CN113881686A

CN113881686A - Method and sequence for improving branching capability of plant and fruit seedling breeding method

Info

Publication number: CN113881686A
Application number: CN202111225782.5A
Authority: CN
Inventors: 郑晓东; 边传杰; 张勇; 孙志娟; 王彩虹; 田义轲; 马长青; 刘晓丽
Original assignee: Qingdao Agricultural University
Current assignee: Qingdao Agricultural University
Priority date: 2021-10-21
Filing date: 2021-10-21
Publication date: 2022-01-04

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses a method and a sequence for improving the branching capacity of plants and a method for breeding fruit seedlings, wherein the method for improving the branching capacity of plants specifically comprises the following steps: performing monoclonal amplification on the CBF-L gene by using an upstream primer and a downstream primer of the CBF-L gene to obtain an amplification product; constructing an overexpression vector by using the gene obtained by cloning; the plant overexpression vector is transferred into a GALA-3 plant. The invention clones and identifies the CBF full-length gene from apple, wherein the CDS sequence of the CBF-L gene is shown in a sequence table SEQ ID NO. 1; the selected plant is preferably apple. The invention is implemented to verify the effect of CBF-L in apple branches, and the CBF-L is overexpressed in GALA-3 plants in a transgenic mode, so that the apple branches are effectively regulated and controlled.

Description

Method and sequence for improving branching capability of plant and fruit seedling breeding method

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a method and a sequence for improving the branching capacity of plants and a seedling breeding method.

Background

Plant branching is an important factor affecting plant type formation and has an important influence on plant biological characteristics and agricultural production. In the plant growth process, axillary buds and terminal buds are developed from bud primordia, the terminal buds are completed at one time in the early development stage of a stem and are mainly related to the main development of the plant, the axillary buds are fixed buds growing from leaf axillary branches, the fixed buds are commonly found in seed plants and are mainly related to plant branches, and the formation and the development of the terminal buds and the axillary buds jointly regulate the growth of the overground part of the plant and the formation of the plant configuration. The formation of axillary buds and the development of branches in plants are also influenced by many factors, and the stem tip inhibits the formation of axillary buds in a manner of apical dominance, thereby influencing the branching of the stem. The plants are influenced by self-hormone (auxin, strigolactone and cytokinin) regulation, nutrient distribution and environmental factors and are regulated by a plurality of complex signals, so that the growth of axillary buds is regulated, the formation of new branches of the plants is influenced, and the normal life activities of the plants are ensured.

Plant branches are key factors influencing plant types, are very important for adapting plants to the environment, and influence the cultivation mode and yield of crops and horticultural crops. Particularly in the fruit tree field, the branch height, the branch number, the branch length, the branch angle and the distribution mode of the plant have great significance for the early formation of the tree shape of the fruit tree, the cultivation management of the fruit tree and the yield of the fruit tree. The generation of lateral branches is derived from the germination of axillary meristems, and the axillary buds can keep the excellent properties of the original variety after germination, which undoubtedly plays a great role in apple seedling breeding and fine variety promotion. However, the specific mechanism of collateral formation is largely unknown, and the mechanism of action is yet to be studied. CBF transcription factors are an important class of transcription factors in the AP2/ERF family. During the evolution process of plants, the domain of the CBF transcription factor has a highly conserved PKKRAGRKKFRETRHP amino acid sequence and is capable of regulating the expression of downstream genes involved in the branching phenotype and thus involved in the progression of plant life activities.

Through the above analysis, the problems and defects of the prior art are as follows: the time for cultivating new fruit tree varieties in the aspects of apple seedling breeding and fine variety promotion is long, and the yield and the quality of plants cannot be improved in a short time.

The difficulty in solving the above problems and defects is: the construction steps of the gene are various, and the survival rate of the infection of the agrobacterium maltuli transformed leaves is low.

The significance of solving the problems and the defects is as follows: the transgenic plant is difficult to domesticate after being transferred, and a certain time is needed for applying the transgenic plant in the field.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a method and a sequence for improving the branching capacity of plants and a seedling breeding method.

The present invention is achieved by a method for improving branching ability of a plant using CBF-L gene.

Further, the method for improving the branching capacity of the plant specifically comprises the following steps:

firstly, performing monoclonal amplification on a CBF-L gene by using an upstream primer and a downstream primer of the CBF-L gene to obtain an amplification product;

secondly, constructing an over-expression vector by using the gene obtained by cloning;

thirdly, the plant overexpression vector is transferred into a GALA-3 plant.

Further, the first monoclonal amplification of the CBF-L gene specifically comprises:

(1) PCR amplification of the CBF-L Gene: using the upstream primer F and the downstream primer R as a primer pair, performing monoclonal amplification on the CBF-L gene by using a 40 microliter system in the following table 1 to obtain a CBF-L nucleotide double strand; wherein, the CDS sequence of the CBF-L gene is SEQIDNO 1; the nucleotide sequence SE QIDNO of the upstream primer F is 2; the nucleotide sequence of the downstream primer R is SEQIDNO 3;

(2) connecting the CBF-L nucleotide double strand obtained by PCR amplification with a PMD-19-T (simple) carrier by using a10 microliter system, and connecting overnight at 16 ℃ to obtain a connecting product;

(3) ligation products transformed competent cells:

taking out Escherichia coli DH5 alpha competent cells from an ultra-low temperature refrigerator at minus 80 ℃, placing the Escherichia coli DH5 alpha competent cells on ice for melting, sucking 20 microliters of DH5 alpha competent cells into a 1.5mL sterile centrifuge tube, adding 10 microliters of connecting products, uniformly blowing, carrying out ice bath for 30min, carrying out water bath heat shock for 90s at 42 ℃, carrying out ice bath for 2min again, adding 200 microliters of LB liquid culture medium into a sterile environment, placing the sterile environment into a shaking table at 37 ℃ and a rotating speed of 180rpm, shaking the bacteria for 1h, opening a super clean workbench for sterilization after 30min, starting to burn an applicator after 15min, generally burning for 2-3 min, and placing the applicator on the super clean workbench for waiting to room temperature; after bacteria shaking is finished, taking 100 microliters of bacteria liquid to coat an LB plate, starting coating the plate until the plate is dried, covering a cover, sealing, marking, and culturing in a constant-temperature incubator at 37 ℃ for 10-12 hours until bacterial plaque grows out;

(4) spot picking: in an aseptic super clean bench, sucking 100 microliters of LB liquid culture medium by using an aseptic gun head, pumping into a 0.5mL aseptic centrifuge tube, picking 10 bacterial plaques by using a10 microliter aseptic gun head, placing the bacterial plaques in the LB liquid culture medium, blowing for several times, covering a cover, marking on the centrifuge tube, placing the bacterial plaques in a shaking table at 37 ℃, 180rpm and 4-6 hours to obtain a bacterial liquid;

(5) identifying bacterial liquid: after bacteria shaking is finished, performing PCR identification by using a 10-microliter system, taking the bacteria liquid as a template, the selected upstream primer as a sequence of a carrier, the selected downstream primer as a downstream primer of a gene, identifying according to a normal bacteria batch verification process, and taking water as negative control; and (3) running a small-hole adhesive, checking the positive rate of the bacterial liquid, and selecting the bright bacterial liquid in positive identification.

Further, the construction of the plant overexpression vector CBF-L-pBI121 in the second step:

(1) extracting plasmids from the positive bacterial liquid to obtain PMD-19-T (simple) fusion plasmids connected with CBF-L;

(2) carrying out double enzyme digestion on the PMD-19-T (simple) fusion plasmid connected with the CBF-L and the PBI121 empty vector according to a 40 microliter system, reacting for more than 2-6 h at 37 ℃, and carrying out enzyme digestion for 3 h;

(3) and (3) recovering and connecting the target gene and the target vector: after the enzyme digestion reaction time is finished, carrying out gel recovery on the band cut with the target gene, simultaneously cutting off the enzyme digestion band of the target vector for gel recovery, and then connecting the target gene and the target vector by using a 10-microliter system;

(4) transforming the ligation product into E.coli DH5 alpha competent cells; then, E.coli DH 5. alpha. competent cells were removed from a freezer at-80 ℃ and immediately thawed on ice, 20. mu.l of E.coli DH 5. alpha. competent cells were pipetted into a 1.5mL sterile centrifuge tube, sucking 10 microliter of the constructed connecting product, uniformly blowing, uniformly mixing, carrying out ice bath for 30min, carrying out heat shock for 90s at 42 ℃, carrying out ice bath for 2min, adding 200 microliters of LB liquid culture medium in a sterile environment, placing in a shaking table at 37 ℃ and the rotating speed of 180rpm, shaking bacteria for 1h, opening a superclean workbench after 30min for sterilization, after 15min, the coater is started to be fired for 2-3 min, the coating is placed on a clean bench to wait for the temperature to be changed to the room temperature, after bacteria shaking is finished, taking 100 microliters of bacteria liquid to coat an LB plate, starting coating the plate until the plate is dried, covering a cover, sealing, marking, and culturing in a constant-temperature incubator at 37 ℃ for 10-12 h;

(5) spot picking: in an aseptic super clean bench, sucking 100 microliters of LB liquid culture medium by using an aseptic gun head, pumping into a 0.5mL aseptic centrifuge tube, picking 10 bacterial plaques by using a10 microliter aseptic gun head, placing the bacterial plaques in the LB liquid culture medium, blowing for several times, covering a cover, marking on the centrifuge tube, placing the centrifugal tube in a shaking table, and keeping the centrifugal tube at 37 ℃, 180rpm for 4-6 hours;

(6) identifying bacterial liquid: after the bacteria shaking is finished, performing PCR identification by using a 10-microliter system shown in the table 3, and identifying by using a bacteria liquid as a template, a primer as an upstream primer of a carrier and a downstream primer of a gene according to a normal bacteria batch verification process and using water as a negative control; running a small-hole adhesive, checking the positive rate of the bacterial liquid, and selecting the bright bacterial liquid in positive identification;

(7) extracting plasmid from the positive bacterial liquid to obtain the plant overexpression vector CBF-L-pBI 121.

Further, the third step of transferring the plant overexpression vector CBF-L-pBI121 into GALA-3 plants by using an agrobacterium-mediated method specifically comprises the following steps:

(1) transforming the plant overexpression vector CBF-L-pBI121 into Agrobacterium EHA 105: taking out agrobacterium tumefaciens EHA105 competent cells from an ultra-low temperature refrigerator at minus 80 ℃, sucking 20 microliter of agrobacterium tumefaciens EHA105 competent cells into a 1.5mL sterile centrifuge tube, sucking the overexpression vector CBF-L-pBI1215 microliter, adding into 50 microliter of agrobacterium tumefaciens EHA105 competent cells, blowing, beating and uniformly mixing, carrying out ice bath for 30min, carrying out heat shock for 90s at 37 ℃, carrying out ice bath for 2min, adding into 200 microliter of LB liquid culture medium in an ultra-clean workbench, shaking for 4h in a shaking table at 28 ℃ and the rotating speed of 180rpm, after finishing shaking, taking 100 microliter of LB liquid to coat a plate, starting coating the plate until the plate becomes dry, covering a cover, sealing and marking, and putting into a constant temperature incubator at 28 ℃ for culturing for 10-12 h;

(2) agrobacterium mediated transformation of the expression vector into GALA-3 plants: culturing the obtained agrobacterium EHA105 in a YEP culture medium culture dish in a shaking table at 180rpm and 28 ℃ for 50mL in a shaking way for 4-6 hours until the OD value is 0.4-0.6, centrifuging at 25 ℃ and 5000rpm for 5min by using a centrifuge to collect thalli, suspending the bacterial liquid by using a glucose liquid culture medium, and adding 20mg of acetosyringone for later use; then, cutting off leaves of the GALA-3 plant from a test-tube seedling subjected to subculture for about 30 days for genetic transformation, selecting young leaves with 3-4 leaves spread at the top of the test-tube seedling, cutting off the leaf apex and the leaf stalk part, cutting the middle part into leaf blocks with the width of 3mm, placing the leaf blocks in a liquid co-culture medium with agrobacterium, shaking the leaf blocks for several times every 2min, wherein the infection time is about 8min approximately, then transferring the leaf blocks onto sterile filter paper to absorb bacterial liquid, and quickly transferring the leaf blocks without the bacterial liquid on the surface to a culture dish filled with the co-culture medium; after the leaves grow the transgenic buds, amplifying the buds by using an amplification culture medium; after the buds grow into seedlings, putting the seedlings into a rooting culture medium for rooting to obtain transgenic plants.

Further, the plant is a dicot.

Further, the plant is apple.

Further, the plant is gala apple.

Another object of the present invention is to provide a CDS sequence of CBF-L gene used in the method for improving branching ability of plants, wherein the CDS sequence is SEQ ID NO. 1.

Another object of the present invention is to provide a method for breeding fruit seedlings using the method for improving branching ability of plants.

By combining all the technical schemes, the invention has the advantages and positive effects that: the invention is presented in the form of transgenic plants, and the CBF-L is overexpressed in the plants of the plants to be enhanced, so that the branching capacity of the plants is increased, and the yield of fruit trees is improved. The method can obviously enhance the branching capability of apple plants, does not need to cultivate new fruit tree varieties for a long time, improves the yield and quality of the plants in a short time, and is simple and easy to implement, simple to operate and good in stability.

Drawings

FIG. 1 is a flow chart of a method for improving branching ability of a plant according to an embodiment of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Aiming at the problems in the prior art, the invention provides a method for improving the branching capacity of plants, which utilizes a transgenic technology to amplify a target gene and utilizes an agrobacterium transformation method to transfer the target gene into apple seedlings, so that the transgenic seedlings achieve the branching effect, and the method has great significance for improving the yield of fruit trees and economic benefits. In the transformation process, the survival rate of the leaves is low, the leaves can be pre-cultured firstly, and then the transformation efficiency is improved. The invention is described in detail below with reference to the accompanying drawings.

As shown in FIG. 1, the method for improving branching ability of plants provided by the invention comprises the following steps:

s101: performing monoclonal amplification on the CBF-L gene by using an upstream primer and a downstream primer of the CBF-L gene to obtain an amplification product;

s102: constructing an overexpression vector by using the gene obtained by cloning;

s103: the plant overexpression vector is transferred into a GALA-3 plant.

Those skilled in the art of the method for improving branching ability of plants provided by the present invention can also perform other steps, and the method for improving branching ability of plants provided by the present invention of fig. 1 is only one specific example. After the CBF-L gene is successfully amplified, agrobacterium infection is carried out, and because the infection of leaves has certain difficulty, the following methods can be respectively adopted:

the technical solution of the present invention is further described with reference to the following specific examples.

The application of the CBF-L gene provided by the embodiment of the invention in enhancing the branching capacity of fruit trees, particularly the method for enhancing the branching capacity of fruit trees comprises the following steps:

first, monoclonal amplification of the CBF-L gene:

(1) PCR amplification of the CBF-L Gene:

using the upstream primer F and the downstream primer R as a primer pair, performing monoclonal amplification on the CB F-L gene by using a 40 microliter system in the following table 1 to obtain a CBF-L nucleotide double strand; wherein, the CDS sequence of the CBF-L gene is shown in a sequence table SEQIDNO:1, and specifically comprises the following steps: ATGTCAAAGTCAAATCATTCTAT ATATTTTCTCTACATTGTCACACTCTGTTTTTGTGTGTGGGAACACCGGAAGTTGCCTMTGTGGGCAACATTTCTCCACGTGGCGTCCTCCTCACTCTCCGTGTGCAACTCGCATGGACCCGGGGCCCACTCAAGACCCTCCCAATCCAAAGCTATAAAAGCCACCTCACTCTCTCCCCAGTTGTCAGCCTGCAACCCCAAAACTTGTGCTAAAACACACTCTCAACTCACAGCTTTCTCCGACGCAGCAGAACAAATGAACACRATCTCCAGACAACTCTCCGATTCCGCCGAAAGGCCCGAATCGAGTTCCGAAAGCGTCACGAMTCGAAGCCAGCCGACTTCGTTCTCCGATGAGGAGGTCATTTTGGCGTCCAGCACGCCGAAGAAGCGAGCGGGGAGGAGAGTTTTCAACGAGACAAGGCACCCCGTTTACAGAGGAGTGAGGAGGAGGAACAACGACAAGTGGGTGTGCGAAATGAGAGAACCAAACAAGAAGAAGTCGAGGATATGGCTCGGAACTTATCCAACGGCAGAGATGGCAGCTCGGGCGCATGACGTGGCGGCATTGGCCTTTAGAGGGAGGCTTGCCTGCCTCAATTTTGCAGACTCCGCATGGCGCCTGCCTGTCCCRGCTTCCACTGATTCAGTGGATATCAGGCGGGCGGCCGCGGAGGCTGCAGAGACATTCAGGCCAGCCGAGTTTGGCGGAGTGTCGGAAAGTGGGGATGATGAGAAGGAGAGCAAGAAAATGGAGGGGGAGAAGGATTGTGGATGTGCGGAGCAAAGCGATTGTGGAGGTGCGGAGCAAAGCGATTGTGGAGGTGCGGAGCAAAGTGGCAGCTCGTTTTACTTGGATGAGGAGGAAATGTTCGCCATGCCAAGGTTGCTTGATAGTATGGCGGAAGGSCTTCTGCTCTCTCCACCTCGCCGTTCAGCTGGTAGCAACATGAACTGGGATGATATGGGAAGCAATGATGATGACGTCAATCTGTGGAGCTTCTCAAAGTAA, respectively; the nucleotide sequence of the upstream primer F is shown in a sequence table SEQIDNO:2, and the specific sequence is as follows: ATGTCAAAGTCAAATCATTCTATATATTTTC, respectively; the nucleotide sequence of the downstream primer R is shown in a sequence table SEQIDNO:3, and the specific sequence is as follows: TTACTTTGAGAAGCTCCACAGATT are provided.

TABLE 1

(2) The CBF-L nucleotide duplexes obtained by the above PCR amplification were ligated to a PMD-19-T (simple) vector using a 10. mu.l system as shown in Table 2 below, and ligated overnight at 16 ℃ to obtain ligation products.

TABLE 2

Components	Addition amount (microlitre)
		PMD-19-T (simple) carrier	0.5
Solution1	5
		Recovery of the product (CBF-L nucleotide duplex)	4.5
Total	10

(3) Ligation products transformed competent cells:

taking out Escherichia coli DH5 alpha competent cells from an ultra-low temperature refrigerator at minus 80 ℃, placing the Escherichia coli DH5 alpha competent cells on ice for melting, sucking 20 microliters of DH5 alpha competent cells into a 1.5mL sterile centrifuge tube, adding 10 microliters of connecting products, uniformly blowing, carrying out ice bath for 30min, carrying out water bath heat shock for 90s at 42 ℃, carrying out ice bath for 2min again, adding 200 microliters of LB liquid culture medium into a sterile environment, placing the sterile environment into a shaking table at 37 ℃ and the rotating speed of 180rpm, shaking the bacteria for 1h, opening a clean bench for 30min, carrying out sterilization, starting to burn an applicator after 15min, generally burning for 2-3 min, and placing the applicator on the clean bench for waiting to reach room temperature. And after bacteria shaking is finished, coating 100 microliters of bacteria liquid on an LB plate (containing antibiotics), starting coating the plate until the plate is dried, covering a cover, sealing, marking, and culturing in a constant-temperature incubator at 37 ℃ for 10-12h until bacterial plaque grows out.

(4) Spot picking: in a sterile super clean bench, sucking 100 microliters of LB liquid culture medium (containing antibiotics) by using a sterile gun head, pumping the LB liquid culture medium into a 0.5mL sterile centrifuge tube, picking 10 bacterial plaques (with regular shapes) by using a10 microliter sterile gun head, placing the bacterial plaques into the LB liquid culture medium, blowing and beating the bacterial plaques for several times, covering the bacterial plaques with a cover, marking the bacterial plaques on the centrifuge tube, placing the bacterial plaques into a shaking table at 37 ℃, 180rpm and 4-6 hours to obtain bacterial liquid.

(5) Identifying bacterial liquid: after the bacteria shaking is finished, PCR identification is carried out by using a10 microliter system shown in the following table 3, the bacteria liquid is used as a template, the selected upstream primer is used as a sequence of a carrier, the selected downstream primer is used as a downstream primer of a gene, identification is carried out according to a normal bacteria batch verification process, and water is used as a negative control. And (3) running a small-hole adhesive, checking the positive rate of the bacterial liquid, and selecting the bright bacterial liquid in positive identification.

TABLE 3

Components	Addition amount (microlitre)
		Target vector upstream primer F	0.5
Target gene downstream primer R	0.5
		Bacterial liquid	1
Mix(1x)	8
		Total	10

Secondly, constructing a plant overexpression vector CBF-L-pBI 121:

(1) extracting plasmids from the positive bacterial liquid (the plasmid extraction method is carried out according to the steps of a kit) to obtain a fusion plasmid of PMD-19-T (simple) connected with CBF-L.

(2) Carrying out double enzyme digestion on the PMD-19-T (simple) fusion plasmid connected with the CBF-L and the PBI121 empty vector according to a 40 microliter system shown in the table 4, and reacting at 37 ℃ for more than 2-6 h, wherein the enzyme digestion is generally carried out for 3 h.

TABLE 4

Components	Addition amount (microlitre)
		10×buffer	4
According to the co-addition of two restriction enzyme activities	4
		Plasmid (PMD-19-T (simple) vector of CBF-L or PBI121 empty vector)	20
Water (W)	12
		Total	40

(3) And (3) recovering and connecting the target gene and the target vector: after the time of the enzyme digestion reaction is over, the band of the cut target gene is subjected to gel recovery (according to a kit), the enzyme digestion band of the target vector is also cut and subjected to gel recovery (according to the kit), and then the target gene and the target vector are connected by using a 10-microliter system shown in Table 5.

TABLE 5

Components	Addition amount (microlitre)
		T4 ligase	1
10xT4buffer	1
		Target gene and target vector	8
Total	10

(4) The ligation product was transformed into E.coli DH 5. alpha. competent cells using the system shown in Table 6;

TABLE 6

Components	Addition amount (microlitre)
		Competent cell (Escherichia coli DH5 alpha)	20
Ligation product	10
		Total	30

Then, E.coli DH 5. alpha. competent cells were removed from a freezer at-80 ℃ and immediately thawed on ice, 20. mu.l of E.coli DH 5. alpha. competent cells were pipetted into a 1.5mL sterile centrifuge tube, sucking 10 microliter of the constructed connecting product, uniformly blowing, uniformly mixing, carrying out ice bath for 30min, carrying out heat shock for 90s at 42 ℃, carrying out ice bath for 2min, adding 200 microliters of LB liquid culture medium in a sterile environment, placing in a shaking table at 37 ℃ and the rotating speed of 180rpm, shaking bacteria for 1h, opening a superclean workbench after 30min for sterilization, after 15min, the coater is started to be heated for 2-3 min, the coating is placed on a clean bench to wait for the temperature to be changed to the room temperature, after the bacteria shaking is finished, 100 microliters of bacteria liquid is coated on an LB plate (with antibiotics), the plate coating is started until the plate is dried, a cover is covered, the mark is made, and the plate is placed in a constant-temperature incubator at 37 ℃ for culturing for 10-12 hours.

(5) Spot picking: in a sterile super clean bench, 100 microliters of LB liquid culture medium (containing antibiotics) is sucked by a sterile gun head and is put into a 0.5mL sterile centrifuge tube, 10 plaques (regular in shape) are picked by a10 microliter sterile gun head and are placed in the LB liquid culture medium, the plaques are blown and beaten for several times, a cover is covered, a mark is made on the centrifuge tube, and the centrifuge tube is put into a shaking table at 37 ℃ and 180rpm for 4-6 h.

(6) Identifying bacterial liquid: after the bacteria shaking is finished, performing PCR identification by using a10 microliter system shown in the table 3, and identifying by using a bacteria liquid as a template, a primer as an upstream primer of a carrier and a downstream primer of a gene according to a normal bacteria batch verification process and using water as a negative control. And (3) running a small-hole adhesive, checking the positive rate of the bacterial liquid, and selecting the bright bacterial liquid in positive identification.

(7) Extracting plasmids from the positive bacterial liquid (the plasmid extraction method is carried out according to the steps of a kit), and obtaining the plant overexpression vector CBF-L-pBI 121.

Thirdly, transferring the plant overexpression vector CBF-L-pBI121 into GALA-3 plants (Gala apple plants) by utilizing an agrobacterium-mediated method:

(1) transforming the plant overexpression vector CBF-L-pBI121 into Agrobacterium EHA 105: taking out agrobacterium tumefaciens EHA105 competent cells from a ultralow-temperature refrigerator at minus 80 ℃, sucking 20 microliter of agrobacterium tumefaciens EHA105 competent cells into a 1.5mL sterile centrifuge tube, sucking 1215 microliter of an overexpression vector CBF-L-pBI, adding 50 microliter of agrobacterium tumefaciens EHA105 competent cells, blowing, uniformly mixing, ice-bathing for 30min, 37 ℃ heat shock for 90s, ice-bathing for 2min, adding the mixture into 200 microliter LB liquid culture medium in an ultraclean workbench, shaking for 4h in a shaking table at 28 ℃ and the rotating speed of 180rpm, taking 100 microliter of bacterial liquid LB coating plate (containing antibiotics) after the bacteria shaking is finished, starting coating the plate until the plate is dried, covering a cover, sealing, marking, and culturing in a constant-temperature incubator at 28 ℃ for 10-12 h.

(2) Agrobacterium mediated transformation of the expression vector into GALA-3 plants: culturing the obtained Agrobacterium EHA105 in a YEP culture medium culture dish in a shaking table at 180rpm and 28 ℃ for 50mL by shaking for 4-6 hours until the OD value is 0.4-0.6, centrifuging at 25 ℃ and 5000rpm for 5min by using a centrifuge to collect thalli, suspending the thalli by using a glucose liquid culture medium (MS powder, sucrose and glucose), and adding 20mg of acetosyringone for later use. Then, cutting off leaves of GALA-3 plants from test-tube seedlings subjected to subculture for about 30 days for genetic transformation, selecting young leaves with 3-4 leaves spread at the tops of the test-tube seedlings, cutting off the leaf tips and the leaf stalks, cutting the middle parts into leaf blocks with the width of 3mm, immediately placing the leaf blocks in a liquid co-culture medium with agrobacterium, slightly shaking the leaf blocks, shaking the leaf blocks for several times at intervals of about 2min, wherein the infection time is about 8min, then transferring the leaf blocks onto sterile filter paper, sucking dry bacterial liquid, and quickly transferring the leaf blocks without the bacterial liquid on the surfaces to culture dishes filled with the co-culture medium. And after the transgenic buds grow on the leaves, amplifying the buds by using an amplification culture medium. After the buds grow into seedlings, putting the seedlings into a rooting culture medium for rooting to obtain transgenic plants.

The technical effects of the present invention will be described in detail with reference to experiments.

1. The transgenic plants with two months of large roots obtained in the above example and the control untreated GA LA-3 are in the same external environment and subjected to phenotypic observation after a period of time, and the physiological data determination is carried out, specifically comprising the following steps:

(1) selecting transgenic GALA-3 seedlings with consistent growth vigor and rooting for two months and a control group.

(2) The control group was acclimatized to the transgenic plants and placed under the same external conditions.

2. And (4) analyzing results:

after fibrous roots grow in a rooting culture medium, the CBF-L overexpression plant is domesticated and grown for two months, the overexpression CBF-L transgenic GALA-3 plant shows obvious branching and is accompanied with obvious dwarfing, while the GALA-3 plant of a control group is strong in growth vigor and has no obvious branching condition, but the whole tree height is obviously higher than that of the transgenic plant. This means that CBF-L significantly enhances the branching ability of plants.

As described above, the CBF-L transgenic GALA-3 plants have a multi-branched phenotype.

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> Qingdao agricultural university

<120> method and sequence for improving branching capability of plants and method for breeding fruit seedlings

<141> 2021-10-21

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1035

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtcaaagt caaatcattc tatatatttt ctctacattg tcacactctg tttttgtgtg 60

tgggaacacc ggaagttgcc tmtgtgggca acatttctcc acgtggcgtc ctcctcactc 120

tccgtgtgca actcgcatgg acccggggcc cactcaagac cctcccaatc caaagctata 180

aaagccacct cactctctcc ccagttgtca gcctgcaacc ccaaaacttg tgctaaaaca 240

cactctcaac tcacagcttt ctccgacgca gcagaacaaa tgaacacrat ctccagacaa 300

ctctccgatt ccgccgaaag gcccgaatcg agttccgaaa gcgtcacgam tcgaagccag 360

ccgacttcgt tctccgatga ggaggtcatt ttggcgtcca gcacgccgaa gaagcgagcg 420

gggaggagag ttttcaacga gacaaggcac cccgtttaca gaggagtgag gaggaggaac 480

aacgacaagt gggtgtgcga aatgagagaa ccaaacaaga agaagtcgag gatatggctc 540

ggaacttatc caacggcaga gatggcagct cgggcgcatg acgtggcggc attggccttt 600

agagggaggc ttgcctgcct caattttgca gactccgcat ggcgcctgcc tgtcccrgct 660

tccactgatt cagtggatat caggcgggcg gccgcggagg ctgcagagac attcaggcca 720

gccgagtttg gcggagtgtc ggaaagtggg gatgatgaga aggagagcaa gaaaatggag 780

ggggagaagg attgtggatg tgcggagcaa agcgattgtg gaggtgcgga gcaaagcgat 840

tgtggaggtg cggagcaaag tggcagctcg ttttacttgg atgaggagga aatgttcgcc 900

atgccaaggt tgcttgatag tatggcggaa ggscttctgc tctctccacc tcgccgttca 960

gctggtagca acatgaactg ggatgatatg ggaagcaatg atgatgacgt caatctgtgg 1020

agcttctcaa agtaa 1035

<210> 2

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgtcaaagt caaatcattc tatatatttt c 31

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aatctgtgga gcttctcaaa gtaa 24

Claims

1. A method for improving branching ability of a plant, which comprises using CBF-L gene.

2. The method for improving branching ability of a plant according to claim 1, wherein the method for improving branching ability of a plant comprises:

thirdly, the plant overexpression vector is transferred into a GALA-3 plant.

3. The method for improving branching ability of a plant according to claim 2, wherein the monoclonal amplification of the CBF-L gene of the first step comprises in particular:

(1) PCR amplification of the CBF-L Gene: using the upstream primer F and the downstream primer R as a primer pair, performing monoclonal amplification on the CBF-L gene by using a 40 microliter system in the following table 1 to obtain a CBF-L nucleotide double strand; wherein, CDS sequence of CBF-L gene is SEQ ID NO 1; the nucleotide sequence SE Q ID NO of the upstream primer F is 2; the nucleotide sequence of the downstream primer R is SEQ ID NO. 3;

(3) ligation products transformed competent cells:

4. The method for improving branching ability of a plant according to claim 2, wherein the second step of constructing the plant overexpression vector CBF-L-pBI 121:

5. The method for improving branching ability of a plant according to claim 2, wherein the third step of transforming the plant overexpression vector CBF-L-pBI121 into GALA-3 plant using agrobacterium-mediated transformation specifically comprises:

6. The method of increasing branching capacity of a plant of claim 2, wherein the plant is a dicot.

7. The method of increasing branching capacity of a plant of claim 2, wherein the plant is apple.

8. The method of claim 2, wherein the plant is a gala apple.

9. The CDS sequence of the CBF-L gene for use in the method of increasing branching ability of a plant according to claim 1, wherein the CDS sequence is SEQ ID NO 1.

10. A method for breeding fruit seedlings, which is characterized in that the method for improving the branching capability of plants as claimed in any one of claims 1 to 8 is used.