evaluation and transcriptional expression in Nature Plants,3: 17018; Tang X, Ren Q, Yang L, Bao Y, Zhang Z, He Y, Liu S, Qi C, Liu B, Wang Y, Srenov S, Zhang Y, Zhang X, Zhang T, Qi Y, Zhang Y.2019. simple transform SPcrit 2. script 2. 0. 92. script 2. 27. CA 19. Cas 19. 27. Biotechnology Cas 19. 11. Cas X, Zhang Y, Zhang Q, Zhang Y, Zhang X, Zhang Y, Zhang Y.2019. simple gene, PCR 2. 53. copy). pTX377 was digested with BsaI, and the establishment of the digestion system and the digestion conditions were carried out according to the restriction enzyme instruction of Thermo Scientific Co. The specific enzyme digestion system is as follows: 10 XFast digest buffer 5. mu.L, plasmid DNA or PCR product 10. mu.L (1.0. mu.g-1.5. mu.g), restriction enzyme 1. mu.L, ddH2O to 50. mu.L.
Reacting in a constant temperature incubator at 37 ℃ for 2h, adding 10 mu L of 6 × loading buff after the reaction is finished, carrying out 1% agarose gel electrophoresis, cutting the gel and recovering.
The digestion recovery product of pTX377 is connected with the annealing dilution product of OsMIR3979-crRNA1-F, OsMIR3979-crRNA1-R, and the connection system and conditions are referred to the specification of T4 DNA ligase of New England Biolabs company, wherein the specific connection system is as follows: 2. mu.L of 10 XT 4 DNA ligase reaction buffer, 1. mu.L of T4 DNA ligase, 5. mu.L of pTX377 cleavage product, 5. mu.L of annealing product, and 20. mu.L of ddH 2O.
(4) Transformation of E.coli
(5) Colony PCR
Single colonies on LB plates were picked with sterilized toothpicks and dissolved in 50. mu.L ddH2In O water, PCR amplification was performed using the bacterial solution as a template. A25 uL system was used, as follows: 10 XPCR Buffer 2.5. mu.L, dNTP 0.5. mu.L, OsMIR3979-crRNA 1-F0.5. mu.L, ZY010-R1 (5'-AAGACCGGCAACAGGATTC-3') 0.5. mu.L, Taq DNA enzyme 0.2. mu.L, Template 1. mu.L, ddH2O19.8. mu.L. The PCR procedure was: 94 ℃, 5min → (94 ℃, 30s → 56 ℃, 30s → 72 ℃, 10-60s)32 cycles → 72 ℃, 5min → 10 ℃, 5min (Taq DNA enzyme, dNTP, etc. available from tiangen bio). After completion of PCR, 5. mu.L of 6 Xbromophenol blue was added and detected by agarose gel electrophoresis.
(6) Plasmid extraction-sequencing verification
The correct single clone was confirmed by colony PCR, and the Plasmid in the bacterial solution was extracted by shaking LB containing 50mg/Lkan, and the Plasmid DNA was extracted according to the AXYGEN AxyPrepTM Plasmid Miniprep Kit. The extracted plasmid was sent to Scout Biotechnology Limited for sequencing verification. A targeted editing expression vector pTX377_ OsMIR3979 for the coding gene of rice OsMIR3979 was obtained, and the schematic diagram of the T-DNA region structure thereof is shown in FIG. 2.
Example 2 Agrobacterium-mediated genetic transformation of Rice
Agrobacterium-mediated transformation of Rice genetic transformation specific Process references (Tang X, Lowder LG, Zhang T, Malzahn A, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y.2017.A CRISPR-Cpf1 system for efficacy gene mapping and transcription expression in Plants Nature Plants,3: 17018).
The genetic transformation steps of the rice are as follows: shelling and sterilizing mature seeds of rice (Nipponbare); inoculating the disinfected seeds on an N-6-D solid culture medium containing 0.4% gellan gum, and continuously culturing for 1-5 days at 32 ℃ by illumination; transferring the plasmid pTX377_ OsMIR3979 into rice by the cultured seeds through an agrobacterium-mediated transformation method, and continuously culturing the transformed rice seeds in an induction selective medium at 32 ℃ for 2 weeks; transferring the callus generated by proliferation into a RE-III culture medium; transfer of young plants produced from callus into HF medium induced root production. And when the obtained resistant regenerated seedlings grow to about 15cm, cleaning the root culture medium with clear water, transplanting the seedlings into nutrient soil, and culturing in a greenhouse.
Example 3 molecular characterization of Rice OsMIR 3979-encoding Gene-directed editing mutants
(1) Extraction of rice seedling genome DNA
The DNA extraction of the rice seedlings adopts a CTAB method, and the specific operation steps are as follows: preheating CTAB extracting solution in a water bath kettle at 65 ℃. Taking a single leaf, putting the single leaf into a 2mL centrifuge tube with steel balls, putting into liquid nitrogen for quick freezing, and then shaking into powder. Adding 500 mu L of preheated CTAB extracting solution, and carrying out water bath at 65 ℃ for 30-50 min, wherein the mixture is fully and uniformly mixed. Add 500. mu.L of chloroform: isoamyl alcohol (24: 1), mixing by thoroughly inverting, and centrifuging at 10000rpm for 10min at 4 deg.C. Taking supernatant, adding isopropanol with the same volume for precipitation, and precipitating for 30 min-2 h at-20 ℃. The precipitate was collected by centrifugation at 12000rpm for 10min at room temperature. The supernatant was removed, rinsed with 75% ethanol and centrifuged at 12000rpm for 2 min. The supernatant was removed and the DNA was air-dried. Adding 30-50 mu L ddH2O dissolving DNA, and storing in a refrigerator at-20 ℃ for later use.
(2) Positive detection of rice seedling transgene
Intron-F1 (5'-ttctgatcctctccgttcct-3') and ZY010-R1 are used for PCR amplification, the size of an amplified fragment is 1068bp, a PCR amplification system and a reaction program are the same as those of a colony PCR reaction, and the result of gel electrophoresis of a part of PCR products is shown in figure 3A.
(3) SSCP-based directed editing mutant genotyping
Firstly, PCR is carried out to amplify a target fragment, then a PCR product is denatured, and preliminary screening of mutants is carried out through polyacrylamide gel electrophoresis. Specific methods are described in the literature references (Zheng XL, Yang SX, Zhang DW, Zhang ZH, Tang X, Deng KJ, Zhou JP, Qi YP, Zhang Y.2016.effective screen of CRISPR-Cas9-induced microorganisms in plant Cell Reports,35(7): 1545-) 1554). The specific operation steps are as follows:
the genomic DNA of the T0 positive plant transformed by the rice pTX377_ OsMIR3979 obtained by detection is subjected to PCR amplification by primers OsMIR3979-SSCP-F (5'-GGTTAGTACTTCTACTTACTACAT-3', Seq ID No.5) and OsMIR3979-SSCP-R (5'-AACAATCAGGTAATCTATATTTTT-3', Seq ID No.6), and the length of the amplified fragment is 300 bp. The PCR amplification system and the reaction procedure are the same as before. Adding 5 μ LPCR product into 5 μ L SSCP denaturant, mixing, and denaturing at 95 deg.C for 5 min; and (5) after the denaturation is finished, quickly putting the mixture into an ice box, and cooling for 10 min. Preparing 15% PAGE (29: 1) gel by the following method: 21mL of Acr/Bis (29: 1) gelatin solution, 150. mu.L of 10% Aps and 10. mu.L of TEMED, and rapidly stirring and mixing uniformly for injecting gelatin. After the gel is solidified, performing electrophoresis for about 20min at the constant current of 45mA at the temperature of 4 ℃. Then, the power was turned off, and 5. mu.L of each denatured sample was sequentially applied. And performing constant current electrophoresis at 4 ℃ for 4-5 h at 45 mA. Unloading the glue, and washing for 2-3 times by using water; dyeing: adding AgNO3 dye solution, and dyeing for 10 min; color development: adding NaOH color developing agent, and placing in a shaking table for color development for about 5min until clear strips are seen; after the completion of the dyeing, the reaction was immediately stopped by rinsing with water. And (4) observation: the glue is laid on the lamp box, observed and photographed.
The results of the SSCP of the directional editing mutant of part of the rice OsMIR3979 coding gene are shown in FIG. 3B: the bands of the single strains OsMIR3979-2-1, OsMIR3979-2-4 and OsMIR3979-5-1 are inconsistent with the wild type (OsMIR3979_ WT), the bands are preliminarily shown to be candidate editing mutants of the rice OsMIR 393979 encoding gene, and the CRISPR-Cas12 editing system is shown to carry out directional editing mutation on the rice genome OsMIR3979 encoding gene.
(4) Sequencing verification of candidate editing mutant of rice OsMIR3979 encoding gene
Extracting genome DNA of a rice OsMIR3979 encoding gene candidate editing mutant single plant which is obtained by screening SSCP and is different from the wild type, carrying out PCR amplification by using primers OsMIR3979-SSCP-F and OsMIR3979-SSCP-R (the primer sequences are respectively shown in Seq ID No.5 and Seq ID No.6), and carrying out Sanger sequencing on PCR amplification products by a Ducheko biological company.
The sequencing results of the candidate editing mutant Sanger of part of rice OsMIR3979 coding gene are shown in figure 3C, and single strains OsMIR3979-2-1, OsMIR3979-2-4 and OsMIR3979-5-1 are all OsMIR3979 coding gene double allelic mutations.
(5) Agronomic trait identification of rice OsMIR3979 encoding gene editing mutant
And collecting T1 seeds from related rice OsMIR3979 encoding gene targeted editing mutant T0 individuals identified by Sanger sequencing, and carrying out bagging continuous selfing single-grain passage. The method is characterized in that T3 generation homozygous mutant editing individuals of OsMIR3979-M1, OsMIR3979-M2 and OsMIR3979-M3, which are obtained through homozygous editing mutation of an OsMIR3979 encoding gene and do not contain pTX377_ OsMIR3979 vector transgenic components, and the genotype, the thousand grain weight, the grain length and the grain width agronomic characters of the editing results of the OsMIR3979 generation individual plant OsMIR3979 encoding sites are further identified: as shown in FIG. 4A, OsMIR3979-M1 is a 10bp deletion homozygous mutation, OsMIR3979-M2 is a 6bp deletion homozygous mutation, and OsMIR3979-M3 is a 9bp deletion homozygous mutation; as shown in fig. 4B: compared with wild type (OsMIR3979_ WT) materials, the T3 generation homozygous mutant of OsMIR3979-M1, OsMIR3979-M2 and OsMIR3979-M3 has obviously increased grain length and grain width of the edited single plant; as shown in fig. 5: compared with wild type (OsMIR3979_ WT) materials, the T3 homozygous mutant editing individual grains of OsMIR3979-M1, OsMIR3979-M2 and OsMIR3979-M3 have the advantages that the thousand kernel weight, the grain length and the grain width are remarkably increased, the average thousand kernel weight is increased from 25.61g to 27.09g, 26.04g and 27.24g respectively, the average grain length is increased from 7.51mm to 7.62mm, 7.60mm and 7.92mm respectively, and the average grain width is increased from 3.30mm to 3.40mm, 3.39mm and 3.45mm respectively.
Experimental results show that the rice OsMIR3979 encoding gene directional editing expression vector pTX377_ OsMIR3979 constructed on the basis of the constructed wizard RNA (OsMIR3979_ crRNA1) can effectively obtain the OsMIR3979 encoding gene directional editing mutant rice material without transgenic components, realize the remarkable increase of thousand kernel weight, kernel length and kernel width of the kernels, and further improve the yield and quality of the rice.
Claims (14)
1. A method for improving rice grain traits is characterized by comprising the following steps: the expression of OsMIR3979 in rice is blocked or weakened, and the rice grain character is improved.
2. The method of claim 1, wherein: the blocking or weakening of the expression of OsMIR3979 in rice is performed by knocking out the encoding gene of OsMIR3979 of rice or interfering the action of the expression product of the encoding gene of OsMIR 3979.
3. The method of claim 1, wherein: the method for interfering the action of the OsMIR3979 encoding gene expression product comprises at least one of an RNA interference method, an antisense RNA method, a CRISPR-Cas13 method, a target gene analogue method or a short tandem target analogue method.
4. The method of claim 1, wherein: the method for knocking out the OsMIR3979 encoding gene in the rice genome is carried out by at least one of a genome editing method, a homologous recombination method or a random insertion mutation method; preferably, the genome editing method includes at least one of Meganuclease (Meganuclase) method, ZFN method, TALEN method or CRISPR-Cas method.
5. The method of claim 4, wherein: when the CRISPR-Cas method is used for knocking out the gene coding the OsMIR3979 in the rice genome, the method comprises the following steps:
a. designing a guide RNA aiming at a rice OsMIR3979 encoding gene;
b. constructing a Cas editing expression vector capable of expressing the guide RNA;
c. b, transforming rice by using the expression vector obtained in the step a, and obtaining a transformed plant by using a CRISPR-Cas gene editing system;
d. collecting seeds of the transformed plants, and screening out rice OsMIR3979 encoding gene directional editing mutant seeds to obtain rice mutants with improved seed properties;
preferably, the CRISPR-Cas method comprises at least one of CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12 b.
6. The method of claim 5, wherein: the nucleotide sequence of the guide RNA aiming at the rice OsMIR3979 encoding gene in the step a is shown as Seq ID No. 2.
7. The method of claim 1, wherein: the rice grain trait is at least one of thousand kernel weight, grain length and grain width.
8. The application of the reagent for blocking or weakening the expression of OsMIR3979 in rice in improving the rice grain traits.
9. Use according to claim 8, characterized in that: the reagent for blocking or weakening the expression of OsMIR3979 in rice comprises at least one of a reagent for knocking out the encoding gene of OsMIR3979 of rice or a reagent for interfering with the expression product of the encoding gene of OsMIR 3979.
10. Use according to claim 9, characterized in that: the reagent for interfering the OsMIR3979 encoding gene expression product comprises a reagent used by at least one of an RNA interference method, an antisense RNA method, a CRISPR-Cas13 method, a target gene analogue (TM) method or a short tandem target analogue (STTM) method; preferably, the agent that interferes with the action of an OsMIR3979 expression product comprises at least one of siRNA (small interfering RNA), antisense RNA, target gene analogs, short tandem target analogs, guide RNA for CRISPR-Cas13 method to edit OsMIR3979 expression product, to OsMIR3979 expression product.
11. Use according to claim 9, characterized in that: the reagent for knocking out the OsMIR3979 encoding gene in the rice genome comprises at least one of giant nuclease for a giant nuclease method, ZFN protein for a ZFN method, TALEN protein for a TALEN method, guide RNA for editing the OsMIR3979 encoding gene by a CRISPR-Cas method, a recombinant DNA fragment for a homologous recombination method, and T-DNA or transposon for a random insertion mutation method, which aim at the OsMIR3979 encoding gene.
12. Use according to claim 11, characterized in that: the nucleotide sequence of the guide RNA for CRISPR-Cas12a is shown as Seq ID No. 2.
13. A guide RNA for a rice OsMIR3979 encoding gene; preferably, the coding nucleotide sequence of the guide RNA is shown as Seq ID No. 2.
14. A vector loaded with the guide RNA of claim 13; preferably, the vector is a Cas editing expression vector for CRISPR-Cas gene editing technology; more preferably, the CRISPR-Cas gene editing technology is CRISPR-Cas12a technology.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010265162.3A CN113493786B (en) | 2020-04-07 | 2020-04-07 | Method for blocking or weakening expression of OsMIR3979 in rice to improve rice seed shape |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010265162.3A CN113493786B (en) | 2020-04-07 | 2020-04-07 | Method for blocking or weakening expression of OsMIR3979 in rice to improve rice seed shape |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113493786A true CN113493786A (en) | 2021-10-12 |
| CN113493786B CN113493786B (en) | 2023-05-23 |
Family
ID=77994649
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010265162.3A Active CN113493786B (en) | 2020-04-07 | 2020-04-07 | Method for blocking or weakening expression of OsMIR3979 in rice to improve rice seed shape |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113493786B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113493787A (en) * | 2020-04-08 | 2021-10-12 | 电子科技大学 | Method for improving grain traits by blocking or weakening rice OsMIR7695 expression |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892232A (en) * | 2010-06-29 | 2010-11-24 | 清华大学 | miRNA-n3 derived from rice and application thereof |
| CN104278051A (en) * | 2013-07-09 | 2015-01-14 | 中国科学院上海生命科学研究院 | Regulation and control gene of awn, grain length and number of grain per ear and application thereof |
| US20150337332A1 (en) * | 2012-12-18 | 2015-11-26 | University Of Washington Through Its Center For Commercialization | Methods and Compositions to Modulate RNA Processing |
| CN105779492A (en) * | 2016-03-28 | 2016-07-20 | 四川农业大学 | Application of rice miR396c |
| US20160264981A1 (en) * | 2014-10-17 | 2016-09-15 | The Penn State Research Foundation | Methods and compositions for multiplex rna guided genome editing and other rna technologies |
| CN106367435A (en) * | 2016-09-07 | 2017-02-01 | 电子科技大学 | Method for directionally knocking out miRNA (micro Ribonucleic Acid) of paddy rice |
| WO2019238772A1 (en) * | 2018-06-13 | 2019-12-19 | Stichting Wageningen Research | Polynucleotide constructs and methods of gene editing using cpf1 |
-
2020
- 2020-04-07 CN CN202010265162.3A patent/CN113493786B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892232A (en) * | 2010-06-29 | 2010-11-24 | 清华大学 | miRNA-n3 derived from rice and application thereof |
| US20150337332A1 (en) * | 2012-12-18 | 2015-11-26 | University Of Washington Through Its Center For Commercialization | Methods and Compositions to Modulate RNA Processing |
| CN104278051A (en) * | 2013-07-09 | 2015-01-14 | 中国科学院上海生命科学研究院 | Regulation and control gene of awn, grain length and number of grain per ear and application thereof |
| US20160264981A1 (en) * | 2014-10-17 | 2016-09-15 | The Penn State Research Foundation | Methods and compositions for multiplex rna guided genome editing and other rna technologies |
| CN105779492A (en) * | 2016-03-28 | 2016-07-20 | 四川农业大学 | Application of rice miR396c |
| CN106367435A (en) * | 2016-09-07 | 2017-02-01 | 电子科技大学 | Method for directionally knocking out miRNA (micro Ribonucleic Acid) of paddy rice |
| WO2019238772A1 (en) * | 2018-06-13 | 2019-12-19 | Stichting Wageningen Research | Polynucleotide constructs and methods of gene editing using cpf1 |
Non-Patent Citations (1)
| Title |
|---|
| LI HUA等: "Identification of microRNAs in rice root in response to nitrate and ammonium", 《J GENET GENOMICS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113493787A (en) * | 2020-04-08 | 2021-10-12 | 电子科技大学 | Method for improving grain traits by blocking or weakening rice OsMIR7695 expression |
| CN113493787B (en) * | 2020-04-08 | 2023-07-28 | 电子科技大学 | Method for blocking or weakening expression of rice OsMIR7695 to improve seed shape |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113493786B (en) | 2023-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | Engineering non-transgenic gynoecious cucumber using an improved transformation protocol and optimized CRISPR/Cas9 system | |
| CN106367435B (en) | A kind of method that rice miRNA orientation knocks out | |
| CN108642055B (en) | sgRNA capable of effectively editing pig miR-17-92 gene cluster | |
| WO2017028768A1 (en) | Method for obtaining glyphosate-resistant rice by site-directed nucleotide substitution | |
| Wang et al. | Construction of a genomewide RNA i mutant library in rice | |
| CN110551759A (en) | Composition and method for improving recombination efficiency of transgenic cells | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN110684777B (en) | Application of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular stings | |
| CN110541002A (en) | method for constructing zebra fish asap1b gene knockout mutant by using CRISPR/Cas9 technology | |
| CN111206047B (en) | OsSWEET13 gene mutant and application thereof in increasing rice yield | |
| CN113493786B (en) | Method for blocking or weakening expression of OsMIR3979 in rice to improve rice seed shape | |
| CN112175990B (en) | Method for blocking or weakening expression of rice circRNA coding site to improve rice seedling growth traits | |
| CN111909956B (en) | Method for blocking or weakening OsNAC092 gene expression of rice to improve drought resistance of rice | |
| CN113493787B (en) | Method for blocking or weakening expression of rice OsMIR7695 to improve seed shape | |
| CN112226458B (en) | Method for improving rice yield by using rice osa-miR5511 gene | |
| CN112226457B (en) | Application of rice osa-miR5504 gene in rice dwarf breeding | |
| CN115029352A (en) | Method for breeding adgrg1 gene-deleted zebra fish through gene knockout | |
| CN112852805B (en) | Preparation method of rice miRNA homozygous lethal mutant | |
| CN112522299A (en) | Method for obtaining rice with increased tillering by using OsTNC1 gene mutation | |
| CN111621508A (en) | Tobacco terpene synthase NtTPS7 gene and vector and application thereof | |
| CN114891786B (en) | Dog Rosa26 gene and application thereof | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof | |
| CN110129359B (en) | Method for detecting gene editing event and determining gene editing efficiency and application thereof | |
| CN112322622B (en) | Application of lncRNA17978 in improvement of disease resistance of rice | |
| WO2021079759A1 (en) | Method for producing dna-edited plant cell, and kit to be used therein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |