CN101892232A - miRNA-n3 derived from rice and application thereof - Google Patents
miRNA-n3 derived from rice and application thereof Download PDFInfo
- Publication number
- CN101892232A CN101892232A CN 201010221438 CN201010221438A CN101892232A CN 101892232 A CN101892232 A CN 101892232A CN 201010221438 CN201010221438 CN 201010221438 CN 201010221438 A CN201010221438 A CN 201010221438A CN 101892232 A CN101892232 A CN 101892232A
- Authority
- CN
- China
- Prior art keywords
- sequence
- mirna
- rice
- rna
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses miRNA-n3 derived from rice and application thereof. The miRNA-n3 protected by the invention is RNA shown in a sequence 1 of a sequence table. The pre-miRNA-n3 protected by the invention is the RNA shown in a sequence 2 of the sequence table. The invention also protects the application of the RNA shown in the sequence 1 in inhibiting the gene expression of bHLH transcription factors and/or promoting the degradation of mRNA of the bHLH transcription factors, wherein the bHLH transcription factor is shown in a sequence 3 of the sequence table. By using the miRNA-n3, the plant which has important phenotypes in the aspects of growth and development as well as adverse situation stress tolerance is expected to be obtained, thereby having important biological significances and potential application value, providing valuable gene resources for the culturing of rice improved varieties (for example culturing of stress-resistant rice), having important research value and potential social benefits and being applied to the production practice finally.
Description
Technical field
The present invention relates to derive from miRNA-n3 and the application thereof of paddy rice.
Background technology
MiRNA (microRNA, Microrna) is the non-coding small molecule RNA of endogenous strand that a class length is about 20-24nt, in organism, extensively there is (Bartel D P.MicroRNAs:genomics, biogenesis, mechanisms, and function.Cell, 2004,116:281-297.).Studies show that in a large number in recent years, miRNA can regulate and control many expression of gene in the organism, grow in adjusting, cell proliferation, apoptosis, resist all many-sides such as environment-stress (Bushati N that plays a significant role, Cohen S M.MicroRNA functions.Annu.Rev.Cell Dev.Biol., 2007,23:175-205.; Jin Longguo, Wang Chuan, Liu Jinyuan. Plant MicroRNA. Chinese biological chemistry and molecular biosciences journal, 2006,22:609-614.).Mirnas of plant is mainly by cutting target gene mRNA, or suppress said target mrna and translate, regulating and control plant individual grows and influences its physiological process, it is a kind of new gene regulating pattern, have important Research Significance (Voinnet O.Origin, biogenesis, andactivity of plant microRNAs.Cell, 2009,136:669-687.).
Paddy rice is not only one of most important food crop in the world, also is a kind of important model animals simultaneously, particularly occupies critical role in the monocotyledons research at plant research.Had been found that the paddy rice miRNA gene of a great deal of at present, but the paddy rice miRNA gene dosage of finding also is the part of whole miRNA gene numbers in the organism, may still exist the undiscovered miRNA of a large portion, they are generally non-conservative on structure or sequence, express to have the characteristics of low abundance, tissue specificity or inducing specific.This also points out us certain particular growth of paddy rice period, some particular organization, certain special coercing under the treatment condition, by up-to-date technique means, still is expected to find the new miRNA of this condition specifically expressing.And find miRNA in the paddy rice as much as possible, have realistic meaning for forming process, constructional feature and the functional mechanism of overall understanding paddy rice and even whole plants miRNA.
China is the maximum country of world population, also is main rice production and consumption state simultaneously, and paddy rice has critical role for China.Both at home and abroad except utilizing the conventional breeding means, progressively use genetic engineering technique to rice quality (output, pest-resistant, drought resisting etc.) carry out genetic improvement and become a kind of trend.Because miRNA has regulating and controlling effect widely to plant, become one of primary study gene of genetic modification of plants probably, therefore press for by the large scale sequencing method and fully excavate and develop the new miRNA gene that belongs to national intellecture property, thereby be that later stage orderly improvement and the rice varieties of cultivating the high-quality proterties lay the foundation.
Summary of the invention
The purpose of this invention is to provide the miRNA-n3 and the application thereof that derive from paddy rice.
The sequence following (5 ' → 3 ') of the miRNA-n3 of the present invention's protection:
CUUCGGGGGAGGAGAGAAGC (sequence 1 of sequence table).
MiRNA-n3 precursor (pre-miRNA-n3) sequence following (5 ' → 3 ') of the present invention's protection:
GGUUUUCUUGGAUCUCUCUCUCCCUUGAAGGCUAUCUCAUGGAGGUUUGAUGUACACCAUUGUUGCCUAAGAAACUGAGAAAGCCUUCGGGGGAGGAGAGAAGCCAAGCAAGCC。(sequence 2 of sequence table).
The present invention also protects the application of RNA shown in the sequence 1 in suppressing bHLH transcription factor gene (Os02g0178700) expression; Described bHLH transcription factor is shown in the sequence 3 of sequence table.Described bHLH transcription factor gene can be as the sequence 4 of sequence table from shown in 5 ' terminal the 79th to 711 Nucleotide.Described bHLH transcription factor gene also can be shown in the sequence 4 of sequence table.
The present invention also protects the application of RNA shown in the sequence 1 in the mRNA degraded that promotes bHLH transcription factor gene (Os02g0178700); Described bHLH transcription factor is shown in the sequence 3 of sequence table.Described bHLH transcription factor gene can be as the sequence 4 of sequence table from shown in 5 ' terminal the 79th to 711 Nucleotide.Described bHLH transcription factor gene also can be shown in the sequence 4 of sequence table.
RNA shown in the sequence 2 of RNA shown in the sequence 1 of sequence table and/or sequence table can be used for the rice germplasm improvement.
Solexa has overcome the shortcoming of conventional miRNA clone technology, has highly sensitive advantage, can detect a minimum small RNA molecular, and the accuracy height, and the small RNA molecular base error rate that detects is extremely low.This technology also has high-throughput, large-scale characteristics simultaneously, can cover whole genome, and the order-checking amount in two libraries is up to 5,000,000 more than the little RNA sequence.Based on this up-to-date order-checking means, will be expected to discern in the paddy rice the new miRNA of specifically expressing under indiscoverable low abundance in the past or some condition.
The present invention adopts advanced in the world Solexa high throughput sequencing technologies in conjunction with various biological means such as bioinformatic analysis, Northern hybridization, 5 ' RACE, identify miRNA-n3 from genomic level first, and the target gene that confirms miRn3 is the bHLH transcription factor gene, has participated in the regulation and control of development of plants process.Cross the transfer-gen plant of expressing miRNA-n3 and have the variation (length of root hair, the time of blooming etc.) of tangible development, this all will provide valuable genetic resources for the quality breeding (as cultivating the resistance paddy rice) of paddy rice, bring certain researching value and social benefit, and finally be used for actual production.MiRNA wide participation provided by the invention the adjusting of the multiple vital movement of paddy rice, have important biological significance and potential using value.
Description of drawings
Fig. 1 is for separating and identify the schema of new miRNA in the little RNA sequencing data.
Fig. 2 is the precursor secondary structure figure of osa-miRn3; Black line is partly indicated the position at ripe miRNA place.
Fig. 3 detects different concns H for Northern hybridization
2O
2The expression of osa-miRn3 in the rice seedling of handling.
Fig. 4 is target gene 5 ' the RACE checking of osa-miRn3; The arrow of sequence top is represented the site of cutting, and clone's number and the total ratio of clone of cutting takes place at numeric representation this place, point of contact.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is to buy from routine biochemistry reagent shop and obtains.% among the following embodiment if no special instructions, is the quality percentage composition.
Used rice varieties is rice variety 93-11 (Oryza sativa L.ssp indica cv.93-11) in following examples, rice paddy seed is preserved center (Institute of Crop Science, Chinese Academy of Agricultural Science, postcode: 100081 telephone numbers: 010-68919715) available from national farm crop germplasm.This rice varieties is finished gene order-checking work by BeiJing, China Joint Genome Institute.
The discovery of embodiment 1, miRNA-n3
One, H
2O
2Handle
Rice paddy seed is after surface sterilization, and 37 ℃ are soaked 24h, and 45h is sprouted in vernalization then.After the sprouting paddy rice is transferred in the illumination box, the incubator condition enactment is: 28 ℃/21 ℃ of temperature (16h/ 8h at night on daytime), intensity of illumination 400 μ mol/m
2S, relative humidity 70% provides paddy growth required whole nutrition by the Hogland nutritive medium, and nutritive medium was changed once in per 2 days.
The rice seedling in 12 day age adopts H
2O
2Handle: be immersed in 0.6mM, 3.0mM and 15.0mM H respectively
2O
2In the aqueous solution, be immersed in the distilled water rice seedling in contrast; The seedling of various processing places 25 ℃ of shaking tables to handle 6h simultaneously.After disposing, the paddy rice sample of each processing is pressed the 0.5g packing, be stored in behind the liquid nitrogen flash freezer-80 ℃ standby.
Two, the discovery of miRNA-n3
1, RNA extracts
The paddy rice sample is ground in liquid nitrogen, and (Invitrogen) extracts total RNA with the TRIZOL test kit, and operation steps is undertaken by the specification sheets that the TRIZOL test kit carries.Use Ultrospec 3000 type ultraviolet spectrophotometers (Amersham Biosciences) to measure the RNA of extraction at 260nm (OD
260) and 280nm (OD
280) absorbance of wavelength to be to determine purity and the concentration of RNA.Up-to-standard RNA concentration should be more than 1 μ g/ μ l, OD
260/ OD
280Ratio between 1.8-2.0, and clear through the electrophoresis detection band, no obvious degradation and DNA pollute.
2, the structure in little RNA library
The total RNA of the rice seedling that quality test is qualified is used to make up little RNA library.3 kinds of concentration (0.6mM, 3.0mM and 15.0mM) H
2O
2The RNA of the paddy rice sample extraction of handling respectively gets 10 μ g balanced mix, and 30 μ g are used to make up rice seedling H altogether
2O
2The little RNA library of handling.The RNA that control sample extracts gets 30 μ g, is used to make up rice seedling and contrasts little RNA library.The structure in little RNA library carries out according to Illumina Sample Preparation Protocol library constructing method, Solexa high-flux sequence (Huada Gene Research Center, Beijing) is adopted in the library that builds, and obtains the little RNA sequence (two little RNA libraries have all obtained more than 500 ten thousand sequences) of high-quality 18-30nt.
3, reply H in two little RNA libraries
2O
2The evaluation of miRNA
Foreign literature is to successful methods (the Jones-Rhoades M W of high-flux sequence data analysis before the reference, Bartel D P.Computational identification of plant miRNAs and their targets, including a stress-induced miRNA.Mol.Cell, 2004,14:787-799.), set up a cover computer analysis method and be used for finding and identify paddy rice miRNA (analysis process is as shown in Figure 1) in the sequencing data.Original series in two little RNA libraries that 1. will obtain removes 3 ' joint by computer approach, and filters out the sequence of sequence length below 18nt, obtains so-called " totally " sequence library; 2. by SOAP program (Li R, Li Y, Kristiansen K, Wang J.SOAP:short oligonucleotide alignment program.Bioinformatics, 2008,24:713-714.) sequence in " totally " sequence library and paddy rice 93-11 genome (http://rice.genomics.org.cn/rice/) are mated, the sequence that reservation can be mated fully with genome is carried out subsequent analysis; 3. will carry out BLAST with the sequence of genome coupling and the middle paddy rice miRNA mature sequence and the precursor sequence of announcing of miRNA database miRBase (http://microrna.sanger.ac.uk/sequences/) of internal authority, thereby find which sequence comes from known paddy rice miRNA, can not enter next step analysis again with the sequence of known miRNA coupling; 4. with remaining genome matching sequence again with other non-coding RNA database (ftp: //ftp.sanger.ac.uk/pub/databases/Rfam/), the tumor-necrosis factor glycoproteins database (ftp: //ftp.tigr.org/pub/data/TIGR_Plant_Repeats/) and 93-11 protein coding gene database (http://rice.genomics.org.cn/rice/) mate, thereby find which sequence comes from other non-coding RNA, tumor-necrosis factor glycoproteins and protein coding gene, filter out these sequences, may contain new miRNA in the remaining sequence, be called potential miRNA sequence library; 5. the sequence in the potential miRNA sequence library is reverted in the genome, get that each 150nt of this sequence upstream and downstream carries out secondary structure analysis in the genome, meet ripe miRNA requirement if can form good loop-stem structure and its this sequence position in loop-stem structure of similar miRNA precursor (pre-miRNA), then this sequence can be thought candidate's new miRNA; 6. investigate the little RNA distribution characteristics of loop-stem structure precursor at candidate's new miRNA sequence place, if mainly be distributed in candidate's new miRNA zone and corresponding miRNA* zone, think that then this candidate's new miRNA sequence height is credible, be real miRNA sequence (Meyers B C, Axtell M J, Bartel B, Bartel D P, Baulcombe D, Bowman J L, Cao X, Carington J C, Chen X, Green P J, et al.Criteria for annotation of plant microRNAs.Plant Cell, 2008,20:3186-3190.).
Identify 1 new miRNA, called after osa-miRn3 (miRn3; MiRNA-n3).
The sequence of osa-miRn3 following (5 ' → 3 '): CUUCGGGGGAGGAGAGAAGC.
H
2O
2Handle the order-checking number of times (Q in little RNA library
H2O2) be 48, contrast little RNA library (Q
Contrast) the order-checking number of times be 47.
The secondary loop-stem structure of miRNA precursor (pre-miRNA) sequence is one of outstanding feature of miRNA gene, also is all impassable important rule of all miRNA authentication methods.
Osa-miRn3 precursor (pre-osa-miRn3) sequence following (5 ' → 3 '):
GGUUUUCUUGGAUCUCUCUCUCCCUUGAAGGCUAUCUCAUGGAGGUUUGAUGUACA CCAUUGUUGCCUAAGAAACUGAGAAAGCCUUCGGGGGAGGAGAGAAGCCAAGCAAG CC (sequence 2 of sequence table).
Pre-osa-miRn3 can form good loop-stem structure, and sophisticated miRNA produces from the stem of miRNA precursor, meets the constitutional features (see figure 2) of miRNA precursor fully.
Three, miRNA Northern hybridization
In order to verify that further osa-miRn3 has the H of replying
2O
2Expression pattern, adopt miRNA Northern hybridization to detect several H
2O
2The expression of (0,0.6,3.0,15.0mM) miRNA under the concentration of treatment.
1, preparation probe
Detect the sequence of the probe (5 ' → 3 ') of osa-miRn3: GCTTCTCTCCTCCCCCGAAG.
Adopt T4 polynueleotide kinase (New England Biolabs) to above-mentioned sequence terminal phosphate group carry out isotropic substance (γ-
32P ATP) mark obtains probe, with Microspin G-25 post (GE Healthcare) purifying probe, removes unlabelled isotropic substance, and the probe behind the purifying is used for Northern hybridization.
2, miRNA Northern hybridization
In the Northern hybridization, each swimming lane applied sample amount is 20 μ g low molecular weight RNAs, and the U6 gene detects on same film with miRNA as confidential reference items.The probe sequence of U6 gene is: TATGCGTGTCATCCTTGCGCAG.
(1) total RNA of each paddy rice sample of difference extraction step one preparation.
(2) adopt the PEG8000/NaCl precipitator method (the Park W of report such as Park, Li J, Song R, MessingJ, Chen X.CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act inmicroRNA metabolism in Arabidopsis thaliana.Curr.Biol., 2002,12:1484-1495.) enrichment low molecular weight RNA (helping improving the detectivity of miRNA) from total RNA.
(3) miRNA Northern hybridization
1. the low molecular weight RNA of enrichment is dissolved in DEPC water, adds isopyknic 2 * RNA sample-loading buffer (95% methane amide, 18mM EDTA, 0.1% tetrabromophenol sulfonphthalein and 0.1% dimethylbenzene green grass or young crops) again, mixes back 95 ℃ of sex change 5min, obtains the RNA sample.
2. the RNA sample separates with 15% urea-denatured polyacrylamide gel electrophoresis, and electricity consumption transfer device (BIO-RAD) is transferred to Hybond N subsequently
+On the nylon membrane (Amersham Biosciences).
3. shift the RNA sample is arranged nylon membrane through the of short duration rinsing of 6 * SSC solution, UV-crosslinked (Stratagene) 5min, 80 ℃ of baking 2h are completely fixed on the nylon membrane RNA again.
4. the nylon membrane that will shift RNA is put into hybrid pipe, adds 5ml ULTRAhyb-Oligo hybridization solution (Ambion) 42 ℃ of prehybridization 2h in hybrid heater, adds probe then, mixing, and 42 ℃ of hybridization are spent the night.
5. after hybridization finishes, carefully pour out hybridization solution, add the 2 * SSC solution that contains 0.5%SDS, 42 ℃ are washed three times, each 10min.
6. after washing the film end, film is wrapped up smooth being pressed under the X-ray sheet, additional intensifying screen ,-70 ℃ of 1 weeks of exposure with preservative film.
7. behind the end exposure, towards X-ray sheet developing, carrying out densitometric scan, is 1 with the hybridization signal of control group, calculates the relative intensity of each treatment group hybridization signal.
The results are shown in Figure 3.Northern results of hybridization and sequencing data are very identical, and osa-miRn3 is subjected to H hardly
2O
2Abduction delivering has hinted that it may play a part different in oxidative stress.
Target gene prediction and the checking of embodiment 2, miRNA
Because Mirnas of plant and target gene mRNA are close to complementary fully, therefore can predict the target gene of osa-MIRn3 by bioinformatics method.Target gene (the Schwab R of the method prediction miRNA that employing Schwab etc. describes, Palatnik J F, Riester M, Schommer C, Schmid M, Weigel D.Specific effects ofmicroRNAs on the plant transcriptome.Dev.Cell, 2005,8:517-527.).Use the searching in paddy rice 93-11 full-length cDNA and gene pool (http://rice.genomics.org.cn/rice/) of Patscan program to be close to complete complementary cDNA or gene, be the target of miRNA with the miRNA sequence; Parameter is set to: the Patscan program parameter is a default setting, allowing maximum mispairing number is 3, the 10th and 11 bit bases of miRNA do not allow mispairing, the function of target is by NCBI (http://www.ncbi.nlm.nih.gov/) homology search, and the known function gene the highest with homology carries out note.
Predict the outcome and see Table 1.
Target gene and the function of table 1osa-MIRn3
| The miRNA title | The prediction target gene | The target gene function |
| osa-miRn3 | Os02g0178700 | BHLH transcription factor (bHLH transcription factor) |
The target gene of osa-miRn3 is bHLH transcription factor (bHLH transcription factor) gene Os02g0178700 (GENBANK ACCESSION NO.Os02g0178700; See the sequence 4 of sequence table, its encoded protein matter is seen the sequence 3 of sequence table).Such transcription factor plays important regulation in the development of plants process, as the growth of control root hair, the branch growth of adjusting and controlling rice etc.
Osa-miRn3 verifies (Jones-Rhoades M W to the cutting of target gene Os02g0178700 (seeing the sequence 4 of sequence table) mRNA with 5 ' RACE method, Bartel D P.Computational identification ofplant miRNAs and their targets, including a stress-induced miRNA.Mol.Cell, 2004,14:787-799.).After target gene mRNA was cut by miRNA, its comparatively stable 3 ' cleaved products, 5 ' terminal nucleotide phosphoric acid group exposed, and connected last 5 ' RACE special joint with the T4RNA ligase enzyme at this cleaved products 5 ' end; By the synthetic cDNA of reverse transcription reaction; By special nido outer primer of target gene and test kit with the nido outer primer carry out first round PCR, nido inner primer that target gene is special and test kit with the nido inner primer carry out second and take turns PCR; Check order after the PCR product that 5 ' RACE is obtained is connected to pMD 19-T carrier, just can know accurate target gene mRNA cleavage site.
1, extracts total RNA of each paddy rice sample of the step 1 preparation of embodiment 1 respectively.
2, carry out 5 ' RACE by Firstchoice RLM-RACE test kit (Ambion) operation instructions, the sequence of the nido outer primer that target gene is special is: TGCATGGAAATGTAGTTCTCGGCA, the sequence of the nido inner primer that target gene is special is: GGACTTGATGGCACGCTTCCTCTC.
3, the PCR product carries out agarose electrophoresis, reclaims specific band about 170bp (among Fig. 4 shown in the swimming lane 1).
4, the PCR product that reclaims is connected to pMD 19-T carrier (TaKaRa), and transformed into escherichia coli DH5 α (TaKaRa).
5, choose the mono-clonal order-checking, determine the cleavage site of target gene mRNA according to sequencing result.
The cleavage site that the electrophorogram of PCR product and sequencing result show is seen Fig. 4.Cutting is taking place with its complementary zone in the target gene of osa-miRn3, and the strong Os02g0178700 that proved of this result is the target gene (among Fig. 4, two cleavage sites are arranged, the cutting likelihood ratio is 1: 8) of real regulation and control in the osa-miRn3 body really.
Claims (9)
1. the RNA shown in the sequence 1 of sequence table.
2. the application of RNA shown in the sequence 1 in suppressing the expression of bHLH transcription factor gene; Described bHLH transcription factor is shown in the sequence 3 of sequence table.
3. application as claimed in claim 2 is characterized in that: described bHLH transcription factor gene as the sequence 4 of sequence table from shown in 5 ' terminal the 79th to 711 Nucleotide.
4. application as claimed in claim 2 is characterized in that: described bHLH transcription factor gene is shown in the sequence 4 of sequence table.
5. the application of RNA shown in the sequence 1 in the mRNA degraded that promotes the bHLH transcription factor gene; Described bHLH transcription factor is shown in the sequence 3 of sequence table.
6. application as claimed in claim 5 is characterized in that: described bHLH transcription factor gene as the sequence 4 of sequence table from shown in 5 ' terminal the 79th to 711 Nucleotide.
7. application as claimed in claim 5 is characterized in that: described bHLH transcription factor gene is shown in the sequence 4 of sequence table.
8. the RNA shown in the sequence 2 of sequence table.
9. the application of the RNA shown in the sequence 2 of RNA shown in the sequence 1 of sequence table and/or sequence table in the rice germplasm improvement.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010221438 CN101892232B (en) | 2010-06-29 | 2010-06-29 | miRNA-n3 derived from rice and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010221438 CN101892232B (en) | 2010-06-29 | 2010-06-29 | miRNA-n3 derived from rice and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101892232A true CN101892232A (en) | 2010-11-24 |
| CN101892232B CN101892232B (en) | 2013-01-02 |
Family
ID=43101577
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010221438 Expired - Fee Related CN101892232B (en) | 2010-06-29 | 2010-06-29 | miRNA-n3 derived from rice and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101892232B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103288943A (en) * | 2013-06-08 | 2013-09-11 | 清华大学 | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof |
| CN105039337A (en) * | 2015-08-31 | 2015-11-11 | 安徽农业大学 | 5'RACE RNA adapter sequence and kit for amplifying terminal of miRNA sheared target gene cDNA 5' |
| CN113493786A (en) * | 2020-04-07 | 2021-10-12 | 电子科技大学 | Method for improving rice grain traits by blocking or weakening expression of OsMIR3979 in rice |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101487021A (en) * | 2009-02-06 | 2009-07-22 | 中山大学 | Use of miR397 in drought resistance plant cultivation |
-
2010
- 2010-06-29 CN CN 201010221438 patent/CN101892232B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101487021A (en) * | 2009-02-06 | 2009-07-22 | 中山大学 | Use of miR397 in drought resistance plant cultivation |
Non-Patent Citations (2)
| Title |
|---|
| 《中国博士学位论文全文数据库 农业科学辑》 20091015 陈锐 耐旱野生大豆MicroRNA的鉴定与表达分析 D047-53 1-9 , 第10期 2 * |
| 《重庆医学》 20090131 曹学武等 miRNA靶基因实验验证的研究进展 211-213 1-9 第38卷, 第2期 2 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103288943A (en) * | 2013-06-08 | 2013-09-11 | 清华大学 | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof |
| CN103288943B (en) * | 2013-06-08 | 2014-09-10 | 清华大学 | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof |
| CN105039337A (en) * | 2015-08-31 | 2015-11-11 | 安徽农业大学 | 5'RACE RNA adapter sequence and kit for amplifying terminal of miRNA sheared target gene cDNA 5' |
| CN113493786A (en) * | 2020-04-07 | 2021-10-12 | 电子科技大学 | Method for improving rice grain traits by blocking or weakening expression of OsMIR3979 in rice |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101892232B (en) | 2013-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Peláez et al. | Identification and characterization of microRNAs in Phaseolus vulgaris by high-throughput sequencing | |
| Zeng et al. | Identification of cold stress responsive microRNAs in two winter turnip rape (Brassica rapa L.) by high throughput sequencing | |
| Li et al. | Identification and analysis of seven H2O2-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica) | |
| Chen et al. | Identification of aluminum-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing | |
| Huang et al. | A set of miRNAs from Brassica napus in response to sulphate deficiency and cadmium stress | |
| Khan et al. | Comprehensive genome-wide identification and expression profiling of foxtail millet [Setaria italica (L.)] miRNAs in response to abiotic stress and development of miRNA database | |
| Liu et al. | Genome-wide identification and comparative analysis of drought-related microRNAs in two maize inbred lines with contrasting drought tolerance by deep sequencing | |
| Zhang et al. | Genome-wide identification of conserved microRNA and their response to drought stress in Dongxiang wild rice (Oryza rufipogon Griff.) | |
| Liu et al. | micro RNA s contribute to enhanced salt adaptation of the autopolyploid Hordeum bulbosum compared with its diploid ancestor | |
| Kim et al. | Identification and profiling of novel microRNAs in the Brassica rapa genome based on small RNA deep sequencing | |
| CN102277357A (en) | miRNA (Micro Ribonucleic Acid)-GhmiR156 from cotton and application thereof | |
| Zhang et al. | Identification and characterization of microRNAs in the developing seed of linseed flax (Linum usitatissimum L.) | |
| CN101892232B (en) | miRNA-n3 derived from rice and application thereof | |
| Zhu et al. | Small RNA sequencing revealed that miR4415, a legume-specific miRNA, was involved in the cold acclimation of Ammopiptanthus nanus by targeting an L-Ascorbate Oxidase gene and regulating the redox state of apoplast | |
| Li et al. | Computational identification of conserved microRNAs and their targets from expression sequence tags of blueberry (Vaccinium corybosum) | |
| Cao et al. | Drought stress-induced changes of microRNAs in diploid and autotetraploid Paulownia tomentosa | |
| Barnhart et al. | Phenotypic and transcriptomic responses of cultivated sunflower seedlings (Helianthus annuus L.) to four abiotic stresses | |
| Zhang et al. | Functional analysis of three miRNAs in Agropyron mongolicum Keng under drought stress | |
| CN101892233B (en) | Micro ribonucleic acid (miRNA)-397 for responding to hydrogen peroxide (H2O2) and application thereof | |
| Wang et al. | High-throughput sequencing-based genome-wide identification of microRNAs expressed in developing cotton seeds | |
| CN101892231B (en) | MiRNA-408-5p for responding H2O2 and application thereof | |
| CN101899441B (en) | MiRNA-827 responding to H2O2 and application thereof | |
| CN102250899B (en) | MiRNA-GramiRn22 from cotton and applications thereof | |
| CN101921765B (en) | miRNA-169b for responding H2O2 and application thereof | |
| CN103695430A (en) | Osa-miR396d responding to rice black streaked dwarf virus infection, and application and production method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: WUXI APPLICATION TECHNOLOGY RESEARCH INSTITUTE OF Free format text: FORMER OWNER: TSINGHUA UNIVERSITY Effective date: 20130705 Owner name: TSINGHUA UNIVERSITY Effective date: 20130705 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 100084 HAIDIAN, BEIJING TO: 214072 WUXI, JIANGSU PROVINCE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20130705 Address after: 214072 Jiangsu Province Road DiCui Binhu District of Wuxi City No. 100, No. 1 building, 530 floor 12 Patentee after: WUXI RESEARCH INSTITUTE OF APPLIED TECHNOLOGIES, TSINGHUA UNIVERSITY Patentee after: Tsinghua University Address before: 100084 School of life science, Tsinghua University, 1 Haidian District Tsinghua Yuan, Beijing Patentee before: Tsinghua University |
|
| DD01 | Delivery of document by public notice |
Addressee: WUXI RESEARCH INSTITUTE OF APPLIED TECHNOLOGIES, TSINGHUA UNIVERSITY Document name: Notification to Pay the Fees |
|
| DD01 | Delivery of document by public notice |
Addressee: WUXI RESEARCH INSTITUTE OF APPLIED TECHNOLOGIES, TSINGHUA UNIVERSITY Document name: Notification of Termination of Patent Right |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130102 Termination date: 20150629 |
|
| EXPY | Termination of patent right or utility model |