CN113322263B - Application of PcAGP7-1 gene in regulation and control of pear dwarfing and application method - Google Patents
Application of PcAGP7-1 gene in regulation and control of pear dwarfing and application method Download PDFInfo
- Publication number
- CN113322263B CN113322263B CN202110759812.4A CN202110759812A CN113322263B CN 113322263 B CN113322263 B CN 113322263B CN 202110759812 A CN202110759812 A CN 202110759812A CN 113322263 B CN113322263 B CN 113322263B
- Authority
- CN
- China
- Prior art keywords
- pear
- dwarfing
- pcagp7
- gene
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention is suitable for the technical field of genetic engineering, and provides a gene engineering genePcAGP7‑1The invention relates to an application of gene in regulating and controlling dwarfing of pear and an application method thereofPcAGP7‑1The pear plants are overexpressed, the growth and development process of the pear plants is regulated and controlled, the dwarfing of the pear plants is promoted, and the problem of shortage of dwarfing resources of pears is solved, so that the application of the pear plants in dwarfing close planting production is promoted. The method can promote dwarfing of pear plants, greatly shortens the breeding period compared with the traditional crossbreeding method, can quickly obtain dwarfing plants, and is simple and easy to implement, simple to operate and good in stability.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to application of a PcAGP7-1 gene in regulation and control of dwarfing of pears and an application method thereof.
Background
Dwarfing of fruit trees is an extremely important agronomic trait and has the advantages of early fruit, high yield, easy management and the like. In recent years, dwarfing cultivation has become the development direction of fruit tree cultivation in the world, so that the cultivation and utilization of dwarf fruit tree varieties have important application value. At present, apple dwarf stocks and dwarf varieties are widely applied in production, but the application of dwarf close planting mode in production is severely restricted by pear because of the shortage of dwarf varieties.
The methods for realizing dwarfing of fruit trees in production mainly comprise two methods: grafting dwarfing stock and planting dwarfing variety. The pear is one of the fruits with larger world cultivation area, and the dwarfing stock has earlier breeding. However, because the pears lack dwarfing resources, the breeding of the early pear dwarfing rootstock is always based on the quince. In the 17 th century, 3 quince varieties 'QA', 'QG' and 'QB' which can be used for dwarf production of pears are bred in Dongmelin of the UK, and the 3 quince varieties are popularized in production, but due to poor grafting affinity and high mortality, breeders in various countries in Europe begin to carry out a series of optimization on quince stocks and finally breed a series of excellent quince stock varieties, such as: 'QR 193-16' and 'CQ 132' in the UK, 'S-1' in Poland, 'Sydo' in France, 'Adams 332' in Belgium, 'Ct.S.212' and 'Ct.S.214' in Italy, 'BW 20' and 'BW 11' in Switzerland. Because quince and pear are not compatible in grafting, breeding workers also breed the congeneric dwarfing stock of pear at all times, and several better dwarfing stock strains of pear are bred in succession in the 60 th generation of 20 th century, such as: 'BA-29' bred in France, 'OH multiplied by F' series rootstocks bred in America, and 'K' series dwarf rootstocks and 'S' series dwarf rootstocks bred in China still have various defects and are less in application in production.
However, limited by the shortage of pear germplasm resources and the late research on pear dwarfing, there are very few varieties available for dwarfing close-planting cultivation. At present, the better dwarf cultivars are 'dwarf bergamot pears' bred from the head pears at the institute of fruit trees of Chinese academy of agricultural sciences, and 'fragrant red honey' and 'medium dwarf red pears' semi-dwarf lines bred by hybridizing 'dwarf bergamot' with 'Hexincun'.
Therefore, the conventional pear plant dwarfing method has the problems that the conventional breeding time is long and the effect is difficult to obtain in a short time.
Disclosure of Invention
The embodiment of the invention aims to provide a method for dwarfing pear plants, and aims to solve the problems that the conventional pear plant dwarfing method has long breeding time and is difficult to obtain effect in a short time.
The embodiment of the invention is realized by applying the PcAGP7-1 gene to regulation and control of dwarfing of pears.
The embodiment of the invention also aims at an application method of the PcAGP7-1 gene in regulation and control of dwarfing of pears, which comprises the following steps:
carrying out monoclonal amplification on the PcAGP7-1 gene according to an upstream primer and a downstream primer of the PcAGP7-1 gene to obtain an amplification product;
constructing a plant overexpression vector according to the amplification product;
and transferring the plant overexpression vector into a pear plant to be regulated.
The PcAGP7-1 gene provided by the embodiment of the invention is applied to regulation and control of dwarfing of pears, and the PcAGP7-1 is overexpressed in pear plants in the form of transgenic plants, so that the growth and development process of the pear plants is regulated, the dwarfing of the pear plants is promoted, and the problem of shortage of dwarfing resources of pears is solved, thereby promoting the application of the pear plants in dwarfing and close planting production. The method can promote dwarfing of pear plants, greatly shortens the breeding period compared with the traditional crossbreeding method, can quickly obtain dwarfing plants, and is simple and easy to implement, simple to operate and good in stability.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The embodiment of the invention aims to solve the problems that the conventional pear plant dwarfing method has long conventional breeding time and is difficult to obtain effect in a short time, and a key candidate gene PcAGP7-1 identified from the filial generation of the 'dwarfed pear' and the 'pear' by a molecular marker technology. It belongs to Arabinogalactan Glycoproteins (AGPs), is a glycoprotein widely existing in various tissues and cells of higher plants, participates in multiple links of plant growth and development and plays a key role, such as: the application of the PcAGP7-1 gene in regulating and controlling pear dwarfing is provided in the aspects of cell growth, cell division, programmed cell death, morphogenesis, pollen tube oriented growth, pollen self-incompatibility signal conduction and identification and the like.
In the embodiment of the invention, the CDS sequence of the PcAGP7-1 gene is shown as SEQ ID NO. 1.
SEQ ID NO:1
ATGGCTGCTGCAAAGATAAACCCACTTATCCTGTCAGCTCTCTTTTTGTTCTCAATAATTCTCAGCTTTCCTGCAACAACAATATCAGATAATCCCTGTGCATACCCATGTTATCCTCCACCTACAGGCACCGGGAGCACTTCTACTCCAACAACAACAACTCCGACAACCACAACTCCATCTCCTCCGTCGTCCCAAACCGGGTCATACCCGCCTCCGGCCGTCGTCAACAACCCAAATGGAAATTACCCGTACAACCCTCCTCCGTCTACTGATAACGGTGGTTATGGATATGGTGCTAATCCTCCTCCTGACCCCATCTTACCTTATTTTCCATTCTACTTCAAAAACGGTGCTCGTGGAAACAAAGACGCTTCGTCGGCAACCTCTGTAATCAGAAGATCGTCAACGCTCTTCAACACTATCGCCACCACCAATCTTTTCGTTGTATTCGTCTACTTTTTTAACTTTCTGCAAAATTAG。
In the embodiment of the invention, the pear is a autumn pear.
The embodiment of the invention also provides an application method of the PcAGP7-1 gene in regulation and control of dwarfing of pears, which comprises the following steps:
step S1: the PcAGP7-1 gene is subjected to monoclonal amplification according to an upstream primer and a downstream primer of the PcAGP7-1 gene to obtain an amplification product.
In the embodiment of the invention, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2; the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
SEQ ID NO:2TGGCTGCTGCAAAGATAAACC；
SEQ ID NO:3CTAATTTTGCAGAAAGTTAAAAAA。
Step S2: and constructing a plant overexpression vector according to the amplification product.
Step S3: and transferring the plant overexpression vector into a pear plant to be regulated.
In the embodiment of the invention, the method for transferring the plant overexpression vector into the pear plant to be regulated is an agrobacterium-mediated method.
Examples of certain embodiments of the invention are given below, which are not intended to limit the scope of the invention.
Example 1
The embodiment provides an experimental result of the overexpression of the PcgPAP 7-1 gene in a autumn pear plant, and particularly provides a method for promoting dwarfing of the pear plant, which comprises the following steps:
single clone amplification of S1 and PcAGP7-1 genes:
(1) PCR amplification of the PcgPAP 7-1 gene:
using the upstream primer F and the downstream primer R as primer pairs, carrying out monoclonal amplification on the PcAG P7-1 gene by using a 40 mu L system in the following table 1 to obtain a PcAGP7-1 nucleotide double strand; wherein, the CDS sequence of the PcAGP7-1 gene is shown in a sequence table SEQ ID NO:1, and specifically comprises the following components: ATGGCTGCTGCAAAGATAAACCCACTTATCCTGTCAGCTCTCTTTTTGTTCTCAATAATTCTCAGCTTTCCTGCAACAACAATATCAGATAATCCCTGTGCATACCCATGTTATCCTCCACCTACAGGCACCGGGAGCACTTCTACTCCAACAACAACAACTCCGACAACCACAACTCCATCTCCTCCGTCGTCCCAAACCGGGTCATACCCGCCTCCGGCCGTCGTCAACAACCCAAATGGAAATTACCCGTACAACCCTCCTCCGTCTACTGATAACGGTGGTTATGGATATGGTGCTAATCCTCCTCCTGACCCCATCTTACCTTATTTTCCATTCTACTTCAAAAACGGTGCTCGTGGAAACAAAGACGCTTCGTCGGCAACCTCTGTAATCAGAAGATCGTCAACGCTCTTCAACACTATCGCCACCACCAATCTTTTCGTTGTATTCGTCTACTTTTTTAACTTTCTGCAAAATTAG, respectively; the nucleotide sequence of the upstream primer F is shown as a sequence table SEQ ID NO. 2, and specifically comprises the following steps: TGGCTGCTGCAAAGATAAACC, respectively; the nucleotide sequence of the downstream primer R is shown in a sequence table SE Q ID NO. 3, and specifically comprises the following steps: CTAATTTTGCAGAAAGTTAAAAAA are provided.
TABLE 1
(2) The PcAGP7-1 nucleotide duplex obtained by the PCR amplification was ligated to the pMD-19-T (simple) vector using a 10. mu.L system as shown in Table 2 below, and ligated overnight at 16 ℃ to obtain a ligation product.
TABLE 2
| Components | Addition amount (μ L) |
| pMD-19-T(Simple) | 0.5 |
| Solution 1 | 5 |
| Recovering product (PcAGP7-1) | 4.5 |
| Total | 10 |
(3) Ligation products transformed competent cells:
taking out DH5 alpha competent cells from a refrigerator at minus 80 ℃, immediately putting the cells on prepared ice to melt, sucking 20 mu L of DH5 alpha competent cells into a sterilized centrifugal tube with the volume of 1.5mL, sucking 10 mu L of constructed ligation product, adding the ligation product into 20 mu L of DH5 alpha competent cells, gently mixing the cells uniformly, carrying out ice bath for 30min, carrying out heat shock for 90s at 42 ℃, carrying out ice bath for 2min again, adding the cells into 200 mu L of LB liquid culture medium in an ultraclean workbench, carrying out 37 ℃, 180rpm and 1 h. After bacteria shaking is finished, 100 mu L of bacteria liquid is taken and coated on an LB plate (with antibiotics) until the plate is dried, a cover is covered and the plate is sealed, a mark is made, and the plate is placed in a constant temperature incubator at 37 ℃ for culturing for 10-12h to obtain bacterial plaques.
(4) Spot picking: in a sterile super clean bench, 100 mu L of liquid LB culture medium (with antibiotics) is sucked by a sterile gun head and is put into a 0.5mL sterile centrifuge tube, 10 bacterial plaques (with regular shapes) are picked by a10 mu L sterile gun head and are placed in the LB liquid culture medium, the bacterial plaques are marked on the centrifuge tube and are put into a shaking table at 37 ℃ and 180rpm for 4-6 h.
(5) Identifying bacterial liquid: and (3) after bacteria shaking is finished, identifying bacteria liquid by using a system shown in the table 3, identifying the bacteria liquid as a template, an upstream primer as an upstream primer of a carrier and a downstream primer as a downstream primer of a gene according to a normal PCR process, and comparing the bacteria liquid with water as a negative control. And (5) detecting the positive rate of the bacterial liquid, and selecting the bacterial liquid which is brighter in positive identification.
TABLE 3
| Components | Addition amount (μ L) |
| Target vector upstream primer F | 0.5 |
| Target gene downstream primer R | 0.5 |
| Bacterial liquid | 1 |
| Mix(1×) | 8 |
| Total | 10 |
S2, constructing a plant overexpression vector PcAGP7-1-pBI 121:
(1) plasmids of the positive bacterial liquid were extracted (the plasmid extraction method was performed according to the kit procedures), and a pMD-19-T (simple) vector linked with PcgPAP 7-1 was obtained.
(2) The pMD-19-T (simple) vector linked with PcAGP7-1 and the pBI121 empty vector were subjected to double digestion in a 40. mu.L system as shown in Table 4, and reacted at 37 ℃ for 2-6 hours.
TABLE 4
| Components | Addition amount (μ L) |
| 10×buffer | 4 |
| According to the co-addition of two restriction enzyme activities | 4 |
| Plasmid (PcAGP7-1 pMD-19-T (simple) vector or pBI121 empty vector) | 20 |
| H2O | 12 |
| Total | 40 |
(3) And (3) recovering and connecting the target gene and the target vector: the band of the excised target gene was recovered by gel (kit), and the band of the enzyme-cleaved target vector was also excised and recovered by gel (kit), followed by ligation using the system shown in Table 5.
TABLE 5
| Components | Addition amount (μ L) |
| T4 ligase | 1 |
| 10×T4 Buffer | 1 |
| Target gene and target vector | 8 |
| Total | 10 |
(4) The ligation products were transformed into DH 5. alpha. competent cells using the system shown in Table 6;
TABLE 6
| Components | Addition amount (μ L) |
| Competent cell (Escherichia coli DH5 alpha) | 20 |
| Ligation product | 10 |
| Total | 30 |
Then, DH5 alpha competent cells were taken out of the-80 ℃ refrigerator, placed on ice prepared in advance to melt, 20. mu.L of DH5 alpha competent cells were aspirated into a sterilized 1.5mL centrifuge tube, 10. mu.L of the constructed ligation product was aspirated, 20. mu.L of DH5 alpha competent cells were added, mixed gently, ice-cooled for 30min, heat shock for 90s at 42 ℃ and ice-cooled again for 2min, and then added into 200. mu.L of LB liquid medium in a super clean bench at 37 ℃, 180rpm, 1 h. After the bacteria shaking is finished, 100 mu L of bacteria liquid is taken and coated on an LB plate (with antibiotics) until the plate is dried, a cover is covered and the plate is sealed, and the plate is marked and put into a constant temperature incubator at 37 ℃ for culture for 10 to 12 hours.
(5) Spot picking: in a sterile super clean bench, 100 mul of liquid LB culture medium (with antibiotics) is sucked by a sterile gun head, the liquid LB culture medium is thrown into a 0.5mL sterile centrifuge tube, 10 plaques (with a more regular shape) are picked by a 10-liter sterile gun head, the plaques are placed in the LB liquid culture medium, the plaques are marked on the centrifuge tube, and the plaques are placed in a shaking table at 37 ℃ and 180rpm for 4-6 h.
(6) Identifying bacterial liquid: after the bacteria shaking is finished, PCR identification is carried out by using a system shown in the table 3, a bacteria liquid is used as a template, an upstream primer is used as an upstream primer of a carrier, a downstream primer is used as a downstream primer of a gene, identification is carried out according to a normal PC R process, and water is used as a negative control. And (5) detecting the positive rate of the bacterial liquid, and selecting the bacterial liquid which is brighter in positive identification.
(7) And extracting the plasmid of the positive bacterial liquid (the plasmid extraction method is carried out according to the kit steps), thus obtaining the plant over-expression vector PcAGP7-1-pBI 121.
S3, transferring the plant overexpression vector PcAGP7-1-pBI121 into a autumn pear plant by using an agrobacterium-mediated method:
(1) the plant overexpression vector PcAGP7-1-pBI121 was transformed into Agrobacterium EHA 105: taking out EHA105 competent cells from a refrigerator at minus 80 ℃, sucking 50 mu L of EHA105 competent cells into a sterilized 1.5mL centrifuge tube, sucking 5 mu L of overexpression vector PcAGP7-1-pBI121, adding 50 mu L of EHA105 competent cells, gently mixing, ice-cooling for 30min, heat shock for 90s at 37 ℃, ice-cooling for 2min, adding the mixture into 200 mu L of LB liquid culture medium in an ultraclean workbench, cooling at 37 ℃, rotating at 180rpm for 4h, taking 100 mu L of bacterial liquid to coat an LB plate (with antibiotics) after bacteria shaking is finished, coating the plate until the plate is dried, covering a cover, sealing, marking, and placing the plate in a constant temperature incubator at 28 ℃ for culturing for 48-72 h.
(2) The agrobacterium-mediated method is used for transferring the expression vector into an autumn pear plant: selecting a tissue culture seedling of the autumn pears which are subcultured for about 21 days for genetic transformation, selecting 3-4 young leaves which are unfolded at the top of the tissue culture seedling, cutting off the leaf tips and the leaf stalks, marking 3 scars in the middle part, immediately placing the young leaves in a pre-culture medium for pre-culture, and carrying out no light, 24 ℃ and 3 days. Culturing the obtained Agrobacterium EHA105 with YEP liquid culture medium, shaking at 220rpm and 28 deg.C for 4-6 hr to OD600The value is 0.4-0.6, a centrifugal machine is used for centrifuging at 25 ℃ and 6000rpm for 5min to collect thalli, heavy suspension is carried out by using heavy suspension, acetosyringone is added until the final concentration is 20mg/L, pre-cultured leaves are placed into bacterial liquid for infection for 8-15min, then leaf blocks are transferred to sterile filter paper for sucking the bacterial liquid, and the leaf blocks without the bacterial liquid on the surface are quickly transferred to a culture dish filled with a co-culture medium. And after the transgenic buds grow on the leaves, amplifying the buds by using an amplification culture medium. After the buds grow into seedlings, putting the seedlings into a rooting culture medium for rooting to obtain transgenic plants.
Example 2
The transgenic plant with two months of large roots and the control plant obtained in the example 1 are transferred into a substrate for phenotype observation and physiological data determination, and the method specifically comprises the following steps:
(1) 6 transgenic autumn pear plants with two-month-old roots and consistent growth vigor and 6 non-transgenic autumn pear plants of a control group are selected.
(2) Placing sterilized vermiculite into square seedling pots (8 × 8cm in length and width and 10cm in depth), placing two groups of flowerpots containing plants into 30 × 20cm trays, transferring the seedling of the autumn pear plant into the flowerpots, pouring nutrient solution into the trays, and culturing for 40 days.
(3) The plant height, internode spacing, root length, anatomical structure, chlorophyll content and leaf photosynthetic rate of each group of plants before and after 40 days of treatment were measured and statistically analyzed, and the test was repeated three times or more.
And (4) analyzing results:
after 40 days of greenhouse growth, the transgenic autumn pear plants over-expressing PcAGP7-1 show obvious dwarfing phenotype, the plant height becomes short obviously, the plant pitch becomes short, and the root system development is retarded. This means that PcAG P7-1 has obvious promotion effect in regulating plant dwarfing.
Through observing the anatomical structures of a transgenic autumn pear plant and a control plant which grow for 40 days in a greenhouse, the transverse cutting structure of the stem of the transgenic autumn pear plant over-expressing PcAGP7-1 and the transverse cutting structure of the stem of the control group plant show obvious difference, and the diameter of the stem parenchyma cell of the transgenic autumn pear plant over-expressing PcAGP7-1 is obviously increased; the longitudinal cutting structure of the transgenic autumn pear plant stem over-expressing the PcAGP7-1 also shows obvious difference with the longitudinal cutting structure of the plant stem of a control group, the cell length of the transgenic autumn pear plant stem over-expressing the PcAGP7-1 is obviously shortened, the whole form of the cell becomes short and thick, and the PcAGP7-1 can regulate and control the cell morphogenesis.
The chlorophyll content and the photosynthetic rate are important physiological indexes for plant growth, and in the embodiment of the invention, the results show that the photosynthetic rate and the chlorophyll content of the transgenic autumn pear plants over-expressing PcAGP7-1 and the control plants have no significant change, which indicates that the PcAGP7-1 promotes the dwarfing of the plants not by regulating the photosynthetic indexes.
The development of roots is another important physiological index influencing the plant development, in the embodiment of the invention, the result shows that the root development of the transgenic autumn pear plant over-expressing PcAGP7-1 is obviously slower than that of the control plant, which indicates that PcAGP7-1 can influence the growth of the plant by regulating the development of the root system of the plant to promote the dwarfing of the plant.
In conclusion, the PcgPAP 7-1 transgenic autumn pear plants obviously promote the dwarfing of the pear plants.
In summary, the PcAGP7-1 gene provided by the embodiment of the invention is applied to regulating and controlling dwarfing of pears, and the PcAGP7-1 is over-expressed in pear plants in the form of transgenic plants to regulate and control the growth and development process of the pear plants, so that the dwarfing of the pear plants is promoted, the problem of shortage of dwarfing resources of pears is solved, and the application of the pear plants in dwarfing and close planting production is promoted. The method can promote dwarfing of pear plants, greatly shortens the breeding period compared with the traditional crossbreeding method, can quickly obtain dwarfing plants, and is simple and easy to implement, simple to operate and good in stability.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> Qingdao agricultural university
<120> application of PcAGP7-1 gene in regulation and control of pear dwarfing and application method
<160> 3
<170> SIPOSequenceListing 1.0
<210> 2
<211> 483
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atggctgctg caaagataaa cccacttatc ctgtcagctc tctttttgtt ctcaataatt 60
ctcagctttc ctgcaacaac aatatcagat aatccctgtg catacccatg ttatcctcca 120
cctacaggca ccgggagcac ttctactcca acaacaacaa ctccgacaac cacaactcca 180
tctcctccgt cgtcccaaac cgggtcatac ccgcctccgg ccgtcgtcaa caacccaaat 240
ggaaattacc cgtacaaccc tcctccgtct actgataacg gtggttatgg atatggtgct 300
aatcctcctc ctgaccccat cttaccttat tttccattct acttcaaaaa cggtgctcgt 360
ggaaacaaag acgcttcgtc ggcaacctct gtaatcagaa gatcgtcaac gctcttcaac 420
actatcgcca ccaccaatct tttcgttgta ttcgtctact tttttaactt tctgcaaaat 480
tag 483
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tggctgctgc aaagataaac c 21
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctaattttgc agaaagttaa aaaa 24
Claims (4)
1. A kind ofPcAGP7-1The application of the gene in regulating and controlling dwarfing of pears is characterized in thatPcAGP7-1The CDS sequence of the gene is shown as SEQ ID NO. 1; the pear is a autumn pear.
2. A kind ofPcAGP7-1The application method of the gene in regulating and controlling dwarfing of pears is characterized by comprising the following steps:
according toPcAGP7-1Upstream primer and downstream primer of gene, pairPcAGP7-1Performing monoclonal amplification on the gene to obtain an amplification product; the CDS sequence of the PcAGP7-1 gene is shown as SEQ ID NO 1;
constructing a plant overexpression vector according to the amplification product;
transferring the plant overexpression vector into a pear plant to be regulated; the pear is a autumn pear.
3. The method of claim 2PcAGP7-1An application method of a gene in regulating and controlling dwarfing of pears is characterized in that the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2; the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
4. The method of claim 2PcAGP7-1The application method of the gene in regulating and controlling dwarfing of the pear is characterized in that the step of transferring the plant overexpression vector into the pear plant to be regulated and controlled comprises the following steps:
and transferring the plant overexpression vector into a pear plant to be regulated and controlled by an agrobacterium-mediated method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110759812.4A CN113322263B (en) | 2021-07-06 | 2021-07-06 | Application of PcAGP7-1 gene in regulation and control of pear dwarfing and application method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110759812.4A CN113322263B (en) | 2021-07-06 | 2021-07-06 | Application of PcAGP7-1 gene in regulation and control of pear dwarfing and application method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113322263A CN113322263A (en) | 2021-08-31 |
| CN113322263B true CN113322263B (en) | 2022-03-25 |
Family
ID=77425714
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110759812.4A Active CN113322263B (en) | 2021-07-06 | 2021-07-06 | Application of PcAGP7-1 gene in regulation and control of pear dwarfing and application method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113322263B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116724879A (en) * | 2023-06-06 | 2023-09-12 | 中国农业科学院果树研究所 | Dwarf pear variety breeding technology |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5107064A (en) * | 1987-10-22 | 1992-04-21 | Wisconsin Alumni Research Foundation | Fast-cycling dwarf Bassica oleracea |
| CN101165186A (en) * | 2007-09-27 | 2008-04-23 | 复旦大学 | Flavonoid-3,5'-hydroxylase gene cloned from moth orchid, its coded sequence and application |
| CN102796760A (en) * | 2012-08-10 | 2012-11-28 | 福建农林大学 | Application of zinc finger protein gene in adjusting paddy rice root growth |
-
2021
- 2021-07-06 CN CN202110759812.4A patent/CN113322263B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5107064A (en) * | 1987-10-22 | 1992-04-21 | Wisconsin Alumni Research Foundation | Fast-cycling dwarf Bassica oleracea |
| CN101165186A (en) * | 2007-09-27 | 2008-04-23 | 复旦大学 | Flavonoid-3,5'-hydroxylase gene cloned from moth orchid, its coded sequence and application |
| CN102796760A (en) * | 2012-08-10 | 2012-11-28 | 福建农林大学 | Application of zinc finger protein gene in adjusting paddy rice root growth |
Non-Patent Citations (1)
| Title |
|---|
| 植物启动子研究进展;李田等;《生物技术通报》;20151231;第31卷(第02期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113322263A (en) | 2021-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110637087B (en) | Method for epigenetic manipulation of plant phenotype plasticity traits | |
| CN101121940B (en) | Method for conversing switchgrass conducted by agrobacterium | |
| CN113584072B (en) | Construction method of strawberry genetic transformation system | |
| CN111893133A (en) | Agrobacterium-mediated cabbage heart genetic transformation method | |
| JP2000510325A (en) | Method for propagation and / or selection of plant material | |
| CN113322263B (en) | Application of PcAGP7-1 gene in regulation and control of pear dwarfing and application method | |
| CN115720851A (en) | Sugarcane somatic embryo and induction method thereof | |
| CN109735538A (en) | A kind of carrier and its preparation method and application improving forest Strawberry Leaves regeneration efficiency | |
| CN102499075A (en) | Method for preparation of soybean composite explants and method for preparation of rapidly transgenic soybean plants by using the same | |
| CN104450742B (en) | Maize kernel factor gene ZmNF YB3 and its homologous gene application | |
| CN113528534A (en) | Application of GhMYB44 gene in differentiation and development of cotton callus | |
| CN111528089A (en) | Method for quickly breeding new rice line by combining anther culture and in-vitro chromosome doubling | |
| CN113151294B (en) | Application of WRKY53 gene in enhancing aluminum resistance of plants | |
| CN116814651B (en) | Application of oat flower MYB4a transcription factor in regulating and controlling plant flower column elongation | |
| CN117187294B (en) | Application of BnaC5.ACBP4 gene in improving flooding resistance of plants | |
| CN114836468B (en) | Betula alba root transgenic method | |
| CN114805513B (en) | Tobacco NtOEE1 gene and application thereof in regulation of stem and leaf included angle and plant height | |
| CN116334101B (en) | Corn sterol content regulating gene ZmSCYL2 and application thereof | |
| CN112694523B (en) | Application of Brassica campestris Bra014815 gene in regulating and controlling branch number and plant type | |
| CN113912687B (en) | Method for changing morphological characteristics of plant stems, leaves and flowers and application | |
| CN117004624A (en) | Orange stomatal density regulation gene, coded protein and application | |
| CN102329817B (en) | Agrobacterium-mediated method for culturing transgenic populus wutunensis plants | |
| CN113881686A (en) | Method and sequence for improving branching capability of plant and fruit seedling breeding method | |
| CN1263949A (en) | Method for creating transgenic receptor system of corn and application of same | |
| Deng et al. | Plant regeneration from apple (Malus× domestica Borkh.) anther culture-derived embryos |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |