CN114875025B

CN114875025B - Drought and ABA inducible promoter P SCBV-YZ2060 And applications thereof

Info

Publication number: CN114875025B
Application number: CN202210307818.2A
Authority: CN
Inventors: 孙生仁; 王勤南; 常海龙; 王竹青; 陈俊吕; 秦元霞
Original assignee: Nanfan Seed Industry Research Institute Guangdong Academy Of Sciences
Current assignee: Nanfan Seed Industry Research Institute Guangdong Academy Of Sciences
Priority date: 2022-03-25
Filing date: 2022-03-25
Publication date: 2023-09-19
Anticipated expiration: 2042-03-25
Also published as: CN114875025A

Abstract

The invention provides a drought and ABA inducible promoter and application thereof, wherein the promoter has the nucleotide sequence shown in SEQ ID NO:1, and a nucleotide sequence shown in the specification. The invention verifies that the promoter can increase the expression quantity of GUS genes in plants under drought and ABA stress by detecting the expression condition of the GUS genes in transgenic arabidopsis and transgenic sugarcane. Therefore, the promoter can be used for preparing transgenic plants and carrying out plant transgenic breeding, can effectively improve drought and ABA stress adaptability of the transgenic plants, and has wide application in plant genetic engineering breeding.

Description

Drought and ABA inducible promoter P SCBV-YZ2060 And applications thereof

Technical Field

The invention belongs to the technical fields of plant genetic engineering and plant genetic breeding, and in particular relates to a drought and ABA inducible promoter P _SCBV-YZ2060 And applications thereof.

Background

Drought is the most severe abiotic stress affecting crop yield worldwide. Sugarcane is an important sugar crop and is also an important raw material for producing fuel ethanol, and is a crop with relatively high water demand, and the growth of the crop is easily affected by water deficiency. Drought is statistically responsible for up to 60% yield loss in sugarcane. The production area of the global sugarcane is mainly concentrated in areas with sufficient rainwater or perfect irrigation facilities, such as Brazil, australia, america and the like, and in main production areas of Guangxi, guangdong, yunnan and the like in China, the sugarcane is mainly planted on dry sloping fields and water-irrigated lands, and most sugarcane fields are easy to be seriously affected by drought due to lack of irrigation facilities, so that the development of sugar industry in China is seriously restricted. Drought causes the growth and development of plants to be inhibited, and even more, the yield and quality of the plants are seriously damaged, so that the drought is one of main abiotic stress in the agricultural production process.

The genetic engineering technology has the advantages of rapidness, wide sources, accuracy, high efficiency and the like, can overcome the defects of long period, serious germplasm resource deficiency and the like of the traditional breeding, and is a strong effective way for improving drought resistance of plants. The gene engineering technology can transfer drought related genes into plant receptors to enable plants to express related drought resistant proteins, so that drought resistant characteristics or characters are obtained. The expression of the gene is regulated by signals of the promoter, and different promoters have different time-space expression characteristics, so that the promoters can be divided into constitutive promoters, inducible promoters, specific promoters and the like. The constitutive promoter can promote efficient expression of heterologous genes in most dicotyledonous plants, and is widely used for researching transgene expression of exogenous genes in different plant species. However, continuous expression of stress-resistance related proteins in normal environments can generate a certain burden on plants, and cause conditions of normal metabolic disturbance, uneven energy distribution and the like of the plants, and at the moment, similar problems can not occur if drought stress induction promoters are adopted to promote expression of drought-resistance related genes, and development and utilization of the induction promoters can enable transgenic plants to adapt to stress better.

The application of the virus-encoded promoter to the transgenic expression of higher plants is an important method for plant genetic engineering, and the research of the promoter becomes one of important entry points for exploring the gene expression of plants. Related studies on the genomic promoters of members of the family Cauliferae have been reported, but the genome of different virus species of the family Cauliferae has very large differences, and the driving gene expression activity and the expression characteristics are different. Sugarcane baculovirus (Sugarcane bacilliform virus, SCBV) belongs to the cauliflower mosaic virus family, the genus baculodnavirus, which is one of the important pathogens infecting sugarcane, and the family member promoter is widely used in the genetic transformation process of crops. The SCBV population has high genetic variation, and the expression modes of promoters encoded by different SCBV genotypes are greatly different, so that the excavation of the SCBV promoters and functions thereof has great significance for modern genetic breeding technology.

Disclosure of Invention

Based on the drought and ABA inducible promoter, the invention aims to provide a drought and ABA inducible promoter, which can enable a target gene to be expressed only under drought and ABA inducible stress, is beneficial to more accurately regulating drought-resistant genes of crops such as sugarcane and the like, realizes balance of stress resistance and yield, and is applied to transgenic breeding of crops.

The technical scheme for achieving the purpose is as follows.

An drought, ABA inducible promoter, the nucleotide sequence of which is:

(1) Comprising the amino acid sequence as shown in SEQ ID NO:1, and a nucleotide sequence shown in the formula 1; or (b)

(2) And a polypeptide comprising the amino acid sequence as set forth in SEQ ID NO:1, and a sequence which is completely complementary to the nucleotide sequence shown in 1; or (b)

(3) Comprising the amino acid sequence as shown in SEQ ID NO:1 by substituting, deleting or adding one or more nucleotides, and having the same function; or (b)

(4) Consists of SEQ ID NO:4 and the sequence of SEQ ID NO:5, and the sequence obtained by PCR amplification of the downstream primer.

The invention also provides a plant expression cassette, which comprises the promoter, a target gene driven to express by the promoter and a terminator which are connected with each other in an expressible mode.

In some of these embodiments, the gene of interest is a GUS gene.

The invention also provides a recombinant vector containing the promoter or the expression cassette.

In some of these embodiments, the recombinant vector is P _SCBV-YZ2060 GUS; the P is _SCBV-YZ2060 The GUS vector is a recombinant vector obtained by replacing the CaMV 35S promoter sequence of the GUS gene in the pCAMBIA1305 vector with the above promoter sequence.

In some embodiments, the recombinant cloning vector is a recombinant cloning vector comprising a promoter as described aboveCloning the vector.

The invention also provides a host cell containing the promoter or the expression cassette or the recombinant vector.

In some embodiments, the host cell is a recombinant microorganism.

In some of these embodiments, the host cell is a recombinant bacterium.

In some embodiments, the recombinant bacterium is escherichia coli.

In some embodiments, the recombinant bacterium is agrobacterium.

In some of these embodiments, the recombinant bacterium is GV3101 agrobacterium.

In some of these embodiments, the host cell is a plant transgenic cell.

In some of these embodiments, the host cell is a plant callus cell.

The invention also provides any one of the following applications of the promoter, the expression cassette or the recombinant vector:

(1) Application in the regulation and control of plant gene expression of drought and ABA adversity stress;

(2) The application in improving the drought and ABA adversity stress adaptability of plants;

(3) The application in the adaptive breeding for improving drought and ABA adversity stress of plants.

In some embodiments, the plant is a monocot or dicot.

In some embodiments, the plant is sugarcane or arabidopsis thaliana.

The invention also provides a method for improving the adaptability of plants to drought and ABA adversity stress, which comprises the steps of introducing the promoter or the expression cassette or the recombinant vector into plants, and obtaining transgenic plants through screening.

In some embodiments, the method of introducing the above-described promoter or expression cassette or recombinant vector into a plant is agrobacterium infection.

In some embodiments, the method of introducing the above-described promoter or expression cassette or recombinant vector into a plant is a gene gun method.

The invention also provides a primer pair, which comprises a primer sequence shown as SEQ ID NO:4 and the sequence of SEQ ID NO:5, and a downstream primer shown in FIG. 5.

The invention also provides a preparation method of the promoter, which comprises the following steps: the SCBV genome DNA is used as a template, and the primer pair is used for PCR amplification to obtain the DNA.

In some of these embodiments, the reaction system for PCR amplification is as follows: 2X PrimeSTAR Max Premix 25.0.0. Mu.L, 10. Mu.M PSCBV-YZ 2060-F2.0. Mu.L, 10. Mu.M PSCBV-YZ 2060-R2.0. Mu.L, H ₂ O 20.0μL。

In some of these embodiments, the PCR amplification reaction procedure is as follows: pre-denaturation at 98℃for 2min; denaturation at 98℃for 10s, annealing at 55℃for 15s, extension at 72℃for 2min for a total of 35 amplification cycles; finally, the extension is carried out at 72 ℃ for 7min.

The invention obtains a DNA molecule from SCBV genome through first separation of study, and discovers that 2 promoter regions PPR1 and PPR2 exist in the DNA molecule through bioinformatics analysis, are respectively positioned at the 5 'end (74-124 bp) and the 3' end (854-904 bp) of a promoter sequence, and contain basic expression regulatory elements TATA-box and transcription initiation site TSS which are necessary for the promoter; in addition, the DNA molecules are enriched for various types of cis-regulatory elements. The DNA molecule contains 2 ABRE cis-acting elements which are regulated by ABA and are related to drought stress, and each element contains a common core motif ACGTG which is respectively positioned at 735-740 bp and 801-807 bp of a promoter sequence. The 2 ABRE elements are closely spaced, only 60 bases apart, for which the inventors predicted that they might have the function of responding to drought stress and verified experimentally.

The invention provides an drought and ABA inducible promoter which is derived from SCBV and is a part of genome nucleic acid sequence of the virus, and comprises a part of RT/RNase H region and a full-length promoter. The promoter is connected with a downstream target gene and constructs a recombinant expression vector, and the transgenic arabidopsis and the transgenic sugarcane obtained through transformation can induce the target gene to be expressed in high under drought and ABA stress, so that the adaptability of monocotyledonous and dicotyledonous plants to drought and ABA adversity stress can be obviously improved, the demand of monocotyledonous and dicotyledonous plants for drought and ABA adversity stress transgenic breeding is met, the transgenic arabidopsis and the transgenic sugarcane can be ideal selection of transgenic molecular breeding engineering, and the transgenic arabidopsis and the transgenic sugarcane have important application significance for regulating the growth and development of plants under drought and ABA adversity stress conditions.

Drawings

FIG. 1P _SCBV-YZ2060 Promoter sequence analysis map. Two putative transcription initiation sites TSS1 and TSS2 are marked with red and blue bold letters, respectively. Both TATA boxes (TATAAAT and ataaa) were boxed with red rectangles. Two putative ABRE cis-acting regulatory elements (ABRE-2 and ABRE-1) are underlined in orange and green, respectively.

FIG. 2P _SCBV-YZ2060 GUS plant recombinant expression vector construction diagram.

FIG. 3P _SCBV-YZ2060 GUS transgenic Arabidopsis expression analysis of GUS gene under 25% PEG6000 and 10. Mu.M ABA treatment. (a) 25% peg6000 treatment; (B) 10. Mu.M ABA treatment. The values in the figures are expressed as mean ± standard error (n=3). * And respectively represent that the difference reaches a significant level (P<0.05 And extremely significant level (P)<0.01)。

FIG. 4P _SCBV-YZ2060 Identifying GUS transgenic sugarcane. (a) herbicide selection of transgenic plants; (B) PCR detection of transgenic sugarcane lanes 1-21: transgenic sugarcane lines; m: DL2000 DNA markers; PC: positive control (transformed vector); NC: negative control (non-transgenic sugarcane); (C) PAT/bar transgenic test strip detection, 1-21: transgenic sugarcane lines; PC: positive control (transgenic arabidopsis); NC:negative control (non-transgenic sugarcane); red arrow positions represent positive bands.

FIG. 5P _SCBV-YZ2060 GUS transgenic sugarcane is subjected to detection results of GUS enzyme activity under the treatment of PEG6000 and ABA. (A) GUS gene quantitative PCR results; (B) GUS enzyme Activity measurement results. Wherein the letters a, b, c represent significant differences between the data of a and b, b and c, a and c (P<0.05)。

Detailed Description

The experimental procedure of the present invention, in which no specific conditions are noted in the following examples, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. The various chemicals commonly used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The terms "comprising" and "having" and any variations thereof, are intended to cover a non-exclusive inclusion. For example, a process, method, apparatus, article, or device that comprises a list of steps is not limited to the elements or modules listed but may alternatively include additional steps not listed or inherent to such process, method, article, or device.

In the present invention, the term "plurality" means two or more. "and/or", describes an association relationship of an association object, and indicates that there may be three relationships, for example, a and/or B, and may indicate: a exists alone, A and B exist together, and B exists alone. The character "/" generally indicates that the context-dependent object is an "or" relationship.

The invention firstly takes the leaf DNA of sugarcane variety YZ08-2060 infected with SCBV-YZ2060 as a template to clone and obtain a positive cloning plasmid containing the genome sequence of SCBV-YZ2060, and thenPCR amplification is carried out by taking the PCR primer as a template, and the amplified product is connected toOn a Cloning Vector, after escherichia coli is transformed, positive clones are screened for sequencing, and nucleotide sequences shown in SEQ ID NO:1, and a DNA molecule shown in the specification.

The DNA molecule has the total length of 934bp, and is found to have 2 promoter regions PPR1 and PPR2 through bioinformatics analysis, and contains basic expression regulatory elements TATA-box and transcription initiation site TSS necessary for the promoter; in addition, the DNA molecules are enriched for various types of cis-regulatory elements. The DNA molecule contains 2 ABRE cis-acting elements which are dependent on ABA to regulate and control and are related to drought stress, and all contain a common core motif ACGTG. The inventors predicted it to be a promoter having a function of responding to drought stress and named P _SCBV-YZ2060 。

The inventors have further constructed that the composition contains the P _SCBV-YZ2060 Plant binary expression vector P of (2) _SCBV-YZ2060 GUS is transformed into agrobacterium GV3101, positive strain is obtained through screening, arabidopsis thaliana is infected, and P is found through real-time fluorescent quantitative PCR detection _SCBV-YZ2060 GUS transgenic plants are obviously up-regulated in GUS gene expression under drought stress treatment and ABA treatment, which shows that P _SCBV-CHN2 Is a drought and ABA inducible promoter.

Then, the inventors obtained P by gene gun method _SCBV-YZ2060 GUS transgenic sugarcane seedlings, the GUS enzyme activity measurement results show that P _SCBV-YZ2060 GUS enzyme activity in root and leaf tissues of GUS transgenic sugarcane is obviously induced by drought stress and ABA; only under the induction of drought stress, the expression level of GUS is obviously up-regulated in stem tissues.

SEQ ID NO：1：

5’-AAGAACCAGTACTAATGTGTGCATGCAGGAAACCGGCGGTTCTCTTCACCTCAGGAACAAGGAACAATCCAAGCCGGAAGTTCTACAAATGTGTGGCAAATCAATGCCATTGCTGGTACTGGAAGGATCTCATTGAAGCTTACGTCCAAGATCGCATTGAAGAGTTCATGGTCGACAACTTCGACAGTAAAATGAACATATCAGAAGCTTCAACAAGTCAAGCCAAGCCGGAGATTGAAGAAGATCCGTTAGAAAATCTTCGATCAAGCGTCATTGATAGGCCAAGGCCTAGCGATGAACATTTCAAGCCAGGGTATGAATATCCTCAGTGTCCGGAGTACGTTCAAGAAGAACTCGCCAATAGGTTAATGACCTATGAAGAATACCTCAAGATGATTCAAAGTGAAGAGCACCTCCATCAGCAAAACTCTTTGCAGAAGATTGCTGAAGATTATCCAAGCCCACCATGGGGAGAACTGGACCTCTATTGCCATGAAGACCCAGACTTGGTGTACGAAGACGCCCGCACAGAAGATCTGCTCGACCTTGAAGACGTCATCGATGACATCAGAAGCTGAAGAAACGTCACTGCTGACCTCAAGACGCATCAAGCGGAGCGTGAAGGACCCATTCAGTGGACCTCACCACTGAAGAAGAATCTCAACTTTCGGCGCAATAATGCGTTAGGTGTGCCCGGCACCATGTTCGGTGCGATGTATCGAGTCTGTCGGTTGTACGTGTCCAGCACCTTTGTTCGGTGCGTGTCCTTTTCGGGCATCTGTGCCCATCTTCCTTTGTCGGCCACGTTGCCTTTGCTTAGCCCTTACGCGAAGCATAGCGCTCGGCCCTGGTGTGCCCTCTGCCTATATAAGGCATGGATGTAAGGCTCTTACACTCATCGGTAGTTCACCACATGAGTATTTGAGCTTGTTTC-3’

Those skilled in the art will appreciate that for a polypeptide as set forth in SEQ ID NO:1 by substituting, deleting or adding one or more nucleotides, for example, substituting one or more bases in a non-responsive element or an active element, thereby obtaining a nucleotide sequence with the same function, which belongs to the protection scope of the present invention.

The plant binary expression vector P constructed by the invention _SCBV-YZ2060 GUS is achieved by combining P _Ubi1 Ubi1 promoter sequence of GUS gene in GUS vector (P _Ubi1 ) Replaced with the SCBV-YZ2060 promoter sequence (P _SCBV-YZ2060 ) And (3) a recombinant vector constructed later. The P is _Ubi1 GUS vector was prepared by introducing the original promoter sequence (P _CaMV _35S ) Double cleavage with the endonucleases BamHI and HindIII followed by substitution to P _Ubi1 And the constructed recombinant vector. Wherein P is _CaMV _35S And P _Ubi1 Are all constitutive strong promoter sequences with known sequences.

The present invention will be further illustrated with reference to the following specific examples, but the present invention is not limited to the following examples. In the following examples, the percentages are mass percentages unless otherwise indicated.

EXAMPLE 1 cloning of the nucleotide sequence of the SCBV-YZ2060 promoter

1-1 Experimental materials

Sugarcane variety YZ08-2060 leaf samples infected with SCBV-YZ2060 were collected. The leaves are picked from the +1 leaves (the highest visible thickening band leaves) of sugarcane field, brought back to the laboratory, cleaned and sterilized by 75% alcohol, placed in a self-sealing bag and stored in an ultralow temperature refrigerator at-80 ℃.

1-2 sugarcane leaf Total DNA extraction

The sugarcane leaf total DNA extraction method adopts a modified CTAB method (Sun et al, 2016). The total DNA absorbance and concentration were measured by a NanoVue ultra-micro spectrophotometer (GE Healthcare) protein nucleic acid analyzer, usa, and total DNA integrity was checked by electrophoresis.

1-3 SCBV-YZ2060 genomic clone

According to two SCBV genome sequences published at present in Genbank database, 1 pair of degenerate primers SCBV-F5603 are designed by Primer Premier 5 software: 5'-GAAGAGYGGSTTTCATCAAGT-3' (SEQ ID NO: 2) and SCBV-R1002:5'-CTCCGCTTCAGGTATTCCA-3' (SEQ ID NO: 3) for cloning the SCBV genomic sequence, the desired fragment size is expected to be about 3000bp. SCBV pathogen detection PCR amplification was performed using 200ng total DNA as template and LA Taq kit (TaKaRa, china). The PCR reaction system is as follows: 10 XLA PCR Buffer (Mg) ²⁺ Plus) 5.0. Mu.L, dNTP mix (2.5 mM each) 8.0. Mu.L, SCBV-F5603 (10. Mu.M) 2.0. Mu.L, SCBV-R1002 (10. Mu.M) 2.0. Mu.L, LA Taq (5U/. Mu.L) 0.5. Mu.L, pure H ₂ O31.5. Mu.L, DNA 1.0. Mu.L. The PCR reaction procedure was as follows: pre-denaturation at 94℃for 6min; denaturation at 94℃for 1min, annealing at 58℃for 1min, extension at 72℃for 5min, total of 35 amplification cycles; finally, the extension is carried out at 72 ℃ for 10min. After the PCR amplification reaction, 5. Mu.L of the PCR reaction product was taken and subjected to 1% agarose gel electrophoresis. PCR reaction product passageGel Extraction Kit the kit was purified and ligated into pMD19-T cloning vector and transformed into E.coli host cells DH 5. Alpha. Competent cells. 100 mu L of transformation bacteria liquid is coated on an LB solid culture medium flat plate containing ampicillin (100 mu g/mL), after being cultivated overnight at 37 ℃ in a dark place, a plurality of white single colonies are selected and respectively inoculated into LB liquid culture medium containing ampicillin (50 mu g/mL), and are cultivated for 6 to 8 hours at 37 ℃ in a dark place in a shake way, and then respectively takenBacterial liquid PCR detection is carried out on bacterial liquid with the concentration of 0.5 mu L, and the reaction system is as follows: 10 XLA PCR Buffer (Mg) ²⁺ Plus) 2.5. Mu.L, dNTP mix (2.5 mM each) 4.0. Mu.L, SCBV-F5603 (10. Mu.M) 1.0. Mu.L, SCBV-R1002 (10. Mu.M) 1.0. Mu.L, LATAq (5U/. Mu.L) 0.25. Mu.L, pure H ₂ O15.75. Mu.L, bacterial liquid 0.5. Mu.L. The reaction procedure was as follows: pre-denaturation at 94℃for 6min; denaturation at 94℃for 1min, annealing at 58℃for 1min, extension at 72℃for 5min for 30 amplification cycles; finally, the extension is carried out at 72 ℃ for 10min. After bacterial liquid PCR detection, 3 positive clones are selected for sequencing verification.

1-4 SCBV-YZ2060 promoter clone

According to the obtained SCBV-YZ2060 genome fragment sequence, predicting by bioinformatics software, selecting a promoter homologous nucleotide sequence fragment, and designing a promoter fragment cloning primer PSCBV-YZ2060-F:5'-AAGAACCAGTACTAATGTGTGCATG-3' (SEQ ID NO: 4) and PSCBV-YZ2060-R:5'-GAAACAAGCTCAAATACTCATGTG-3' (SEQ ID NO: 5), fragment size 934bp. 100ng of a plasmid containing the SCBV-YZ2060 genomic fragment was used as a template, usingMax DNA Polymerase kit (TaKaRa, china) for PCR amplification. The PCR reaction system is as follows: primeSTAR Max Premix (2X) 25.0. Mu.L, PSCBV-YZ2060-F (10. Mu.M) 2.0. Mu.L, PSCBV-YZ2060-R (10. Mu.M) 2.0. Mu.L, pure H ₂ O20.0. Mu.L. The PCR reaction procedure was as follows: pre-denaturation at 98℃for 2min; denaturation at 98℃for 10s, annealing at 55℃for 15s, extension at 72℃for 2min for a total of 35 amplification cycles; finally, the extension is carried out at 72 ℃ for 7min. After the PCR amplification reaction, 5. Mu.L of the PCR reaction product was taken and subjected to 1% agarose gel electrophoresis. PCR reaction products pass->Gel Extraction Kit kit (Omega, USA) purified by +.>Simple Cloning Kit (full gold, china) is connected to +.>On the Cloning Vector, the ligation reaction system was 5. Mu.L, containing 4.0. Mu.L of recovered product and +.>Cloning Vector 1.0. Mu.L. The ligation reaction solution was transformed into DH 5. Alpha. Competent cells, and the cells were screened by LB plate containing ampicillin (50. Mu.g/mL) to obtain monoclonal colonies. After bacterial liquid PCR identification, 3 positive clones are sent for sequencing, and after sequencing, the connection product has the sequence shown in SEQ ID NO:1, which is designated as P _SCBV-YZ2060 。

Example 2P _SCBV-YZ2060 Bioinformatic analysis of promoter sequences

P was predicted by promoter on-line analysis software Proscan Version 1.7 and Neural Network Promoter Prediction, respectively _SCBV-YZ2060 TATA-box and transcription initiation site of the promoter, cis-acting element prediction was accomplished by on-line analysis software plantaCARE and New PLACE. As a result, as shown in FIG. 1, the promoter has 2 promoter regions PPR1 and PPR2, which are respectively positioned at the 5 '-end (74-124 bp) and the 3' -end (854-904 bp) of the promoter sequence, and contains basic expression regulatory elements TATA-box and transcription initiation site TSS which are necessary for the promoter; in addition, the promoter is enriched in cis-regulatory elements of various types. The predicted NEW PLACE and plant CARE software shows that the promoter contains 2 ABRE cis-acting elements which are regulated by ABA and are related to drought stress, and the ABRE cis-acting elements contain a common core motif ACGTG which is respectively positioned at 735-740 bp and 801-807 bp of the promoter sequence. The 2 ABRE elements are closely spaced, separated by only 60 bases, suggesting that the promoter may have a function of responding to drought stress.

EXAMPLE 3 construction of promoter recombinant expression vector

Preparation of plant expression vector skeleton: linearizing P using the fast restriction endonucleases HindIII and BamHI (Fermentas, USA) _Ubi1 GUS vector, 25. Mu.L of the cleavage reaction system contained 2.5. Mu.L of 10X FastDigest Buffer, 0.5. Mu.L of HindIII, 0.5. Mu.L of BamHI and 1. Mu.g of the plasmid of interest. After 30min of water bath at 37 ℃, agarose of 1 percent is usedElectrophoresis is carried out in gel, a large fragment, namely a target carrier framework is recovered, and the gel is placed in a refrigerator at the temperature of minus 20 ℃ for standby.

And (3) PCR amplification: the amplified promoter P was designed by means of a seamless cloning primer design tool (http:// 123.56.75.195 /) _SCBV-YZ2060 The GUS vector of the sequence was ligated to primer IF-GUS-YZ2060-F:5'-GGCCAGTGCCAAGCTTAAGAACCAGTACTAATGTGTGCATG-3' (SEQ ID NO: 6) and IF-GUS-YZ2060-R:5'-GACCACCCGGGGATCCGAAACAAGCTCAAATACTCATGTG-3' (SEQ ID NO: 7) byAmplifying the Max DNA Polymerase kit to obtain a SCBV promoter fragment added with a connector, and purifying and recovering a target fragment by agarose gel electrophoresis at the annealing temperature of 60 ℃; the PCR system and the reaction procedure were the same as in examples 1-4.

And (3) carrier connection: ligation was performed by an In-Fusion kit (TaKaRa, china), and P was used _SCBV-YZ2060 The promoter sequence was ligated into the GUS gene expression vector. The 10. Mu.L ligation reaction contained 2. Mu.L of 5 XIn-Fusion HD enzyme Premix, 2. Mu.L of linearized plasmid vector and 4. Mu.L of PCR product. Mixing the above mixed solution with light bullet, water-bathing at 50deg.C for 15min, placing on ice, transferring the connected product into DH5 alpha competent cells, coating on LB plate containing ampicillin (50 μg/mL), dark culturing at 37deg.C for 12 hr, picking monoclonal colony, identifying by bacterial liquid PCR, and sequencing 3 positive clones to obtain recombinant plasmid P _SCBV-YZ2060 GUS, amplifying and culturing the plasmid, and standing at-20deg.C for use, P _SCBV-YZ2060 GUS plasmid map is shown in FIG. 2.

Example 4 GUS Gene real-time fluorescent quantitative PCR detection under Arabidopsis genetic transformation and drought stress

4-1 plasmid transformation of Agrobacterium competent cells

Extracting and preserving the plasmid P _SCBV-YZ2060 GUS is transformed into Agrobacterium competent cells GV3101 by the following steps: (1) 1. Mu.g of plasmid DNA was added to 200. Mu.L of prepared GV3101 competent cells, and mixed gently; (2) Placing the mixed solution in liquid nitrogen for 10min, and placing on ice for 5min; (3) 200 mu L of antibiotic-free LB liquid medium is takenAdding into the mixed solution, and activating at 28deg.C with shaking table at 200rpm/min for 2 hr; (4) Placing the activated transformation solution in a sterile ultra-clean workbench, taking 100 mu L of the transformation solution, coating the transformation solution on LB solid plate medium containing 50 mu g/mL kanamycin and rifampicin, and inversely culturing at 28 ℃ for 2 days; (5) And (3) selecting single bacterial colonies, shaking, performing bacterial liquid PCR, running glue to detect whether a target strip exists, selecting positive agrobacterium bacterial liquid with the target plasmid for expansion culture, and preserving in a refrigerator at-80 ℃ for later use.

4-2 Arabidopsis transformation and transgenic seedling selection

The method comprises the following specific steps: (1) Taking 10 mu L to 10mL of LB liquid medium (50 mu g/mL kanamycin and rifampicin) of the positive agrobacterium liquid, and activating at 28 ℃ at 200rpm/min overnight; (2) Inoculating 10mL of agrobacterium tumefaciens bacteria solution into 200mL of LB liquid medium (50 mug/mL kanamycin and rifampicin), activating at 28 ℃ at 200rpm/min until OD600 = 0.8-1.0, centrifuging at 5000rpm/min at room temperature for 5min, and collecting bacteria; (3) Removing supernatant, adding 10mL of a dye solution (1/2 MS,2.215mg/mL; sucrose, 5% (W/V; silwet 77,0.02% (W/V)) to resuspend thallus, centrifuging at 5000rpm/min at room temperature for 5min, and collecting thallus; (4) discarding the supernatant, and adding 200mL of an invaded solution to resuspend the thallus; (5) Selecting strong Arabidopsis thaliana in the initial fruit period, removing fruit pods, only retaining inflorescences which are not fully bloomed, horizontally placing the plants to enable inflorescences to be completely immersed into dye liquor, placing the plants in a new tray horizontally after soaking for 1min, covering the plants with a preservative film, and culturing the plants in a darkroom for 24h; (6) After dark treatment for 1 day, taking out plants, placing the plants in a climatic culture chamber for normal culture, maturing the plants for about one month, and harvesting T0 generation seeds for transgenic plant screening; (7) Preparing a resistance plate, spreading the sterilized T0 generation seeds on the plate, taking out the seeds after vernalization in darkness for 2-4 days at 4 ℃, culturing for 2-3 weeks in a constant temperature incubator at 23 ℃, taking positive seedlings, transplanting the positive seedlings into nutrient soil, identifying the positive seedlings again by PCR, and continuously culturing until the T3 homozygous seeds are obtained for subsequent experiments.

Drought stress treatment and ABA treatment of 4-3 transgenic Arabidopsis thaliana

(1) Drought treatment: after the transgenic arabidopsis seeds are disinfected, dibbling the seeds in a 1/2MS culture medium, carrying out vernalization at 4 ℃ for 2 days, culturing the seedlings in an incubator for 7 days, respectively transferring the transgenic seedlings to a 1/2MS liquid culture medium containing 25% PEG6000 for 2 days, respectively sampling the seedlings at 0h, 3h, 6h, 12h and 24h by taking the liquid culture medium of the 1/2MS as a control, and freezing 3 biological replicates of each sample in liquid nitrogen and then preserving the seedlings at-80 ℃ for later use.

(2) ABA treatment: after the transgenic arabidopsis seeds are disinfected, the transgenic arabidopsis seeds are sown in a 1/2MS culture medium, after vernalization for 2 days at 4 ℃, the transgenic seedlings are cultured in an incubator for 7 days, the transgenic seedlings are respectively transferred to a 1/2MS liquid culture medium containing 10 mu M ABA for culture, the 1/2MS liquid culture medium without ABA is used as a control group, and 3 times of repetition are arranged for each treatment group. Sampling at 0h, 1h, 4h, 8h and 16h, freezing the sample with liquid nitrogen, and preserving at-80 ℃ for later use.

4-4 real-time fluorescent quantitative PCR detection

(1) Transgenic arabidopsis RNA was extracted by TRIzol method, drought stress treatment and ABA treatment, for specific steps see TRIzol reagent (Invitrogen, usa) instructions.

(2) The remaining DNA in the total RNA was removed. The reaction system was 10. Mu.L, containing 2.0. Mu.L of 5X gDNA Eraser Buffer, 1.0. Mu.L of gDNA Eraser and 1. Mu.g of total RNA. The reaction conditions were 42℃for 2min.

(3) Using PrimeScript as template and total RNA extracted ^TM RT reagent Kit with gDNA Eraser the cDNA was obtained by reverse transcription using the kit (TaKaRa). 10. Mu.L of a reverse transcription solution comprising 1.0. Mu. L PrimeScript RT Enzyme Mix I, 1.0. Mu.L of RT Primer Mix and 2.0. Mu.L of 5X PrimeScript Buffer 2 and 4.0. Mu.L of RNase Free dH was added to the DNA reaction solution from which the total RNA was removed ₂ O. The reaction condition is 37 ℃ for 15min;85 ℃,5s. After the reaction is finished, the product is diluted by 5 times and is directly subjected to the next test or is stored at the temperature of minus 80 ℃ for standby.

(4) Real-time fluorescent quantitative PCR experiments were performed using a Quantum studio 3 quantitative PCR apparatus (Applied Biosystems, USA), with TBPremix Ex Taq ^TM qRT-PCR detection is carried out by a fluorescent kit (TaKaRa company), and the expression quantity of GUS gene is quantitatively analyzed by selecting Arabidopsis thaliana Actin2 as an internal reference gene. GUS quantitative primer qGUS-F:5' -AGCGTTGAACTGCGTGAT-3' (SEQ ID NO: 8) and qGUS-R:5'-TTGCCAGAGGTGCGGATT-3' (SEQ ID NO: 9), action 2 quantitative primer qactin-F:5'-TGTTCCCATCAGAACCGTGA-3' (SEQ ID NO: 10) and qactin-R:5'-CACCTGTCTTTGGGTCAACAA-3' (SEQ ID NO: 11). The qRT-PCR reaction contained 10TB Green Premix Ex Taq (2X), 0.2. Mu.M upstream and downstream primers, 0.4. Mu. L ROX Reference Dye II and 1.0. Mu.L cDNA template. After mixing, the mixture is centrifuged slightly and put into a Quantum studio 3 quantitative PCR instrument for real-time fluorescence PCR reaction. The reaction procedure is: pre-denaturation at 95 ℃ for 30s; 15s at 95℃and 34s at 60℃for 40 cycles. The experiment was set up with 3 biological replicates and 3 technical replicates.

The results are shown in FIG. 3, and the GUS quantitative results show that P _SCBV-YZ2060 The GUS gene expression level of GUS transgenic arabidopsis thaliana is obviously improved after being treated for 3-24 hours by 25% PEG6000, and reaches the highest value in 12 hours, and is improved by 3.3 times compared with a blank control (figure 3 (A)); GUS gene expression level was significantly increased after 1h of 10. Mu.M ABA treatment until the maximum value was reached after 16h, 3.7 times that of the blank control group (FIG. 3 (B)). These results indicate P _SCBV-YZ2060 The promoter has the capability of responding to drought and ABA stress induction in dicotyledon, can regulate the expression of a target gene under drought and ABA stress, and is an drought and ABA stress induction type promoter.

Example 5P _SCBV-YZ2060 Screening of GUS transgenic sugarcane plants and GUS enzyme activity determination

5-1 configuration of Medium and Gene gun bombardment reagent required in sugarcane tissue culture Process

0.1M spermidine: weighing 0.0726g, dissolving in 5ml of sterile water, filtering with 0.45 μm sterile filter head, packaging, and keeping at-20deg.C in dark place for use. Spermidine dosage= (V _{Tungsten powder} +V _{Plasmid DNA} )÷2.75。

2.5M CaCl ₂ : 0.2775g of anhydrous CaCl is weighed ₂ Dissolving in 1.0ml of sterile water, filtering with 0.45 μm sterile filter head, and keeping at-20deg.C in dark place. CaCl (CaCl) ₂ Usage= (V) _{Tungsten powder} +V _{Plasmid DNA} )÷1.1。

60. Mu.g/uL tungsten powder (diameter 1.1 μm): weighing a proper amount of tungsten powder (500 mug/gun), and loading into a 1.5mL inlet centrifuge tube; adding 800 mu L of absolute ethyl alcohol, vibrating at a high speed for 1-2 min, centrifuging at a speed of 8000g for 1min, removing the supernatant, and repeating the steps; adding 500 mu L of sterile water, vibrating at a high speed for 1-2 min, centrifuging at a speed of 8000g for 1min, removing the supernatant, and repeating the steps; finally, adding sterile water to resuspend the tungsten powder to ensure that the concentration of the tungsten powder is 60 mug/mu L.

Induction medium: 4.4g/L MS culture medium salt (containing vitamins) (Cool, china), 2 mg/L2, 4-D,20g/L sucrose, 6g/L agar powder, and the pH is 5.8-6.2.

Osmotic medium: 4.4g/L MS culture medium salt (containing vitamins), 36.4g/L sorbitol, 36.4g/L mannitol, 0.6 mg/L2, 4-D,25g/L sucrose, 6g/L agar powder, and pH 5.8-6.2.

Recovery medium: 4.4g/L MS culture medium salt (containing vitamins), 0.6 g/L2, 4-D,20g/L sucrose, 6g/L agar powder and pH 5.8-6.2.

Differentiation medium: 4.4g/L MS culture medium salt (containing vitamins), 0.5mg/L NAA,0.5 mg/L6-BA, 1mg/L KT,25g/L sucrose, 6g/L agar powder and pH 5.8-6.2.

Rooting medium: 4.4g/L MS culture medium salt (containing vitamins), 3mg/L NAA,0.2 mg/L6-BA, 0.2mg/L KT,5g/L sucrose, 0.25g/L activated carbon, and pH 5.8-6.2.

5-2 sugarcane genetic transformation

(1) Taking the tip of new sugar No. 22 of a normal and pest-free sugarcane variety as a material, removing old leaves and grown upper leaves, sterilizing for 10min by using 5% sodium hypochlorite, cleaning twice by using sterile water, selecting young heart leaf tissue slices of the sugarcane to be 1mm thick, spreading the slices in an induction culture medium, and culturing in a dark state at 28 ℃ for 10-14 days.

(2) Clean, loose and bright yellow callus is picked and spread in a permeation culture medium, and is pretreated for 4 hours under the dark condition at 28 ℃.

(3)P _SCBV-YZ2060 GUS recombinant plasmid DNA coating: taking prepared tungsten powder suspension (60 mug/uL), swirling for 1min, adding plasmid DNA (1 mug/gun) and 2.5M CaCl in sequence ₂ And 0.1M spermidine, continuing vortex for 2-3 min, fully mixing uniformly, and standing on ice for 5min until tungsten powder sinks to the bottom of the centrifuge tube; add 800. Mu.l of anhydrous ethanolAlcohol, removing supernatant, repeating for one time, and adding proper amount of absolute ethyl alcohol to make the concentration of tungsten powder be 60 mug/uL.

(4) 10 mu L of tungsten powder ethanol mixed solution coated with plasmid DNA is sucked and coated on a particle slide glass for airing. The split film (1100 psi) soaked in 80% isopropyl alcohol is put into a metal collar, after the tightness is checked, the vacuum is pumped until the pressure reaches more than 28inHg, and the plasmid DNA is introduced into the young leaf cells of the sugarcane by using high-pressure helium gas. The bombardment parameter is helium pressure 1300psi, bombardment distance 6cm.

(5) After the bombardment of the gene gun is finished, the callus is continuously cultured on a permeation culture medium for 24 hours, and then is transferred to a recovery culture medium, and is subjected to dark culture for 5-7 days at the temperature of 28 ℃.

(6) The callus is crushed by clipping, transferred to a differentiation medium containing 4mg/L biamphos, cultivated at 28 ℃ under illumination (16 h illumination/8 h darkness), and the medium is replaced every two weeks until 3-5 cm long and stronger seedlings are grown. Wherein biamphos may be added only at the first and last time of transfer of the differentiation medium.

(7) The sugarcane seedlings are transferred to a rooting culture medium, and are cultured under the conditions of 28 ℃ and 16h illumination/8 h darkness, and the culture medium is replaced every two weeks until the seedlings root and are thick.

(8) Transplanting the robustly sugarcane seedlings into nutrient soil, and culturing at 28 ℃ under the conditions of 60% relative humidity and 16h illumination/8 h darkness.

5-3 screening and identification of transgenic plants

(1) Herbicide screening of transgenic plants: the sugarcane seedlings grow in the nutrient soil, after 7-10 days of re-greening, 6.6mL/L of glufosinate herbicide (reaching the conservation) is sprayed, and after 7 days, the seedlings are sprayed again. After 7-10 days, young green-leaf surviving sugarcane seedlings are transplanted into a pot for cultivation, and the cultivation is shown in fig. 4 (A).

(2) And (3) PCR molecular identification: when the young sugarcane seedlings grow stronger, the leaves are cut, the total DNA is extracted, and the primer PSCBV-YZ2060-F is used for: 5'-AAGAACCAGTACTAATGTGTGCATG-3' (SEQ ID NO: 12) and GUS-R:5'-CCCTTCACTGCCACTGACCG-3' (SEQ ID NO: 13) for PCR detection, PCR reaction System and procedure are described in examples 1-4, target band size is 1805bp, and positive detection is performedThe result of plant screening is shown in fig. 4 (B), 45 positive P plants are screened out _SCBV-YZ2060 GUS transgenic sugarcane seedlings.

(3) PAT/bar transgenic test strip detection: a small amount of leaves were put into a mortar, fully ground by adding liquid nitrogen, then the powder was put into a 5.0mL reaction tube, a proper amount of extract was added, vortexed for 30s, a PAT/bar transgenic test strip (EnviroLogix, usa) was inserted into the mixed solution, and the result was observed after standing at room temperature for 5 min. Two red bands appear positive as shown in fig. 4 (C).

5-4 sugarcane drought stress and ABA treatment

And (3) transferring sugarcane seedlings with similar growth vigor into clear water for culture, and culturing for 2 weeks by using a honland nutrient solution about 5-7 days after new roots grow out. Selecting seedlings with consistent growth vigor, dividing the seedlings into 3 groups, and culturing the first group in a Hongland nutrient solution containing 25% PEG 6000; the second group was incubated in Hongland nutrient solution containing 10 μm ABA; culturing the third group in normal Hongland nutrient solution, treating for 12h to sample, wherein the sampling part is the leaf, root and pseudo-stem of the plant, quick-freezing with liquid nitrogen, and placing in a refrigerator at-80 ℃ for standby. The experiment was set up with 6 biological replicates.

5-5 real-time fluorescent quantitative PCR detection

(1) Transgenic sugarcane RNA for drought stress treatment and ABA treatment was extracted by TRIzol method, see TRIzol reagent (Invitrogen, USA) instructions for specific procedures.

(2) The remaining DNA in the total RNA was removed. The reaction system contained 2.0. Mu.L of 5X gDNA Eraser Buffer, 1.0. Mu.L of gDNAEras and 1. Mu.g total RNA in 10. Mu.L. The reaction conditions were 42℃for 2min.

(3) Using PrimeScript as template and total RNA extracted ^TM RT reagent Kit with gDNAEraser the cDNA was obtained by reverse transcription using the kit (TaKaRa). 10. Mu.L of a reverse transcription solution comprising 1.0. Mu. L PrimeScript RT Enzyme Mix I, 1.0. Mu.L of RT Primer Mix and 2.0. Mu.L of 5X PrimeScript Buffer 2 and 4.0. Mu.L of RNase Free dH was added to the DNA reaction solution from which the total RNA was removed ₂ O. The reaction condition is 37 ℃ for 15min;85 ℃,5s. Diluting the product 5 times after the reaction is finished, directly performing the next test or placing the product at-80 DEG CAnd (5) storing for standby.

(4) Real-time fluorescent quantitative PCR experiments were performed using a Quantum studio 3 quantitative PCR apparatus (Applied Biosystems, USA), with TBPremix Ex Taq ^TM qRT-PCR detection is carried out by a fluorescent kit (TaKaRa company), sugarcane GAPDH is selected as an internal reference gene, and the expression quantity of GUS gene is quantitatively analyzed. GUS quantitative primer qGUS-F:5'-AGCGTTGAACTGCGTGAT-3' (SEQ ID NO: 8) and qGUS-R:5'-TTGCCAGAGGTGCGGATT-3' (SEQ ID NO: 9), GAPDH quantitative primer qGAPDH-F:5'-CACGGCCACTGGAAGCA-3' (SEQ ID NO: 14) and qGAPDH-R:5'-TCCTCAGGGTTCCTGATGCC-3' (SEQ ID NO: 15). The qRT-PCR reaction contained 10TB Green Premix Ex Taq (2X), 0.2. Mu.M upstream and downstream primers, 0.4. Mu. L ROX Reference Dye II and 1.0. Mu.L cDNA template. After mixing, the mixture is centrifuged slightly and put into a Quantum studio 3 quantitative PCR instrument for real-time fluorescence PCR reaction. The reaction procedure is: pre-denaturation at 95 ℃ for 30s; 15s at 95℃and 34s at 60℃for 40 cycles. The experiment was set up with 3 biological replicates and 3 technical replicates.

As shown in FIG. 5 (A), the GUS quantitative result shows that the expression quantity of GUS genes in root tissues is obviously higher than that of a control group without drought stress and ABA treatment, and is respectively improved by 17.8 times and 9.6 times compared with the control group; the expression level of GUS gene in leaf tissue was 4.4-fold and 8.3-fold higher than that in the control group; however, in stem tissues, the GUS expression level was significantly up-regulated only under the induction of ABA, which was 21.7 times that of the control.

5-6 GUS protein Activity assay

(1) Preparing a solution: mother liquor of 1mM of 4-methylumbelliferone (4-MU): weighing 0.04404g of 4-MU, and fixing the volume to 250mL by using GUS termination reaction solution; mother liquor of 4-MU 1. Mu.M: 0.5mL of 1mM 4-MU mother liquor was diluted to 500mL.

(2) Extraction of GUS protein: the extraction of the plant crude protein is completed by a plant protein extraction kit (Soxhao, beijing), after the arabidopsis tissue material is ground into powder by liquid nitrogen, 1mL of extracting solution is added for uniform mixing, the solution is placed on ice for 20min, shaking is carried out for 1 time every 5min during the period, the solution is centrifuged for 30min at the speed of 14000rpm at the temperature of 4 ℃, and the supernatant is sucked into a new centrifuge tube for standby.

(3) Determination of protein concentration: the protein concentration determination kit (Soxhaust Bao, beijing) was used. BSA (0. Mu.g/. Mu.L, 0.0625. Mu.g/. Mu.L, 0.125. Mu.g/. Mu.L, 0.5. Mu.g/. Mu.L, 1. Mu.g/. Mu.L, and 2. Mu.g/. Mu.L gradient) was prepared in different concentration gradients, and 200. Mu.L BCA working fluid (BCA: cu) was added to each concentration gradient of 20. Mu.L to 96 well plates ²⁺ =50:1), mixing, incubating for 15-30 min at 37 ℃, measuring 595nm light absorption value in an enzyme label instrument, repeating each concentration gradient for 3 times, and drawing a protein concentration standard curve according to the absorption value and the corresponding protein concentration; taking 20 mu L of the crude protein extract of the sample, adding 200 mu LBCA working solution, uniformly mixing, incubating for 15-30 min at 37 ℃, measuring 595nm light absorption value in an enzyme-labeled instrument, and calculating the protein content of the sample according to a protein concentration standard curve.

(4) GUS fluorescence assay: with 1 MU M4-MU as fluorescent standard substance, 4-MU (0 nM, 50nM, 100nM, 200nM, 400nM, 600nM, 800nM and 1000 nM) with different concentration gradients is prepared, 200 MU L is absorbed into the ELISA plate for each concentration gradient, after removing bubbles, the fluorescence value of 4-MU with different concentration gradients is measured by using the ELISA plate under the conditions of 365nM excitation light and 455nM emission light, each concentration gradient is repeated 3 times, and a standard curve of 4-MU is drawn according to the fluorescence value and the corresponding concentration. Taking 20 mu L of crude protein extract of a sample, adding 480 mu L of GUS reaction solution, uniformly mixing, incubating at 37 ℃, respectively taking 100 mu L of reaction solution in 0min and 60min, rapidly adding the 100 mu L of reaction solution into 0.9mL of GUS termination reaction solution to terminate the reaction, taking 200 mu L of reaction solution into an ELISA plate, removing bubbles, and measuring the fluorescence value of the sample under the conditions of excitation light 365nm and emission light 455nm by using an ELISA instrument. The activity of GUS protein in the samples was calculated according to the standard curve of 4-MU.

As shown in FIG. 5 (B), the GUS enzyme activity of root tissues is obviously induced by drought stress and ABA, which are obviously higher than that of a control group by 2.2 times and 2.8 times respectively; the GUS enzyme activity of leaf tissues is obviously higher than that of a control group, and is respectively improved by 4.4 times and 2.2 times compared with the control group; however, in stem tissues, the GUS expression level was significantly up-regulated to 2.3 of the control group only under drought stress induction.

The above knotFruit-indicated promoter P _SCBV-YZ2060 In monocotyledonous plants such as sugarcane and the like, the promoter also has drought and ABA induction characteristics, can improve the expression of a target gene under drought and ABA stress, and is a drought and ABA stress induction promoter.

The above examples disclose only that the exogenous GUS gene is subject to promoter P under drought, ABA stress in Arabidopsis and sugarcane _SCBV-YZ2060 The invention can also be extended to other functional genes, such as insecticidal genes, disease-resistant genes, stress-resistant genes, weeding genes and the like, and to other monocotyledonous plants and dicotyledonous plants, and can be applied to the induction expression of the functional genes under drought and ABA stress conditions in plant genetic engineering, and has wide application prospect in drought-resistant genetic engineering breeding of various crops. The invention can also be applied to the transformation of plant bioreactors suitable for drought and ABA adversity, so as to obtain the transgenic plant bioreactors with high yield of target protein under drought and ABA stress conditions.

The technical features of the above embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The foregoing examples illustrate only a few embodiments of the invention and are described in detail herein without thereby limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

SEQUENCE LISTING

<110> institute of south-propagation and seed-production of academy of sciences in Guangdong province

<120> an drought, ABA inducible promoter PSCBV-YZ2060 and use thereof

<130> 2022-03-25

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 934

<212> DNA

<213> Artificial Sequence

<400> 1

aagaaccagt actaatgtgt gcatgcagga aaccggcggt tctcttcacc tcaggaacaa 60

ggaacaatcc aagccggaag ttctacaaat gtgtggcaaa tcaatgccat tgctggtact 120

ggaaggatct cattgaagct tacgtccaag atcgcattga agagttcatg gtcgacaact 180

tcgacagtaa aatgaacata tcagaagctt caacaagtca agccaagccg gagattgaag 240

aagatccgtt agaaaatctt cgatcaagcg tcattgatag gccaaggcct agcgatgaac 300

atttcaagcc agggtatgaa tatcctcagt gtccggagta cgttcaagaa gaactcgcca 360

ataggttaat gacctatgaa gaatacctca agatgattca aagtgaagag cacctccatc 420

agcaaaactc tttgcagaag attgctgaag attatccaag cccaccatgg ggagaactgg 480

acctctattg ccatgaagac ccagacttgg tgtacgaaga cgcccgcaca gaagatctgc 540

tcgaccttga agacgtcatc gatgacatca gaagctgaag aaacgtcact gctgacctca 600

agacgcatca agcggagcgt gaaggaccca ttcagtggac ctcaccactg aagaagaatc 660

tcaactttcg gcgcaataat gcgttaggtg tgcccggcac catgttcggt gcgatgtatc 720

gagtctgtcg gttgtacgtg tccagcacct ttgttcggtg cgtgtccttt tcgggcatct 780

gtgcccatct tcctttgtcg gccacgttgc ctttgcttag cccttacgcg aagcatagcg 840

ctcggccctg gtgtgccctc tgcctatata aggcatggat gtaaggctct tacactcatc 900

ggtagttcac cacatgagta tttgagcttg tttc 934

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 2

gaagagyggs tttcatcaag t 21

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 3

ctccgcttca ggtattcca 19

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 4

aagaaccagt actaatgtgt gcatg 25

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 5

gaaacaagct caaatactca tgtg 24

<210> 6

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 6

ggccagtgcc aagcttaaga accagtacta atgtgtgcat g 41

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 7

gaccacccgg ggatccgaaa caagctcaaa tactcatgtg 40

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 8

agcgttgaac tgcgtgat 18

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 9

ttgccagagg tgcggatt 18

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

tgttcccatc agaaccgtga 20

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 11

cacctgtctt tgggtcaaca a 21

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 12

aagaaccagt actaatgtgt gcatg 25

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

cccttcactg ccactgaccg 20

<210> 14

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 14

cacggccact ggaagca 17

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

tcctcagggt tcctgatgcc 20

Claims

1. Any of the following applications of drought, ABA inducible promoters:

(3) Application in adaptive breeding for improving drought and ABA adversity stress of plants;

the nucleotide sequence of the promoter is as follows:

(1) As set forth in SEQ ID NO:1, and a nucleotide sequence shown in the formula 1; or (b)

(2) And the sequence shown in SEQ ID NO:1, and a sequence which is completely complementary to the nucleotide sequence shown in 1; or (b)

(3) Consists of SEQ ID NO:4 and the sequence of SEQ ID NO:5, a sequence obtained by PCR amplification of the downstream primer;

the plant is sugarcane or Arabidopsis thaliana.

2. Any one of the following applications of the plant expression cassette:

(3) Use in adaptive breeding for increasing drought, ABA stress in plants, characterized in that the expression cassette comprises the promoter as claimed in claim 1, the gene of interest expressed driven by the promoter as claimed in claim 1 and a terminator, which are connected to each other in an expressible manner;

the plant is sugarcane or Arabidopsis thaliana.

3. The use according to claim 2, wherein the gene of interest isGUSAnd (3) a gene.

4. Use of a recombinant vector comprising the promoter of claim 1 or the expression cassette of any one of claims 2 to 3 for any one of the following:

the plant is sugarcane or Arabidopsis thaliana.

5. The use according to claim 4, wherein the recombinant vector is P _SCBV-YZ2060 GUS; the P is _SCBV-YZ2060 GUS vector is pCAMBIA1305 vectorGUSA recombinant vector obtained by replacing the CaMV 35S promoter sequence of the gene with the promoter sequence according to claim 1.

6. A method for improving the drought and ABA stress adaptability of plants, which is characterized in that the method comprises the steps of introducing the promoter in claim 1 or the expression cassette in any one of claims 2-3 or the recombinant vector in any one of claims 4-5 into plants, and obtaining transgenic plants through screening, wherein the plants are sugarcane or arabidopsis.