CN110184279A - New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum - Google Patents
New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum Download PDFInfo
- Publication number
- CN110184279A CN110184279A CN201910493917.2A CN201910493917A CN110184279A CN 110184279 A CN110184279 A CN 110184279A CN 201910493917 A CN201910493917 A CN 201910493917A CN 110184279 A CN110184279 A CN 110184279A
- Authority
- CN
- China
- Prior art keywords
- srdreb2a
- expression vector
- branch development
- stevia rebaudianum
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention belongs to molecular biology fields, disclose stevia rebaudianum and promote branch development geneSrDREB2AAnd its plant expression vector and construction method.Stevia rebaudianum promotes branch development geneSrDREB2A, sequence is SEQ ID NO.1.The plant expression vector isBglAfter II single endonuclease digestion pCAMBIA1305.1 expression vector, one section of pCAMBIA1305.1 carrier sequence is added respectively with both endsSrDREB2AGenetic fragment carries out recombining reaction and obtains.SrDREB2AIt is a new promotion branch development gene.The present inventionSrDREB2APlant expression vector be to report for the first time, can be directly used for Agrobacterium-mediated genetic transformation, create the new germ plasm of branch development enhancing, improve the biological yield of plant, can be used for carrying out plant species improvement.
Description
Technical field
The invention belongs to molecular biology field, it is related to a new promotion branch development gene in stevia rebaudianumSrDREB2AAnd
Its plant expression vector and application.
Background technique
Stevia rebaudianum (Stevia rebaudianaIt Bertoni) is composite family (Asteraceae) herbaceos perennial, leaf
In the steviol glycoside component sugariness that is rich in be about 300-400 times of sucrose, and have low in calories, prevention and adjuvant treatment fat
The advantages that disease, diabetes, hypertension and hyperglycemia[1], therefore it has been widely used in food, beverage and medicine and other fields, stevia rebaudianum
Also become after sugarcane and beet the most natural sugar crop of development prospect.
Branch development is a kind of common biological phenomena, and morphogenesis and final yield forming for plant have
It has a major impact.Stevia rebaudianum is harvest object with blade, is had multiple studies have shown that its cured leaf yield and number of branches are at positive
It closes[2], therefore the gene for excavating positive regulation branch development in stevia rebaudianum plays a significant role for improving stevia rebaudianum yield.SrDREB2ABelong to the distinctive AP2/ERF class transcription factor family DREB subfamily A-2 subgroup gene of plant, this subgroup gene
In arabidopsis[3], rice[4]And sunflower[5]Be reported in equal plants be primarily involved in the drought-enduring of positive regulation plant, salt tolerant and
The processes such as high temperature resistant, andSrDREB2AIt is proven to have the new function of regulation branch development.The present invention is by stevia rebaudianumSrDREB2ABase
Because being building up on plant expression vector, the new germ plasm that side shoot increases is obtained by agrobcterium-mediated transformation.This
Extensive use of the patent for the cultivation of elite crop new varieties and in production, is of great significance.
Summary of the invention
The present invention provides the new gene for promoting branch developmentSrDREB2A。
The present invention also provides the promotion branch development genesSrDREB2APlant expression vector and its construction method.
Technical problem of the invention can solve by the following technical programs:
Stevia rebaudianum promotes branch development geneSrDREB2A, the sequence of the gene is SEQ ID NO. 1.
Stevia rebaudianum promotes branch development geneSrDREB2APlant expression vector, promote branch to develop base by the stevia rebaudianum
CauseSrDREB2AIt is constituted with plant expression vector.
The stevia rebaudianum promotes branch development geneSrDREB2APlant expression vector construction be first with addition carrier
The adapter-primer SEQ ID NO. 4 of sequence and 5 pairs of SEQ ID NO. buildings are on pMD19-T Simple carrierSrDREB2AFull length gene sequence expand and electrophoresis detection recycling target fragment after with warpBglII single endonuclease digestion
PCAMBIA1305.1 zero load carries out what recombining reaction obtained.
The stevia rebaudianum promotes branch development geneSrDREB2AThe construction method of plant expression vector the following steps are included:
(1) design primer SrDREB2A-F and SrDREB2A-R carries out PCR reaction with high fidelity enzyme using stevia rebaudianum cDNA as template,
Wherein upstream and downstream primer sequence is respectively SEQ ID NO. 2 and SEQ ID NO. 3；
(2) PCR product of step (1) is connected to pMD19-T Simple carrier using T4 ligase, convertedDH5αCompetence
Cell extracts positive plasmid pMD19-T Simple-SrDREB2A；
(3) SrDREB2A- is utilizedBglII-F and SrDREB2A-BglII-R primer pair is connected on pMD19-T carrierSrDREB2AFull length sequence is expanded, and purpose band is recycled after electrophoresis detection, with utilizationBglAfter II enzyme single endonuclease digestion
PCAMBIA1305.1 carrier carries out recombining reaction, recombinant plasmid transformedDH5αCompetent cell, positive plasmid are that stevia rebaudianum promotes
Branch development geneSrDREB2APlant expression vector pCAMBIA1305.1-SrDREB2A。
The stevia rebaudianum promotes branch development geneSrDREB2AIncrease the application in new germ plasm in creation branch.
The promotion branch development geneSrDREB2APlant expression vector increases answering in new germ plasm in creation branch
With.
Beneficial effects of the present invention:
1. provided by the inventionSrDREB2AGene is the new gene for promoting branch development, which can promote plant point
Branch development.
2. the stevia rebaudianum that the present invention constructs promotes branch development geneSrDREB2APlant expression vector is to report for the first time, can
It is directly used in Agrobacterium-mediated genetic transformation, multi-branched new germ plasm is created, plant species improvement can be carried out.
Detailed description of the invention
Fig. 1 plant expression vector pCAMBIA1305.1-SrDREB2AConstructing plan.
Fig. 2 wild type (WT) and transgenic arabidopsis (SrDREB2A) PCR identification.
Fig. 3 wild type and transgenic arabidopsis collateral development phenotype.
Specific embodiment
Term as used in the present invention generally has those of ordinary skill in the art usual unless otherwise specified
The meaning of understanding.
Below with reference to specific preparation embodiment and Application Example, and this hair is described in further detail referring to data
It is bright.It should be understood that these embodiments are of the invention solely for the purpose of illustration, rather than limit the scope of the invention in any way.
Below in an example, the various processes and method being not described in detail are conventional methods as known in the art.
Used primer, is indicated on the first occurrence, and same primers used, identical with the content shown for the first time thereafter.
Embodiment 1.SrDREB2AClone
Selection stevia rebaudianum (Stevia rebaudianaBertoni) blade is as material, referring to Trizol RNA extracts kit
(TaKaRa) specification method extracts blade total serum IgE, takes 1 μ g total serum IgE to invert according to M-MLV reverse transcription reagent box (TaKaRa)
Record into cDNA.
Using the leaf cDNA of extraction as template, design primer SrDREB2A-F and SrDREB2A-R carry out PCR reaction:
Upstream primer SrDREB2A-F:ATCTGTTGCTCTGTTGATGT (SEQ ID NO. 2)
Downstream primer SrDREB2A-R:GTTCAACCTAAGGCCAGTAA (SEQ ID NO. 3)
50 μ L reaction systems: 10 × Buffer for KOD, 5.0 μ L, SrDREB2A-F and SrDREB2A-R primer each 1.5
µL (10 pmol/µL), 2 mM dNTPs 5.0 µL, 25 mM MgSO4 2.0 1 μ L, cDNA template 1 of μ L, KOD
µL, ddH2O 33.0 µL；Response procedures: 94 DEG C of 2 min of initial denaturation, then 94 DEG C of unwinding 15 sec, 55 DEG C of annealing 30
Sec, 68 DEG C of 1 min of extension, reacts 35 circulations；Agarose electrophoresis, product gel reclaims kit are carried out after PCR
(TaKaRa) recovery purifying is connected to pMD19-T Simple carrier (TaKaRa) with T4 DNA ligase (TaKaRa), conversion
Escherichia coliDH5αCompetent cell, picking monoclonal carries out bacterium solution detection and surveys to positive colony after 37 DEG C of overnight incubations
Sequence obtainsSrDREB2AFull length sequence is SEQ ID NO. 1.
2. plant expression vector pCAMBIA1305.1- of embodimentSrDREB2ABuilding
Design primer SrDREB2A-BglII-F and SrDREB2A-BglII-R is to building on pMD19-T Simple carrierSrDREB2AFull length sequence carries out PCR amplification, in target geneSrDREB2AUpstream and downstream introduce the expression of one section of plant respectively and carry
Body pCAMBIA1305.1BglCarrier sequence near II restriction enzyme site, then and through BglII single endonuclease digestion
PCAMBIA1305.1 carrier carries out recombining reaction, recombinant plasmid transformed Escherichia coliDH5αCompetent cell, 37 DEG C of overnight incubations
Picking monoclonal carries out bacterium solution detection afterwards and sequence verification is SEQ ID NO. 1, the specific steps are as follows:
Upstream primer SrDREB2A-BglII-F: actcttgaccatggtagatctATGGGTCTTCTTAGTCAACCACCC
(SEQ ID NO. 4)
Downstream primer SrDREB2A-BglII-R: tagaaatttaccctcagatctCTATATACCCAAATCATCATCCATA
CAC (SEQ ID NO. 5)
1. the positive sequencing plasmid extracted using in embodiment 1 is as template, with the system reacted of PCR in embodiment 1 and program one
1 μ L of cDNA template is only substituted for 1 μ L of positive plasmid and carries out PCR reaction by sample, and the target fragment expanded is examined through electrophoresis
Surveying after determining recycles Ago-Gel QIAquick Gel Extraction Kit to be recycled.
2. utilizingBglThe fast enzyme cutting of II (TaKaRa) carries out single endonuclease digestion, single endonuclease digestion system to pCAMBIA1305.1 empty carrier
(40 μ L): 10 × QuickCut Buffer, 4.0 μ L, QuickCut BglII, 2.0 μ L, pCAMBIA1305.1 carrier
10 μ L(total amount of plasmid, 2 μ g), ddH2Electrophoresis detection is carried out after O 24 μ L, 37 DEG C of 1 h of reaction and recycles linearisation carrier-pellet
Section.
3. the target gene fragment being recovered in 1. and 2. and carrier segments are carried out recombining reaction, recombining reaction system
(10 μ L): it is recycled in 1.SrDREB2A3.5 μ L of genetic fragment, 2. in 3.5 μ L of pCAMBIA1305.1 linearized vector,
4 are down to after 1 μ L, 5 × CE II Buffer (Vazyme) of Exnase II (Vazyme) 2 μ L, 37 DEG C of 30 min of reaction
℃.By recombinant plasmid transformed Escherichia coliDH5αCompetent cell, 37 DEG C are incubated overnight rear picking monoclonal and carry out bacterium solution detection
And sequence verification is SEQ ID NO. 1, plant expression vector pCAMBIA1305.1-SrDREB2AIt constructs successfully.
3. plant expression vector pCAMBIA1305.1- of embodimentSrDREB2AGenetic transformation arabidopsis and its collateral development
Phenotypic evaluation
(1) freeze-thaw method converts agrobacterium strainsEHA105
Take 10 μ L pCAMBIA1305.1-SrDREB2A50 μ L are added in vector plasmidEHA105Competent cell is (only raw
Object), then 30 min of ice bath, liquid nitrogen frozen 5 min, 37 DEG C of 5 min of heat shock are added 800 μ L YEB fluid nutrient mediums, and 28 DEG C
200 rpm cultivate 4 h, and bacterium solution coated plate is in+50 μ g/mL kanamycins of YEB(50 μ g/mL rifampin) on solid medium, 28
DEG C be inverted dark culture 2-3 days, picking monoclonal utilize primer SrDREB2A-BglII-F and SrDREB2A-BglII-R carries out PCR
Detection chooses positive colony and shakes bacterium, converts for arabidopsis floral；
(2) arabidopsis floral dip dyeing and seed screening
100 μ L of positive colony bacterium solution in (1) is connected to the YEB of 100 mL, and (that is mould for+50 μ g/mL card of 50 μ g/mL rifampin
Element) in fluid nutrient medium, culture to OD6000.8-1 or so, 4000 rpm be centrifuged 20 min, then with conversion fluid (1/2 MS,
The sucrose of 50 g/L is added, the Silwet L-77 of 200 μ L/L, adjusting PH is the precipitating that 5.8) sufficiently suspends.Arabidopsis has been grown
Pod and by complete steamed dumpling with pork, mushrooms and bamboo shoots pod extend thaliana flower cut, then remaining is spent and is directly soaked in 1 min in above-mentioned suspension,
With the fully wrapped around plant of preservative film to keep certain humidity after having infected, put open after 20 h of dark culture in the incubator it is fresh-keeping
Film is put 37 DEG C baking oven 2-3 days, is then put in 4 DEG C of refrigerators to seed mature harvesting, the seed after harvesting in time.
Seed disinfection and sowing: the seed being placed in 4 DEG C of refrigerators is divided in 1.5 mL centrifuge tubes, and 1 mL 75% is added
Alcohol, turn upside down 15 min of washing, directly will kind after having washed then in superclean bench with 100% ethanol wash 4 times
Son is poured on the filter paper to sterilize together with alcohol, gently taps filter paper for seed uniform broadcasting to screening and culturing after seed drying
Base (+25 mg/L ampicillin of MS+20 mg/L hygromycin) screening and culturing 10-14 days, then by resistance transplantation of seedlings to soil
In, preservative film covers 5-7 days with moisturizing；
(3) branch develops phenotypic evaluation
To the continuous sowing of positive seedling to T3 generation, and carries out PCR and detect its expression quantity.Wild type and T3 are for transgenic arabidopsis single plant
It plants in Yu little Fang basin, the incubator photoperiod is that 16 h illumination/8 h dark have found 2 transgenic arabidopsis after growth 35 days
The side shoot number of strain is significantly more than wild type.
In conclusion the present invention is constructed containing the plant expression vector pCAMBIA1305.1 for promoting branch development gene,
WhereinSrDREB2APromote branch development to report for the first time.Constructed carrier is heritable to be transformed into plant, and plant is promoted
Branch development.
Bibliography:
[1] Lemus-Mondaca R, Vega-Gálvez A, Zura-Bravo L, Ah-Hen K (2012) Stevia
rebaudiana Bertoni, source of a high-potency natural sweetener: A
comprehensive review on the biochemical, nutritional and functional aspects.
Food Chemistry 132 (3): 1121-1132
[2] Yadav AK, Singh S, Dhyani D, Ahuja PS (2011) A review on the
improvement of stevia [Stevia rebaudiana (Bertoni)]. Revue Canadienne De
Phytotechnie 91 (1): 1-27.
[3] Sakuma Y, Maruyama K, Qin F, Osakabe Y, Shinozaki K, Yamaguchi-
Shinozaki K (2006) Dual function of an Arabidopsis transcription factor
DREB2A in water-stress-responsive and heat-stress-responsive gene expression.
Proceedings of the National Academy of Sciences, 103(49): 18822-18827.
[4] Matsukura S, Mizoi J, Yoshida T, Todaka D, Ito Y, Maruyama K,
Shinozaki K, Yamaguchi-Shinozaki K (2010) Comprehensive analysis of rice
DREB2-type genes that encode transcription factors involved in the expression
of abiotic stress-responsive genes. Molecular Genetics and Genomics 283(2):
185-196.
[5] Díaz-Martín J, Almoguera C, Prieto-Dapena P, Espinosa JM, Jordano J
(2005) Functional interaction between two transcription factors involved in
the developmental regulation of a small heat stress protein gene promoter.
Plant Physiology, 139(3): 1483-1494。
Sequence table
<110>Institute of Botany
<120>new a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 906
<212> DNA
<213>stevia rebaudianum (Stevia rebaudiana)
<400> 1
atgggtcttc ttagtcaacc acccaacaca gtttcttcac gaccggattg cttaaaaaag 60
aagaaaagca gaagtagaaa agaggcacca aagaaagttg ctgcaacact cgccaagtgg 120
atcgaataca acaatgctga ctcagcagac accaaatcaa aaacgcgtaa agcacccgcc 180
aaaggttcaa aaaagggttg catgaaggga aaaggcgggc ccgagaacgc caggtgtaac 240
ttccgaggtg tgagacaaag aacatggggt aaatgggttg ctgaaattcg tgaaccgaat 300
cgcggtaaaa ggttatggct cgggacattt gggtcagcgg ttcaagccgc attggcttat 360
gatgaagcgg ctcgagccat gtacgggtca tgtgctcgac tcaattttcc aaactgtcaa 420
ccgaagaatg tttatgataa tagttttccg cttgtggcta accctgcttc tagctgtgac 480
tcgaccacga catgtagcta ctctgaaggc ggtgcaaccc atgagtccaa accggagtta 540
accgtgtttc caaacatcaa acatgaggag aacttacaag tgaaacatga acctgaaatt 600
gtagctaaag aagaacaact ttctgatggc aataaagatc cgagttttta tcctgttgat 660
gaaatgtttg atctggatca acttcttgaa tctgtatcgg gttgtattcg tgagccaggg 720
tctgaaccgg ggtctggtga tggttacgag ggttggtttg aagacggtca gatgggcatg 780
aatcaagatc cgtgtttgag cggtttggat tatagttttg atttcttgga gccgggtcgt 840
cccgaagatt gtagtattac aatggaggag ttgggtctgt gtatggatga tgatttgggt 900
atatag 906
<210> 2
<211> 20
<212> DNA
<213>stevia rebaudianum (Stevia rebaudiana)
<400> 2
atctgttgct ctgttgatgt 20
<210> 3
<211> 20
<212> DNA
<213>stevia rebaudianum (Stevia rebaudiana)
<400> 3
gttcaaccta aggccagtaa 20
<210> 4
<211> 45
<212> DNA
<213>stevia rebaudianum (Stevia rebaudiana)
<400> 4
actcttgacc atggtagatc tatgggtctt cttagtcaac caccc 45
<210> 5
<211> 49
<212> DNA
<213>stevia rebaudianum (Stevia rebaudiana)
<400> 5
tagaaattta ccctcagatc tctatatacc caaatcatca tccatacac 49
Claims (6)
1. STEVIA REBAUDIANA promotes branch development geneSrDREB2A, it is characterised in that the sequence of the gene is SEQ ID NO. 1.
2. promoting branch development gene containing stevia rebaudianum described in claim 1SrDREB2APlant expression vector, feature exists
In by stevia rebaudianum described in claim 1 promotion branch development geneSrDREB2AIt is constituted with plant expression vector.
3. according to claim 2 promote branch development gene containing stevia rebaudianum described in claim 1SrDREB2APlant
Object expression vector, it is characterised in that utilize the primer pair of addition carrier sequenceSrDREB2AExpanded to obtain after target fragment with
ThroughBglPlant expression vector pCAMBIA1305.1 after II single endonuclease digestion carries out recombining reaction and obtains.
4. as claimed in claim 3 promote branch development gene containing stevia rebaudianum described in claim 1SrDREB2APlant table
Up to the construction method of carrier, it is characterised in that include the following steps: (1)SrDREB2AThe acquisition of full length gene code area: design
Primer SrDREB2A-F:SEQ ID NO. 2 and SrDREB2A-R:SEQ ID NO. 3 is carried out by template of stevia rebaudianum cDNA
PCR reaction, PCR product are connected to pMD19-T Simple carrier, convertDH5αCompetent cell extracts positive plasmid and surveys
Sequence obtainsSrDREB2AFull length sequence SEQ ID NO. 1；(2) design primer SrDREB2A-BglII-F: SEQ ID NO. 4
And SrDREB2A-BglII-R:SEQ ID NO. 5, to construct on pMD19-T Simple carrierSrDREB2AGene
Overall length is that template carries out PCR amplification, and electrophoresis detection simultaneously recycles target fragment；(3) it utilizesBglII enzyme is to pCAMBIA1305.1 sky
It is loaded into after the linearisation of row single endonuclease digestion and carries out recombining reaction, recombinant plasmid transformed Escherichia coli with the target fragment being recovered in (2)DH5αPositive plasmid, electrophoresis detection and sequence verification are extracted after competence as SEQ ID NO. 1, show plant expression vector
pCAMBIA1305.1-SrDREB2AIt constructs successfully.
5. stevia rebaudianum described in claim 1 promotes branch development geneSrDREB2AApplication in creation multi-branched new germ plasm.
6. application of the plant expression vector as claimed in claim 2 in creation multi-branched new germ plasm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910493917.2A CN110184279A (en) | 2019-06-08 | 2019-06-08 | New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910493917.2A CN110184279A (en) | 2019-06-08 | 2019-06-08 | New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110184279A true CN110184279A (en) | 2019-08-30 |
Family
ID=67720944
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910493917.2A Pending CN110184279A (en) | 2019-06-08 | 2019-06-08 | New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110184279A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113881686A (en) * | 2021-10-21 | 2022-01-04 | 青岛农业大学 | Method and sequence for improving branching capability of plant and fruit seedling breeding method |
| CN115851754A (en) * | 2022-07-11 | 2023-03-28 | 华中农业大学 | Soybean gene GmYSL7 and application thereof, primer pair, expression vector and application thereof |
-
2019
- 2019-06-08 CN CN201910493917.2A patent/CN110184279A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113881686A (en) * | 2021-10-21 | 2022-01-04 | 青岛农业大学 | Method and sequence for improving branching capability of plant and fruit seedling breeding method |
| CN115851754A (en) * | 2022-07-11 | 2023-03-28 | 华中农业大学 | Soybean gene GmYSL7 and application thereof, primer pair, expression vector and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105753956B (en) | Upland cotton GhB2 albumen and its encoding gene and application | |
| CN110904071B (en) | Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance | |
| CN109750047B (en) | Tea tree hexose transporter gene CsSWEET17 and application thereof in regulating and controlling vegetative growth and seed size of plants | |
| CN102464710A (en) | Helicoverpa armigera juvenile hormone binding protein (Ha-JHBP) and encoding gene and application thereof | |
| CN109111514A (en) | And the breeding method and its relevant biological material of the transgenic wheat of anti-banded sclerotial blight and root rot | |
| CN107674873A (en) | Wheat thermal excited transcryption factor gene TaHsfA2i and its encoding proteins and application | |
| Yang et al. | Genetic transformation and expression of transgenic lines of Populus x euramericana with insect-resistance and salt-tolerance genes | |
| CN110184279A (en) | New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum | |
| CN112746062A (en) | Protein related to biosynthesis of perilla terpene substances as well as encoding gene and application thereof | |
| CN106397556B (en) | Plant drought GAP-associated protein GAP ZmNAC111 and its encoding gene and application | |
| US20240043858A1 (en) | A Protein Vapbp2-L For Enhancing Drought Resistance Of Plants And Application Thereof | |
| CN108864264B (en) | Corn OXS2a gene, and encoding protein and application thereof | |
| CN113201558B (en) | Soybean GmHDA12 gene and protein and application thereof | |
| CN109295070A (en) | A kind of and paddy rice anti contravariance related gene OsDTH1 and its coding albumen and application | |
| CN112795580B (en) | Pitaya gene HuAAE3 and application thereof in regulation and control of high temperature stress resistance of plants | |
| CN106632627B (en) | LNSM protein and application of encoding gene thereof in plant transgenosis | |
| CN109234290B (en) | Brassica napus BnKAT2 gene and promoter and application thereof | |
| CN111139244A (en) | Populus tomentosa MODD1 gene and application thereof | |
| CN113604475B (en) | Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance | |
| CN115851812B (en) | Dragon fruit HuC3H35 gene and encoding protein and application thereof | |
| CN103408647B (en) | Plant green-staying related protein as well as coding gene and application thereof | |
| CN114875025B (en) | Drought and ABA inducible promoter P SCBV-YZ2060 And applications thereof | |
| CN112280779B (en) | Promoter pNtab3450 and expression vector and application thereof | |
| CN116200401B (en) | Application of feather needle grass sugar transporter gene SpSWEET13 in promotion of plant root sticky soil | |
| CN112592392B (en) | Application of pleiotropic gene SbSnf4 in improvement of cane sugar yield, plant height, fresh weight of stems and/or juice amount |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190830 |