CN109295070A

CN109295070A - A kind of and paddy rice anti contravariance related gene OsDTH1 and its coding albumen and application

Info

Publication number: CN109295070A
Application number: CN201811099766.4A
Authority: CN
Inventors: 徐凯; 杨诗勤; 夏辉; 罗利军
Original assignee: SHANGHAI MUNICIPAL AGRICULTURAL BIOLOGICAL GENE CENTER
Current assignee: SHANGHAI MUNICIPAL AGRICULTURAL BIOLOGICAL GENE CENTER
Priority date: 2018-09-20
Filing date: 2018-09-20
Publication date: 2019-02-01

Abstract

The invention discloses a kind of to separate the OsDTH1 gene relevant to paddy rice anti contravariance cloned from paddy DNA segment.The gene encodes a transcription factor, belongs to basic leucine zipper (bZIP) protein family.For OsDTH1 gene by with high salt, low temperature, high temperature and ABA inducing expression, the ability that rice seedling resists peroxidating stress is can be improved in overexpression OsDTH1, related to paddy rice anti contravariance.Paddy gene of the invention obvious responses to adverse circumstance generation, can be applied to the resistance that plant is improved in plant stress-resistance breeding.

Description

A kind of and paddy rice anti contravariance related gene OsDTH1 and its coding albumen and application

Technical field

The present invention relates to a kind of genes relevant to paddy rice anti contravariance, specifically, being related to a kind of new Rice Resistance anti-phase Correlation gene OsDTH1 and its application, belong to genetic engineering field.

Background technique

Drought and water shortage is one of an important factor for causing the world food underproduction.Drought stress seriously affects plant growth and hair It educates, or even causes Plant death.Rice is important one of cereal crops, and rice water accounts for the 65% of agricultural water, using now For the biochemical reactions of biology techniques research plant drought, important anti-drought gene is cloned, and then be transferred in plant and cultivate The new rice variety that the New Crop Varieties of resistance enhancing especially cultivate saving water, resisting drought is to alleviate global drought and water shortage, population increasing The effective way of long bring grain-production pressure.

Plant forms a series of adaptation mechanism in long-term evolutionary process to cope with the environment stresses such as arid.Arid Under stress, on the one hand plant is closed by adjusting stomata to reduce moisture transpiration, while increasing water by promoting root growth Divide and absorb, to effectively avoid injury of the drought stress to plant.Meanwhile plant can pass through the infiltrations tune such as synthesis organic macromolecule The molecule and antioxidant reductase of section and protection enhance itself tolerance to adverse circumstance.

The research of plant physiology, science of heredity, molecular biology is some important so that the degeneration-resistant mechanism of plant is gradually apparent Adversity gene be cloned.Be divided into two classes substantially according to function difference to degeneration-resistant relevant gene: one kind is coding osmotic adjustment The gene of the functional proteins such as albumen, antioxidase, transport protein；Another kind of is that encoding transcription factors, protein kinase etc. play adjusting The gene of action protein.

Transcription factor plays crucial regulating and controlling effect in plant reply drought stress reaction, to its function and transgenosis Research is always one of the hot spot of plant stress-resistance research.Transcription factor is a kind of adjusting that can regulate and control target gene transcriptional level Albumen.Under environment-stress, plant regulates and controls it in conjunction with specific DNA sequence dna by signal transduction, activating transcription factor The expression of adverse circumstance correlation effect gene is resisted, to achieve the purpose that resist adverse circumstance.At present it has been reported that AP2/EREBP, NAC, The transcription factor of the types such as bZIP/HD-ZIP, MYB and Zinc finger is answered the environment-stress such as plant resistant drought resisting, salt tolerant Very important effect is played during answering.In arabidopsis it has been found that degeneration-resistant associated transcription factor have DREB1/2, CBF1, AtMYB2 etc., the transcription factor gene cloned in rice such as SNAC1, DST and OsbZIP46 etc. have significantly affected rice Drought resistance.Transcription factor number is big in plant, and type is more, shows the complexity of its expression and regulation mechanism.Adverse circumstance correlation turns at present The mechanism of the record factor also needs in-depth study.

This laboratory has chosen the typical rice in part early period, dryland rice material has carried out the processing of drought tolerance and transcribed Group sequencing, is obtained by the methods of bioinformatic analysis, gene expression and drought tolerance physical signs correlation analysis Integrated Selection The drought-enduring candidate gene of part was obtained, the candidate gene of one of encoding transcription factors is the OsDTH1 gene in the present invention. Gene expression spectrum analysis under arid, hydrogen peroxide, exogenous aba treatment shows that OsDTH1 gene can respond environment stress.It is super The transgenic paddy rice for expressing the gene is resisted the ability that peroxidating is coerced and is significantly increased.

Summary of the invention

The purpose of the present invention is to provide a kind of new paddy rice anti contravariance related gene OsDTH1 and OsDTH1 gene codings BZIP transcription factor has typical ZIP transcriptional activation domain, can respond environment stress, can be improved after overexpression and turn base Because the anti-peroxidation of plant coerces ability.

Another object of the present invention is to provide paddy rice anti contravariance related gene OsDTH1 and is improving the application in paddy rice anti contravariance.

The present invention separates the DNA fragmentation of one section of complete coding region section of clone from rice, to the egg of this gene coding Bai Xulie carry out analysis shows, it encode basic leucine zipper (bZIP) protein family transcription factor, have typical case BZIP protein structure domain, be named as OsDTH1.

The present invention separates and applies a kind of DNA fragmentation comprising OsDTH1 gene, which can respond arid, peroxidating Expression variation occurs for the Stress treatments such as hydrogen, Exogenous ABA.

The technical solution adopted by the present invention is that providing a kind of OsDTH1 gene relevant to paddy rice anti contravariance, wherein described The sequence of OsDTH1 gene is as one of following: DNA sequence dna shown in SEQ ID NO:1；It is homologous with SEQ ID NO:1 at least 90% DNA sequence dna；Function is equivalent to the subfragrnent of sequence shown in SEQ ID NO:1.

Another preferred embodiment of the invention is that the sequence of the OsDTH1 gene is as one of following: SEQ ID DNA sequence dna shown in 367-1193 in NO:1；Or with 367-1193 in SEQ ID NO:1 shown in DNA sequence dna phase DNA sequence dna like property up to 90%.

The present invention also provides a kind of albumen comprising OsDTH1 gene coding, wherein the amino acid sequence of the albumen is such as Homologous sequence or conservative variant or allelic variation shown in SEQ ID NO:2, or for the SEQ ID NO:2 sequence Body or natural mutation or induced mutants.

The present invention also provides a kind of recombinant vectors comprising OsDTH1 gene coding, wherein constructs the recombinant vector institute The carrier of selection is Ti-plasmids or plant viral vector.

The present invention also provides a kind of a kind of vegetable transformants comprising OsDTH1 gene, wherein the vegetable transformant Host is rice.

Another priority scheme of the present invention is to provide a kind of application improved in stress resistance of plant, wherein in the resistance The plant of application includes the gene of OsDTH1 as claimed in claim 1 or 2, and the plant is rice.

Obtain it is above-mentioned use the OsDTH1 gene cloned for probe, screen and obtain from cDNA library and genomic library Gene or homologous gene of the invention.Can also use PCR (polymerase chain reaction) technology, from genome, Amplification obtains OsDTH1 gene of the invention and any interested section of DNA or homologous with it one section in mRNA and cDNA DNA.Using the above technology, this sequence and any one can be guided into foreign gene with isolated OsDTH1 gene The carrier expressed in plant is ligated and transformed into plant, can get the transgenic plant enhanced stress response.

The expression vector that carrier provided by the invention carries OsDTH1 gene of the present invention can be by using Ti-plasmids, phytopathy Poisonous carrier, the standard biologics technical method such as directly delivered DNA, microinjection, electroporation import plant cell.

OsDTH1 expression vector conversion host of the present invention is the various plants including rice.

The present invention provides a kind of paddy DNA piece by separating the response cloned and its to environment stress to paddy gene The disconnected encoding gene OsDTH1 comprising a 825bp.The gene contains the typical bZIP structure domain of bZIP transcription factor family. OsDTH1 gene is related to paddy rice anti contravariance by arid, salt and Exogenous ABA inducing expression.

The present invention can be used for the molecular method that the conversion of this gene genetic of research and utilization obtains genetically modified plants.

Paddy gene of the invention obvious responses to adverse circumstance generation, can be applied in plant stress-resistance breeding.

Detailed description of the invention

Fig. 1 is that the present invention is same by part in the protein sequence and rice of OsDTH1 predictive genes using ClustalW2 software The result that heterologous protein sequence is compared；

Fig. 2 is the expression of OsDTH1 gene of the invention in rice different tissues；

Fig. 3 be OsDTH1 gene of the invention in seedling stage rice by PEG, H₂O₂With expression water when exogenous aba treatment It is flat；

Fig. 4 is the transcriptional activation activity analysis of OsDTH1 gene of the invention in yeast

Fig. 5 is that the expression of OsDTH1 gene overexpression transgenic rice plant of the invention detects；

Fig. 6 is that OsDTH1 gene overexpression transgenic paddy rice of the present invention and wild rice are resisted peroxidating stress and coerced Comparative analysis.

Fig. 7 is compared with OsDTH1 knockout transgenic rice of the present invention resists peroxidating stress stress with wild rice Analysis.

Specific embodiment

Following embodiments further describe the present invention, but the embodiment is merely to illustrate the present invention rather than limits this hair It is bright.Without departing from the spirit and substance of the case in the present invention, to modifications or substitutions made by the method for the present invention, step or condition, It all belongs to the scope of the present invention.

Test method without specific conditions in following embodiments, usually according to normal condition, such as Sambrook etc. Molecular cloning: described in laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) Condition, or according to the normal condition proposed by manufacturer.

The clone of 1 rice Os DTH1 gene of embodiment

1. seedling culture

Rice is placed in 30 DEG C to sprout 48 hours, is then seeded in greenhouse, when rice leaf is 3-5 piece, prepares to take out Take DNA or RNA.

The separation of 2.RNA:

The extraction of RNA: for samples taken with powdery is ground into after liquid nitrogen frozen in mortar, addition fills 1mL TRNzol-A The 2mL EP of+reagent (Tiangeng biochemical technology Co., Ltd) is managed, and sufficiently after oscillation, is placed at room temperature for 5min, later plus 0.2mL chlorine It is imitative, after acutely shaking 15s, it is placed at room temperature for 3min；Afterwards in 4 DEG C, after 12000rpm is centrifuged 10min, supernatant moves to new 2mL In EP pipe, add isometric isopropanol precipitating RNA, adds 100 μ L RNase-free ddH₂O dissolution.Electroresis appraisal total serum IgE quality, Then rna content is measured on spectrophotometer.

3. reverse transcription synthesizes the first chain cDNA

(1) it needs to digest extracted RNA sample with DNaseI before reverse transcription, reaction system is as follows:

After 37 DEG C of reaction 15min, 0.25 μ L 0.1M EDTA (guaranteeing final concentration > 2mM) is added, 70 DEG C of incubation 10min are whole It only reacts, of short duration centrifugation is placed on spare on ice.

The synthesis of (2) first chain cDNA is referring to Promega reverse transcription system A3500 operation manual, the specific steps are as follows:

The reaction system of following 20 μ L of each preparation of reagents is sequentially added in the sample that DNaseI digested:

By upper reaction system in 42 DEG C of incubation 15min；Then 95 DEG C of heating 5min, inactivate AMV reverse transcriptase and prevent It is in conjunction with DNA；4 DEG C or 5min is placed on ice.The cDNA prepared can immediately using or deposit in -20 DEG C it is spare.

4. the amplification of rice Os DTH1 full length gene

By having carried out the processing of drought tolerance to typical rice, dryland rice material and having carried out transcript profile sequencing, pass through biology It is candidate that the methods of bioinformatics analysis, gene expression and drought tolerance physical signs correlation analysis Integrated Selection obtains a collection of drought tolerance Gene, one of gene are LOC_Os07g48660, are named as OsDTH1.Upstream and downstream primer is designed according to predictive information DTH1F (5 ' ACAGCCCTGGAACATTGGCC 3 ') and DTH1R (5 ' TAGTTAAGAAAAGAGTTCGTCG 3 '), from rice Direct Cloning obtains OsDTH1 gene in cDNA, and gel recycling is connected on pEASY-Blunt carrier, sequence is carried out after identification Column measurement, sequencing result is compared through BLAST to be confirmed.The length of the rice Os DTH1 full length DNA in the present invention is as the result is shown 1323bp, detailed sequence are shown in SEQ ID NO:1, and wherein open reading frame (ORF) is 825bp, and 5 ' non-translational regions (UTR) are 368bp, 3 ' non-translational regions (UTR) are 130bp.

The sequence information and homology analysis of 2 rice Os DTH1 albumen of embodiment

The ORF of new rice Os DTH1 derives the amino acid sequence of rice Os DTH1 according to the present invention, totally 274 amino Acid, molecular weight are 249394 dalton, and detailed sequence is shown in SEQ ID NO:2.It is compared by the BLASTP program of the website NCBI Out (Http:// www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi? RID=6ACDWHRB016&mode =all), OsDTH1, which encodes albumen, has bZIP structure domain, belongs to bZIP family.By encoding egg to the part bZIP in rice White progress Multiple Sequence Alignment (Fig. 1), it has been found that the albumen has highly conserved bZIP DNA binding structural domain.

Expression analysis of the 3 paddy gene OsDTH1 of embodiment in each histoorgan

1. chosen material

For OryzasativaLcv.Nipponbare Rice Cropping in paddy field, boot stage takes root, stem, sword-like leave, leaf sheath and the fringe of plant to be analyzed.

2.RNA extraction is synthesized with the first chain cDNA

RNA is extracted according to the method in embodiment 1, and the first chain cDNA is synthesized with reverse transcription reaction.

3. quantitative PCR analysis

The quantitative analysis of gene expression uses Takara companyPremix Ex TaqTM(Perfect Real Time) kit and U.S.'s Bio-Rad CFX96 quantitative PCR apparatus carry out.Quantitatively drawn according to the design of OsDTH1 full length cDNA sequence Object (F:GCACGGAAGCAGGCATA, R:TCGACGCAGCTAGGGAA).With rice housekeeping gene actin (GenBank Accession No.AY212324) it is reference gene, according to its cDNA sequence design primer.The preparation of 20 μ L reaction systems:

Reaction condition are as follows: 95 DEG C of 30s are recycled 40 times then in 95 DEG C of 5s, 60 DEG C of 31s, and add Dissociation Stage.Data are collected when setting 60 DEG C of 30s in each cycle, other concrete operations are carried out by instrument operation instructions.It calculates The mean CT-number and △ CT value of target gene and reference gene, utilize 2^-ΔΔCTMethod carries out interpretation of result, finally imports data to GraphPad Prism5.0 makes the relative expression quantity histogram of target gene.

Quantitative analysis results show (Fig. 2), which has expression in each histoorgan, and expression quantity is higher in root.

Expression analysis of the 4 paddy gene OsDTH1 of embodiment under environment stress

1. environment stress is handled

Full OryzasativaLcv.Nipponbare seed, distilled water cleaning are chosen, 3%NaClO is cleaned up after sterilizing 10min, 30 DEG C of vernalization, Seed relays hydroponics growing in germination box after showing money or valuables one carries unintentionally, apply nutrient solution (International Rice institute standard liquid nutrient) after tri-leaf period.? It 28 DEG C, cultivates in the illumination cultivation room of 16h/8h, until carrying out various adverse circumstances and HORMONE TREATMENT when four leaf stage: 20%PEG6000, 60mM H₂O₂With 100 μM of abscisic acids (ABA).Respectively before treatment, processing after 0.5h, 1h, 2h, 4h, 8h, 12h, for 24 hours to processing Sample.All processing and sampling process are carried out under conditions of continuous light.

2.RNA extraction is synthesized with the first chain cDNA

With embodiment 1.

3. quantitative PCR analysis

With embodiment 1.

As the result is shown: the characteristics of slowly response is then presented to PEG processing and ABA processing in OsDTH1 is expressed after handling 8h Apparent increase reaches highest after handling 12h；The characteristics of relatively rapid response is presented to hydrogen peroxide treatment in OsDTH1, It is significantly raised after processing 2h, and maintain higher expression (Fig. 3) always in subsequent treatment process.These results indicate that should Gene can be by the inducing expression of the environment stresses such as arid, peroxidating stress and hormone ABA, thus the gene is answered in adverse circumstance Certain effect may be played by answering in reaction.

The analysis of 5 paddy gene OsDTH1 transcriptional activation activity of embodiment

1. the building of yeast transcriptional activation carrier

According to each functional domain design primer of OsDTH1, the overall length of OsDTH1 gene is expanded respectively and includes different structure The segment in domain after PCR product is separately recovered, is recombinated PCR product on Yeast expression carrier pGBKT7 using recombinase respectively.

2. Yeast Genetics convert

Using lithium acetate transformation method, the recombinant plasmid being constructed above is transformed into respectively in yeast strain Y2Hgold, is coated with SD/-Trp screening and culturing medium, 28 degree are cultivated 2-3 days, and picking positive colony is inoculated into SD/-Trp fluid nutrient medium, culture For 24 hours, PCR carries out bacterial examination.

3. transcriptional activation activity is analyzed

By 10 times be serially diluted of positive colony, take respectively 5ul contact plate to SD/-Trp, SD/-Trp-His 5mM 3-AT, In SD/-Trp-His X-Gal culture medium, 28 degree are cultivated 3 days, observe yeast growth situation.As the result is shown (Fig. 4): containing OsDTH1 The yeast of full length gene cannot be grown on Selective agar medium, containing OsDTH1 the segment DC1 and DC2 for having lacked C-terminal partial sector Yeast can be grown on Selective agar medium and can show blue, although show the overall length of the OsDTH1 gene do not have transcribe it is sharp It is activity, but the partial sector of its gene has transcriptional activation activity

6 paddy gene OsDTH1 overexpression of embodiment and CRISPR/Cas9 carrier rice transformation

1. utilizing the overexpression carrier of recombinant clone technology building gene containing OsDTH1:

To have obtained the pEasy-blunt carrier containing OsDTH1 gene in embodiment 1 as template, PCR amplification is carried out.Expand It is recovered after purification to increase production object, by gateway recombinant technique, amplified production segment is cloned on overexpression carrier.Tool Body process is as follows:

(1) PCR amplification

20 μ L reaction systems are as follows:

Amplification program: 98 DEG C of initial denaturations 2min, 98 DEG C of 15s, 60 DEG C of 30s, 72 DEG C of 2min, 10 circulations.

5 μ LPCR products are taken to carry out electrophoresis detection after reaction.

(3) recycling of PCR product

Purification and recovery is carried out using plain agar sugar gel DNA QIAquick Gel Extraction Kit.

(4) BP recombining reaction

The purpose of BP recombining reaction is to recombinate containing the PCR product of connector onto intermediate vector.Recombining reaction can be Room temperature, which is prepared, to be mixed, and is carried out in the centrifuge tube of 0.5mL.Reaction system is as follows:

BP reaction solution is then converted competent escherichia coli cell by 37 DEG C of warm bath 30min or so.Recombination bacillus coli needs It is grown on plate containing gentamicin.Then picking single colonie finally extracts plasmid to carry out PCR verifying.

(5) LR recombining reaction

Using LR recombining reaction, the OsDTH1 in intermediate vector is cloned on donor overexpression carrier, converts large intestine Bacillus competent cell.Recombination bacillus coli need to be grown on plate containing kanamycins.Then picking single colonie is tested with carrying out PCR Card, finally extracts plasmid.The plasmid can convert Agrobacterium EHA105, be used for rice transformation.

The building of 2.OsDTH1 gene C RISPR/Cas9 knockout carrier

(1) using pYLgRNA-OsU6a/LacZ plasmid as template, OsU6a- target spot is carried out respectively in two reaction systems The amplification of segment and gRNA- target spot segment, PCR reaction use KOD plus polymerase, 25 circulations: 94 DEG C of 10s, 58 DEG C of 15s, and 68 ℃20s.Electrophoresis detection PCR product.

Taking the first round each 1 μ l of two PCR products is template, with primer U-GAL (ACCGGTAAGGCGCGCCGTAGTGCTC ) and Pgs-GAR (TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTATCCA GACTAGTATGGAATCGGCAGCAAAGG TCCACTCCAAGCTCTTG the second wheel PCR, 30 circulations) are carried out by above step.Detected through gel electrophoresis, gel extraction, this product As gRNA expression cassette.

(2) the recombination connection of gRNA expression cassette and pYLCRISPR/Cas9

The linearisation of pYLCRISPR/Cas9 carrier: in 50 μ l reaction 20U Bsa I digestion~2 μ g pYLCRISPR/ Cas9 carrier about 30min.2 μ l (~80ng) electrophoretic examinations is taken, confirms the ccdB band being cut out.

According to the form below prepares recombining reaction system and carries out recombining reaction:

37 degree of 30min are reacted, after directly converted, be coated with positive gram of the LB plate screening containing kanamycins Grand, next day picking positive colony shakes bacterium, carries out PCR detection with 1300F/1300R primer and carries out sequencing analysis, and selection is identified Positive colony carry out plasmid extraction, be used for rice transformation.

3. Agrobacterium-mediated Transformation

(1) preparation of Agrobacterium tumefaciems (EHA105) competent cell:

For Agrobacterium tumefaciems bacterium solution when 28 DEG C of cultures are to OD600=0.5,4 DEG C thalline were collected by centrifugation, with 500 μ L, 0.1mol/L ice bath CaCl₂It is resuspended, is centrifuged after ice bath 30min, supernatant is removed, with 100 μ L, 0.1mol/L ice CaC1₂After resuspension, in 4 DEG C save.

(2) Agrobacterium-mediated Transformation (freeze-thaw method):

To 5 μ L plant expression carrier plasmid DNA are added in Agrobacterium competent cell (100 μ L), mix gently, ice-water bath After 30min, the quick-frozen cold shock 2min in liquid nitrogen；400-800 μ L YEP culture solution (containing kanamycins, Kan) is added；28 DEG C, 200r/min shaken cultivation 3-5h；Room temperature is centrifuged (5000r/min, 5min), retains 100 μ L supernatants and thallus is resuspended, be coated on LB On solid medium (containing Kan), 28 DEG C are inverted culture 2 days until growing the bacterium colony of suitable size, and picking monoclonal carries out PCR inspection It surveys, obtains positive strain.

4. callus induces: seed rinsed with sterile water 15-20min, then 75% ethanol disinfection 1min is used, then with secondary chlorine Sour sodium (1.5% effective concentration) solution oscillation disinfection 20min.Finally use aseptic water washing 5 times again.Washed seed is absorbed water Paper, which blots, to be seeded in callus induction culture medium, 25 DEG C dark culture 2 weeks.

Calli induction media: using the induced medium of table 1, be added 0.3g proline, 0.6g hydrolyzed casein, 30g sucrose and 2.5mL 2,4-D (concentration 1mg/mL) are made into 1L solution, adjust pH to 5.9, and 7g agar powder is added, and high temperature and pressure is gone out Bacterium.

5. squamous subculture: embryo callus is cut, access subculture medium in, 25 DEG C dark culture 2 weeks.

Subculture medium: using the subculture medium of table 1,0.5g proline, 0.6g hydrolyzed casein, 30g sugarcane is added Sugar and 2mL 2,4-D (concentration 1mg/mL) are made into 1L solution, adjust pH to 5.9, and 7g agar powder, autoclave sterilization is added.

6. During Agrobacterium and callus co-culture: culture Agrobacterium, picking positive single colonie are trained in 1mL Agrobacterium In nutrient solution (containing antibiotic), 28 DEG C of overnight incubations；The above culture is taken, is added in 50mL Agrobacterium culture solution (containing antibiotic), 28 DEG C are cultivated to OD600=0.6-1.0.The Agrobacterium bacterium solution of acquisition is centrifuged, suspending nutrient solution is added in the thallus being collected into In, shake culture 30min to OD600=0.6-1.0.Then callus is put into the suspending nutrient solution containing Agrobacterium bacterium solution In, shaken cultivation 20min or so.Callus is dried in sterilizing filter paper, is transferred in co-culture medium, 25 DEG C of dark cultures 5d。

Suspending nutrient solution: using the suspending nutrient solution of table 1, being added 0.08g hydrolyzed casein, 2g sucrose and 0.2mL2, 4-D (concentration 1mg/mL) is made into 100mL solution, adjusts pH to 5.4, is divided into two bottles (every bottle of 50mL), autoclave sterilization.It uses The glucose and 100 μ L AS (100mM) of 1mL 50% are added before.

Co-culture medium: using the co-culture medium of table 1, be added 0.8g hydrolyzed casein, 20g sucrose and 3.0mL 2,4-D (concentration 1mg/mL) are made into 1L solution, adjust pH to 5.6, and 7g agar powder, autoclave sterilization is added.Use it The preceding glucose and 1mL AS (100mM) that 20mL 50% is added.

7. screening and culturing: after co-culturing 3d, the callus chosen is transferred in screening and culturing medium, 25 DEG C of dark cultures 2 In week, screening is twice.

Screening and culturing medium: using the screening and culturing medium of table 2, being added 0.6g hydrolyzed casein, 30g sucrose and 2.5mL2, 4-D (concentration 1mg/mL) is made into 1L solution, adjusts pH to 6.0, and 7g agar powder, autoclave sterilization is added.It is added before use 1mL Hn and 1mL Cn (100ppm).

8. differentiation culture: picking embryo callus accesses differential medium, and 24 DEG C, 16h/8h brightness culture induction is broken up Bud (4-6 weeks).

Differential medium: using the differential medium of table 2,2.0mg/L 6-BA, 2.0mg/L KT, 0.2mg/L is added NAA, 0.2mg/L IAA, 1.0g hydrolyzed casein and 30g sucrose are made into 1L solution, adjust pH to 6.0, and 7g agar powder is added, Autoclave sterilization.

9. culture of rootage: when bud length to 2cm or so, young shoot is cut, is inserted into root media, 25 DEG C or so, 16h/8h brightness culture, root induction.

Root media: using the root media of table 2,30g sucrose is added, is made into 1L solution, adjusts pH to 5.8, is added 7g agar powder, autoclave sterilization.

10. transformed plant culture: after well developed root system, opening test tube mouth, after sterile water hardening 2-3d is added, plant is taken Out, the solid medium of attachment is cleaned with sterile water, is moved into soil, wind sheltering of shading just is started, and is carried out after robust plant normal Advise field or greenhouse management culture.

1 minimal medium ingredient 1 of table

2 minimal medium ingredient 2 of table

11. the expression detection of target gene in overexpression positive plant

RNA is extracted and quantifying PCR method is shown in embodiment 1.

Transgenosis T0 is extracted for plant leaf blade RNA, purpose in OsDTH1 overexpression plant is had detected using quantitative PCR method The expression (Fig. 5) of gene, in 3 plants of transgenic plants of detection, expression quantity is more than 100 times.

12. the knockout site primer of knockout transgenic rice

The genomic DNA that transgenic plant and nontransgenic plants are extracted using DNA extraction kit, as template, PCR amplification, detected through gel electrophoresis amplified production are carried out using the primer for knocking out target spot both ends, and is sequenced, is tied according to sequencing Fruit carries out sequence alignment, and detection knocks out the catastrophe in site.

The seedling stage peroxidating Stress treatment of 7 transgenic paddy rice of embodiment.

By the transgenic lines seed decladding of OsDTH1 overexpression and gene knockout disinfection (75% ethanol postincubation 1min, 1.5%NaClO handles 20min, sterile water wash 5 times), it germinates on the 1/2MS culture medium containing 50mg/L hygromycin, it is wild Type control evening is sowed on the 1/2MS culture medium without hygromycin for one day.Germination is selected after germinateing 2~3 days well and growing way is consistent Seed, be transferred on 96 plates, be put into rice nutrition liquid and cultivated, when seedling it is long to 4 leaf phase when, seedling is transferred to containing 60mM H₂O₂Rice nutrition liquid in carry out peroxidating Stress treatment, seedling is transferred in normal nutrition liquid after 6 days and carries out rehydration by processing, Phenotype is observed after illumination cultivation room is grown 7~10 days, counts the survival rate of plant.Phenotype is observed in treatment process and is taken pictures.

Experimental result can be seen that under normal growing conditions, and OsDTH1 transgenic plant and WT lines are not obvious Difference；After peroxidating stress, WT lines blade obviously crimps wilting, and the growth of transgenic plant is also by certain journey The influence of degree, but growing way is substantially better than WT lines, and the n plant survival rate of 3 transgenic lines is all remarkably higher than open country after stress Raw type plant (Fig. 6) should be the result shows that overexpression OsDTH1 improves the resistance that rice seedling coerces peroxidating.

Under normal growing conditions, the transgenic plant and WT lines that OsDTH1 is knocked out do not have apparent difference；In mistake After oxidative stress, WT lines blade by a degree of influence, wither by the rotaring gene plant blade curling that OsDTH1 is knocked out Listless more serious, the n plant survival rate of 3 transgenic lines is substantially less than WT lines (Fig. 7) and is somebody's turn to do the result shows that striking after stress Except OsDTH1 gene reduces the resistance that rice seedling coerces peroxidating.

In conclusion being described in detail although being cited some specific examples to the present invention, to art technology For personnel, as long as it is obvious for making various changes or correcting without departing from the spirit and scope of the present invention.

Sequence table

<110>Shanghai City Agricultural biological Gene Center

<120>a kind of OsDTH1 gene relevant to paddy rice anti contravariance and its coding albumen and application

<130> OsDTH1

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1323

<212> DNA

<213> Oryza sativa

<220>

<221> CDS

<222> (369)..(1190)

<400> 1

acagccctgg aacattggcc atgccaaaaa gttaggcttt ctttccattc attcattcat 60

tcatcagcta gcaaagcaaa gcattttctc agctcaagtt gcttgctcct cttctttctt 120

tcttcctcct ccccttccct ttcaggactc ctccccccac atcagtagct ttcactgccc 180

aaaccctctt tgtgggtggc aaccctagat tattaatgtc ctcctcctca tcatcaccat 240

ctcctcctct tcttcctccc ctgcttctct ctccagattc tcttctcatc tggtcccttc 300

cttcccctgc tttgcttgct cagctagctg atcgcacgtg ggtagggtga gtgtgtgtgc 360

gtgtgtgg atg gga gtc cac gca atg tcg tgc cac ggc ggc ggc ggc ggt 410

Met Gly Val His Ala Met Ser Cys His Gly Gly Gly Gly Gly

1 5 10

ggc ggc gaa ggg gca ctg tcg cgg cag ggg tcg gtg tac agc ctg acg 458

Gly Gly Glu Gly Ala Leu Ser Arg Gln Gly Ser Val Tyr Ser Leu Thr

15 20 25 30

ctg aac gag gtg gag agc cac ctg ggc gag ccg ctg cgg agc atg aac 506

Leu Asn Glu Val Glu Ser His Leu Gly Glu Pro Leu Arg Ser Met Asn

35 40 45

ctg gac gac ctc ctg cgc acg gtg ctc ccc gcc gcg gcg gcg gcg gcg 554

Leu Asp Asp Leu Leu Arg Thr Val Leu Pro Ala Ala Ala Ala Ala Ala

50 55 60

gag acg gcg ggg agg aag acg gtg gac gag gtg tgg cgc gac atc cag 602

Glu Thr Ala Gly Arg Lys Thr Val Asp Glu Val Trp Arg Asp Ile Gln

65 70 75

ggc gcc agc acc ggc cgg cac cac gcg acg ccc atg ggc gag atg acg 650

Gly Ala Ser Thr Gly Arg His His Ala Thr Pro Met Gly Glu Met Thr

80 85 90

ctc gag gac ttc ctc tcg cgc gcc ggc gtc gcc gtc gac ggt gcc gcc 698

Leu Glu Asp Phe Leu Ser Arg Ala Gly Val Ala Val Asp Gly Ala Ala

95 100 105 110

tcc gcc gcc ggc gcg cat tgg ctg cgt ggg cac tac ccg ccg ccg ccg 746

Ser Ala Ala Gly Ala His Trp Leu Arg Gly His Tyr Pro Pro Pro Pro

115 120 125

ccg ccg acg acg acg acg ctg cag tac gtg ggc ggc tcc ggg gcg gtg 794

Pro Pro Thr Thr Thr Thr Leu Gln Tyr Val Gly Gly Ser Gly Ala Val

130 135 140

gtg gac ggc gtg tat aac cgc gtg gac ggg cac ggc gtc gcg ggg ttc 842

Val Asp Gly Val Tyr Asn Arg Val Asp Gly His Gly Val Ala Gly Phe

145 150 155

ctc tcg cag gtg ggc gtg gcg ggg cgg aag cgc ggc ggc ggc gtg gac 890

Leu Ser Gln Val Gly Val Ala Gly Arg Lys Arg Gly Gly Gly Val Asp

160 165 170

ggc gtg gtg gag aag acg gtg gag cgg agg cag aag cgc atg atc aag 938

Gly Val Val Glu Lys Thr Val Glu Arg Arg Gln Lys Arg Met Ile Lys

175 180 185 190

aac cgc gag tcg gcg gcg cgg tcc cga gca cgg aag cag gca tac acg 986

Asn Arg Glu Ser Ala Ala Arg Ser Arg Ala Arg Lys Gln Ala Tyr Thr

195 200 205

aac gag ctc gag aac aag atc tcg cgg ttg gag gag gag aac cag cgc 1034

Asn Glu Leu Glu Asn Lys Ile Ser Arg Leu Glu Glu Glu Asn Gln Arg

210 215 220

ctc agg gag cac aag gct gtt gct gat ttc tca aca ttc cct agc tgc 1082

Leu Arg Glu His Lys Ala Val Ala Asp Phe Ser Thr Phe Pro Ser Cys

225 230 235

gtc gat ttc ctg aaa gca ttc ttg acg cag aag ctg gaa cca gta atg 1130

Val Asp Phe Leu Lys Ala Phe Leu Thr Gln Lys Leu Glu Pro Val Met

240 245 250

cag att gtg ccc cag ccg gag ccg aag cag cag ctg cga cga act act 1178

Gln Ile Val Pro Gln Pro Glu Pro Lys Gln Gln Leu Arg Arg Thr Thr

255 260 265 270

tcg gcc tct ttc taatcaacca accacaatgt tcatagcgaa atgatttaaa 1230

Ser Ala Ser Phe

ctcgatctct gtaggaaaat caatgggggt ttgtacttgg ggatgctggc tgttgtgaac 1290

aagagctgaa acgacgaact cttttcttaa cta 1323

<210> 2

<211> 274

<212> PRT

<213> Oryza sativa

<400> 2

Met Gly Val His Ala Met Ser Cys His Gly Gly Gly Gly Gly Gly Gly

1 5 10 15

Glu Gly Ala Leu Ser Arg Gln Gly Ser Val Tyr Ser Leu Thr Leu Asn

20 25 30

Glu Val Glu Ser His Leu Gly Glu Pro Leu Arg Ser Met Asn Leu Asp

35 40 45

Asp Leu Leu Arg Thr Val Leu Pro Ala Ala Ala Ala Ala Ala Glu Thr

50 55 60

Ala Gly Arg Lys Thr Val Asp Glu Val Trp Arg Asp Ile Gln Gly Ala

65 70 75 80

Ser Thr Gly Arg His His Ala Thr Pro Met Gly Glu Met Thr Leu Glu

85 90 95

Asp Phe Leu Ser Arg Ala Gly Val Ala Val Asp Gly Ala Ala Ser Ala

100 105 110

Ala Gly Ala His Trp Leu Arg Gly His Tyr Pro Pro Pro Pro Pro Pro

115 120 125

Thr Thr Thr Thr Leu Gln Tyr Val Gly Gly Ser Gly Ala Val Val Asp

130 135 140

Gly Val Tyr Asn Arg Val Asp Gly His Gly Val Ala Gly Phe Leu Ser

145 150 155 160

Gln Val Gly Val Ala Gly Arg Lys Arg Gly Gly Gly Val Asp Gly Val

165 170 175

Val Glu Lys Thr Val Glu Arg Arg Gln Lys Arg Met Ile Lys Asn Arg

180 185 190

Glu Ser Ala Ala Arg Ser Arg Ala Arg Lys Gln Ala Tyr Thr Asn Glu

195 200 205

Leu Glu Asn Lys Ile Ser Arg Leu Glu Glu Glu Asn Gln Arg Leu Arg

210 215 220

Glu His Lys Ala Val Ala Asp Phe Ser Thr Phe Pro Ser Cys Val Asp

225 230 235 240

Phe Leu Lys Ala Phe Leu Thr Gln Lys Leu Glu Pro Val Met Gln Ile

245 250 255

Val Pro Gln Pro Glu Pro Lys Gln Gln Leu Arg Arg Thr Thr Ser Ala

260 265 270

Ser Phe

Claims

1. a kind of OsDTH1 gene relevant to paddy rice anti contravariance, which is characterized in that the sequence of the OsDTH1 gene is for example following One of:

DNA sequence dna shown in SEQ ID NO:1；

With the homologous DNA sequence dna of SEQ ID NO:1 at least 90%；

Function is equivalent to the subfragrnent of sequence shown in SEQ ID NO:1.

2. OsDTH1 gene according to claim 1, which is characterized in that the sequence of the OsDTH1 gene is as following One of:

DNA sequence dna shown in 369-1193 in SEQ ID NO:1；

Or with 369-1193 in SEQ ID NO:1 shown in DNA sequence dna of the DNA sequence dna similitude up to 90%.

3. a kind of albumen comprising OsDTH1 gene as claimed in claim 1 or 2 coding, which is characterized in that the amino of the albumen Acid sequence as shown in SEQ ID NO:2, or homologous sequence or conservative variant for the SEQ ID NO:2 sequence or Allelic variant or natural mutation or induced mutants.

4. a kind of recombinant vector comprising gene as claimed in claim 1 or 2.

5. recombinant vector according to claim 4, which is characterized in that constructing carrier selected by the recombinant vector is Ti Plasmid or plant viral vector.

6. a kind of a kind of vegetable transformant comprising OsDTH1 gene as claimed in claim 1 or 2.

7. transformant according to claim 6, which is characterized in that the host of the transformant is rice.

8. a kind of application improved in stress resistance of plant, which is characterized in that the plant applied in the resistance is wanted comprising right The gene of 1 or 2 OsDTH1 is sought, the plant is rice.