CN103288943B - Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof - Google Patents
Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof Download PDFInfo
- Publication number
- CN103288943B CN103288943B CN201310227604.5A CN201310227604A CN103288943B CN 103288943 B CN103288943 B CN 103288943B CN 201310227604 A CN201310227604 A CN 201310227604A CN 103288943 B CN103288943 B CN 103288943B
- Authority
- CN
- China
- Prior art keywords
- plant
- bhlh13
- resistance
- protein
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a protein bHLH13 (Basic Helix Loop Helix 13) as well as a coding gene and an application thereof. The protein bHLH13 is a protein having one of the following amino acid residue sequences: 1) the amino acid residue sequence shown in SEQ ID No. 2 in a sequence table; and 2) the protein related to the growth, development, disease resistance and insect resistance of plants, and derived from the amino acid residue sequence 1) shown in SEQ ID No. 2 in the sequence table via substitution and/or deletion and/or addition of one or more amino acid residues. The protein and the coding gene thereof disclosed by the invention can be used for cultivating plants with a short growth period or enhanced disease resistance and insect resistance, and lay the foundation for cultivation for transgenic plants.
Description
Technical field
The invention belongs to genetically engineered field, be specifically related to a kind of and growth and development of plants and disease-resistant insect-resistance associated protein and encoding gene and its application.
Background technology
Arabidopis thaliana (Arabidopsis thaliana) belongs to Angiospermae, Dicotyledoneae, Cruciferae.Arabidopis thaliana is the modern international and domestic model plant that carries out plant biology research.The further investigation of arabidopsis gene function will be contributed to the genetic improvement of crop character.
The flowering of plant time is an important phenotype.In agriculture production, the bolting flowering times such as vegetables sooner or later have material impact to agriculture production.Plant directly affects the existence of plant a little less than on the strong resistance of disease and pest.In agriculture production, the resistance of crop to disease and pest, direct relation the output of crop.The crop of cultivating Resistant, can reduce the use of agricultural chemicals, improves output, reduces the negative impact to human health.
Summary of the invention
The invention provides a kind of plant bHLH13 albumen and encoding gene thereof and its application, described bHLH13 dietary protein origin is in Arabidopis thaliana (Arabidopsis thaliana).
An object of the present invention is to provide a kind of albumen, is following 1) or 2) albumen:
1) protein of the composition of the aminoacid sequence shown in the SEQ ID № .2 in sequence table;
2) by the amino acid residue sequence of the SEQ ID № .2 in sequence table through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with disease-resistant insect-resistance to growth and development of plants by 1) derivative protein.
Described 2), in, described growth and development of plants specifically refers to that plant bolting blooms.
Described 2), in, described disease resistance of plant specifically refers to the resistance of Genes For Plant Tolerance pseudomonas or botrytis cinerea.
Described 2), in, described plant resistance to insect refers to the resistance of Genes For Plant Tolerance food grass insect; Be specially the resistance of Genes For Plant Tolerance beet exigua larvae.
Described 2), in, described object plant is dicotyledons or monocotyledons; Described dicotyledons is specially Arabidopis thaliana.
In sequence table, the aminoacid sequence shown in SEQ ID № .2 is made up of 590 amino-acid residues.
Above-mentioned 1) and 2) in bHLH13 albumen can synthetic, also can first synthesize its encoding gene, then carry out biological expression and obtain.Above-mentioned 1) and 2) in the encoding gene of bHLH13 albumen can be by the DNA sequence dna shown in SEQ ID № .1 in sequence table is lacked to the codon of one or several amino-acid residue, and/or carry out obtaining after the missense mutation of one or several base pair.
The nucleic acid molecule of described bHLH13 albumen of encoding also belongs to protection scope of the present invention.
Described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA, hnRNA or tRNA etc.
In the time that described nucleic acid molecule is DNA, its sequence is one of following nucleotide sequence:
1) SEQ ID № in sequence table: the nucleotide sequence of 1 1-1770 position;
2) SEQ ID № in code sequence list: the polynucleotide sequence of 2 protein sequences;
3) under the rigorous condition of height can with SEQ ID № in sequence table: the nucleotide sequence of the 1 DNA sequence dna hybridization limiting;
4) with 1) or 2) or 3) DNA sequence dna that limits has 90% above homology, and the identical function protein DNA sequence of encoding; Concrete, described homology is more than 95%; Concrete is more than 96% again; Concrete is more than 97% again; Concrete is more than 98% again; Concrete is more than 99% again.
The rigorous condition of above-mentioned height can be with 6 × SSC, the solution of 0.5%SDS, and at 65 DEG C, hybridization, then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively washes film once.
Wherein, SEQ ID № in sequence table: 1 is made up of 1773 Nucleotide, its open reading frame (ORF) is from 5 ' end 1-1770 position Nucleotide, SEQ ID № in code sequence list: the protein shown in 2, i.e. bHLH13 albumen of the present invention.
The recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contain above-mentioned nucleic acid molecule also belong to protection scope of the present invention.
Described recombinant vectors can be recombinant expression vector, also can be recombinant cloning vector.
Described recombinant expression vector can be used existing expression vector establishment.Described expression vector also can comprise 3 ' end untranslated region of foreign gene, comprises the DNA fragmentation of polyadenylic acid signal and any other participation mRNA processing or genetic expression.The bootable polyadenylic acid of described polyadenylic acid signal joins 3 ' end of mRNA precursor.While using described gene constructed recombinant expression vector, can add any enhancement type, composing type, organizing specific type or inducible promoter before its transcription initiation Nucleotide, they can be used alone or are combined with other promotor; In addition, while using gene constructed recombinant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer.For the ease of transgenic plant cells or plant are identified and are screened, can process plant expression vector used, as be added in antibiotic marker thing (gentamicin marker, kantlex marker etc.) or the anti-chemical reagent marker gene (as anti-weedkiller gene) etc. that expression in plant can produce the enzyme of colour-change or the gene of luminophor (gus gene, GFP gene, luciferase genes etc.), have resistance.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.
Described recombinant expression vector is specially and will has SEQ ID № in sequence table: between the SalI of the nucleic acid fragment insertion pCambia1300 carrier of nucleotide sequence shown in 1 and SpeI restriction enzyme site, obtain.
The primer pair of encoding gene total length of the present invention or its any fragment of increasing also belongs to the scope of protection of the invention.
Another object of the present invention is to provide albumen of the present invention, encoding gene and the recombinant vectors that contains described encoding gene, expression cassette, transgenic cell line or recombinant bacterium following 1)-4) application at least one:
1) regulating plant breeding time;
2) regulating plant bolting flowering time;
3) regulating plant disease resistance;
4) regulating plant insect-resistance.
In described application, described regulating plant be breeding time make plant breeding time in advance;
In described application, described regulating plant is bloomed for promoting plant bolting to bloom;
In described application, described regulating plant disease resistance is for strengthening disease resistance of plant;
In described application, described regulating plant insect-resistance is for strengthening plant resistance to insect.
In described application, described disease resistance of plant specifically refers to the resistance of Genes For Plant Tolerance pseudomonas or botrytis cinerea.
In described application, described plant resistance to insect refers to the resistance of Genes For Plant Tolerance food grass insect; Be specially the resistance of Genes For Plant Tolerance beet exigua larvae.
In described application, described object plant is dicotyledons or monocotyledons; Described dicotyledons is specially Arabidopis thaliana.
An also object of the present invention is to provide albumen of the present invention, encoding gene and the application in cultivation transgenic plant of the recombinant vectors that contains described encoding gene, expression cassette, transgenic cell line or recombinant bacterium; Concrete, described transgenic plant have following at least one proterties: 1) breeding time is in advance; 2) bolting flowering time in advance; 3) disease resistance of plant strengthens; 4) plant resistance to insect strengthens.
In described application, described disease resistance of plant strengthens the resistance enhancing that specifically refers to Genes For Plant Tolerance pseudomonas or botrytis cinerea.
In described application, described plant resistance to insect strengthens the resistance enhancing that refers to Genes For Plant Tolerance food grass insect; The resistance that is specially Genes For Plant Tolerance beet exigua larvae strengthens.
In described application, described object plant is dicotyledons or monocotyledons; Described dicotyledons is specially Arabidopis thaliana.
Another object of the present invention is to provide a kind of method of cultivating transgenic plant, is encoding gene of the present invention is imported to object plant, obtains transgenic plant; Described transgenic plant, compared with described object plant, have following at least one proterties: 1) breeding time in advance; 2) bolting flowering time in advance; 3) disease resistance of plant strengthens; 4) plant resistance to insect weakens; 5) disease resistance of plant weakens.
In described method, described disease resistance of plant strengthens the resistance enhancing that specifically refers to Genes For Plant Tolerance pseudomonas.
In described method, the resistance that described disease resistance of plant weakens concrete finger Genes For Plant Tolerance botrytis cinerea weakens.
In described method, the resistance that described plant resistance to insect weakens finger Genes For Plant Tolerance food grass insect weakens; The resistance that is specially Genes For Plant Tolerance beet exigua larvae weakens.
In described method, described encoding gene can by using, Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity be led, the conventional biological method such as agriculture bacillus mediated imports plant.
Further object of the present invention is to provide a kind of method of cultivating the plant that disease resistance or insect-resistance strengthened, and the expression of specifically lowering the encoding gene described in plant that sets out, maybe by the afunction of the encoding gene described in plant that sets out.
In described method, described disease resistance of plant strengthens the resistance enhancing that specifically refers to Genes For Plant Tolerance botrytis cinerea.
In described method, described plant resistance to insect strengthens the resistance enhancing that refers to Genes For Plant Tolerance food grass insect; The resistance that is specially Genes For Plant Tolerance beet exigua larvae strengthens.
In described method, described object plant is dicotyledons or monocotyledons; Described dicotyledons is specially plan
BHLH13 albumen provided by the invention and encoding gene thereof help lend some impetus to the research of people to plant resistance to environment stress.The present invention has wide application space and market outlook at agriculture field, this gene can be crossed and is expressed in plant, is used for shortening the development of plants phase; Or in plant this gene of loss of expression, for the preparation of disease and insect resistance plant, thus increase output.
Brief description of the drawings
Fig. 1 is the structural representation of recombinant plasmid pCambia1300-35S-bHLH13.
Fig. 2 is the qualification result figure of bHLH13 gene transcription level in transgenic arabidopsis.
Fig. 3 is the phenotypic evaluation result figure that turns bHLH13 gene Arabidopis thaliana.
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
Quantitative test in following examples, all arranges and repeats experiment, results averaged for three times.
Arabidopis thaliana (Arabidopsis thaliana) used in embodiment is the Columbia-0 ecotype: Arabidopsis Biological Resource Center (ABRC), seed number: CS6673.
Agrobacterium (Agrobacterium tumefaciens) bacterial strain GV3101, is called for short agrobacterium strains GV3101.
The acquisition of embodiment 1, bHLH13 gene
The RNA that extracts the environmental flower of Arabidopis thaliana Columbia-0, reverse transcription obtains cDNA, carries out pcr amplification taking this cDNA as template, and pcr amplification primer is as follows:
F1：acgc
GTCGACatgaatattggtcgcctagtgtgg
R1：cgg
ACTAGTctatctacctgatgatgttcttgac
The PCR product obtaining is sent to order-checking.Sequencing result shows, the nucleic acid fragment that above-mentioned pcr amplification obtains comprises restriction enzyme site and has SEQ ID № in sequence table: the nucleic acid fragment of nucleotide sequence shown in 1; SEQ ID №: nucleotide sequence shown in 1 is 1773bp altogether, head of district 1770bp wherein encodes, this coding region sequence is as SEQ ID № in sequence table: in 1 as shown in the Nucleotide of 1-1770 position, and SEQ ID № in code sequence list: the aminoacid sequence shown in 2, totally 590 amino-acid residues.This is had to SEQ ID № in sequence table: the nucleic acid fragment called after bHLH13 of nucleotide sequence shown in 1.
Also can prepare and there is SEQ ID № in sequence table by synthetic: the nucleic acid fragment of nucleotide sequence shown in 1.
The functional verification of embodiment 2, bHLH13 gene
(1) structure of recombinant expression vector (pCambia1300-35S-bHLH13)
1, the pcr amplification product obtaining with restriction enzyme SalI and SpeI double digestion embodiment 1, obtains enzyme and cuts product.
2,, with restriction enzyme SalI and SpeI double digestion pCambia1300 carrier, reclaim the carrier framework of about 14kb.
3, the carrier framework of the enzyme of step 1 being cut to product and step 2 is connected under the effect of T4DNA ligase enzyme, obtains recombinant plasmid; The exactness of sequence verification sequence; Sequencing result show gained plasmid be between the SalI of pCambia1300 carrier and SpeI restriction enzyme site, insert there is sequence table in SEQ ID №: the nucleic acid fragment of nucleotide sequence shown in 1, by this plasmid called after pCambia1300-35S-bHLH13; The structural representation of recombinant plasmid pCambia1300-35S-bHLH13 is shown in Fig. 1.
(2) acquisition of transfer-gen plant
1, turn the preparation of bHLH13 gene Arabidopis thaliana
1) recombinant plasmid pCambia1300-35S-bHLH13 electric shock is transformed to agrobacterium strains GV3101, Agrobacterium GV3101/pCambia1300-35S-bHLH13 obtains recombinating).
2) the restructuring Agrobacterium of 28 DEG C of incubated overnight steps 1 to adjust its concentration be OD
600=0.8 bacterium liquid.
3) by flower infusion method (flower be immersed in the bacterium liquid of step 2 30 seconds), recombinant plasmid pCambia1300-35S-bHLH13 is imported to Arabidopis thaliana Columbia-0 (being Col-0), the seed of results is the seed of T1 for Arabidopis thaliana.
4) by T1 for the planting seed of Arabidopis thaliana in the enterprising row filter of MS substratum containing Totomycin (20mg/L), obtain T1 that 25 strains have hygromycin resistance for Arabidopis thaliana (numbering is followed successively by 1-25).
2, turn the qualification of bHLH13 gene Arabidopis thaliana
1) detection of bHLH13 gene in transgenic arabidopsis
In the time that T1 grows to 4-6 sheet leaf for Arabidopis thaliana, be transplanted on vermiculite, grow 45 days (24 DEG C; 16 hours/illumination+8 hour/dark), extract respectively the DNA of 25 strain T1 for Arabidopis thaliana leaf, carry out PCR qualification with agaagacgttccaaccacgtc (with the sequences match on carrier) and ctatctacctgatgatgttcttgac composition primer pair, can amplify 1900bp pcr amplification product be transfer-gen plant.Obtain altogether the positive T1 of 25 strains for turning bHLH13 Arabidopis thaliana.
2) detection of bHLH13 gene transcription level in transgenic arabidopsis
The phenotype of 25 strain transgenic lines is similar, below sets forth the testing process of transcriptional level as an example of the transgenic line 13OE1 of overexpression bHLH13 gene example.
Extract respectively the seedling RNA of 13OE1 and Col-0 wild-type, and reverse transcription is cDNA, with primer cgagttcaagggcttcagag and ccactgcatctgcccatt by the expression level of Real-time PCR Analysis bHLH13.
QRT-PCR detected result is shown in Fig. 2.The demonstration of Fig. 2 result, in 13OE1, the expression level of bHLH13 is 19 times of left and right of wild-type (Col-0) Arabidopis thaliana.QRT-PCR detected result has further proved that bHLH13 gene has been incorporated into transgenosis T1 in the genome of Arabidopis thaliana and be successfully transcribed into mRNA.
(3) turn the phenotype of bHLH13 gene Arabidopis thaliana
The phenotype of 25 strain transgenic lines is similar, below sets forth the phenotype that turns bHLH13 gene Arabidopis thaliana as an example of the transgenic line 13OE1 of overexpression bHLH13 gene example.
1, transfer-gen plant is bloomed early than wild-type plant
Respectively by 13OE1, Col-0 and turn empty carrier adjoining tree be planted in 16 hours illumination (20-25 DEG C)/8 hour dark (19-22 DEG C) plant room in, statistics is from sprouting time of stretching out to inflorescence, i.e. bolting flowering time.The phenotype that turns empty carrier adjoining tree is consistent with Col-0.Statistics is shown in Fig. 3.Fig. 3 A result shows, 13OE1 was than wild-type Col-0 prematurity approximately 1.8 days.This research shows that bHLH13 promotes Arabidopis thaliana bolting to bloom.
2, the resistance of transfer-gen plant botrytis cinerea is weaker than wild-type plant
With concentration be 10
5botrytis cinerea spore (the JAV1 Controls Jasmonate-Regulated PlantDefense.Hu P of/ml, Zhou W, Cheng Z, Fan M, Wang L, Xie D.Mol Cell.201323:504-15) more than suspension processes Col-0, the 13OE1 growing 4 weeks in plant room and turns each 30 strains of empty carrier adjoining tree.The phenotype that turns empty carrier adjoining tree is consistent with Col-0.The results are shown in Figure 3.Fig. 3 B result is presented to be processed after 6 days, and 13OE1 shows more serious illness compared with wild-type Col-0.This experiment shows that bHLH13 gene reduces the resistance of Arabidopis thaliana to botrytis cinerea.
3, the resistance of pseudomonas Pst DC3000 is better than to wild-type plant concentration is 10 to transfer-gen plant
8pseudomonas Pseudomonas syringae pv.Tomato DC3000 (PstDC3000) (the The Arabidopsis thaliana-pseudomonas syringae interaction.KatagiriF of cfu/ml, Thilmony R, He SY.Arabidopsis Book.2002; 1:e0039.) more than suspension is processed Col-0, the 13OE1 growing 4 weeks in plant room and is turned each 30 strains of empty carrier adjoining tree.The phenotype that turns empty carrier adjoining tree is consistent with Col-0.The results are shown in Figure 3.Fig. 3 C result is presented to be processed after 5 days, and 13OE1 shows obvious resistance compared with wild-type Col-0.This experiment shows that bHLH13 gene strengthens the resistance of Arabidopis thaliana plant to pseudomonas Pst DC3000.
4, described transfer-gen plant is weaker than wild-type plant to the resistance of beet armyworm exigua larvae
Beet exigua larvae (Jiyuan, Henan white clouds Industrial Co., Ltd.) to 10 3 ages is weighed, and average weight is 8mg.Afterwards larva is put into culture dish, and in culture dish, add more than 50 wild-type Col-0, the 13OE1 of 4 weeks and turn the blade of empty carrier adjoining tree.Two days later, 10 larvas are weighed, and average weight.Finally calculate the weightening finish of larva.The phenotype that turns empty carrier adjoining tree is consistent with Col-0.The results are shown in Figure 3.Fig. 3 D and the demonstration of E result, the blade of 13OE1 is weaker than wild-type to the resistance of beet exigua larvae.After feeding Col-0 wild-type after beet armyworm nursing 13OE1, weightening finish is many.This research shows that bHLH13 reduces the resistance of Arabidopis thaliana to beet armyworm.
Claims (5)
- By protein that in sequence table, the aminoacid sequence shown in SEQ ID No:2 forms or its encoding gene in the application strengthening in Genes For Plant Tolerance pseudomonas.
- By protein that in sequence table, the aminoacid sequence shown in SEQ ID No:2 forms or its encoding gene in the application of cultivating in transgenic plant; Described transgenic plant strengthen the resistance of pseudomonas.
- 3. application according to claim 1 and 2, is characterized in that: described encoding gene is the DNA molecular as shown in the 1-1770 position nucleotide sequence of SEQ ID No:1 in sequence table.
- 4. cultivating a method for transgenic plant, is that the encoding gene of the protein of the composition of the aminoacid sequence shown in SEQ ID No:2 in sequence table is imported to object plant, obtains transgenic plant; Described transgenic plant, compared with described object plant, show the resistance of pseudomonas are strengthened.
- 5. method according to claim 4, is characterized in that: described encoding gene is the DNA molecular as shown in the 1-1770 position nucleotide sequence of SEQ ID No:1 in sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310227604.5A CN103288943B (en) | 2013-06-08 | 2013-06-08 | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310227604.5A CN103288943B (en) | 2013-06-08 | 2013-06-08 | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103288943A CN103288943A (en) | 2013-09-11 |
| CN103288943B true CN103288943B (en) | 2014-09-10 |
Family
ID=49090517
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310227604.5A Expired - Fee Related CN103288943B (en) | 2013-06-08 | 2013-06-08 | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103288943B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164391A (en) * | 2017-06-30 | 2017-09-15 | 沈阳农业大学 | A kind of strawberry floral genes FvbHLH78 and its application |
| CN109912701B (en) * | 2017-12-13 | 2020-12-01 | 中国科学院遗传与发育生物学研究所 | Method for improving insect resistance of tomatoes |
| CN111205356B (en) * | 2020-01-15 | 2023-03-21 | 湖北大学 | Gene for regulating and controlling plant florescence and encoding protein and application thereof |
| CN111690661A (en) * | 2020-06-01 | 2020-09-22 | 云南省烟草农业科学研究院 | Tobacco NtbHLH13 gene mutant and molecular identification method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892232A (en) * | 2010-06-29 | 2010-11-24 | 清华大学 | miRNA-n3 derived from rice and application thereof |
-
2013
- 2013-06-08 CN CN201310227604.5A patent/CN103288943B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892232A (en) * | 2010-06-29 | 2010-11-24 | 清华大学 | miRNA-n3 derived from rice and application thereof |
Non-Patent Citations (6)
| Title |
|---|
| Arabidopsis thaliana putative transcription factor BHLH13 mRNA, complete cds;Schoenbohm,C.等;《GenBank AAL55720.1》;20020101 * |
| putative transcription factor BHLH13 [Arabidopsis thaliana];Schoenbohm,C等;《GenBank AF251698.1》;20020101 * |
| Schoenbohm C.等.Arabidopsis thaliana putative transcription factor BHLH13 mRNA |
| Schoenbohm,C等.putative transcription factor BHLH13 [Arabidopsis thaliana].《GenBank AF251698.1》.2002, |
| 刘文文等.植物bHLH转录因子研究进展.《生物技术进展》.2013,第3卷(第1期),第7-11页. |
| 植物bHLH转录因子研究进展;刘文文等;《生物技术进展》;20130228;第3卷(第1期);第7－11页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103288943A (en) | 2013-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103183732B (en) | Cotton Gh FPP1 protein as well as coding gene and application thereof | |
| CN103288944B (en) | Protein bHLH17 (Basic Helix Loop Helix 17) as well as coding gene and application thereof | |
| CN113337520B (en) | Upland cotton GhA0749 and GhD0744 transcription factors and application thereof in flowering regulation | |
| CN102498125A (en) | Regulation of zinc deficiency and tolerance in plants | |
| CN107299103B (en) | Thick boisiana IpASR gene and its coding albumen and application | |
| CN104480119B (en) | Plant salt stress inducible gene OsSIR1 and its encoding proteins and application | |
| CN105624188B (en) | A kind of SPL18 gene is improving the application in plant products | |
| CN110283824A (en) | A method of using CsXTH04 gene silencing to improve citrus to canker resistance | |
| CN103288943B (en) | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof | |
| CN104059929B (en) | Application of maize CIPK21 gene in improving plant stress resistance | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN109423492A (en) | Application of the SlTOE1 gene in regulation tomato flowering time and yield | |
| CN103172715B (en) | Plant epidermal hair controlling gene and application thereof | |
| CN109295070A (en) | A kind of and paddy rice anti contravariance related gene OsDTH1 and its coding albumen and application | |
| CN103172716B (en) | Heat-resistant plant gene and application thereof | |
| CN101712718B (en) | Protein relevant to plant drought resistance, coding gene and application thereof | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| CN107663232B (en) | Plant anti-adversity associated protein OsIAA18 and its encoding gene and application | |
| CN102234327B (en) | Plant salt resistant associated protein AtST1, coded genes and application thereof | |
| CN104592370A (en) | OsPYL9 protein, OsPYL9 protein coding gene and applications of OsPYL9 protein | |
| CN104610438B (en) | One grows cotton stress response GAP-associated protein GAP GhGeBP and its encoding gene and application | |
| CN103570813A (en) | Plant-stress-resistance related protein Gh01399, and coding gene and application thereof | |
| CN102796747A (en) | Application of Zea mays L. drought-induced protein (ZmDIP1) gene and its encoding protein | |
| CN102146126A (en) | Protein related to insect resistance and encoding gene and application thereof | |
| CN104561040B (en) | Genes For Plant Tolerance hot radical is because of HTT3 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140910 Termination date: 20160608 |